Sample records for nuclear encoded gene

  1. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.


    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5' UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  2. (Structure and expression of nuclear genes encoding rubisco activase)

    SciTech Connect

    Zielinski, R.E.


    Our activities during the past year have centered around two basic aspects of the project: describing more thoroughly the diurnal and light irradiance effects on activase gene expression in barley; and isolating and structurally characterizing cDNA and genomic DNA sequences encoding activase from barley. Three appendices are included that summarize these activities.

  3. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products

    SciTech Connect

    Kuchka, M.R.


    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  4. Regulation of nuclear genes encoding mitochondrial proteins in Saccharomyces cerevisiae.


    Brown, T A; Evangelista, C; Trumpower, B L


    Selection for mutants which release glucose repression of the CYB2 gene was used to identify genes which regulate repression of mitochondrial biogenesis. We have identified two of these as the previously described GRR1/CAT80 and ROX3 genes. Mutations in these genes not only release glucose repression of CYB2 but also generally release respiration of the mutants from glucose repression. In addition, both mutants are partially defective in CYB2 expression when grown on nonfermentable carbon sources, indicating a positive regulatory role as well. ROX3 was cloned by complementation of a glucose-inducible flocculating phenotype of an amber mutant and has been mapped as a new leftmost marker on chromosome 2. The ROX3 mutant has only a modest defect in glucose repression of GAL1 but is substantially compromised in galactose induction of GAL1 expression. This mutant also has increased SUC2 expression on nonrepressing carbon sources. We have also characterized the regulation of CYB2 in strains carrying null mutation in two other glucose repression genes, HXK2 and SSN6, and show that HXK2 is a negative regulator of CYB2, whereas SSN6 appears to be a positive effector of CYB2 expression.

  5. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1990--June 30, 1992

    SciTech Connect

    Kuchka, M.R.


    Many individual chloroplast genes require the products of a collection of nuclear genes for their successful expression. These nuclear gene products apparently work with great specificity, each committed to the expression of a single chloroplast gene. We have chosen as a model nuclear mutants of Chlamydomonas affected in different stages in the expression of the chloroplast encoded Photosystem II polypeptide, D2. We have made the progress in understanding how nuclear gene products affect the translation of the D2 encoding MRNA. Two nuclear genes are required for this process which have been mapped genetically. In contrast to other examples of nuclear control of translation in the chloroplast, these nuclear gene products appear to be required either for specific stages in translation elongation or for the post-translational stabilization of the nascent D2 protein. Pseudoreversion analysis has led us to a locus which may be directly involved in D2 expression. We have made considerable progress in pursuing the molecular basis of psbd MRNA stabilization. psbD 5` UTR specific transcripts have been synthesized in vitro and used in gel mobility shift assays. UV-crosslinking studies are underway to identify the transacting factors which bind to these sequences. The continued examination of these mutants will help us to understand how nuclear gene products work in this specific case of chloroplast gene expression, and will elucidate how two distinct genomes can interact generally.

  6. Significant prognostic values of nuclear genes encoding mitochondrial complex I subunits in tumor patients.


    Li, L D; Sun, H F; Bai, Y; Gao, S P; Jiang, H L; Jin, W


    In cancer biology, it remains still open question concerning the oncogenic versus oncosuppressor behavior of metabolic genes, which includes those encoding mitochondrial complex I (CI) subunits. The prognostic value of nuclear genome mRNAs expression of CI subunits is to be evaluated in the tumor patients. We used the Kaplan Meier plotter database, the cBio Cancer Genomics Portal, and the Oncomine in which gene expression data and survival information were from thousands of tumor patients to assess the relevance of nuclear genome mRNAs level of CI subunits to patients' survival, as well as their alterations in gene and expression level in tumors. We presented that the relative expression level of overwhelming majority of the nuclear genes of CI subunits with survival significance (overall survival, relapse free survival, progression free survival, distant metastasis free survival, post progression survival, and first progression), had consistent effects for patients in each type of four tumors separately, including breast cancer, ovarian cancer, lung cancer, and gastric cancer. However, in gene level, frequent cumulative or individual alteration of these genes could not significantly affect patients' survival and the overexpression of the individual gene was not ubiquitous in tumors versus normal tissues. Given that reprogrammed energy metabolism was viewed as an emerging hallmark of tumor, thus tumor patients' survival might potentially to be evaluated by certain threshold for overall expression of CI subunits. Comprehensive understanding of the nuclear genome encoded CI subunits may have guiding significance for the diagnosis and prognosis in tumor patients.

  7. Structural organization of the human gene (LMNB1) encoding nuclear lamin B1

    SciTech Connect

    Lin, F.; Worman, H.J.


    The authors have determined the structural organization of the human gene (LMNB1) that encodes nuclear lamin B1, an intermediate filament protein of the nuclear envelope. The transcription unit spans more than 45 kb and the transcription start site is 348 nucleotides upstream from the translation initiation codon. Lamin B1 is encoded by 11 exons. Exon 1 codes for the amino-terminal head domain and the first portion of the central rod domain, exons 2 through 6 the central rod domain, and exons 7 through 11 the carboxyl-terminal tail domain of this intermediate filament protein. Intron positions are conserved in other lamin genes from frogs, mice, and humans but different in lamin genes from Drosophila melanogaster and Caenorhabditis elegans. In the region encoding the central rod domain, intron positions are also similar to those in the gene for an invertebrate nonneuronal cytoplasmic intermediate filament protein and the genes for most vertebrate cytoplasmic intermediate filament proteins except neurofilaments and nestin. 51 refs., 3 figs.

  8. Post transcriptional regulation of chloroplast gene expression by nuclear encoded gene products. Progress report, June 1, 1991--May 31, 1992

    SciTech Connect

    Kuchka, M.R.


    The following is a review of research accomplished in the first two years of funding for the above mentioned project. The work performed is a molecular characterization of nuclear mutants of Chlamydomonas reinhardtii which are deficient in different stages in the post-transcriptional expression of a single chloroplast encoded polypeptide, the D2 protein of Photosystem II. Our long-term goals are to understand the molecular mechanisms by which nuclear gene products affect the expression of chloroplast genes. Specifically, we which to understand how specific nuclear gene products affect the turnover rate of the D2 encoding mRNA (psbD), how other nuclear encoded factors work to promote the translation of psbD mRNA and/or stabilize the D2 protein, and what the role of the D2 protein itself is in Photosystem II assembly and in the control of expression of other chloroplast genes. This progress report will be organized into four major sections concerning (I) The characterization of nuclear mutants affected in D2 translation/turnover, (II) The study of trans-acting factors which associate with the 5{prime} end of the psbD mRNA, (III) In vitro mutagenesis of the psbD gene, and (IV) Additional studies.

  9. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity

    PubMed Central

    Zhang, Jin; Ruhlman, Tracey A.; Sabir, Jamal S. M.; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K.


    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear–plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. PMID:26893456

  10. PABPN1 overexpression leads to upregulation of genes encoding nuclear proteins that are sequestered in oculopharyngeal muscular dystrophy nuclear inclusions.


    Corbeil-Girard, Louis-Philippe; Klein, Arnaud F; Sasseville, A Marie-Josée; Lavoie, Hugo; Dicaire, Marie-Josée; Saint-Denis, Anik; Pagé, Martin; Duranceau, André; Codère, François; Bouchard, Jean-Pierre; Karpati, George; Rouleau, Guy A; Massie, Bernard; Langelier, Yves; Brais, Bernard


    Oculopharyngeal muscular dystrophy (OPMD) is an adult-onset disease caused by expanded (GCN)12-17 stretches encoding the N-terminal polyalanine domain of the poly(A) binding protein nuclear 1 (PABPN1). OPMD is characterized by intranuclear inclusions (INIs) in skeletal muscle fibers, which contain PABPN1, molecular chaperones, ubiquitin, proteasome subunits, and poly(A)-mRNA. We describe an adenoviral model of PABPN1 expression that produces INIs in most cells. Microarray analysis revealed that PABPN1 overexpression reproducibly changed the expression of 202 genes. Sixty percent of upregulated genes encode nuclear proteins, including many RNA and DNA binding proteins. Immunofluorescence microscopy revealed that all tested nuclear proteins encoded by eight upregulated genes colocalize with PABPN1 within the INIs: CUGBP1, SFRS3, FKBP1A, HMG2, HNRPA1, PRC1, S100P, and HSP70. In addition, CUGBP1, SFRS3, and FKBP1A were also found in OPMD muscle INIs. This study demonstrates that a large number of nuclear proteins are sequestered in OPMD INIs, which may compromise cellular function.

  11. Phylogenetic analysis to uncover organellar origins of nuclear-encoded genes.


    Foth, Bernardo J


    Most proteins that are located in mitochondria or plastids are encoded by the nuclear genome, because the organellar genomes have undergone severe reduction during evolution. In many cases, although not all, the nuclear genes encoding organelle-targeted proteins actually originated from the respective organellar genome and thus carry the phylogenetic fingerprint that still bespeaks their evolutionary origin. Phylogenetic analysis is a powerful in silico method that can yield important insights into the evolutionary history or molecular kinship of any gene or protein and that can thus also be used more specifically in the context of organellar targeting as one means to recognize protein candidates (e.g., from genome data) that may be targeted to mitochondria or plastids. This chapter provides protocols for creating multiple sequence alignments and carrying out phylogenetic analysis with the robust and comprehensive software packages Clustal and PHYLIP, which are both available free of charge for multiple computer platforms. Besides presenting step-by-step instructions on how to run these computer programs, this chapter also covers topics such as data collection and presentation of phylogenetic trees. PMID:17951706

  12. Cloning and characterization of the nucleoredoxin gene that encodes a novel nuclear protein related to thioredoxin

    SciTech Connect

    Kurooka, Hisanori; Kato, Keizo; Minoguchi, Shigeru


    In a yeast artificial chromosome contig close to the nude locus on mouse chromosome 11, we identified a novel gene, nucleoredoxin, that encodes a protein with similarity to the active site of thioredoxins. Nucleoredoxin is conserved between mammalian species, and two homologous genes were found in Caenorhabditis elegans. The nucleoredoxin transcripts are expressed in all adult tissues examined, but restricted to the nervous system and the limb buds in Day 10.5-11.5 embryos. The nucleoredoxin protein is predominantly localized in the nucleus of cells transfected with the nucleoredoxin expression construct. Since the bacterially expressed protein of nucleoredoxin showed oxidoreductase activity of the insulin disulfide bonds with kinetics similar to that of thioredoxin, it may be a redox regulator of the nuclear proteins, such as transcription factors. 40 refs., 6 figs.

  13. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy


    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  14. Structure and expression of a pea nuclear gene encoding a chlorophyll a/b-binding polypeptide

    SciTech Connect

    Cashmore, A.R.


    A nuclear gene AB80 has been isolated from a phage lambda Charon 4 library of pea DNA. The sequence of the gene has been determined and it has been shown to contain an interrupted reading frame of 269 amino acids, corresponding to a precursor to a constituent polypeptide of the light-harvesting chlorophyll a/b-protein complex. Primer extension and S1 nuclease studies defined a cap site for AB80. The first methionine codon 3' from this site is 69 nucleotides away and is the initiating codon of the open reading frame. A TATA sequence occurs 31 nucleotides 5' from the cap site. A second TATA sequence is found 7 nucleotides on the 5' side of the initiating methionine codon and the sequences surrounding this TATA sequence are strikingly similar to those surrounding the first TATA sequence. The mature polypeptide encoded by AB80 differs by 5 amino acids from the polypeptide corresponding to a previously characterized cDNA sequence pAB96. This result is indicative of heterogeneity within the constituent polypeptides of the light-harvesting chlorophyll a/b-protein complex. The sequence Arg-Lys-Ser-Ala-Thr-Thr-Lys-Lys occurs at, or near, the NH/sub 2/-terminus of the mature polypeptide encoded by AB80. This basic peptide is of interest because of its apparent involvement in changes in excitation-energy distribution in chloroplast membranes. Some general similarities, but no extensive sequence homology, is found on comparing the transit sequence for the precursor to the chlorophyll a/b-binding polypeptide with the transit sequences previously determined for the precursors to the small subunit of ribulose-1,5-bisphosphate carboxylase. 40 references, 3 figures.

  15. Discovery of Nuclear-Encoded Genes for the Neurotoxin Saxitoxin in Dinoflagellates

    PubMed Central

    Stüken, Anke; Orr, Russell J. S.; Kellmann, Ralf; Murray, Shauna A.; Neilan, Brett A.; Jakobsen, Kjetill S.


    Saxitoxin is a potent neurotoxin that occurs in aquatic environments worldwide. Ingestion of vector species can lead to paralytic shellfish poisoning, a severe human illness that may lead to paralysis and death. In freshwaters, the toxin is produced by prokaryotic cyanobacteria; in marine waters, it is associated with eukaryotic dinoflagellates. However, several studies suggest that saxitoxin is not produced by dinoflagellates themselves, but by co-cultured bacteria. Here, we show that genes required for saxitoxin synthesis are encoded in the nuclear genomes of dinoflagellates. We sequenced >1.2×106 mRNA transcripts from the two saxitoxin-producing dinoflagellate strains Alexandrium fundyense CCMP1719 and A. minutum CCMP113 using high-throughput sequencing technology. In addition, we used in silico transcriptome analyses, RACE, qPCR and conventional PCR coupled with Sanger sequencing. These approaches successfully identified genes required for saxitoxin-synthesis in the two transcriptomes. We focused on sxtA, the unique starting gene of saxitoxin synthesis, and show that the dinoflagellate transcripts of sxtA have the same domain structure as the cyanobacterial sxtA genes. But, in contrast to the bacterial homologs, the dinoflagellate transcripts are monocistronic, have a higher GC content, occur in multiple copies, contain typical dinoflagellate spliced-leader sequences and eukaryotic polyA-tails. Further, we investigated 28 saxitoxin-producing and non-producing dinoflagellate strains from six different genera for the presence of genomic sxtA homologs. Our results show very good agreement between the presence of sxtA and saxitoxin-synthesis, except in three strains of A. tamarense, for which we amplified sxtA, but did not detect the toxin. Our work opens for possibilities to develop molecular tools to detect saxitoxin-producing dinoflagellates in the environment. PMID:21625593

  16. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.


    Vanlerberghe, G. C.; McLntosh, L.


    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  17. Signals Regulating the Expression of the Nuclear Gene Encoding Alternative Oxidase of Plant Mitochondria.

    PubMed Central

    Vanlerberghe, G. C.; McLntosh, L.


    Suspension cells of tobacco (Nicotiana tabacum L. cv Bright Yellow) were used to investigate signals regulating the expression of the nuclear gene Aox1 encoding the mitochondrial alternative oxidase (AOX) protein responsible for cyanide-resistant respiration in plants. We found that an increase in the tricarboxylic acid cycle intermediate citrate (either after its exogenous supply to cells or after inhibition of aconitase by monofluoroacetate) caused a rapid and dramatic increase in the steady-state level of Aox1 mRNA and AOX protein. This led to a large increase in the capacity for AOX respiration, defined as the amount of salicylhydroxamic acid-sensitive O2 uptake by cells in the presence of potassium cyanide. The results indicate that citrate may be an important signal metabolite regulating Aox1 gene expression. A number of other treatments were also identified that rapidly induced the level of Aox1 mRNA and AOX capacity. These included short-term incubation of cells with 10 mM acetate, 2 [mu]M antimycin A, 5 mM H2O2, or 1 mM cysteine. For some of these treatments, induction of AOX occurred without an increase in cellular citrate level, indicating that other signals (possibly related to oxidative stress conditions) are also important in regulating Aox1 gene expression. The signals influencing Aox1 gene expression are discussed with regard to the potential function(s) of AOX to modulate tricarboxylic acid cycle metabolism and/or to prevent the generation of active oxygen species by the mitochondrial electron transport chain. PMID:12226312

  18. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis.


    Jandova, Jana; Janda, Jaroslav; Sligh, James E


    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-κB (NF-κB) is a key transcription factor for production of MMPs. An inhibitor of NF-κB activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-κB in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids.

  19. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    PubMed Central

    Jandova, Jana; Janda, Jaroslav; Sligh, James E


    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-κB (NF-κB) is a key transcription factor for production of MMPs. An inhibitor of NF-κB activation, Bay11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-κB in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. PMID:22705584

  20. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    SciTech Connect

    Jandova, Jana; Janda, Jaroslav; Sligh, James E


    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  1. The relationship between transcript expression levels of nuclear encoded (TFAM, NRF1) and mitochondrial encoded (MT-CO1) genes in single human oocytes during oocyte maturation

    PubMed Central

    Novin, M Ghaffari; Allahveisi, A; Noruzinia, M; Farhadifar, F; Yousefian, E; Fard, A Dehghani; Salimi, M


    In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII) stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA), copied in oocytes, is essential for providing adenosine triphosphate (ATP) during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1) and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1) and mitochondrial transcription factor A (TFAM) in various stages of human oocyte maturation. Nine consenting patients, age 21–35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI) procedures. mRNA levels of mitochondrial-related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR). There was no significant relationship between the relative expression levels in germinal vesicle (GV) stage oocytes (p = 0.62). On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI) and MII (p = 0.03 and p = 0.002). A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation. PMID:26929904

  2. Structure and expression of nuclear genes encoding rubisco activase. Final technical report

    SciTech Connect

    Zielinski, R.E.


    Rubisco activase (Rca) is a soluble chloroplast protein that catalyzes the activation of rubisco, the enzyme that initiates the photosynthetic carbon reduction cycle, to catalytic competency. Rca in barley consists of three polypeptides, one of 46- and two of 42-kDa, but the quaternary structure of the protein is not known. The authors have isolated and completely sequenced 8.8 kb of barley genomic DNA containing two, tandemly oriented activase genes (RcaA and RcaB) and three different cDNAs encoding the 42- and 46-kDa Rca polypeptide isoforms. Genomic Southern blot assays indicate that these sequences represent the entire Rca gene family in barley. Pre-mRNAs transcribed from the RcaA gene are alternatively spliced to give mRNAs encoding both 46- (RcaA1) and 42-kDa (RcaA2) Rca isoforms. The RcaB gene encodes a single polypeptide of 42 kDa. Primer extension and northern blot assays indicate that RcaB mRNA is expressed at a level that is 10- to 100-fold lower than RcaA mRNA. Analyses at the mRNA and protein level showed that Rca gene expression is coordinated by that of the rubisco subunits during barley leaf development.

  3. Nuclear-cytoplasmic conflict in pea (Pisum sativum L.) is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.


    Bogdanova, Vera S; Zaytseva, Olga O; Mglinets, Anatoliy V; Shatskaya, Natalia V; Kosterin, Oleg E; Vasiliev, Gennadiy V


    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

  4. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.


    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm


    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle. PMID:25973601

  5. The BAT1 gene in the MHC encodes an evolutionarily conserved putative nuclear RNA helicase of the DEAD family

    SciTech Connect

    Peelman, L.J.; Van Zeveren, A.; Coppeiters, W.


    The BAT1 gene has previously been identified about 30 kb upstream from the tumor necrosis factor (TNF) locus and close to a NF{sub kb}-related gene of the nuclear factor family in the major histocompatibility complex (MHC) of human, mouse, and pig. We now show that the BAT1 translation product is the homolog of the rat p47 nuclear protein, the WM6 Drosophila gene product, and probably also Ce08102 of Caenorhabditis elegans, all members of the DEAD protein family of ATP-dependent RNA helicases. This family has more than 40 members, including the eukaryotic translation initiation factor-4A (eIF-4A), the human nuclear protein p68, and the Drosophila oocyte polar granule component vasa. BAT1 spans about 10 kb, is split into 10 exons of varying length, and encodes a protein of 428 amino acids ({approximately}48 kDa). Human and pig BAT1 cDNAs display 95.6% identity in the coding region and 80% identity in the 5{prime} and 3{prime} noncoding regions. Several repeat sequences of different types were identified in introns of the porcine BAT1 gene. Three different mRNAs, 4.1,1.7, and 0.9 kb, respectively, were detected in all tissues analyzed upon hybridization with porcine BAT1 cDNA. Transfection and expression of human BAT1 cDNA after tagging with a heterologous antibody recognition epitope revealed a nuclear localization of the hybrid protein. An MspI RFLP was detected in an SLA class I typed family, confirming the localization of the BAT1 gene in the porcine MHC. BAT1 thus encodes a putative nuclear ATP-dependent RNA helicase and is likely to have an indispensable function. 35 refs., 6 figs., 1 tab.

  6. Structure, mapping and expression of a growth factor inducible gene encoding a putative nuclear hormonal binding receptor.

    PubMed Central

    Ryseck, R P; Macdonald-Bravo, H; Mattéi, M G; Ruppert, S; Bravo, R


    We have characterized a growth factor inducible gene, N10, encoding a nuclear protein of 601 amino acids with a significant similarity to members of the steroid and thyroid hormone receptor families. The gene is rapidly but transiently induced by several mitogens. Immunoprecipitation studies show that the N10 protein is transiently expressed after stimulation of quiescent cells, presenting a half-life of approximately 30 min. The N10 transcription unit is 8 kb in length, split into seven exons. The exon-intron distribution is in general similar to that of other members of the nuclear receptor superfamily, but presents some differences which suggest that N10 belongs to a new family of these molecules. The 5' flanking region contains one DSE which could explain its immediate response to external stimulus. The N10 gene is located in the [F1-F3] region of mouse chromosome 15. Images PMID:2555161

  7. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP) Which Is Overexpressed in Highly Proliferating Tissues.


    Szafron, Lukasz Michal; Balcerak, Anna; Grzybowska, Ewa Anna; Pienkowska-Grela, Barbara; Felisiak-Golabek, Anna; Podgorska, Agnieszka; Kulesza, Magdalena; Nowak, Natalia; Pomorski, Pawel; Wysocki, Juliusz; Rubel, Tymon; Dansonka-Mieszkowska, Agnieszka; Konopka, Bozena; Lukasik, Martyna; Kupryjanczyk, Jolanta


    CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  8. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP) Which Is Overexpressed in Highly Proliferating Tissues

    PubMed Central

    Szafron, Lukasz Michal; Balcerak, Anna; Grzybowska, Ewa Anna; Pienkowska-Grela, Barbara; Felisiak-Golabek, Anna; Podgorska, Agnieszka; Kulesza, Magdalena; Nowak, Natalia; Pomorski, Pawel; Wysocki, Juliusz; Rubel, Tymon; Dansonka-Mieszkowska, Agnieszka; Konopka, Bozena; Lukasik, Martyna; Kupryjanczyk, Jolanta


    CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene. PMID:25978564

  9. Identification of the gene encoding the major latency-associated nuclear antigen of the Kaposi's sarcoma-associated herpesvirus.

    PubMed Central

    Kedes, D H; Lagunoff, M; Renne, R; Ganem, D


    Over 85% of patients with Kaposi's sarcoma (KS) are seropositive for antibodies to the latency-associated nuclear antigen (LANA) expressed in B cell lines infected with Kaposi's sarcoma-associated herpesvirus (KSHV). The presence of antibodies to LANA strongly correlates with the risk of developing the disease. However, the identity of the protein(s) comprising LANA and the corresponding gene(s) has remained unclear. To identify potential latent gene candidates for LANA, we probed total RNA extracted from BCBL-1 cells (a B cell line latently infected with KSHV) using lambda clones that span the KSHV genome. One region encoding latent transcripts spanned KSHV open reading frames (orfs) 71 (K13), 72 (v-cyclin), and 73. Among these, however, only orf 73, when expressed in heterologous mammalian cell systems, reacted with KSHV antibody-positive human sera, resulting in a punctate nuclear staining pattern reminiscent of LANA in BCBL-1 cells. Furthermore, extracts from cells expressing the orf 73 protein product specifically blocked the binding of KS patient antibodies to LANA. Finally, seroreactivity with recombinant orf 73 protein exactly paralleled reactivity with classical LANA as expressed in BCBL-1 cells, both in KS patients and in other groups. Together, these data support the identification of KSHV orf 73 as the gene encoding the dominant immunogenic component of LANA. PMID:9366576

  10. Reconstruction of Family-Level Phylogenetic Relationships within Demospongiae (Porifera) Using Nuclear Encoded Housekeeping Genes

    PubMed Central

    Hill, Malcolm S.; Hill, April L.; Lopez, Jose; Peterson, Kevin J.; Pomponi, Shirley; Diaz, Maria C.; Thacker, Robert W.; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C.; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E.; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A.; di Stefano, Michael; Tarver, James E.; Collins, Allen G.


    Background Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. Methodology/Principal Findings We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosap, Myxospongiaep, Spongillidap, Haploscleromorphap (the marine haplosclerids) and Democlaviap. We found conflicting results concerning the relationships of Keratosap and Myxospongiaep to the remaining demosponges, but our results strongly supported a clade of Haploscleromorphap+Spongillidap+Democlaviap. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillidap) are sister to Haploscleromorphap rather than part of Democlaviap. Within Keratosap, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiaep, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlaviap, Tetractinellidap, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlaviap. Within Tetractinellidap, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. Conclusions/Significance These results, using an

  11. (Structure and expression of nuclear genes encoding rubisco activase): Progress report

    SciTech Connect

    Not Available


    Our first year's activities include: (1) completing a survey of the basic characteristics of activase gene expression in barley; and (2) isolating and structurally characterizing cDNA and genomic DNA sequences encoding activase from barley. Our goal was to determine whether activase mRNA and protein accumulation are coordinated with those of the rubisco subunits. We utilized the first leaves of barley as an experimental system for these studies because they can be used in two ways to study the expression of leaf genes: by following the naturally occurring differentiation of leaf cells, which occurs acropetally along the barley leaf; and by following the photomorphogenesis of etiolated barley seedlings. In the acropetal gradient of leaf cell differentiation, activase mRNA and mRNA and polypeptide expression is tightly coordinated with rubisco subunit mRNA and polypeptide expression. Although we have not measured their precise stoichiometry at each stage of leaf differentiation, activase protein is expressed at the level of about one polypeptide per rubisco holoenzyme in mature regions of the leaf. Coordination of the expression of activase mRNAs and polypeptides indicates that in the barley leaf gradient, activase gene expression is largely controlled at the level of transcription. However, translational controls may play a role in regulating activase expression on a short term basis.

  12. Phylogenetic analysis of four nuclear protein-encoding genes largely corroborates the traditional classification of Bivalvia (Mollusca).


    Sharma, Prashant P; González, Vanessa L; Kawauchi, Gisele Y; Andrade, Sónia C S; Guzmán, Alejandra; Collins, Timothy M; Glover, Emily A; Harper, Elizabeth M; Healy, John M; Mikkelsen, Paula M; Taylor, John D; Bieler, Rüdiger; Giribet, Gonzalo


    Revived interest in molluscan phylogeny has resulted in a torrent of molecular sequence data from phylogenetic, mitogenomic, and phylogenomic studies. Despite recent progress, basal relationships of the class Bivalvia remain contentious, owing to conflicting morphological and molecular hypotheses. Marked incongruity of phylogenetic signal in datasets heavily represented by nuclear ribosomal genes versus mitochondrial genes has also impeded consensus on the type of molecular data best suited for investigating bivalve relationships. To arbitrate conflicting phylogenetic hypotheses, we evaluated the utility of four nuclear protein-encoding genes-ATP synthase β, elongation factor-1α, myosin heavy chain type II, and RNA polymerase II-for resolving the basal relationships of Bivalvia. We sampled all five major lineages of bivalves (Archiheterodonta, Euheterodonta [including Anomalodesmata], Palaeoheterodonta, Protobranchia, and Pteriomorphia) and inferred relationships using maximum likelihood and Bayesian approaches. To investigate the robustness of the phylogenetic signal embedded in the data, we implemented additional datasets wherein length variability and/or third codon positions were eliminated. Results obtained include (a) the clade (Nuculanida+Opponobranchia), i.e., the traditionally defined Protobranchia; (b) the monophyly of Pteriomorphia; (c) the clade (Archiheterodonta+Palaeoheterodonta); (d) the monophyly of the traditionally defined Euheterodonta (including Anomalodesmata); and (e) the monophyly of Heteroconchia, i.e., (Palaeoheterodonta+Archiheterodonta+Euheterodonta). The stability of the basal tree topology to dataset manipulation is indicative of signal robustness in these four genes. The inferred tree topology corresponds closely to those obtained by datasets dominated by nuclear ribosomal genes (18S rRNA and 28S rRNA), controverting recent taxonomic actions based solely upon mitochondrial gene phylogenies.

  13. (Nuclear genes from nicotiana encoding the small subunit of ribulose-1,5-bisphosphate carboxylase). Progress report

    SciTech Connect

    Cashmore, A.R.


    Two pea nuclear genes encoding ribulose-1,5-bisphosphate carboxylase (rbcS) were isolated and completely sequenced. These sequence studies include approximately 1 kb of 5' noncoding region and several hundred nucleotides of 3' noncoding sequences. The two genes are tightly linked being separated by 10 kb of DNA and they are oriented with their 3' ends towards one another. The two genes (ss3.6 and ss8.0) correspond to two of five EcoRI fragments of pea DNA that hybridize to a rbcS hybridization probe. The two genes ss3.6 and ss8.0 are quite divergent at their 5' and their 3' ends and in the first of the two intervening sequences. In direct contrast the second of the two intervening sequences is total conserved between the two genes. This conservation of sequence identity could result directly from evolutionary forces selecting against any sequence change. Such selection would presumably reflect a very sequence-dependent function for these introns. A role in splicing is one possibility and a transcriptional regulatory element is another possibility. 9 refs.

  14. STP1, a gene involved in pre-tRNA processing, encodes a nuclear protein containing zinc finger motifs.

    PubMed Central

    Wang, S S; Stanford, D R; Silvers, C D; Hopper, A K


    STP1 is an unessential yeast gene involved in the removal of intervening sequences from some, but not all, families of intervening sequence-containing pre-tRNAs. Previously, we proposed that STP1 might encode a product that generates pre-tRNA conformations efficiently recognized by tRNA-splicing endonuclease. To test the predictions of this model, we have undertaken a molecular analysis of the STP1 gene and its products. The STP1 locus is located on chromosome IV close to at least two other genes involved in RNA splicing: PRP3 and SPP41. The STP1 open reading frame (ORF) could encode a peptide of 64,827 Da; however, inspection of putative transcriptional and translational regulatory signals and mapping of the 5' ends of mRNA provide evidence that translation of the STP1 ORF usually initiates at a second AUG to generate a protein of 58,081 Da. The STP1 ORF contains three putative zinc fingers. The first of these closely resembles both the DNA transcription factor consensus and the Xenopus laevis p43 RNA-binding protein consensus. The third motif more closely resembles the fingers found in spliceosomal proteins. Employing antisera to the endogenous STP1 protein and to STP1-LacZ fusion proteins, we show that the STP1 protein is localized to nuclei. The presence of zinc finger motifs and the nuclear location of the STP1 protein support the model that this gene product is involved directly in pre-tRNA splicing. Images PMID:1588961

  15. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or {gamma}-rays

    SciTech Connect

    Woloschak, G.E.; Chang-Liu, Chin-Mei


    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, and cytoskeletal elements. The experiments reported herein were designed to examine the effects of either JANUS neutron or {gamma}-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or {gamma}-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and (to a lesser extent) Rb following {gamma}-ray but not following neutron exposure. Expression of p53 and c-myc genes was unaffected by radiation exposure. Radiations at different doses and dose rates were compared for each of the genes studied.

  16. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.


    Brunsch, Melanie; Schubert, Daniela; Gube, Matthias; Ring, Christiane; Hanisch, Lisa; Linde, Jörg; Krause, Katrin; Kothe, Erika


    The white-rot fungus Schizophyllum commune (Agaricomycetes) was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  17. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune

    PubMed Central

    Gube, Matthias; Ring, Christiane; Hanisch, Lisa; Linde, Jörg; Krause, Katrin; Kothe, Erika


    The white-rot fungus Schizophyllum commune (Agaricomycetes) was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing. PMID:26284622

  18. The human CCGl gene, essential for progression of the G sub 1 phase, encodes a 210-kilodalton nuclear DNA-binding protein

    SciTech Connect

    Sekiguchi, Takeshi; Nohiro, Yukiko; Hisamoto, Naoki; Nishimoto, Takeharu ); Nakamura, Yasuhara )


    The human CCGl gene complements tsBN462, a temperature-sensitive G{sup 1} mutant of the BHK21 cell line. The previously cloned cDNA turned out to be a truncated form of the actual CCGl cDNA. The newly cloned CCGl cDNA was 6.0 kb and encoded a protein with a molecular mass of 210 kDa. Using an antibody to a predicted peptide from the CCGl protein, a protein with a molecular mass of over 200 kDa was identified in human, monkey, and hamster cell lines. In the newly defined C-terminal region, an acidic domain was found. It contained four consensus target sequences for casein kinase 2 and was phosphorylated by this enzyme in vitro. However, this C-terminal region was not required to complement tsBN462 mutation since the region encoding the C-terminal part was frequently missing in complemented clones derived by DNA-mediated gene transfer, CCGl contains a sequence similar to the putative DNA-binding domain of HMGl in addition to the previously detected amino acid sequences common in nuclear proteins, such as a proline cluster and a nuclear translocation signal. Consistent with these predictions, CCGl was present in nuclei, possessed DNA-binding activity, and was eluted with similar concentrations of salt, 0.3 to 0.4 M NaCl either from isolated nuclei or from a DNA-cellulose column.

  19. Mutation in TOR1AIP1 encoding LAP1B in a form of muscular dystrophy: a novel gene related to nuclear envelopathies.


    Kayman-Kurekci, Gulsum; Talim, Beril; Korkusuz, Petek; Sayar, Nilufer; Sarioglu, Turkan; Oncel, Ibrahim; Sharafi, Parisa; Gundesli, Hulya; Balci-Hayta, Burcu; Purali, Nuhan; Serdaroglu-Oflazer, Piraye; Topaloglu, Haluk; Dincer, Pervin


    We performed genome-wide homozygosity mapping and mapped a novel myopathic phenotype to chromosomal region 1q25 in a consanguineous family with three affected individuals manifesting proximal and distal weakness and atrophy, rigid spine and contractures of the proximal and distal interphalangeal hand joints. Additionally, cardiomyopathy and respiratory involvement were noted. DNA sequencing of torsinA-interacting protein 1 (TOR1AIP1) gene encoding lamina-associated polypeptide 1B (LAP1B), showed a homozygous c.186delG mutation that causes a frameshift resulting in a premature stop codon (p.E62fsTer25). We observed that expression of LAP1B was absent in the patient skeletal muscle fibres. Ultrastructural examination showed intact sarcomeric organization but alterations of the nuclear envelope including nuclear fragmentation, chromatin bleb formation and naked chromatin. LAP1B is a type-2 integral membrane protein localized in the inner nuclear membrane that binds to both A- and B-type lamins, and is involved in the regulation of torsinA ATPase. Interestingly, luminal domain-like LAP1 (LULL1)-an endoplasmic reticulum-localized partner of torsinA-was overexpressed in the patient's muscle in the absence of LAP1B. Therefore, the findings suggest that LAP1 and LULL1 might have a compensatory effect on each other. This study expands the spectrum of genes associated with nuclear envelopathies and highlights the critical function for LAP1B in striated muscle.

  20. Mutation in TOR1AIP1 encoding LAP1B in a form of muscular dystrophy: a novel gene related to nuclear envelopathies.


    Kayman-Kurekci, Gulsum; Talim, Beril; Korkusuz, Petek; Sayar, Nilufer; Sarioglu, Turkan; Oncel, Ibrahim; Sharafi, Parisa; Gundesli, Hulya; Balci-Hayta, Burcu; Purali, Nuhan; Serdaroglu-Oflazer, Piraye; Topaloglu, Haluk; Dincer, Pervin


    We performed genome-wide homozygosity mapping and mapped a novel myopathic phenotype to chromosomal region 1q25 in a consanguineous family with three affected individuals manifesting proximal and distal weakness and atrophy, rigid spine and contractures of the proximal and distal interphalangeal hand joints. Additionally, cardiomyopathy and respiratory involvement were noted. DNA sequencing of torsinA-interacting protein 1 (TOR1AIP1) gene encoding lamina-associated polypeptide 1B (LAP1B), showed a homozygous c.186delG mutation that causes a frameshift resulting in a premature stop codon (p.E62fsTer25). We observed that expression of LAP1B was absent in the patient skeletal muscle fibres. Ultrastructural examination showed intact sarcomeric organization but alterations of the nuclear envelope including nuclear fragmentation, chromatin bleb formation and naked chromatin. LAP1B is a type-2 integral membrane protein localized in the inner nuclear membrane that binds to both A- and B-type lamins, and is involved in the regulation of torsinA ATPase. Interestingly, luminal domain-like LAP1 (LULL1)-an endoplasmic reticulum-localized partner of torsinA-was overexpressed in the patient's muscle in the absence of LAP1B. Therefore, the findings suggest that LAP1 and LULL1 might have a compensatory effect on each other. This study expands the spectrum of genes associated with nuclear envelopathies and highlights the critical function for LAP1B in striated muscle. PMID:24856141

  1. Steep, coincident, and concordant clines in mitochondrial and nuclear-encoded genes in a hybrid zone between subspecies of Atlantic killifish, Fundulus heteroclitus.


    McKenzie, Jessica L; Dhillon, Rashpal S; Schulte, Patricia M


    Steep genetic clines resulting from recent secondary contact between previously isolated taxa can either gradually erode over time or be stabilized by factors such as ecological selection or selection against hybrids. We used patterns of variation in 30 nuclear and two mitochondrial SNPs to examine the factors that could be involved in stabilizing clines across a hybrid zone between two subspecies of the Atlantic killifish, Fundulus heteroclitus. Increased heterozygote deficit and cytonuclear disequilibrium in populations near the center of the mtDNA cline suggest that some form of reproductive isolation such as assortative mating or selection against hybrids may be acting in this hybrid zone. However, only a small number of loci exhibited these signatures, suggesting locus-specific, rather than genomewide, factors. Fourteen of the 32 loci surveyed had cline widths inconsistent with neutral expectations, with two SNPs in the mitochondrial genome exhibiting the steepest clines. Seven of the 12 putatively non-neutral nuclear clines were for SNPs in genes related to oxidative metabolism. Among these putatively non-neutral nuclear clines, SNPs in two nuclear-encoded mitochondrial genes (SLC25A3 and HDDC2), as well as SNPs in the myoglobin, 40S ribosomal protein S17, and actin-binding LIM protein genes, had clines that were coincident and concordant with the mitochondrial clines. When hybrid index was calculated using this subset of loci, the frequency distribution of hybrid indices for a population located at the mtDNA cline center was non-unimodal, suggesting selection against advanced-generation hybrids, possibly due to effects on processes involved in oxidative metabolism. PMID:27547353

  2. Nuclear localization of a double-stranded RNA-binding protein encoded by the vaccinia virus E3L gene.


    Yuwen, H; Cox, J H; Yewdell, J W; Bennink, J R; Moss, B


    We produced a B cell hybridoma (TW2.3) from vaccinia virus-infected mice that secreted a monoclonal antibody (MAb) reactive with a 25-kDA early viral protein that was localized by laser scanning confocal microscopy to the nucleus and cytoplasmic viral factory regions of infected cells. By cell-free translation of mRNA selected by hybridization to a complete library of vaccinia virus DNA fragments, the immunoreactive polypeptide was mapped to open reading frame E3L. The RNA start site of an early promoter was located 26 nucleotides upstream of the first methionine codon of E3L. Evidence was obtained that translation initiation occurs in vivo and in vitro at both the first and second methionine codons to produce major and minor polypeptides of 25 and 19 kDa, respectively. Both polypeptides bound double-stranded RNA, confirming the recent report of H.-W. Chang, J. C. Watson, and B. L. Jacobs (Proc. Natl. Acad. Sci. USA 89, 4825-4829, 1992). Other vaccinia virus proteins were not required for the nuclear localization of the E3L protein, since MAb TW2.3 bound to the nuclei of uninfected cells that were transfected with the E3L gene under the control of the SV40 early promoter. We also demonstrated that the E3L protein can bind to nuclei of aldehyde fixed and detergent permeabilized uninfected cells. This binding was abrogated by treatment of the cells with RNase but not DNase. The nuclear and cytoplasmic locations of the double-stranded RNA binding protein are consistent with multiple functions in the vaccinia virus infectious cycle.

  3. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.


    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C


    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  4. Identification of a light-responsive region of the nuclear gene encoding the B subunit of chloroplast glyceraldehyde 3-phosphate dehydrogenase from Arabidopsis thaliana.

    PubMed Central

    Kwon, H B; Park, S C; Peng, H P; Goodman, H M; Dewdney, J; Shih, M C


    We report here the identification of a cis-acting region involved in light regulation of the nuclear gene (GapB) encoding the B subunit of chloroplast glyceraldehyde 3-phosphate dehydrogenase from Arabidopsis thaliana. Our results show that a 664-bp GapB promoter fragment is sufficient to confer light induction and organ-specific expression of the Escherichia coli beta-glucuronidase reporter gene (Gus) in transgenic tobacco (Nicotiana tabacum) plants. Deletion analysis indicates that the -261 to -173 upstream region of the GapB gene is essential for light induction. This region contains four direct repeats with the consensus sequence 5'-ATGAA(A/G)A-3' (Gap boxes). Deletion of all four repeats abolishes light induction completely. In addition, we have linked a 109-bp (-263 to -152) GapB upstream fragment containing the four direct repeats in two orientations to the -92 to +6 upstream sequence of the cauliflower mosaic virus 35S basal promoter. The resulting chimeric promoters are able to confer light induction and to enhance leaf-specific expression of the Gus reporter gene in transgenic tobacco plants. Based on these results we conclude that Gap boxes are essential for light regulation and organ-specific expression of the GapB gene in A. thaliana. Using gel mobility shift assays we have also identified a nuclear factor from tobacco that interacts with GapA and GapB DNA fragments containing these Gap boxes. Competition assays indicate that Gap boxes are the binding sites for this factor. Although this binding activity is present in nuclear extracts from leaves and roots of light-grown or dark-treated tobacco plants, the activity is less abundant in nuclear extracts prepared from leaves of dark-treated plants or from roots of greenhouse-grown plants. In addition, our data show that this binding factor is distinct from the GT-1 factor, which binds to Box II and Box III within the light-responsive element of the RbcS-3A gene of pea. PMID:8029358

  5. The ORF012 Gene of Marek's Disease Virus Type 1 Produces a Spliced Transcript and Encodes a Novel Nuclear Phosphoprotein Essential for Virus Growth

    PubMed Central

    Schippers, Timo; Jarosinski, Keith


    interfere with MDV and herpesviral pathogenesis. We have identified a previously unidentified phosphoprotein encoded by MDV ORF012. We were able to show experimentally that predicted splicing of the gene based on bioinformatics data does indeed occur during replication. The newly identified p012 is essential for MDV replication and localizes to the nucleus due to the presence of a transferable nuclear localization signal at its C terminus. Our results also imply that p012 could constitute a nucleocytoplasmic shuttle protein, a feature that could prove interesting and important. PMID:25392220

  6. A Deoxynivalenol-Activated Methionyl-tRNA Synthetase Gene from Wheat Encodes a Nuclear Localized Protein and Protects Plants Against Fusarium Pathogens and Mycotoxins.


    Zuo, Dong-Yun; Yi, Shu-Yuan; Liu, Rong-Jing; Qu, Bo; Huang, Tao; He, Wei-Jie; Li, Cheng; Li, He-Ping; Liao, Yu-Cai


    Fusarium graminearum is the fungal pathogen that causes globally important diseases of cereals and produces mycotoxins such as deoxynivalenol (DON). Owing to the dearth of available sources of resistance to Fusarium pathogens, characterization of novel genes that confer resistance to mycotoxins and mycotoxin-producing fungi is vitally important for breeding resistant crop varieties. In this study, a wheat methionyl-tRNA synthetase (TaMetRS) gene was identified from suspension cell cultures treated with DON. It shares conserved aminoacylation catalytic and tRNA anticodon binding domains with human MetRS and with the only previously characterized plant MetRS, suggesting that it functions in aminoacylation in the cytoplasm. However, the TaMetRS comprises a typical nuclear localization signal and cellular localization studies with a TaMetRS::GFP fusion protein showed that TaMetRS is localized in the nucleus. Expression of TaMetRS was activated by DON treatment and by infection with a DON-producing F. graminearum strain in wheat spikes. No such activation was observed following infection with a non-DON-producing F. graminearum strain. Expression of TaMetRS in Arabidopsis plants conferred significant resistance to DON and F. graminearum. These results indicated that this DON-activated TaMetRS gene may encode a novel type of MetRS in plants that has a role in defense and detoxification.

  7. Cis-acting elements essential for light regulation of the nuclear gene encoding the A subunit of chloroplast glyceraldehyde 3-phosphate dehydrogenase in Arabidopsis thaliana.

    PubMed Central

    Park, S C; Kwon, H B; Shih, M C


    We report the characterization of cis-acting elements involved in light regulation of the nuclear gene (GapA) that encodes the A subunit of glyceraldehyde 3-phosphate dehydrogenase in Arabidopsis thaliana. Our previous deletion analyses indicate that the -277 to -195 upstream region of GapA is essential for light induction of the beta-glucuronidase reporter gene in transgenic tobacco (Nicotiana tabacum) plants. This region contains three direct repeats with the consensus sequence 5'-CAAATGAA(A/G)A-3' (Gap boxes). Our results show that 2-bp substitutions of the last four nucleotides (AA or GA) of the Gap boxes by CC abolish light induction of the beta-glucuronidase reporter gene in vivo and affect binding of the Gap box binding factor in vitro. We have also identified an additional cis-acting element, AE (Activation Element) box, that is involved in regulation of GapA. A combination of a Gap box trimer and an AE box dimer can confer light responsiveness of the cauliflower mosaic virus 35S promoter containing the -92 to +6 upstream sequence, whereas oligomers of Gap boxes or AE boxes alone cannot confer light responsiveness on the same promoter. These results suggest that Gap boxes and AE boxes function together as the light-responsive element of GapA. PMID:8972600

  8. Redefining the Epstein-Barr virus-encoded nuclear antigen EBNA-1 gene promoter and transcription initiation site in group I Burkitt lymphoma cell lines.

    PubMed Central

    Schaefer, B C; Strominger, J L; Speck, S H


    The Epstein-Barr virus-encoded nuclear antigen EBNA-1 gene promoter for the restricted Epstein-Barr virus (EBV) latency program operating in group I Burkitt lymphoma (BL) cell lines was previously identified incorrectly. Here we present evidence from RACE (rapid amplification of cDNA ends) cloning, reverse transcription-PCR, and S1 nuclease analyses, which demonstrates that the EBNA-1 gene promoter in group I BL cell lines is located in the viral BamHI Q fragment, immediately upstream of two low-affinity EBNA-1 binding sites. Transcripts initiated from this promoter, referred to as Qp, have the previously reported Q/U/K exon splicing pattern. Qp is active in group I BL cell lines but not in group III BL cell lines or in EBV immortalized B-lymphoblastoid cell lines. In addition, transient transfection of Qp-driven reporter constructs into both an EBV-negative BL cell line and a group I BL cell line gave rise to correctly initiated transcripts. Inspection of Qp revealed that it is a TATA-less promoter whose architecture is similar to the promoters of housekeeping genes, suggesting that Qp may be a default promoter which ensures EBNA-1 expression in cells that cannot run the full viral latency program. Elucidation of the genetic mechanism responsible for the EBNA-1-restricted program of EBV latency is an essential step in understanding control of viral latency in EBV-associated tumors. Images Fig. 1 Fig. 3 Fig. 4 PMID:7479841

  9. The Nuclear Protein Encoded by the Drosophila Neurogenic Gene Mastermind Is Widely Expressed and Associates with Specific Chromosomal Regions

    PubMed Central

    Bettler, D.; Pearson, S.; Yedvobnick, B.


    The Drosophila neurogenic loci encode a diverse group of proteins that comprise an inhibitory signal transduction pathway. The pathway is used throughout development in numerous contexts. We have examined the distribution of the neurogenic locus mastermind protein (Mam). Mam is expressed through all germlayers during early embryogenesis, including ectodermal precursors to both neuroblasts and epidermoblasts. Mam is subsequently down-regulated within the nervous system and then reexpressed. It persists in the nervous system through late embryogenesis and postembryonically. Mam is ubiquitously expressed in wing and leg imaginal discs and is not down-regulated in sensory organ precursor cells of the wing margin or notum. In the eye disc, Mam shows most prominent expression posterior to the morphogenetic furrow. Expression of the protein during oogenesis appears limited to follicle cells. Immunohistochemical detection of Mam on polytene chromosomes revealed binding at >100 sites. Chromosome colocalization studies with RNA polymerase and the groucho corepressor protein implicate Mam in transcriptional regulation. PMID:8725234

  10. Kaposi's sarcoma-associated herpesvirus noncoding polyadenylated nuclear RNA interacts with virus- and host cell-encoded proteins and suppresses expression of genes involved in immune modulation.


    Rossetto, Cyprian C; Pari, Gregory S


    During lytic infection, Kaposi's sarcoma-associated herpesvirus (KSHV) expresses a polyadenylated nuclear RNA (PAN RNA). This noncoding RNA (ncRNA) is localized to the nucleus and is the most abundant viral RNA during lytic infection; however, to date, the role of PAN RNA in the virus life cycle is unknown. Many examples exist where ncRNAs have a defined key regulatory function controlling gene expression by various mechanisms. Our goal for this study was to identify putative binding partners for PAN RNA in an effort to elucidate a possible function for the transcript in KSHV infection. We employed an in vitro affinity protocol where PAN RNA was used as bait for factors present in BCBL-1 cell nuclear extract to show that PAN RNA interacts with several virus- and host cell-encoded factors, including histones H1 and H2A, mitochondrial and cellular single-stranded binding proteins (SSBPs), and interferon regulatory factor 4 (IRF4). RNA chromatin immunoprecipitation (ChIP) assays confirmed that PAN RNA interacted with these factors in the infected cell environment. A luciferase reporter assay showed that PAN RNA expression interfered with the ability of IRF4/PU.1 to activate the interleukin-4 (IL-4) promoter, strongly suggesting a role for PAN RNA in immune modulation. Since the proteomic screen and functional data suggested a role in immune responses, we investigated if constitutive PAN RNA expression could affect other genes involved in immune responses. PAN RNA expression decreased expression of gamma interferon, interleukin-18, alpha interferon 16, and RNase L. These data strongly suggest that PAN RNA interacts with viral and cellular proteins and can function as an immune modulator. PMID:21957289

  11. A hypothesis-driven association study of 28 nuclear-encoded mitochondrial genes with antipsychotic-induced weight gain in schizophrenia.


    Gonçalves, Vanessa F; Zai, Clement C; Tiwari, Arun K; Brandl, Eva J; Derkach, Andriy; Meltzer, Herbert Y; Lieberman, Jeffrey A; Müller, Daniel J; Sun, Lei; Kennedy, James L


    Mitochondria are the main source of energy for neurons and have a role in many vital neuronal functions. Mitochondrial dysfunction has been described in schizophrenia, and antipsychotics such as clozapine and olanzapine have been associated with differences in gene expression in mitochondria. We investigated the hypothesis that nuclear-encoded mitochondrial genes, particularly those involved in oxidative phosphorylation or involved in oxidative stress, mitochondrial biogenesis, inflammation, and apoptosis, would be associated with antipsychotic-induced weight gain (AIWG). In total, we selected 28 genes and analyzed 60 SNPs (50 are functional), in 283 schizophrenia subjects, treated with atypical medications for up to 14 weeks. Association between AIWG (as measured by the % of weight gain from baseline) and SNP genotypes were tested using linear regression with treatment duration, baseline body weight, and medication type as covariates. We observed a significant association between rs6435326 in the NDUFS1 gene and AIWG in the subset of European patients (N=150, Pcorrected=0.02). The haplotype carrying the risk alleles of rs6435326 and two other SNPs (rs1053517 and rs1801318) in NDUFS1 was also nominally associated with percentage of weight gain (T-C-G vs A-T-A, P=0.005). In addition, stepwise linear regression was performed to select important variables predictive of the outcome, and a gene-gene interaction analysis was carried out. We observed a significant interaction between the TT risk genotype of rs6435326 in NDUFS1 and AG genotype of rs3762883 in COX18 (Pcorrected=0.001). A permutation-based test of all 60 SNPs jointly showed significant association with weight gain (P=0.02). Finally, our replication study of rs6435326, rs1053517 and rs1801318 in NDUFS1 using samples from the Clinical Antipsychotic Trials of Intervention Effectiveness (CATIE) showed that rs1801318 was significantly associated with AIWG (N=200, Pcorrected=0.04), and the three SNPs were

  12. The nuclear protein encoded by the Drosophila neurogenic gene mastermind is widely expressed and associates with specific chromosomal regions

    SciTech Connect

    Bettler, D.; Pearson, S.; Yedvobnick, B.


    The Drosophila neurogenic loci encode a diverse group of proteins that comprise an inhibitory signal transduction pathway. The pathway is used throughout development in numerous contexts. We have examined the distribution of the neurogenic locus mastermind protein (Mam). Mam is expressed through all germlayers during early embryogenesis, including ectodermal precursors to both neuroblasts and epidermoblasts. Mam is subsequently down-regulated within the nervous system and then reexpressed. It persists in the nervous system through late embryogenesis and postembryonically. Mam is ubiquitously expressed in wing and leg imaginal discs and is not down-regulated in sensory organ precursor cells of the wing margin or notum. In the eye disc, Mam shows most prominent expression posterior to the morphogenetic furrow. Expression of the protein during oogenesis appears limited to follicle cells. Immunohistochemical detection of Mam on polytene chromosomes revealed binding at >100 sites. Chromosome colocalization studies with RNA polymerase and the groucho corepressor protein implicate Mam in transcriptional regulation. 94 refs., 8 figs., 1 tab.

  13. Promiscuous trans activation of gene expression by an Epstein-Barr virus-encoded early nuclear protein.

    PubMed Central

    Lieberman, P M; O'Hare, P; Hayward, G S; Hayward, S D


    We identified an Epstein-Barr virus (EBV) gene product which functions in transient-expression assays as a nonspecific trans activator. In Vero cells, cotransfection of the BglII J DNA fragment of EBV together with recombinant constructs containing the bacterial chloramphenicol acetyltransferase (CAT) gene gave up to a 100-fold increased expression of CAT activity over that in cells transfected with the recombinant CAT constructs alone. The BglII J fragment acted promiscuously, in that increased CAT synthesis was observed regardless of whether the promoter sequences driving the CAT gene were of EBV, simian virus 40, adenovirus, or herpes simplex virus origin. Cleavage of cloned BglII-J plasmid DNA before transfection revealed that activation was dependent upon the presence of an intact BMLF1 open reading frame. This was confirmed with subclones of BglII-J and with hybrid promoter-open reading frame constructs. This region of the genome is also present in the rearranged P3HR-1-defective DNA species, and defective DNA clones containing these sequences produced a similar activation of CAT expression in cotransfection experiments. The heterogeneous 45-60-kilodalton polypeptide product of BMLF1 may play an important regulatory role in expression of lytic-cycle proteins in EBV-infected lymphocytes. Images PMID:3018281

  14. Gene encoding plant asparagine synthetase


    Coruzzi, Gloria M.; Tsai, Fong-Ying


    The identification and cloning of the gene(s) for plant asparagine synthetase (AS), an important enzyme involved in the formation of asparagine, a major nitrogen transport compound of higher plants is described. Expression vectors constructed with the AS coding sequence may be utilized to produce plant AS; to engineer herbicide resistant plants, salt/drought tolerant plants or pathogen resistant plants; as a dominant selectable marker; or to select for novel herbicides or compounds useful as agents that synchronize plant cells in culture. The promoter for plant AS, which directs high levels of gene expression and is induced in an organ specific manner and by darkness, is also described. The AS promoter may be used to direct the expression of heterologous coding sequences in appropriate hosts.

  15. The moss genes PpSKI1 and PpSKI2 encode nuclear SnRK1 interacting proteins with homologues in vascular plants.


    Thelander, Mattias; Nilsson, Anders; Olsson, Tina; Johansson, Monika; Girod, Pierre-Alain; Schaefer, Didier G; Zrÿd, Jean-Pierre; Ronne, Hans


    The yeast Snf1, animal AMPK, and plant SnRK1 protein kinases constitute a family of related proteins that have been proposed to serve as metabolic sensors of the eukaryotic cell. We have previously reported the characterization of two redundant SnRK1 encoding genes (PpSNF1a and PpSNF1b) in the moss Physcomitrella patens. Phenotypic analysis of the snf1a snf1b double knockout mutant suggested that SnRK1 is important for the plant's ability to recognize and adapt to conditions of limited energy supply, and also suggested a possible role of SnRK1 in the control of plant development. We have now used a yeast two-hybrid system to screen for PpSnf1a interacting proteins. Two new moss genes were found, PpSKI1 and PpSKI2, which encode highly similar proteins with homologues in vascular plants. Fusions of the two encoded proteins to the green fluorescent protein localize to the nucleus. Knockout mutants for either gene have an excess of gametophores under low light conditions, and exhibit reduced gametophore stem lengths. Possible functions of the new proteins and their connection to the SnRK1 kinase are discussed.

  16. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, P.G.; Ohlrogge, J.B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives are disclosed which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides. 5 figs.

  17. Gene encoding acetyl-coenzyme A carboxylase


    Roessler, Paul G.; Ohlrogge, John B.


    A DNA encoding an acetyl-coenzyme A carboxylase (ACCase) from a photosynthetic organism and functional derivatives thereof which are resistant to inhibition from certain herbicides. This gene can be placed in organisms to increase their fatty acid content or to render them resistant to certain herbicides.

  18. Characterization of four nuclear-encoded plastid RNA polymerase sigma factor genes in the liverwort Marchantia polymorpha: blue-light- and multiple stress-responsive SIG5 was acquired early in the emergence of terrestrial plants.


    Kanazawa, Takehiko; Ishizaki, Kimitsune; Kohchi, Takayuki; Hanaoka, Mitsumasa; Tanaka, Kan


    The plastids of plant cells each contain their own genome, and a bacterial-type RNA polymerase called plastid-encoded plastid RNA polymerase (PEP) is involved in transcription of this genome. While the catalytic core subunits are encoded by the plastid genome, the specificity subunit of PEP, sigma, is generally encoded by the nuclear genome and imported into plastids from the cytoplasm after translation. In this study, we identified and analyzed four sigma factor genes from the nuclear genome of a liverwort, Marchantia polymorpha. Phylogenetic analysis suggested that three of the four genes were orthologous to vascular plant genes and thus they were named MpSIG1, MpSIG2 and MpSIG5. The remaining gene was named MpSIGX. The gene products were predicted to localize to the plastid, and this prediction was experimentally demonstrated by expressing yellow fluorescent protein fusion genes in vivo. As with SIG5 genes of other plant species, expression of MpSIG5 was induced by blue-light irradiation and also under various stress conditions, indicating that the regulatory mechanism responsible is conserved among divergent plant species. However, while the major role of SIG5 in vascular plants is to repair the damaged PSII reaction center through psbD gene transcription, the relevant blue-light-responsive promoter (psbD-BLRP) was not found in M. polymorpha and psbD transcript accumulation did not occur in conjunction with MpSIG5 induction. Thus, the physiological role of SIG5 is probably divergent among plant phyla.

  19. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    SciTech Connect

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin . E-mail:


    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations.

  20. The Yeast Hrs1 Gene Encodes a Polyglutamine-Rich Nuclear Protein Required for Spontaneous and Hpr1-Induced Deletions between Direct Repeats

    PubMed Central

    Santos-Rosa, H.; Clever, B.; Heyer, W. D.; Aguilera, A.


    The hrs1-1 mutation was isolated as an extragenic suppressor of the hyperrecombination phenotype of hpr1Δ cells. We have cloned, sequenced and deleted from the genome the HRS1 gene. The DNA sequence of the HRS1 gene reveals that it is identical to PGD1, a gene with no reported function, and that the Hrs1p protein contains polyglutamine stretches typically found in transcription factors. We have purified a His(6) tagged version of Hrs1p protein from E. coli and have obtained specific anti-Hrs1p polyclonal antibodies. We show that Hrs1p is a 49-kD nuclear protein, as determined by indirect immunofluorescence microscopy and Western blot analysis. The hrs1Δ null mutation reduces the frequency of deletions in wild-type and hpr1Δ backgrounds sevenfold below wild-type and rad52 levels. Furthermore, hrs1Δ cells show reduced induction of the GAL1,10 promoter relative to wild-type cells. Our results suggest that Hrs1p is required for the formation of deletions between direct repeats and that it may function in gene expression. This suggests a connection between gene expression and direct repeat recombination. In this context, we discuss the possible roles of Hrs1p and Hpr1p in initiation of direct-repeat recombination. PMID:8849881

  1. The gene responsible for adrenal hypoplasia congenita, DAX-1, encodes a nuclear hormone receptor that defines a new class within the superfamily.


    Burris, T P; Guo, W; McCabe, E R


    X-linked adrenal hypoplasia congenita (AHC) is an inherited disorder of the development of the adrenal cortex. The gene responsible for this genetic disorder has been identified using positional cloning methods and has been named DAX-1 based on its localization within the dosage-sensitive sex reversal (DSS) locus and the AHC locus on the X chromosome. The DAX-1 gene consists of two exons separated by a 3.4 kb intron. Analysis of DNA from patients with deletions in the AHC critical region in the X chromosome provided strong indication for the involvement of the DAX-1 gene in X-linked AHC. A number of intragenic mutations within the DAX-1 gene have also been identified in patients with isolated AHC. The DAX-1 gene product belongs to the nuclear hormone receptor superfamily based on the presence of an entire ligand binding domain present in the carboxy-terminal region of the receptor. However, DAX-1 has a domain structure which is very unusual with respect to other nuclear hormone receptor superfamily members. The amino-terminal portion of DAX-1 contains a novel domain consisting of 3.5 repeats of a 65-67 amino acid motif that contains two putative zinc finger structures in place of the more usual amino-terminal domain, DNA binding domain, and hinge region of the typical nuclear hormone receptors. It has been proposed that the amino-terminal portion of the DAX-1 protein is the DNA binding domain. The expression pattern of DAX-1 suggests that it may play a role in the regulation of steroidogenesis. Not only is DAX-1 expressed in the adrenal glands, but it is also expressed in the ovaries and testes. Most recently, we demonstrated that DAX-1 is also expressed in the hypothalamus and pituitary gland. The expression of DAX-1 in the neuroendocrine system suggests that interruption of the expression in these tissues may be the cause of the hypogonadotropic hypogonadism (HH) that is frequently associated with AHC. Interestingly, hybridization of a human DAX-1 cDNA probe with

  2. Expression and function of AtMBD4L, the single gene encoding the nuclear DNA glycosylase MBD4L in Arabidopsis.


    Nota, Florencia; Cambiagno, Damián A; Ribone, Pamela; Alvarez, María E


    DNA glycosylases recognize and excise damaged or incorrect bases from DNA initiating the base excision repair (BER) pathway. Methyl-binding domain protein 4 (MBD4) is a member of the HhH-GPD DNA glycosylase superfamily, which has been well studied in mammals but not in plants. Our knowledge on the plant enzyme is limited to the activity of the Arabidopsis recombinant protein MBD4L in vitro. To start evaluating MBD4L in its biological context, we here characterized the structure, expression and effects of its gene, AtMBD4L. Phylogenetic analysis indicated that AtMBD4L belongs to one of the seven families of HhH-GPD DNA glycosylase genes existing in plants, and is unique on its family. Two AtMBD4L transcripts coding for active enzymes were detected in leaves and flowers. Transgenic plants expressing the AtMBD4L:GUS gene confined GUS activity to perivascular leaf tissues (usually adjacent to hydathodes), flowers (anthers at particular stages of development), and the apex of immature siliques. MBD4L-GFP fusion proteins showed nuclear localization in planta. Interestingly, overexpression of the full length MBD4L, but not a truncated enzyme lacking the DNA glycosylase domain, induced the BER gene LIG1 and enhanced tolerance to oxidative stress. These results suggest that endogenous MBD4L acts on particular tissues, is capable of activating BER, and may contribute to repair DNA damage caused by oxidative stress. PMID:25900572

  3. The tricornered gene, which is required for the integrity of epidermal cell extensions, encodes the Drosophila nuclear DBF2-related kinase.


    Geng, W; He, B; Wang, M; Adler, P N


    During their differentiation epidermal cells of Drosophila form a rich variety of polarized structures. These include the epidermal hairs that decorate much of the adult cuticular surface, the shafts of the bristle sense organs, the lateral extensions of the arista, and the larval denticles. These cuticular structures are produced by cytoskeletal-mediated outgrowths of epidermal cells. Mutations in the tricornered gene result in the splitting or branching of all of these structures. Thus, tricornered function appears to be important for maintaining the integrity of the outgrowths. tricornered mutations however do not have major effects on the growth or shape of these cellular extensions. Inhibiting actin polymerization in differentiating cells by cytochalasin D or latrunculin A treatment also induces the splitting of hairs and bristles, suggesting that the actin cytoskeleton might be a target of tricornered. However, the drugs also result in short, fat, and occasionally malformed hairs and bristles. The data suggest that the function of the actin cytoskeleton is important for maintaining the integrity of cellular extensions as well as their growth and shape. Thus, if tricornered causes the splitting of cellular extensions by interacting with the actin cytoskeleton it likely does so in a subtle way. Consistent with this possibility we found that a weak tricornered mutant is hypersensitive to cytochalasin D. We have cloned the tricornered gene and found that it encodes the Drosophila NDR kinase. This is a conserved ser/thr protein kinase found in Caenorhabditis elegans and humans that is related to a number of kinases that have been found to be important in controlling cell structure and proliferation.

  4. The tricornered gene, which is required for the integrity of epidermal cell extensions, encodes the Drosophila nuclear DBF2-related kinase.

    PubMed Central

    Geng, W; He, B; Wang, M; Adler, P N


    During their differentiation epidermal cells of Drosophila form a rich variety of polarized structures. These include the epidermal hairs that decorate much of the adult cuticular surface, the shafts of the bristle sense organs, the lateral extensions of the arista, and the larval denticles. These cuticular structures are produced by cytoskeletal-mediated outgrowths of epidermal cells. Mutations in the tricornered gene result in the splitting or branching of all of these structures. Thus, tricornered function appears to be important for maintaining the integrity of the outgrowths. tricornered mutations however do not have major effects on the growth or shape of these cellular extensions. Inhibiting actin polymerization in differentiating cells by cytochalasin D or latrunculin A treatment also induces the splitting of hairs and bristles, suggesting that the actin cytoskeleton might be a target of tricornered. However, the drugs also result in short, fat, and occasionally malformed hairs and bristles. The data suggest that the function of the actin cytoskeleton is important for maintaining the integrity of cellular extensions as well as their growth and shape. Thus, if tricornered causes the splitting of cellular extensions by interacting with the actin cytoskeleton it likely does so in a subtle way. Consistent with this possibility we found that a weak tricornered mutant is hypersensitive to cytochalasin D. We have cloned the tricornered gene and found that it encodes the Drosophila NDR kinase. This is a conserved ser/thr protein kinase found in Caenorhabditis elegans and humans that is related to a number of kinases that have been found to be important in controlling cell structure and proliferation. PMID:11102376

  5. Transposon-disruption of a maize nuclear gene, tha1, encoding a chloroplast SecA homologue: in vivo role of cp-SecA in thylakoid protein targeting.


    Voelker, R; Mendel-Hartvig, J; Barkan, A


    A nuclear mutant of maize, tha1, which exhibited defects in the translocation of proteins across the thylakoid membrane, was described previously. A transposon insertion at the tha1 locus facilitated the cloning of portions of the tha1 gene. Strong sequence similarity with secA genes from bacteria, pea and spinach indicates that tha1 encodes a SecA homologue (cp-SecA). The tha1-ref allele is either null or nearly so, in that tha1 mRNA is undetectable in mutant leaves and cp-SecA accumulation is reduced > or = 40-fold. These results, in conjunction with the mutant phenotype described previously, demonstrate that cp-SecA functions in vivo to facilitate the translocation of OEC33, PSI-F and plastocyanin but does not function in the translocation of OEC23 and OEC16. Our results confirm predictions for cp-SecA function made from the results of in vitro experiments and establish several new functions for cp-SecA, including roles in the targeting of a chloroplast-encoded protein, cytochrome f, and in protein targeting in the etioplast, a nonphotosynthetic plastid type. Our finding that the accumulation of properly targeted plastocyanin and cytochrome f in tha1-ref thylakoid membranes is reduced only a few-fold despite the near or complete absence of cp-SecA suggests that cp-SecA facilitates but is not essential in vivo for their translocation across the membrane.

  6. Molecular cloning of a cDNA encoding human SPH-binding factor, a conserved protein that binds to the enhancer-like region of the U6 small nuclear RNA gene promoter.


    Rincon, J C; Engler, S K; Hargrove, B W; Kunkel, G R


    Many vertebrate small nuclear RNA gene promoters contain an SPH motif in their distal control regions that can confer transcriptional stimulation by RNA polymerase II or RNA polymerase III. Using the human U6 gene SPH motif as a probe, we isolated a cDNA encoding human SPH-binding factor (hSBF) from a HeLa cell expression library. The coding region of hSBF is almost identical to ZNF143, a 626 amino acid, seven zinc finger protein of previously unknown function. Furthermore, the predicted amino acid sequence of hSBF is highly homologous to Xenopus laevis and mouse Staf proteins, that bind to SPH motifs and stimulate transcription of selenocysteine tRNA gene promoters. Recombinant hSBF expressed in vitro or from Escherichia coli bound specifically to the human U6 gene SPH motif as shown by DNase I footprinting and electrophoretic mobility shift assays using various mutant SPH sites as competitors. Antibodies prepared against recombinant hSBF inhibited assembly of native SBF-DNA complexes. Immunodepleted HeLa S100 transcription extract no longer supported elevated levels of transcription by RNA polymerase III from a U6 promoter containing an SPH motif, whereas addition of recombinant hSBF protein to the immunodepleted extract reconstituted stimulated transcription.

  7. The 5' flanking region of the gene for the Epstein-Barr virus-encoded nuclear antigen 2 contains a cell type specific cis-acting regulatory element that activates transcription in transfected B-cells.

    PubMed Central

    Ricksten, A; Olsson, A; Andersson, T; Rymo, L


    We have recently identified the promoter that positions the initiation (cap) site for RNA encoding the Epstein-Barr virus (EBV) determined nuclear antigen 2 (EBNA2) in transfected COS-1 cells. The cells were transfected with recombinant vectors that contained the BamHI WYH region of the EBV genome. In order to delineate regulatory DNA sequences required for the expression of EBNA2 the 5' flanking region of the gene was linked to reporter genes in expression vectors and transfected into EBV genome-negative lymphoid DG75 cells. We demonstrate that several cis-acting elements contribute to a transcriptional enhancer activity found in the region between nucleotides-553 and -86 relative to the cap site. The enhancer was active in lymphoid DG75 cells but not in HeLa cells and stimulated transcription also from the heterologous thymidine kinase (TK) and beta-globin promoters. Nuclear extracts of lymphoid cells contained protein factors that bound to the enhancer. The in vitro introduction of a mutation in the enhancer sequence that substantially reduced the transcription stimulatory activity concurrently blocked the binding of one of the factors. Images PMID:2843816

  8. Genes Encoding Enzymes Involved in Ethanol Metabolism

    PubMed Central

    Hurley, Thomas D.; Edenberg, Howard J.


    The effects of beverage alcohol (ethanol) on the body are determined largely by the rate at which it and its main breakdown product, acetaldehyde, are metabolized after consumption. The main metabolic pathway for ethanol involves the enzymes alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH). Seven different ADHs and three different ALDHs that metabolize ethanol have been identified. The genes encoding these enzymes exist in different variants (i.e., alleles), many of which differ by a single DNA building block (i.e., single nucleotide polymorphisms [SNPs]). Some of these SNPs result in enzymes with altered kinetic properties. For example, certain ADH1B and ADH1C variants that are commonly found in East Asian populations lead to more rapid ethanol breakdown and acetaldehyde accumulation in the body. Because acetaldehyde has harmful effects on the body, people carrying these alleles are less likely to drink and have a lower risk of alcohol dependence. Likewise, an ALDH2 variant with reduced activity results in acetaldehyde buildup and also has a protective effect against alcoholism. In addition to affecting drinking behaviors and risk for alcoholism, ADH and ALDH alleles impact the risk for esophageal cancer. PMID:23134050

  9. 'Green revolution' genes encode mutant gibberellin response modulators.


    Peng, J; Richards, D E; Hartley, N M; Murphy, G P; Devos, K M; Flintham, J E; Beales, J; Fish, L J; Worland, A J; Pelica, F; Sudhakar, D; Christou, P; Snape, J W; Gale, M D; Harberd, N P


    World wheat grain yields increased substantially in the 1960s and 1970s because farmers rapidly adopted the new varieties and cultivation methods of the so-called 'green revolution'. The new varieties are shorter, increase grain yield at the expense of straw biomass, and are more resistant to damage by wind and rain. These wheats are short because they respond abnormally to the plant growth hormone gibberellin. This reduced response to gibberellin is conferred by mutant dwarfing alleles at one of two Reduced height-1 (Rht-B1 and Rht-D1) loci. Here we show that Rht-B1/Rht-D1 and maize dwarf-8 (d8) are orthologues of the Arabidopsis Gibberellin Insensitive (GAI) gene. These genes encode proteins that resemble nuclear transcription factors and contain an SH2-like domain, indicating that phosphotyrosine may participate in gibberellin signalling. Six different orthologous dwarfing mutant alleles encode proteins that are altered in a conserved amino-terminal gibberellin signalling domain. Transgenic rice plants containing a mutant GAI allele give reduced responses to gibberellin and are dwarfed, indicating that mutant GAI orthologues could be used to increase yield in a wide range of crop species.

  10. Reduction of a 4q35-encoded nuclear envelope protein in muscle differentiation

    SciTech Connect

    Ostlund, Cecilia; Guan, Tinglu; Figlewicz, Denise A.; Hays, Arthur P.; Worman, Howard J.; Gerace, Larry; Schirmer, Eric C.


    Muscular dystrophy and peripheral neuropathy have been linked to mutations in genes encoding nuclear envelope proteins; however, the molecular mechanisms underlying these disorders remain unresolved. Nuclear envelope protein p19A is a protein of unknown function encoded by a gene at chromosome 4q35. p19A levels are significantly reduced in human muscle as cells differentiate from myoblasts to myotubes; however, its levels are not similarly reduced in all differentiation systems tested. Because 4q35 has been linked to facioscapulohumeral muscular dystrophy (FSHD) and some adjacent genes are reportedly misregulated in the disorder, levels of p19A were analyzed in muscle samples from patients with FSHD. Although p19A was increased in most cases, an absolute correlation was not observed. Nonetheless, p19A downregulation in normal muscle differentiation suggests that in the cases where its gene is inappropriately re-activated it could affect muscle differentiation and contribute to disease pathology.

  11. A Continental-Wide Perspective: The Genepool of Nuclear Encoded Ribosomal DNA and Single-Copy Gene Sequences in North American Boechera (Brassicaceae)

    PubMed Central

    Kiefer, Christiane; Koch, Marcus A.


    74 of the currently accepted 111 taxa of the North American genus Boechera (Brassicaceae) were subject to pyhlogenetic reconstruction and network analysis. The dataset comprised 911 accessions for which ITS sequences were analyzed. Phylogenetic analyses yielded largely unresolved trees. Together with the network analysis confirming this result this can be interpreted as an indication for multiple, independent, and rapid diversification events. Network analyses were superimposed with datasets describing i) geographical distribution, ii) taxonomy, iii) reproductive mode, and iv) distribution history based on phylogeographic evidence. Our results provide first direct evidence for enormous reticulate evolution in the entire genus and give further insights into the evolutionary history of this complex genus on a continental scale. In addition two novel single-copy gene markers, orthologues of the Arabidopsis thaliana genes At2g25920 and At3g18900, were analyzed for subsets of taxa and confirmed the findings obtained through the ITS data. PMID:22606266

  12. Evolution of the nuclear receptor gene superfamily.

    PubMed Central

    Laudet, V; Hänni, C; Coll, J; Catzeflis, F; Stéhelin, D


    Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplication from a common ancestor or if their different domains came from different independent sources. To test these possibilities we have constructed and compared the phylogenetic trees derived from two different domains of 30 nuclear receptor genes. The tree built from the DNA binding C domain clearly shows a common progeny of all nuclear receptors, which can be grouped into three subfamilies: (i) thyroid hormone and retinoic acid receptors, (ii) orphan receptors and (iii) steroid hormone receptors. The tree constructed from the central part of the E domain which is implicated in transcriptional regulation and dimerization shows the same distribution in three subfamilies but two groups of receptors are in a different position from that in the C domain tree: (i) the Drosophila knirps family genes have acquired very different E domains during evolution, and (ii) the vitamin D and ecdysone receptors, as well as the FTZ-F1 and the NGF1B genes, seem to have DNA binding and hormone binding domains belonging to different classes. These data suggest a complex evolutionary history for nuclear receptor genes in which gene duplication events and swapping between domains of different origins took place. PMID:1312460

  13. Coordination of plastid and nuclear gene expression.

    PubMed Central

    Gray, John C; Sullivan, James A; Wang, Jun-Hui; Jerome, Cheryl A; MacLean, Daniel


    The coordinated expression of genes distributed between the nuclear and plastid genomes is essential for the assembly of functional chloroplasts. Although the nucleus has a pre-eminent role in controlling chloroplast biogenesis, there is considerable evidence that the expression of nuclear genes encoding photosynthesis-related proteins is regulated by signals from plastids. Perturbation of several plastid-located processes, by inhibitors or in mutants, leads to decreased transcription of a set of nuclear photosynthesis-related genes. Characterization of arabidopsis gun (genomes uncoupled) mutants, which express nuclear genes in the presence of norflurazon or lincomycin, has provided evidence for two separate signalling pathways, one involving tetrapyrrole biosynthesis intermediates and the other requiring plastid protein synthesis. In addition, perturbation of photosynthetic electron transfer produces at least two different redox signals, as part of the acclimation to altered light conditions. The recognition of multiple plastid signals requires a reconsideration of the mechanisms of regulation of transcription of nuclear genes encoding photosynthesis-related proteins. PMID:12594922

  14. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  15. Gene encoding herbicide safener binding protein


    Walton, Jonathan D.; Scott-Craig, John S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

  16. Human germline antibody gene segments encode polyspecific antibodies.


    Willis, Jordan R; Briney, Bryan S; DeLuca, Samuel L; Crowe, James E; Meiler, Jens


    Structural flexibility in germline gene-encoded antibodies allows promiscuous binding to diverse antigens. The binding affinity and specificity for a particular epitope typically increase as antibody genes acquire somatic mutations in antigen-stimulated B cells. In this work, we investigated whether germline gene-encoded antibodies are optimal for polyspecificity by determining the basis for recognition of diverse antigens by antibodies encoded by three VH gene segments. Panels of somatically mutated antibodies encoded by a common VH gene, but each binding to a different antigen, were computationally redesigned to predict antibodies that could engage multiple antigens at once. The Rosetta multi-state design process predicted antibody sequences for the entire heavy chain variable region, including framework, CDR1, and CDR2 mutations. The predicted sequences matched the germline gene sequences to a remarkable degree, revealing by computational design the residues that are predicted to enable polyspecificity, i.e., binding of many unrelated antigens with a common sequence. The process thereby reverses antibody maturation in silico. In contrast, when designing antibodies to bind a single antigen, a sequence similar to that of the mature antibody sequence was returned, mimicking natural antibody maturation in silico. We demonstrated that the Rosetta computational design algorithm captures important aspects of antibody/antigen recognition. While the hypervariable region CDR3 often mediates much of the specificity of mature antibodies, we identified key positions in the VH gene encoding CDR1, CDR2, and the immunoglobulin framework that are critical contributors for polyspecificity in germline antibodies. Computational design of antibodies capable of binding multiple antigens may allow the rational design of antibodies that retain polyspecificity for diverse epitope binding.

  17. [Immunoglobulin genes encoding antibodies directed to oncodevelopmental carbohydrate antigens].


    Zenita, K; Yago, K; Fujimoto, E; Kannagi, R


    We investigated the immunoglobulin genes which encode the variable region of the monoclonal antibodies directed to the onco-developmental carbohydrate antigens such SSEA-1, fucosyl SSEA-1, SSEA-3 and SSEA-4. The VH region of these antibodies was preferentially encoded by the gene members of the X24, VH7183 and Q52 families, the families which are known to be located at the 3'-end region of the murine germ line VH gene. This result is interesting particularly when considering that the members of the 3'-end VH families are known to be preferentially expressed in embryonic B lymphocytes by an intrinsic genetic program. The comparative study of the nucleic acid sequences of mRNAs encoding these antibodies and the sequences of the corresponding germ line VH genes disclosed that the sequences encoding the antibodies contain no mutation from the germ line VH genes, or contain only a few somatic mutations, which are thought to be insignificant for the reactivity of the antibodies to the nominal antigens. These results imply that some of the embryonic B lymphocytes that express the unmutated germ line VH genes of the 3'-end families can be reactive with embryonic carbohydrate antigens, albeit rearranged with appropriate D-JH gene segments, and coupled with proper light chains. The VH region of the syngenic monoclonal anti-idiotypic antibodies directed to these anti-carbohydrate antibodies were also encoded preferentially by the members of the 3'-end VH families. We propose here that a part of the virgin embryonic B lymphocytes, which express the antibody encoded by the gene members of the 3'-end VH families at the cell surface, will be stimulated by the embryonic carbohydrate antigens which are abundantly present in the internal milieu of the embryo. The clonally expanded B lymphocytes, in turn, will facilitate the proliferation of other populations of embryonic B lymphocytes expressing the corresponding anti-idiotypic antibodies, which are also encoded by the gene members

  18. Nuclearly encoded splicing factors implicated in RNA splicing in higher plant organelles.


    de Longevialle, Andéol Falcon; Small, Ian D; Lurin, Claire


    Plant organelles arose from two independent endosymbiosis events. Throughout evolutionary history, tight control of chloroplasts and mitochondria has been gained by the nucleus, which regulates most steps of organelle genome expression and metabolism. In particular, RNA maturation, including RNA splicing, is highly dependent on nuclearly encoded splicing factors. Most introns in organelles are group II introns, whose catalytic mechanism closely resembles that of the nuclear spliceosome. Plant group II introns have lost the ability to self-splice in vivo and require nuclearly encoded proteins as cofactors. Since the first splicing factor was identified in chloroplasts more than 10 years ago, many other proteins have been shown to be involved in splicing of one or more introns in chloroplasts or mitochondria. These new proteins belong to a variety of different families of RNA binding proteins and provide new insights into ribonucleo-protein complexes and RNA splicing machineries in organelles. In this review, we describe how splicing factors, encoded by the nucleus and targeted to the organelles, take part in post-transcriptional steps in higher plant organelle gene expression. We go on to discuss the potential for these factors to regulate organelle gene expression.

  19. Selection for Genes Encoding Secreted Proteins and Receptors

    NASA Astrophysics Data System (ADS)

    Klein, Robert D.; Gu, Qimin; Goddard, Audrey; Rosenthal, Arnon


    Extracellular proteins play an essential role in the formation, differentiation, and maintenance of multicellular organisms. Despite that, the systematic identification of genes encoding these proteins has not been possible. We describe here a highly efficient method to isolate genes encoding secreted and membrane-bound proteins by using a single-step selection in yeast. Application of this method, termed signal peptide selection, to various tissues yielded 559 clones that appear to encode known or novel extracellular proteins. These include members of the transforming growth factor and epidermal growth factor protein families, endocrine hormones, tyrosine kinase receptors, serine/threonine kinase receptors, seven transmembrane receptors, cell adhesion molecules, extracellular matrix proteins, plasma proteins, and ion channels. The eventual identification of most, or all, extracellular signaling molecules will advance our understanding of fundamental biological processes and our ability to intervene in disease states.

  20. A heterogeneous population of nuclear-encoded mitochondrial mRNAs is present in the axons of primary sympathetic neurons.


    Aschrafi, Armaz; Kar, Amar N; Gale, Jenna R; Elkahloun, Abdel G; Vargas, Jose Noberto S; Sales, Naomi; Wilson, Gabriel; Tompkins, Miranda; Gioio, Anthony E; Kaplan, Barry B


    Mitochondria are enriched in subcellular regions of high energy consumption, such as axons and pre-synaptic nerve endings. Accumulating evidence suggests that mitochondrial maintenance in these distal structural/functional domains of the neuron depends on the "in-situ" translation of nuclear-encoded mitochondrial mRNAs. In support of this notion, we recently provided evidence for the axonal targeting of several nuclear-encoded mRNAs, such as cytochrome c oxidase, subunit 4 (COXIV) and ATP synthase, H+ transporting and mitochondrial Fo complex, subunit C1 (ATP5G1). Furthermore, we showed that axonal trafficking and local translation of these mRNAs plays a critical role in the generation of axonal ATP. Using a global gene expression analysis, this study identified a highly diverse population of nuclear-encoded mRNAs that were enriched in the axon and presynaptic nerve terminals. Among this population of mRNAs, fifty seven were found to be at least two-fold more abundant in distal axons, as compared with the parental cell bodies. Gene ontology analysis of the nuclear-encoded mitochondrial mRNAs suggested functions for these gene products in molecular and biological processes, including but not limited to oxidoreductase and electron carrier activity and proton transport. Based on these results, we postulate that local translation of nuclear-encoded mitochondrial mRNAs present in the axons may play an essential role in local energy production and maintenance of mitochondrial function.

  1. Structure of the gene encoding columbid annexin Icp35.


    Hitti, Y S; Horseman, N D


    The cp35 gene, encoding an annexin I (AnxI) cropsac 35-kDa protein (cp35) from the pigeon, consists of 13 exons and twelve introns. The borders of exons 2-13 were mapped by comparison with the known cDNA sequence. A 5-kb sequence containing exons 1, 2, and 3, and 1.4 kb of 5'-flanking DNA, is presented. The transcription start point was mapped by S1 nuclease protection. The region of the cp35 mRNA sequence, which we had previously shown to be profoundly different from mammalian anxI, is located in the first half of exon 3. Whereas human anxI is known to be single copy, Southern analysis of pigeon genomic DNA and genomic clones demonstrated multiple anxI genes in the pigeon, diverging significantly in their 5'-termini. Pigeon vimentin, on the other hand, is encoded by a single-copy gene as it is in other birds and mammals. These experiments have demonstrated that the cp35 mRNA is transcribed from its individual gene and is not a product of alternative processing of the pigeon homolog of mammalian anxI. We speculate that the diversification of anxI genes in Columbid birds allowed the recruitment of one of these genes (cp35) for unique regulation by prolactin in the absence of post-translational regulation via residues encoded by exons 2 and 3.

  2. Crystal structures of two active proliferating cell nuclear antigens (PCNAs) encoded by Thermococcus kodakaraensis

    PubMed Central

    Ladner, Jane E.; Pan, Miao; Hurwitz, Jerard; Kelman, Zvi


    Proliferating cell nuclear antigen (PCNA) is a ring-shaped protein that encircles duplex DNA and plays an essential role in many DNA metabolic processes in archaea and eukarya. The eukaryotic and euryarchaea genomes contain a single gene encoding for PCNA. Interestingly, the genome of the euryarchaeon Thermococcus kodakaraensis contains two PCNA-encoding genes (TK0535 and TK0582), making it unique among the euryarchaea kingdom. It is shown here that the two T. kodakaraensis PCNA proteins support processive DNA synthesis by the polymerase. Both proteins form trimeric structures with characteristics similar to those of other archaeal and eukaryal PCNA proteins. One of the notable differences between the TK0535 and TK0582 rings is that the interfaces are different, resulting in different stabilities for the two trimers. The possible implications of these observations for PCNA functions are discussed. PMID:21270332

  3. Cloning and sequencing the genes encoding goldfish and carp ependymin.


    Adams, D S; Shashoua, V E


    Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

  4. Structure and sequence of the gene encoding human keratocan.


    Tasheva, E S; Funderburgh, J L; Funderburgh, M L; Corpuz, L M; Conrad, G W


    Keratocan is one of the three major keratan sulfate proteoglycans characteristically expressed in cornea. We have isolated cDNA and genomic clones and determined the sequence of the entire human keratocan (Kera) gene. The gene is spread over 7.65 kb of DNA and contains three exons. An open reading frame starting at the beginning of the second exon encodes a protein of 352 aa. The amino acid sequence of keratocan shows high identity among mammalian species. This evolutionary conservation between the keratocan proteins as well as the restricted expression of Kera gene in cornea suggests that this molecule might be important in developing and maintaining corneal transparency.

  5. In vitro import of a nuclearly encoded tRNA into mitochondria of Solanum tuberosum.


    Delage, Ludovic; Dietrich, André; Cosset, Anne; Maréchal-Drouard, Laurence


    Some of the mitochondrial tRNAs of higher plants are nuclearly encoded and imported into mitochondria. The import of tRNAs encoded in the nucleus has been shown to be essential for proper protein translation within mitochondria of a variety of organisms. Here, we report the development of an in vitro assay for import of nuclearly encoded tRNAs into plant mitochondria. This in vitro system utilizes isolated mitochondria from Solanum tuberosum and synthetic tRNAs transcribed from cloned nuclear tRNA genes. Although incubation of radioactively labeled in vitro-transcribed tRNA(Ala), tRNA(Phe), and tRNA(Met-e) with isolated potato mitochondria resulted in importation, as measured by nuclease protection, the amount of tRNA transcripts protected at saturation was at least five times higher for tRNA(Ala) than for the two other tRNAs. This difference in in vitro saturation levels of import is consistent with the in vivo localization of these tRNAs, since cytosolic tRNA(Ala) is naturally imported into potato mitochondria whereas tRNA(Phe) and tRNA(Met-e) are not. Characterization of in vitro tRNA import requirements indicates that mitochondrial tRNA import proceeds in the absence of any added cytosolic protein fraction, involves at least one protein component on the surface of mitochondria, and requires ATP-dependent step(s) and a membrane potential.

  6. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    PubMed Central


    Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB). A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters. PMID:21733190

  7. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.


    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  8. The cyclope gene of Drosophila encodes a cytochrome c oxidase subunit VIc homolog.

    PubMed Central

    Szuplewski, S; Terracol, R


    Cytochrome c oxidase is the terminal enzyme of the mitochondrial electron transfer chain. In eukaryotes, the enzyme is composed of 3 mitochondrial DNA-encoded subunits and 7-10 (in mammals) nuclear DNA-encoded subunits. This enzyme has been extensively studied in mammals and yeast but, in Drosophila, very little is known and no mutant has been described so far. Here we report the genetic and molecular characterization of mutations in cyclope (cype) and the cloning of the gene encoding a cytochrome c oxidase subunit VIc homolog. cype is an essential gene whose mutations are lethal and show pleiotropic phenotypes. The 77-amino acid peptide encoded by cype is 46% identical and 59% similar to the human subunit (75 amino acids). The transcripts are expressed maternally and throughout development in localized regions. They are found predominantly in the central nervous system of the embryo; in the central region of imaginal discs; in the germarium, follicular, and nurse cells of the ovary; and in testis. A search in the Genome Annotation Database of Drosophila revealed the absence of subunit VIIb and the presence of 9 putative nuclear cytochrome c oxidase subunits with high identity scores when compared to the 10 human subunits. PMID:11514451

  9. Expression of genes encoding extracellular matrix proteins: a macroarray study.


    Futyma, Konrad; Miotła, Paweł; Różyńska, Krystyna; Zdunek, Małgorzata; Semczuk, Andrzej; Rechberger, Tomasz; Wojcierowski, Jacek


    Endometrial cancer (EC) is one of the most common gynecological malignancies in Poland, with well-established risk factors. Genetic instability and molecular alterations responsible for endometrial carcinogenesis have been systematically investigated. The aim of the present study was to investigate, by means of cDNA macroarrays, the expression profiles of genes encoding extracellular matrix (ECM) proteins in ECs. Tissue specimens were collected during surgical procedures from 40 patients with EC, and control tissue was collected from 9 patients with uterine leiomyomas. RNA was isolated and RT-PCR with radioisotope-labeled cDNA was performed. The levels of ECM protein gene expression in normal endometrial tissues were compared to the expression of these genes in EC specimens. Statistically significant differences in gene expression, stratified by clinical stage of the ECs, were detected for aggrecan, vitronectin, tenascin R, nidogen and two collagen proteins: type VIII chain α1 and type XI chain α2. All of these proteins were overexpressed in stage III endometrial carcinomas compared to levels in stage I and II uterine neoplasms. In conclusion, increased expression of genes encoding ECM proteins may play an important role in facilitating accelerated disease progression of human ECs.

  10. Phylogenetic position of Cryothecomonas inferred from nuclear-encoded small subunit ribosomal RNA.


    Kühn, S; Lange, M; Medlin, L K


    The systematic position of the genus Cryothecomonas has been determined from an analysis of the nuclear-encoded small subunit ribosomal RNA gene of Cryothecomonas longipes and two strains of Cryothecomonas aestivalis. Our phylogenetic trees inferred from maximum likelihood, distance and maximum parsimony methods robustly show that the genus Cryothecomonas clusters within the phylum Cercozoa, and is related to the sarcomonad flagellate Heteromita globosa. Morphological data supporting the taxonomic placement of Cryothecomonas near the sarcomonad flagellates has been compiled from the literature. The high number of nucleotide substitutions found between two morphologically indistinguishable strains of Cryothecomonas aestivalis suggests the possibility of cryptic species within Cryothecomonas aestivalis. PMID:11212894

  11. Parallel loss of nuclear-encoded mitochondrial aminoacyl-tRNA synthetases and mtDNA-encoded tRNAs in Cnidaria.


    Haen, Karri M; Pett, Walker; Lavrov, Dennis V


    Unlike most animal mitochondrial (mt) genomes, which encode a set of 22 transfer RNAs (tRNAs) sufficient for mt protein synthesis, those of cnidarians have only retained one or two tRNA genes. Whether the missing cnidarian mt-tRNA genes relocated outside the main mt chromosome or were lost remains unclear. It is also unknown what impact the loss of tRNA genes had on other components of the mt translational machinery. Here, we explored the nuclear genome of the cnidarian Nematostella vectensis for the presence of mt-tRNA genes and their corresponding mt aminoacyl-tRNA synthetases (mt-aaRS). We detected no candidates for mt-tRNA genes and only two mt-aaRS orthologs. At the same time, we found that all but one cytosolic aaRS appear to be targeted to mitochondria. These results indicate that the loss of mt-tRNAs in Cnidaria is genuine and occurred in parallel with the loss of nuclear-encoded mt-aaRS. Our phylogenetic analyses of individual aaRS revealed that although the nearly total loss of mt-aaRS is rare, aaRS gene deletion and replacement have occurred throughout the evolution of Metazoa.

  12. Nuclear gene indicates coat-color polymorphism in mammoths.


    Römpler, Holger; Rohland, Nadin; Lalueza-Fox, Carles; Willerslev, Eske; Kuznetsova, Tatyana; Rabeder, Gernot; Bertranpetit, Jaume; Schöneberg, Torsten; Hofreiter, Michael


    By amplifying the melanocortin type 1 receptor from the woolly mammoth, we can report the complete nucleotide sequence of a nuclear-encoded gene from an extinct species. We found two alleles and show that one allele produces a functional protein whereas the other one encodes a protein with strongly reduced activity. This finding suggests that mammoths may have been polymorphic in coat color, with both dark- and light-haired individuals co-occurring.

  13. Encoding four gene expression programs in the activation dynamics of a single transcription factor.


    Hansen, Anders S; O'Shea, Erin K


    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  14. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.


    Lee, M M; Schiefelbein, J


    The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

  15. Gene model 129 (Gm129) encodes a novel transcriptional repressor that modulates circadian gene expression.


    Annayev, Yunus; Adar, Sheera; Chiou, Yi-Ying; Lieb, Jason D; Sancar, Aziz; Ye, Rui


    The mammalian circadian clock is a molecular oscillator composed of a feedback loop that involves transcriptional activators CLOCK and BMAL1, and repressors Cryptochrome (CRY) and Period (PER). Here we show that a direct CLOCK·BMAL1 target gene, Gm129, is a novel regulator of the feedback loop. ChIP analysis revealed that the CLOCK·BMAL1·CRY1 complex strongly occupies the promoter region of Gm129. Both mRNA and protein levels of GM129 exhibit high amplitude circadian oscillations in mouse liver, and Gm129 gene encodes a nuclear-localized protein that directly interacts with BMAL1 and represses CLOCK·BMAL1 activity. In vitro and in vivo protein-DNA interaction results demonstrate that, like CRY1, GM129 functions as a repressor by binding to the CLOCK·BMAL1 complex on DNA. Although Gm129(-/-) or Cry1(-/-) Gm129(-/-) mice retain a robust circadian rhythm, the peaks of Nr1d1 and Dbp mRNAs in liver exhibit a significant phase delay compared with control. Our results suggest that, in addition to CRYs and PERs, the GM129 protein contributes to the transcriptional feedback loop by modulating CLOCK·BMAL1 activity as a transcriptional repressor.

  16. [Mutations in the gene encoding filaggrin cause ichthyosis vulgaris].


    Prasad, Sumangali Chandra; Rasmussen, Kirsten; Bygum, Anette


    Ichthyosis vulgaris is a common genetic skin disorder with an estimated prevalence of 1:250 caused by mutations in the gene encoding filaggrin. This disorder manifests itself within the first year of life and is clinically characterized by dry, scaly skin, keratosis pilaris, palmar hyperlinearity and atopic manifestations. Patients with a severe phenotype are homozygous or compound heterozygous for the mutations, whereas heterozygous patients show mild disease, suggesting semidominant inheritance with incomplete penetrance. We present a patient with classic severe ichthyosis vulgaris, atopic eczema and two loss-of-function mutations.

  17. The pea gene NA encodes ent-kaurenoic acid oxidase.


    Davidson, Sandra E; Elliott, Robert C; Helliwell, Chris A; Poole, Andrew T; Reid, James B


    The gibberellin (GA)-deficient dwarf na mutant in pea (Pisum sativum) has severely reduced internode elongation, reduced root growth, and decreased leaflet size. However, the seeds develop normally. Two genes, PsKAO1 and PsKAO2, encoding cytochrome P450 monooxygenases of the subfamily CYP88A were isolated. Both PsKAO1 and PsKAO2 had ent-kaurenoic acid oxidase (KAO) activity, catalyzing the three steps of the GA biosynthetic pathway from ent-kaurenoic acid to GA(12) when expressed in yeast (Saccharomyces cerevisiae). In addition to the intermediates ent-7alpha-hydroxykaurenoic acid and GA(12)-aldehyde, some additional products of the pea KAO activity were detected, including ent-6alpha,7alpha-dihydroxykaurenoic acid and 7beta-hydroxykaurenolide. The NA gene encodes PsKAO1, because in two independent mutant alleles, na-1 and na-2, PsKAO1 had altered sequences and the five-base deletion in PsKAO1 associated with the na-1 allele cosegregated with the dwarf na phenotype. PsKAO1 was expressed in the stem, apical bud, leaf, pod, and root, organs in which GA levels have previously been shown to be reduced in na plants. PsKAO2 was expressed only in seeds and this may explain the normal seed development and normal GA biosynthesis in seeds of na plants.

  18. Urease-Encoding Genes in Ammonia-Oxidizing Bacteria†

    PubMed Central

    Koper, Teresa E.; El-Sheikh, Amal F.; Norton, Jeanette M.; Klotz, Martin G.


    Many but not all ammonia-oxidizing bacteria (AOB) produce urease (urea amidohydrolase, EC and are capable of using urea for chemolithotrophic growth. We sequenced the urease operons from two AOB, the β-proteobacterium Nitrosospira sp. strain NpAV and the γ-proteobacterium Nitrosococcus oceani. In both organisms, all seven urease genes were contiguous: the three structural urease genes ureABC were preceded and succeeded by the accessory genes ureD and ureEFG, respectively. Green fluorescent protein reporter gene fusions revealed that the ure genes were under control of a single operon promoter upstream of the ureD gene in Nitrosococcus oceani. Southern analyses revealed two copies of ureC in the Nitrosospira sp. strain NpAV genome, while a single copy of the ure operon was detected in the genome of Nitrosococcus oceani. The ureC gene encodes the alpha subunit protein containing the active site and conserved nickel binding ligands; these conserved regions were suitable primer targets for obtaining further ureC sequences from additional AOB. In order to develop molecular tools for detecting the ureolytic ecotype of AOB, ureC genes were sequenced from several β-proteobacterial AOB. Pairwise identity values ranged from 80 to 90% for the UreC peptides of AOB within a subdivision. UreC sequences deduced from AOB urease genes and available UreC sequences in the public databases were used to construct alignments and make phylogenetic inferences. The UreC proteins from β-proteobacterial AOB formed a distinct monophyletic group. Unexpectedly, the peptides from AOB did not group most closely with the UreC proteins from other β-proteobacteria. Instead, it appears that urease in β-proteobacterial autotrophic ammonia oxidizers is the product of divergent evolution in the common ancestor of γ- and β-proteobacteria that was initiated before their divergence during speciation. Sequence motifs conserved for the proteobacteria and variable regions possibly

  19. RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

    SciTech Connect

    Sheren, Jamie E.; Kassenbrock, C. Kenneth


    Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequence (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.

  20. Genes encoding homologous antigens in taeniid cestode parasites

    PubMed Central

    Gauci, Charles; Lightowlers, Marshall W.


    Recombinant vaccine antigens are being evaluated for their ability to protect livestock animals against cysticercosis and related parasitic infections. Practical use of some of these vaccines is expected to reduce parasite transmission, leading to a reduction in the incidence of neurocysticercosis and hydatid disease in humans. We recently showed that an antigen (TSOL16), expressed in Escherichia coli, confers high levels of protection against Taenia solium cysticercosis in pigs, which provides a strategy for control of T. solium parasite transmission. Here, we discuss the characteristics of this antigen that may affect the utility of TSOL16 and related antigens for development as recombinant vaccines. We also report that genes encoding antigens closely related to TSOL16 from T. solium also occur in other related species of parasites. These highly homologous antigens have the potential to be used as vaccines and may provide protection against related species of Taenia that cause infection in other hosts. PMID:23090389

  1. Flower-enhanced expression of a nuclear-encoded mitochondrial respiratory protein is associated with changes in mitochondrion number.

    PubMed Central

    Huang, J; Struck, F; Matzinger, D F; Levings, C S


    The mitochondrial Rieske iron-sulfur protein is an obligatory component of the respiratory electron transport chain that is encoded by a single-copy gene in mammals and fungi. In contrast, this protein is encoded by a small gene family in dicotyledonous tobacco and monocotyledonous maize. We cloned four cDNAs from tobacco that encode the mitochondrial Rieske iron-sulfur protein. These clones, along with a previously isolated cDNA, represent five independent members of the gene family that can be divided into three subfamilies. All of these genes were derived from the two progenitor species and were expressed in amphidiploid tobacco. The proteins encoded by these five genes are probably functional because they all contain the universally conserved hexyl peptides necessary for the 2Fe-2S cluster formation. The expression of the Rieske protein gene family is differentially regulated; a 6- to 11-fold higher level of steady state transcripts was found in flowers than in leaves, stems, and roots. Members of at least two subfamilies were preferentially expressed in flowers, indicating that they share a common cis-regulatory element(s), which can respond to a flower-specific signal(s). Although approximately 10 times more transcripts occurred in flowers than in leaves, flower and leaf mitochondria contained a similar amount of the Rieske protein. Flowers, however, contained seven times more Rieske proteins than leaves. These results indicated an increase in mitochondrion number in flowers. High-energy demands during anther development might bring about an increase in mitochondrion numbers in flowers and the flower-enhanced expression of the Rieske protein gene family. Our results suggested that nuclear genes encoding mitochondrial respiratory proteins could sense and respond to changes in energy metabolism and/or changes in mitochondrion numbers. PMID:8180500

  2. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    SciTech Connect

    Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.; Kim, Seong Kee


    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  3. Genome-wide analysis of NBS-encoding disease resistance genes in Cucumis sativus and phylogenetic study of NBS-encoding genes in Cucurbitaceae crops

    PubMed Central


    Background Plant nucleotide-binding site (NBS)-leucine-rich repeat (LRR) proteins encoded by resistance genes play an important role in the responses of plants to various pathogens, including viruses, bacteria, fungi, and nematodes. In this study, a comprehensive analysis of NBS-encoding genes within the whole cucumber genome was performed, and the phylogenetic relationships of NBS-encoding resistance gene homologues (RGHs) belonging to six species in five genera of Cucurbitaceae crops were compared. Results Cucumber has relatively few NBS-encoding genes. Nevertheless, cucumber maintains genes belonging to both Toll/interleukine-1 receptor (TIR) and CC (coiled-coil) families. Eight commonly conserved motifs have been established in these two families which support the grouping into TIR and CC families. Moreover, three additional conserved motifs, namely, CNBS-1, CNBS-2 and TNBS-1, have been identified in sequences from CC and TIR families. Analyses of exon/intron configurations revealed that some intron loss or gain events occurred during the structural evolution between the two families. Phylogenetic analyses revealed that gene duplication, sequence divergence, and gene loss were proposed as the major modes of evolution of NBS-encoding genes in Cucurbitaceae species. Compared with NBS-encoding sequences from the Arabidopsis thaliana genome, the remaining seven TIR familes of NBS proteins and RGHs from Cucurbitaceae species have been shown to be phylogenetically distinct from the TIR family of NBS-encoding genes in Arabidopsis, except for two subfamilies (TIR4 and TIR9). On the other hand, in the CC-NBS family, they grouped closely with the CC family of NBS-encoding genes in Arabidopsis. Thus, the NBS-encoding genes in Cucurbitaceae crops are shown to be ancient, and NBS-encoding gene expansions (especially the TIR family) may have occurred before the divergence of Cucurbitaceae and Arabidopsis. Conclusion The results of this paper will provide a genomic framework

  4. The exception proves the rule? Dual targeting of nuclear-encoded proteins into endosymbiotic organelles.


    Baudisch, Bianca; Langner, Uwe; Garz, Ingo; Klösgen, Ralf Bernd


    Plant cells harbor two types of endosymbiotic organelle: mitochondria and chloroplasts. As a consequence of endosymbiotic gene transfer, the majority of their proteins are encoded in the nucleus and post-translationally 're'-imported into the respective target organelle. The corresponding transport signals are usually selective for a single organelle, but several proteins are transported into both the mitochondria and chloroplasts. To estimate the number of proteins with such dual targeting properties in Arabidopsis, we classified the proteins encoded by nuclear genes of endosymbiotic origin according to the respective targeting specificity of their N-terminal transport signals as predicted by the TargetP software package. Selected examples of the resulting protein classes were subsequently analyzed by transient transformation assays as well as by in organello protein transport experiments. It was found that most proteins with high prediction values for both organelles show dual targeting with both experimental approaches. Unexpectedly, however, dual targeting was even found among those proteins that are predicted to be localized solely in one of the two endosymbiotic organelles. In total, among the 16 candidate proteins analyzed, we identified 10 proteins with dual targeting properties. This unexpectedly high proportion suggests that such transport properties are much more abundant than anticipated.

  5. A ubiquitous plant housekeeping gene, PAP, encodes a major protein component of bell pepper chromoplasts.


    Pozueta-Romero, J; Rafia, F; Houlné, G; Cheniclet, C; Carde, J P; Schantz, M L; Schantz, R


    We have isolated a cDNA (PAP) corresponding to a single nuclear gene that encodes an approximately 30-kD major protein of bell pepper (Capsicum annuum L.) fruit chromoplasts. RNA and protein analyses revealed that, although at a low level, this gene is also expressed in every organ of the plant, the amount of the corresponding transcript and protein dramatically increasing in the latter stages of fruit development. Western-blot and immunocytochemical analyses of purified chloroplasts from leaves and fruits and of chromoplasts from red fruits showed that the encoded protein is the major component of plastoglobules and fibrils and is localized on the outer surface of these lipid structures. Analyses of PAP in plants belonging to different taxa revealed that it is expressed and highly conserved in both monocotyledonous and dicotyledonous plants. The presence of the protein in plastids not differentiating into chromoplasts indicates that PAP is expressed irrespective of the ontogeny of various plastid lines. In light of our results and since the encoded protein, identical to that previously named ChrB or fibrillin, is present in plastoglobules from several species and accumulates in the fibrils of bell pepper chromoplast, we propose to designate it as a plastid-lipid-associated protein.

  6. Cloning of two genes encoding Rab7 in Paramecium.


    Surmacz, Liliana; Wiejak, Jolanta; Wyroba, Elzbieta


    Rab7 is a small GTPase that plays a crucial role in the regulation of transport from early to late endosomes and lysosomes, phagosome maturation and in lysosomal biogenesis in mammalian cells. It contains conserved and unique sequence elements that mediate its function. Two Rab7 genes, Rab7a (703 bp) and Rab7b (707 bp) were identified in the unicellular eukaryote Paramecium by PCR amplification. They contain three short introns of different lengths (28-32 bp) and sequence located at identical positions in both genes. The presence of two Rab7 genes in the Paramecium genome was confirmed by Southern hybridization analysis performed with six different restriction enzymes. Expression of both genes was assessed by Northern blot and RT-PCR. Two transcripts of 1.8 and 2.2 kb were identified by hybridization analysis. The cloned complementary DNAs, both of 618 nucleotides in length, encode polypeptides of 206 amino acids that are 97.6% identical and differ in their C-termini. The predicted protein sequences of Rab7a and Rab7b contain all characteristic domains essential for Rab function: the effector domain (YRATVGADF) and four GTP-binding consensus sequences (GDSGVGKT, WDTAGQ, NKLD, SAK) as well as the prenylation motif (-CC) at the C-terminus indispensable for Rab binding to the membrane. Similarity searches revealed 81.6-82.1% homology of Paramecium Rab7 isoforms to human Rab7 and a lack of an insert typical for the Kinetoplastida - the species that appeared earlier in evolution. Paramecium is the first free-living lower eukaryote in which homologues of Rab7 have been identified that exhibit features similar to those of mammalian Rab7.

  7. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica


    Jarvis, E.E.; Roessler, P.G.


    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities. 8 figs.

  8. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica


    Jarvis, Eric E.; Roessler, Paul G.


    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  9. The limits of nuclear encoded SSU rDNA for resolving the diatom phylogeny

    PubMed Central

    Theriot, Edward C.; Cannone, Jamie J.; Gutell, Robin R.; Alverson, Andrew J.


    A recent reclassification of diatoms based on phylogenies recovered using the nuclear-encoded SSU rRNA gene contains three major classes, Coscinodiscophyceae, Mediophyceae and the Bacillariophyceae (the CMB hypothesis). We evaluated this with a sequence alignment of 1336 protist and heterokont algae SSU rRNAs, which includes 673 diatoms. Sequences were aligned to maintain structural elements conserved within this dataset. Parsimony analysis rejected the CMB hypothesis, albeit weakly. Morphological data are also incongruent with this recent CMB hypothesis of three diatom clades. We also reanalyzed a recently published dataset which purports to support the CMB hypothesis. Our reanalysis found that the original analysis had not converged on the true bipartition posterior probability distribution, and rejected the CMB hypothesis. Thus we conclude that a reclassification of the evolutionary relationships of the diatoms according to the CMB hypothesis is premature. PMID:20224747

  10. Developmental Regulation of Genes Encoding Universal Stress Proteins in Schistosoma mansoni.


    Isokpehi, Raphael D; Mahmud, Ousman; Mbah, Andreas N; Simmons, Shaneka S; Avelar, Lívia; Rajnarayanan, Rajendram V; Udensi, Udensi K; Ayensu, Wellington K; Cohly, Hari H; Brown, Shyretha D; Dates, Centdrika R; Hentz, Sonya D; Hughes, Shawntae J; Smith-McInnis, Dominique R; Patterson, Carvey O; Sims, Jennifer N; Turner, Kelisha T; Williams, Baraka S; Johnson, Matilda O; Adubi, Taiwo; Mbuh, Judith V; Anumudu, Chiaka I; Adeoye, Grace O; Thomas, Bolaji N; Nashiru, Oyekanmi; Oliveira, Guilherme


    The draft nuclear genome sequence of the snail-transmitted, dimorphic, parasitic, platyhelminth Schistosoma mansoni revealed eight genes encoding proteins that contain the Universal Stress Protein (USP) domain. Schistosoma mansoni is a causative agent of human schistosomiasis, a severe and debilitating Neglected Tropical Disease (NTD) of poverty, which is endemic in at least 76 countries. The availability of the genome sequences of Schistosoma species presents opportunities for bioinformatics and genomics analyses of associated gene families that could be targets for understanding schistosomiasis ecology, intervention, prevention and control. Proteins with the USP domain are known to provide bacteria, archaea, fungi, protists and plants with the ability to respond to diverse environmental stresses. In this research investigation, the functional annotations of the USP genes and predicted nucleotide and protein sequences were initially verified. Subsequently, sequence clusters and distinctive features of the sequences were determined. A total of twelve ligand binding sites were predicted based on alignment to the ATP-binding universal stress protein from Methanocaldococcus jannaschii. In addition, six USP sequences showed the presence of ATP-binding motif residues indicating that they may be regulated by ATP. Public domain gene expression data and RT-PCR assays confirmed that all the S. mansoni USP genes were transcribed in at least one of the developmental life cycle stages of the helminth. Six of these genes were up-regulated in the miracidium, a free-swimming stage that is critical for transmission to the snail intermediate host. It is possible that during the intra-snail stages, S. mansoni gene transcripts for universal stress proteins are low abundant and are induced to perform specialized functions triggered by environmental stressors such as oxidative stress due to hydrogen peroxide that is present in the snail hemocytes. This report serves to catalyze the

  11. Developmental Regulation of Genes Encoding Universal Stress Proteins in Schistosoma mansoni.


    Isokpehi, Raphael D; Mahmud, Ousman; Mbah, Andreas N; Simmons, Shaneka S; Avelar, Lívia; Rajnarayanan, Rajendram V; Udensi, Udensi K; Ayensu, Wellington K; Cohly, Hari H; Brown, Shyretha D; Dates, Centdrika R; Hentz, Sonya D; Hughes, Shawntae J; Smith-McInnis, Dominique R; Patterson, Carvey O; Sims, Jennifer N; Turner, Kelisha T; Williams, Baraka S; Johnson, Matilda O; Adubi, Taiwo; Mbuh, Judith V; Anumudu, Chiaka I; Adeoye, Grace O; Thomas, Bolaji N; Nashiru, Oyekanmi; Oliveira, Guilherme


    The draft nuclear genome sequence of the snail-transmitted, dimorphic, parasitic, platyhelminth Schistosoma mansoni revealed eight genes encoding proteins that contain the Universal Stress Protein (USP) domain. Schistosoma mansoni is a causative agent of human schistosomiasis, a severe and debilitating Neglected Tropical Disease (NTD) of poverty, which is endemic in at least 76 countries. The availability of the genome sequences of Schistosoma species presents opportunities for bioinformatics and genomics analyses of associated gene families that could be targets for understanding schistosomiasis ecology, intervention, prevention and control. Proteins with the USP domain are known to provide bacteria, archaea, fungi, protists and plants with the ability to respond to diverse environmental stresses. In this research investigation, the functional annotations of the USP genes and predicted nucleotide and protein sequences were initially verified. Subsequently, sequence clusters and distinctive features of the sequences were determined. A total of twelve ligand binding sites were predicted based on alignment to the ATP-binding universal stress protein from Methanocaldococcus jannaschii. In addition, six USP sequences showed the presence of ATP-binding motif residues indicating that they may be regulated by ATP. Public domain gene expression data and RT-PCR assays confirmed that all the S. mansoni USP genes were transcribed in at least one of the developmental life cycle stages of the helminth. Six of these genes were up-regulated in the miracidium, a free-swimming stage that is critical for transmission to the snail intermediate host. It is possible that during the intra-snail stages, S. mansoni gene transcripts for universal stress proteins are low abundant and are induced to perform specialized functions triggered by environmental stressors such as oxidative stress due to hydrogen peroxide that is present in the snail hemocytes. This report serves to catalyze the

  12. The Serratia marcescens bioH gene encodes an esterase.


    Akatsuka, Hiroyuki; Kawai, Eri; Sakurai, Naoki; Omori, Kenji


    The 3.9 kb chromosomal DNA was cloned from Serratia marcescens Sr41, which confers on Escherichia coli cells a phenotype of clear halo formation on tributyrin agar plates. Three complete open reading frames (ORFs) were identified in the inserted DNA, and one ORF was demonstrated to encode a 28 kDa protein of 255 amino acids related to esterase activity. Interestingly, the ORF was 70% identical to a product of the E. coli bioH gene, which lies at a locus separated from the bioABFCD operon and acts in the early steps of the biotin synthetic pathway before pimeloyl-CoA synthesis. This gene complemented a bioH-deficient mutation of E. coli. From the sequence analysis, BioH is presumed to be a serine hydrolase, which belongs to the alpha/beta hydrolase-fold family comprising a wide variety of hydrolases including esterases. A catalytic triad composed of a nucleophilic residue (Ser80), an acidic residue (Asp206), and histidine (His234) was conserved in BioH, and the nucleophilic residue Ser, a catalytic center, was situated in the consensus sequence of G-X-S-X-G-G, a nucleophile elbow. Although the enzymatic function of BioH is not yet elucidated, the bioH gene products from S. marcescens and E. coli show esterase activity, which may imply the hydrolysis of a precursor leading to pimeloyl-CoA ester. The esterase activity of BioH and its CoA binding activity recently reported agree with a current hypothesis of pimeloyl-CoA ester synthesis from CoA and acylester derivatives including an acyl-carrier protein.

  13. Sequence and structure of the extrachromosomal palindrome encoding the ribosomal RNA genes in Dictyostelium.


    Sucgang, Richard; Chen, Guokai; Liu, Wen; Lindsay, Ryan; Lu, Jing; Muzny, Donna; Shaulsky, Gad; Loomis, William; Gibbs, Richard; Kuspa, Adam


    Ribosomal RNAs (rRNAs) are encoded by multicopy families of identical genes. In Dictyostelium and other protists, the rDNA is carried on extrachromosomal palindromic elements that comprise up to 20% of the nuclear DNA. We present the sequence of the 88 kb Dictyostelium rDNA element, noting that the rRNA genes are likely to be the only transcribed regions. By interrogating a library of ordered YAC clones, we provide evidence for a chromosomal copy of the rDNA on chromosome 4. This locus may provide master copies for the stable transmission of the extrachromosomal elements. The extrachromosomal elements were also found to form chromosome-sized clusters of DNA within nuclei of nocodazole-treated cells arrested in mitosis. These clusters resemble true chromosomes and may allow the efficient segregation of the rDNA during mitosis. These rDNA clusters may also explain the cytological observations of a seventh chromosome in this organism.

  14. A 47-kDa human nuclear protein recognized by antikinetochore autoimmune sera is homologous with the protein encoded by RCC1, a gene implicated in onset of chromosome condensation.

    PubMed Central

    Bischoff, F R; Maier, G; Tilz, G; Ponstingl, H


    Several autoimmune sera from patients with Raynaud phenomenon decorated mammalian kinetochores and bound to a 47-kDa protein on immunoblots of nuclear lysates. Antibody affinity-purified from immunoblots of the 47-kDa band recognized kinetochores, but due to crossreaction with an 18-kDa protein, localization remains elusive. We used one of these sera to purify the antigen from HeLa cells synchronized in mitosis as a noncovalent complex with a 25-kDa protein. The antigen was released from DNA by intercalation with 25 mM chloroquine. Ion-exchange chromatography yielded the pure complex with an apparent molecular size of 68 kDa, which was separated into its components by gel filtration in 6 M guanidinium chloride. Upon two-dimensional gel electrophoresis the 47-kDa protein gave two main spots of pI 6.6 and 6.7, respectively. Posttranslational modification is indicated by additional antigenic spots, by lack of a free alpha-amino group, and by chromatographic behavior of peptides on reversed-phase chromatography. The amino acid sequence for 205 residues of the 47-kDa protein has been established. This sequence is highly homologous with the translated reading frame of RCC1, a gene reportedly involved in regulating onset of mammalian chromosome condensation. Images PMID:2236072

  15. Genomic organization of the human NSP gene, prototype of a novel gene family encoding reticulons

    SciTech Connect

    Roebroek, A.J.M.; Ayoubi, T.A.Y.; Velde, H.J.K. van de; Schoenmakers, E.F.P.M.; Pauli, I.G.L.; Van De Ven, W.J.M.


    Recently, cDNA cloning and expression of three mRNA variants of the human NSP gene were described. This neuroendocrine-specific gene encodes three NSP protein isoforms with unique amino-terminal parts, but common carboxy-terminal parts. The proteins, with yet unknown function, are associated with the endoplasmic reticulum and therefore are named NSP reticulons. Potentially, these proteins are neuroendocrine markers of a novel category in human lung cancer diagnosis. Here, the genomic organization of this gene was studied by analysis of genomic clones isolated from lambda phage and YAC libraries. The NSP exons were found to be dispersed over a genomic region of about 275 kb. The present elucidation of the genomic organization of the NSP gene explains the generation of NSP mRNA variants encoding NSP protein isoforms. Multiple promoters rather than alternative splicing of internal exons seem to be involved in this diversity. Furthermore, comparison of NSP genomic and cDNA sequences with databank nucleotide sequences resulted in the discovery of other human members of this novel family of reticulons encoding genes. 25 refs., 4 figs.

  16. A cysteine protease encoded by the baculovirus Bombyx mori nuclear polyhedrosis virus.

    PubMed Central

    Ohkawa, T; Majima, K; Maeda, S


    Sequence analysis of the BamHI F fragment of the genome of Bombyx mori nuclear polyhedrosis virus (BmNPV) revealed an open reading frame whose deduced amino acid sequence had homology to those of cysteine proteases of the papain superfamily. The putative cysteine protease sequence (BmNPV-CP) was 323 amino acids long and showed 35% identity to a cysteine proteinase precursor from Trypanosoma brucei. Of 36 residues conserved among cathepsins B, H, L, and S and papain, 31 were identical in BmNPV-CP. In order to determine the activity and function of the putative cysteine protease, a BmNPV mutant (BmCysPD) was constructed by homologous recombination of the protease gene with a beta-galactosidase gene cassette. BmCysPD-infected BmN cell extracts were significantly reduced in acid protease activity compared with wild-type virus-infected cell extracts. The cysteine protease inhibitor E-64 [trans-epoxysuccinylleucylamido-(4-guanidino)butane] inhibited wild-type virus-expressed protease activity. Deletion of the cysteine protease gene had no significant effect on viral growth or polyhedron production in BmN cells, indicating that the cysteine protease was not essential for viral replication in vitro. However, B. mori larvae infected with BmCysPD showed symptoms different from those of wild-type BmNPV-infected larvae, e.g., less degradation of the body, including fat body cells, white body surface color due presumably to undegraded epidermal cells, and an increase in the number of polyhedra released into the hemolymph. This is the first report of (i) a virus-encoded protease with activity on general substrates and (ii) evidence that a virus-encoded protease may play a role in degradation of infected larvae to facilitate horizontal transmission of the virus. Images PMID:8083997

  17. Nuclear gene targeting in Chlamydomonas as exemplified by disruption of the PHOT gene.


    Zorin, Boris; Lu, Yinghong; Sizova, Irina; Hegemann, Peter


    Chlamydomonas reinhardtii is the most powerful photosynthetic eukaryotic unicellular model organism. However, its potential is not fully exploitable since as in most green plants specific targeting of nuclear genes is not routinely possible. Recently, we have shown by repair of an introduced truncated model gene that transformation of Chlamydomonas with single stranded DNA greatly suppresses random integration of the DNA in the genome whereas homologous recombination (HR) is left unchanged. However, endogenous genes still could not be targeted. Here we present optimized transformation conditions that further improved HR and suppressed non-homologous DNA integration (NHI). The improved transformation strategy allowed us now to specifically inactivate in two different Chlamydomonas strains the nuclear PHOT gene, which encodes for the blue light photoreceptor phototropin (PHOT). The option to target moderately expressed Chlamydomonas nuclear genes with high efficiency now further improves the utility of this this alga for basic science and biotechnology.

  18. The maize brittle 1 gene encodes amyloplast membrane polypeptides.


    Sullivan, T D; Kaneko, Y


    A chimeric protein, formed of 56 amino acids from the carboxy terminus of the maize (Zea mays L.) wild-type Brittle1 (Bt1) protein fused to the glutathione-S-transferase gene, was synthesized in Escherichia coli, and used to raise antibodies. Following affinity purification, the antibodies recognized a set of 38- to 42-kDa proteins in endosperm from wild-type Bt1 plants, as well as from brittle2, shrunken2 and sugary1 plants, but not in mutant bt1 endosperm. Bt1 proteins were not detected with the preimmune antibodies. A low level of Bt1-specific proteins was detected at 10 d after pollination (DAP) and increased to a plateau at 16 DAP. At the same time, the ratio of slow- to fast-migrating forms of the protein decreased. During endosperm fractionation by differential centrifugation and membrane sedimentation in sucrose gradients, the Bt1 proteins co-purified with the carotenoid-containing plastid membranes. They were localized to amyloplasts by electron-microscopic immunocytochemistry; most of the signal was detected at the plastid periphery. These results are consistent with predictions made from the deduced amino-acid sequence and previous in-vitro experiments that the bt1 locus encodes amyloplast membrane proteins. PMID:7647682

  19. [Association of schizophrenia with variations in genes encoding transcription factors].


    Boyajyan, A S; Atshemyan, S A; Zakharyan, R V


    Alterations in neuronal plasticity and immune system play a key role in pathogenesis of schizophrenia. Identification of genetic factors contributing to these alterations will significantly encourage elucidation of molecular etiopathomechanisms of this disorder. Transcription factors c-Fos, c-Jun, and Ier5 are the important regulators of neuronal plasticity and immune response. In the present work we investigated a potential association of schizophrenia with a number of single nucleotide polymorphisms of c-Fos-,c-Jun and Ier5 encoding genes (FOS, JUN, and IER5 respectively). Genotyping of DNA samples of patients with schizophrenia and healthy individuals was performed using polymerase chain reaction with allele specific primers. The results obtained demonstrated association between schizophrenia and FOS rs1063169, FOS rs7101, JUN rs11688, and IER5 rs6425663 polymorphisms. Namely, it was found that the inheritance of FOS rs1063169*T, JUN rs11688*A, and IER5 rs6425663*T minor variants decreases risk for development of schizophrenia whereas the inheritance of FOS rs7101*T minor variant, especially its homozygous form, increases risk for development of this disorder.

  20. Expression cloning of genes encoding human peroxisomal proteins

    SciTech Connect

    Spathaky, J.M.; Tate, A.W.; Cox, T.M.


    Numerous metabolic disorders associated with diverse peroxisomal defects have been identified but their molecular characterization has been hampered by difficulties associated with the purification of proteins from this fragile organelle. We have utilized antibodies directed against the C-terminal tripeptide peroxisomal targeting signal to detect hitherto unknown peroxisomal proteins in tissue fractions and to isolate genes encoding peroxisonal proteins from human expression libraries. We immunized rabbits with a peptide conjugate encompassing the C-terminal nine amino acids of rat peroxisomal acyl CoA oxidase. Immunoprecipitation assays using radio-labelled peptide showed that the antibody specifically recognizes the terminal SKL motif as well as C-terminal SHL and SRL but not SHL at an internal position. Affinity-purified antibody was used to probe Western blots of crude and peroxisome-enriched monkey liver preparations and detected 8-10 proteins specifically in the peroxisome fractions. 100 positive clones were identified on screening a human liver cDNA expression library in {lambda}-gt11. Sequence analysis has confirmed the identity of cDNA clones for human acyl CoA oxidase and epoxide hydrolase. Four clones show no sequence identity and their putative role in the human peroxisome is being explored.

  1. The maize brittle 1 gene encodes amyloplast membrane polypeptides.


    Sullivan, T D; Kaneko, Y


    A chimeric protein, formed of 56 amino acids from the carboxy terminus of the maize (Zea mays L.) wild-type Brittle1 (Bt1) protein fused to the glutathione-S-transferase gene, was synthesized in Escherichia coli, and used to raise antibodies. Following affinity purification, the antibodies recognized a set of 38- to 42-kDa proteins in endosperm from wild-type Bt1 plants, as well as from brittle2, shrunken2 and sugary1 plants, but not in mutant bt1 endosperm. Bt1 proteins were not detected with the preimmune antibodies. A low level of Bt1-specific proteins was detected at 10 d after pollination (DAP) and increased to a plateau at 16 DAP. At the same time, the ratio of slow- to fast-migrating forms of the protein decreased. During endosperm fractionation by differential centrifugation and membrane sedimentation in sucrose gradients, the Bt1 proteins co-purified with the carotenoid-containing plastid membranes. They were localized to amyloplasts by electron-microscopic immunocytochemistry; most of the signal was detected at the plastid periphery. These results are consistent with predictions made from the deduced amino-acid sequence and previous in-vitro experiments that the bt1 locus encodes amyloplast membrane proteins.

  2. Inactivation of the Neurospora Crassa Gene Encoding the Mitochondrial Protein Import Receptor Mom19 by the Technique of ``sheltered Rip''

    PubMed Central

    Harkness, TAA.; Metzenberg, R. L.; Schneider, H.; Lill, R.; Neupert, W.; Nargang, F. E.


    We have used a technique referred to as ``sheltered RIP'' (repeat induced point mutation) to create mutants of the mom-19 gene of Neurospora crassa, which encodes an import receptor for nuclear encoded mitochondrial precursor proteins. Sheltered RIP permits the isolation of a mutant gene in one nucleus, even if that gene is essential for the survival of the organism, by sheltering the nucleus carrying the mutant gene in a heterokaryon with an unaffected nucleus. Furthermore, the nucleus harboring the RIPed gene contains a selectable marker so that it is possible to shift nuclear ratios in the heterokaryons to a state in which the nucleus containing the RIPed gene predominates in cultures grown under selective conditions. This results in a condition where the target gene product should be present at very suboptimal levels and allows the study of the mutant phenotype. One allele of mom-19 generated by this method contains 44 transitions resulting in 18 amino acid substitutions. When the heterokaryon containing this allele was grown under conditions favoring the RIPed nucleus, no MOM19 protein was detectable in the mitochondria of the strain. Homokaryotic strains containing the RIPed allele exhibit a complex and extremely slow growth phenotype suggesting that the product of the mom-19 gene is important in N. crassa. PMID:8138148

  3. (Genetic engineering with a gene encoding a soybean storage protein). Progress report

    SciTech Connect

    Beachy, R.N.


    Progress is reported on research directed toward introducing a gene (Gmg 17.1) encoding the ..cap alpha..'-subunit of ..beta..-conglycinin, a soybean seed protein, into petunia plants using gene transfer mechanisms. (ACR)

  4. Tracing the origin and evolution of plant TIR-encoding genes.


    Sun, Xiaoqin; Pang, Hui; Li, Mimi; Chen, Jianqun; Hang, Yueyu


    Toll-interleukin-1 receptor (TIR)-encoding proteins represent one of the most important families of disease resistance genes in plants. Studies that have explored the functional details of these genes tended to focus on only a few limited groups; the origin and evolutionary history of these genes were therefore unclear. In this study, focusing on the four principal groups of TIR-encoding genes, we conducted an extensive genome-wide survey of 32 fully sequenced plant genomes and Expressed Sequence Tags (ESTs) from the gymnosperm Pinus taeda and explored the origins and evolution of these genes. Through the identification of the TIR-encoding genes, the analysis of chromosome positions, the identification and analysis of conserved motifs, and sequence alignment and phylogenetic reconstruction, our results showed that the genes of the TIR-X family (TXs) had an earlier origin and a wider distribution than the genes from the other three groups. TIR-encoding genes experienced large-scale gene duplications during evolution. A skeleton motif pattern of the TIR domain was present in all spermatophytes, and the genes with this skeleton pattern exhibited a conserved and independent evolutionary history in all spermatophytes, including monocots, that followed their gymnosperm origin. This study used comparative genomics to explore the origin and evolutionary history of the four main groups of TIR-encoding genes. Additionally, we unraveled the mechanism behind the uneven distribution of TIR-encoding genes in dicots and monocots.

  5. Molecular cloning and characterization of a Bombyx mori gene encoding the transcription factor Atonal.


    Hu, Ping; Feng, Fan; Xia, Hengchuan; Chen, Liang; Yao, Qin; Chen, Keping


    The atonal genes are an evolutionarily conserved group of genes encoding regulatory basic helix-loop-helix (bHLH) transcription factors. These transcription factors have a critical antioncogenic function in the retina, and are necessary for cell fate determination through the regulation of the cell signal pathway. In this study, the atonal gene was cloned from Bombyx mori, and the transcription factor was named BmAtonal. Sequence analysis showed that the BmAtonal protein shares extensive homology with other invertebrate Atonal proteins with the bHLH motif. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analyses revealed that BmAtonal was expressed in all developmental stages of B. mori and various larval tissues. The BmAtonal protein was expressed in Escherichia coli, and polyclonal antibodies were raised against the purified protein. By immunofluorescence, the BmAtonal protein was localized to both the nucleus and cytoplasm of BmN cells. After knocking out nuclear localization signals (NLS), the BmAtonal protein was only detected in the cytoplasm. In addition, using the B. mori nuclear polyhedrosis virus (BmNPV) baculovirus expression system, the recombinant BmAtonal protein was successfully expressed in the B. mori cell line BmN. This work lays the foundation for exploring the biological functions of the BmAtonal protein, such as identifying its potential binding partners and understanding the molecular control of the formation of sensory organs. PMID:24873037

  6. Cell type-specific transcriptional regulation of the gene encoding importin-{alpha}1

    SciTech Connect

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro


    Importin-{alpha}1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: {yields} We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. {yields} NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. {yields} Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  7. Rubisco in marine symbiotic dinoflagellates: form II enzymes in eukaryotic oxygenic phototrophs encoded by a nuclear multigene family.


    Rowan, R; Whitney, S M; Fowler, A; Yellowlees, D


    Genes encoding ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) were cloned from dinoflagellate symbionts (Symbiodinium spp) of the giant clam Tridacna gigas and characterized. Strikingly, Symbiodinium Rubisco is completely different from other eukaryotic (form I) Rubiscos: it is a form II enzyme that is approximately 65% identical to Rubisco from Rhodospirillum rubrum (Rubisco forms I and II are approximately 25 to 30% identical); it is nuclear encoded by a multigene family; and the predominantly expressed Rubisco is encoded as a precursor polyprotein. One clone appears to contain a predominantly expressed Rubisco locus (rbcA), as determined by RNA gel blot analysis of Symbiodinium RNA and sequencing of purified Rubisco protein. Another contains an enigmatic locus (rbcG) that exhibits an unprecedented pattern of amino acid replacement but does not appear to be a pseudogene. The expression of rbcG has not been analyzed; it was detected only in the minor of two taxa of Symbiodinium that occur together in T. gigas. This study confirms and describes a previously unrecognized branch of Rubisco's evolution: a eukaryotic form II enzyme that participates in oxygenic photosynthesis and is encoded by a diverse, nuclear multigene family.

  8. Species-specific duplications of NBS-encoding genes in Chinese chestnut (Castanea mollissima)

    PubMed Central

    Zhong, Yan; Li, Yingjun; Huang, Kaihui; Cheng, Zong-Ming


    The disease resistance (R) genes play an important role in protecting plants from infection by diverse pathogens in the environment. The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) class of genes is one of the largest R gene families. Chinese chestnut (Castanea mollissima) is resistant to Chestnut Blight Disease, but relatively little is known about the resistance mechanism. We identified 519 NBS-encoding genes, including 374 NBS-LRR genes and 145 NBS-only genes. The majority of Ka/Ks were less than 1, suggesting the purifying selection operated during the evolutionary history of NBS-encoding genes. A minority (4/34) of Ka/Ks in non-TIR gene families were greater than 1, showing that some genes were under positive selection pressure. Furthermore, Ks peaked at a range of 0.4 to 0.5, indicating that ancient duplications arose during the evolution. The relationship between Ka/Ks and Ks indicated greater selective pressure on the newer and older genes with the critical value of Ks = 0.4–0.5. Notably, species-specific duplications were detected in NBS-encoding genes. In addition, the group of RPW8-NBS-encoding genes clustered together as an independent clade located at a relatively basal position in the phylogenetic tree. Many cis-acting elements related to plant defense responses were detected in promoters of NBS-encoding genes. PMID:26559332

  9. A nuclear-encoded protein of prokaryotic origin is essential for the stability of photosystem II in Arabidopsis thaliana.

    PubMed Central

    Meurer, J; Plücken, H; Kowallik, K V; Westhoff, P


    To understand the regulatory mechanisms underlying the biogenesis of photosystem II (PSII) we have characterized the nuclear mutant hcf136 of Arabidopsis thaliana and isolated the affected gene. The mutant is devoid of any photosystem II activity, and none of the nuclear- and plastome-encoded subunits of this photosystem accumulate to significant levels. Protein labelling studies in the presence of cycloheximide showed that the plastome-encoded PSII subunits are synthesized but are not stable. The HCF136 gene was isolated by virtue of its T-DNA tag, and its identity was confirmed by complementation of homozygous hcf136 seedlings. Immunoblot analysis of fractionated chloroplasts showed that the HCF136 protein is a lumenal protein, found only in stromal thylakoid lamellae. The HCF136 protein is produced already in dark-grown seedlings and its levels do not increase dramatically during light-induced greening. This accumulation profile confirms the mutational data by showing that the HCF136 protein must be present when PSII complexes are made. HCF136 homologues are found in the cyanobacterium Synechocystis species PCC6803 (slr2034) and the cyanelle genome of Cyanophora paradoxa (ORF333), but are lacking in the plastomes of chlorophytes and metaphytes as well as from those of rhodo- and chromophytes. We conclude that HCF136 encodes a stability and/or assembly factor of PSII which dates back to the cyanobacterial-like endosymbiont that led to the plastids of the present photosynthetic eukaryotes. PMID:9736608

  10. DNA sequence of a gene encoding a BALB/c mouse Ld transplantation antigen.


    Moore, K W; Sher, B T; Sun, Y H; Eakle, K A; Hood, L


    The sequence of a gene, denoted 27.5, encoding a transplantation antigen for the BALB/c mouse has been determined. Gene transfer studies and comparison of the translated sequence with the partial amino acid sequence of the Ld transplantation antigen establish that gene 27.5 encodes an Ld polypeptide. A comparison of the gene 27.5 sequence with several complementary DNA sequences suggests that the BALB/c mouse may contain a number of closely related L-like genes. Gene 27.5 has eight exons that correlate with the structural domains of the transplantation antigen. PMID:7058332

  11. A rhomboid gene controls speciation through regulation of nuclear-mitochondrial compatibility in Triticum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The nuclear encoded species cytoplasm specific (scs) genes control nuclear-cytoplasmic compatibility in Triticum. Alloplasmic cells, which have nucleus and cytoplasm derived from different species, produce vigorous and vital organisms only when the correct version of scs is present in their nucleus....

  12. SurfaceomeDB: a cancer-orientated database for genes encoding cell surface proteins

    PubMed Central

    de Souza, Jorge Estefano Santana; Galante, Pedro Alexandre Favoretto; de Almeida, Renan Valieris Bueno; da Cunha, Julia Pinheiro Chagas; Ohara, Daniel Takatori; Ohno-Machado, Lucila; Old, Lloyd J.; de Souza, Sandro José


    Cell surface proteins (CSPs) are excellent targets for the development of diagnostic and therapeutic reagents, and it is estimated that 10–20% of all genes in the human genome encode CSPs. In an effort to integrate all data publicly available for genes encoding cell surface proteins, a database (SurfaceomeDB) was developed. SurfaceomeDB is a gene-centered portal containing different types of information, including annotation for gene expression, protein domains, somatic mutations in cancer, and protein-protein interactions for all human genes encoding CSPs. SurfaceomeDB was implemented as an integrative and relational database in a user-friendly web interface, where users can search for gene name, gene annotation, or keywords. There is also a streamlined graphical representation of all data provided and links to the most important data repositories and databases, such as NCBI, UCSC Genome Browser, and EBI. PMID:23390370

  13. Genome-wide identification of NBS-encoding resistance genes in Brassica rapa.


    Mun, Jeong-Hwan; Yu, Hee-Ju; Park, Soomin; Park, Beom-Seok


    Nucleotide-binding site (NBS)-encoding resistance genes are key plant disease-resistance genes and are abundant in plant genomes, comprising up to 2% of all genes. The availability of genome sequences from several plant models enables the identification and cloning of NBS-encoding genes from closely related species based on a comparative genomics approach. In this study, we used the genome sequence of Brassica rapa to identify NBS-encoding genes in the Brassica genome. We identified 92 non-redundant NBS-encoding genes [30 CC-NBS-LRR (CNL) and 62 TIR-NBS-LRR (TNL) genes] in approximately 100 Mbp of B. rapa euchromatic genome sequence. Despite the fact that B. rapa has a significantly larger genome than Arabidopsis thaliana due to a recent whole genome triplication event after speciation, B. rapa contains relatively small number of NBS-encoding genes compared to A. thaliana, presumably because of deletion of redundant genes related to genome diploidization. Phylogenetic and evolutionary analyses suggest that relatively higher relaxation of selective constraints on the TNL group after the old duplication event resulted in greater accumulation of TNLs than CNLs in both Arabidopsis and Brassica genomes. Recent tandem duplication and ectopic deletion are likely to have played a role in the generation of novel Brassica lineage-specific resistance genes.

  14. Targeted gene deletion of Leishmania major genes encoding developmental stage-specific leishmanolysin (GP63).


    Joshi, P B; Sacks, D L; Modi, G; McMaster, W R


    The major surface glycoprotein of Leishmania major is a zinc metalloproteinase of 63 kDa referred to as leishmanolysin or GP63, which is encoded by a family of seven genes. Targeted gene replacement was used to delete gp63 genes 1-6 encoding the highly expressed promastigote and constitutively expressed GP63. In the L. major homozygous mutants deficient in gp63 genes 1-6, there was no expression of GP63 as detected by reverse transcription-polymerase chain reaction (RT-PCR) or fluorescent staining in promastigotes from the procyclic stage (logarithmic growth phase). The remaining L. major gP63 gene 7 was shown to be developmentally regulated, as it was expressed exclusively in infectious metacyclic stage (late stationary growth phase) promastigotes and in lesion amastigotes. The gp63 genes 1-6-deficient mutants showed increased sensitivity to complement-mediated lysis. The sensitivity to lysis was greater in procyclics than in metacyclics when compared with the equivalent wild-type stages. Increased resistance of the mutant metacyclic promastigotes correlated with the expression of gp63 gene 7 and was restored to the same levels as wild-type promastigotes by transfection with gp63 gene 1. Thus, expression of GP63 is clearly involved in conferring resistance to complement-mediated lysis. The L. major GP63 1-6 mutants were capable of infecting mouse macrophages and differentiating into amastigotes. Similar levels of infection and subsequent intracellular survival were observed when mouse macrophages were infected in vitro with wild type, GP63 1-6 mutants and mutants transfected with gp63 gene 1. The GP63 1-6 mutants were capable of lesion formation in BALB/c mice and, thus, gp63 genes 1-6 do not play a role in the survival of the parasite within mouse macrophages. The role of gp63 genes 1-6 in parasite development within the sandfly vector was studied. GP63 1-6 mutants grew normally in the blood-engorged midgut of both Phlebotomus argentipes and P. papatasi However

  15. Reduction of nuclear encoded enzymes of mitochondrial energy metabolism in cells devoid of mitochondrial DNA

    SciTech Connect

    Mueller, Edith E.; Mayr, Johannes A.; Zimmermann, Franz A.; Feichtinger, Rene G.; Stanger, Olaf; Sperl, Wolfgang; Kofler, Barbara


    Highlights: Black-Right-Pointing-Pointer We examined OXPHOS and citrate synthase enzyme activities in HEK293 cells devoid of mtDNA. Black-Right-Pointing-Pointer Enzymes partially encoded by mtDNA show reduced activities. Black-Right-Pointing-Pointer Also the entirely nuclear encoded complex II and citrate synthase exhibit reduced activities. Black-Right-Pointing-Pointer Loss of mtDNA induces a feedback mechanism that downregulates complex II and citrate synthase. -- Abstract: Mitochondrial DNA (mtDNA) depletion syndromes are generally associated with reduced activities of oxidative phosphorylation (OXPHOS) enzymes that contain subunits encoded by mtDNA. Conversely, entirely nuclear encoded mitochondrial enzymes in these syndromes, such as the tricarboxylic acid cycle enzyme citrate synthase (CS) and OXPHOS complex II, usually exhibit normal or compensatory enhanced activities. Here we report that a human cell line devoid of mtDNA (HEK293 {rho}{sup 0} cells) has diminished activities of both complex II and CS. This finding indicates the existence of a feedback mechanism in {rho}{sup 0} cells that downregulates the expression of entirely nuclear encoded components of mitochondrial energy metabolism.

  16. An Apicoplast Localized Ubiquitylation System Is Required for the Import of Nuclear-encoded Plastid Proteins

    PubMed Central

    Ponts, Nadia; van Dooren, Giel G.; Prudhomme, Jacques; Brooks, Carrie F.; Rodrigues, Elisadra M.; Tan, John C.; Ferdig, Michael T.; Striepen, Boris; Le Roch, Karine G.


    Apicomplexan parasites are responsible for numerous important human diseases including toxoplasmosis, cryptosporidiosis, and most importantly malaria. There is a constant need for new antimalarials, and one of most keenly pursued drug targets is an ancient algal endosymbiont, the apicoplast. The apicoplast is essential for parasite survival, and several aspects of its metabolism and maintenance have been validated as targets of anti-parasitic drug treatment. Most apicoplast proteins are nuclear encoded and have to be imported into the organelle. Recently, a protein translocon typically required for endoplasmic reticulum associated protein degradation (ERAD) has been proposed to act in apicoplast protein import. Here, we show ubiquitylation to be a conserved and essential component of this process. We identify apicoplast localized ubiquitin activating, conjugating and ligating enzymes in Toxoplasma gondii and Plasmodium falciparum and observe biochemical activity by in vitro reconstitution. Using conditional gene ablation and complementation analysis we link this activity to apicoplast protein import and parasite survival. Our studies suggest ubiquitylation to be a mechanistic requirement of apicoplast protein import independent to the proteasomal degradation pathway. PMID:23785288

  17. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.


    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B


    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (p<0.05), reinforcing the importance of S. aureus as a potential foodborne agent. However, the potential risk posed by CoNS in goat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  18. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae.


    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F


    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  19. Nuclear-encoded factors involved in post-transcriptional processing and modification of mitochondrial tRNAs in human disease

    PubMed Central

    Powell, Christopher A.; Nicholls, Thomas J.; Minczuk, Michal


    The human mitochondrial genome (mtDNA) encodes 22 tRNAs (mt-tRNAs) that are necessary for the intraorganellar translation of the 13 mtDNA-encoded subunits of the mitochondrial respiratory chain complexes. Maturation of mt-tRNAs involves 5′ and 3′ nucleolytic excision from precursor RNAs, as well as extensive post-transcriptional modifications. Recent data suggest that over 7% of all mt-tRNA residues in mammals undergo post-transcriptional modification, with over 30 different modified mt-tRNA positions so far described. These processing and modification steps are necessary for proper mt-tRNA function, and are performed by dedicated, nuclear-encoded enzymes. Recent growing evidence suggests that mutations in these nuclear genes (nDNA), leading to incorrect maturation of mt-tRNAs, are a cause of human mitochondrial disease. Furthermore, mtDNA mutations in mt-tRNA genes, which may also affect mt-tRNA function, processing, and modification, are also frequently associated with human disease. In theory, all pathogenic mt-tRNA variants should be expected to affect only a single process, which is mitochondrial translation, albeit to various extents. However, the clinical manifestations of mitochondrial disorders linked to mutations in mt-tRNAs are extremely heterogeneous, ranging from defects of a single tissue to complex multisystem disorders. This review focuses on the current knowledge of nDNA coding for proteins involved in mt-tRNA maturation that have been linked to human mitochondrial pathologies. We further discuss the possibility that tissue specific regulation of mt-tRNA modifying enzymes could play an important role in the clinical heterogeneity observed for mitochondrial diseases caused by mutations in mt-tRNA genes. PMID:25806043

  20. A single gene encodes a selective toxin causal to the development of tan spot of wheat.

    PubMed Central

    Ciuffetti, L M; Tuori, R P; Gaventa, J M


    The identification and characterization of pathogenicity factors are essential to an understanding of the molecular events that regulate the interaction of plant-pathogenic microbes with their hosts. We have isolated the gene that encodes a host-selective toxic protein produced by the fungus Pyrenophora tritici-repentis and confirmed that this gene functions in the plant as the primary determinant of pathogenicity in the Pyrenophora-wheat interaction. These results demonstrate that a single gene encodes the production of a host-selective toxin and that transformation of this gene into a non-toxin-producing isolate of P. tritici-repentis leads to both toxin production and pathogenicity. PMID:9061946

  1. Active genes at the nuclear pore complex.


    Taddei, Angela


    The nucleus is spatially and functionally organized and its architecture is now seen as a key contributor to genome functions. A central component of this architecture is the nuclear envelope, which is studded with nuclear pore complexes that serve as gateways for communication between the nucleoplasm and cytoplasm. Although the nuclear periphery has traditionally been described as a repressive compartment and repository for gene-poor chromosome regions, several recent studies in yeast have demonstrated that repressive and activating domains can both be positioned at the periphery of the nucleus. Moreover, association with the nuclear envelope favors the expression of particular genes, demonstrating that nuclear organization can play an active role in gene regulation. PMID:17467257

  2. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.


    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo


    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  3. The naked endosperm genes encode duplicate INDETERMINATE domain transcription factors required for maize endosperm cell patterning and differentiation.


    Yi, Gibum; Neelakandan, Anjanasree K; Gontarek, Bryan C; Vollbrecht, Erik; Becraft, Philip W


    The aleurone is the outermost layer of cereal endosperm and functions to digest storage products accumulated in starchy endosperm cells as well as to confer important dietary health benefits. Whereas normal maize (Zea mays [Zm]) has a single aleurone layer, naked endosperm (nkd) mutants produce multiple outer cell layers of partially differentiated cells that show sporadic expression of aleurone identity markers such as a viviparous1 promoter-β-glucuronidase transgene. The 15:1 F2 segregation ratio suggested that two recessive genes were involved, and map-based cloning identified two homologous genes in duplicated regions of the genome. The nkd1 and nkd2 genes encode the INDETERMINATE1 domain (IDD) containing transcription factors ZmIDDveg9 and ZmIDD9 on chromosomes 2 and 10, respectively. Independent mutant alleles of nkd1 and nkd2, as well as nkd2-RNA interference lines in which both nkd genes were knocked down, also showed the nkd mutant phenotype, confirming the gene identities. In wild-type kernels, the nkd transcripts were most abundant around 11 to 16 d after pollination. The NKD proteins have putative nuclear localization signals, and green fluorescent protein fusion proteins showed nuclear localization. The mutant phenotype and gene identities suggest that NKD controls a gene regulatory network involved in aleurone cell fate specification and cell differentiation. PMID:25552497

  4. Expression of the nucleus-encoded chloroplast division genes and proteins regulated by the algal cell cycle.


    Miyagishima, Shin-Ya; Suzuki, Kenji; Okazaki, Kumiko; Kabeya, Yukihiro


    Chloroplasts have evolved from a cyanobacterial endosymbiont and their continuity has been maintained by chloroplast division, which is performed by the constriction of a ring-like division complex at the division site. It is believed that the synchronization of the endosymbiotic and host cell division events was a critical step in establishing a permanent endosymbiotic relationship, such as is commonly seen in existing algae. In the majority of algal species, chloroplasts divide once per specific period of the host cell division cycle. In order to understand both the regulation of the timing of chloroplast division in algal cells and how the system evolved, we examined the expression of chloroplast division genes and proteins in the cell cycle of algae containing chloroplasts of cyanobacterial primary endosymbiotic origin (glaucophyte, red, green, and streptophyte algae). The results show that the nucleus-encoded chloroplast division genes and proteins of both cyanobacterial and eukaryotic host origin are expressed specifically during the S phase, except for FtsZ in one graucophyte alga. In this glaucophyte alga, FtsZ is persistently expressed throughout the cell cycle, whereas the expression of the nucleus-encoded MinD and MinE as well as FtsZ ring formation are regulated by the phases of the cell cycle. In contrast to the nucleus-encoded division genes, it has been shown that the expression of chloroplast-encoded division genes is not regulated by the host cell cycle. The endosymbiotic gene transfer of minE and minD from the chloroplast to the nuclear genome occurred independently on multiple occasions in distinct lineages, whereas the expression of nucleus-encoded MIND and MINE is regulated by the cell cycle in all lineages examined in this study. These results suggest that the timing of chloroplast division in algal cell cycle is restricted by the cell cycle-regulated expression of some but not all of the chloroplast division genes. In addition, it is

  5. An intron-encoded protein assists RNA splicing of multiple similar introns of different bacterial genes.


    Meng, Qing; Wang, Yanfei; Liu, Xiang-Qin


    Four group II introns were found in an unusually intron-rich dnaN gene (encoding the beta subunit of DNA polymerase III) of the cyanobacterium Trichodesmium erythraeum, and they have strong similarities to two introns of the RIR gene (encoding ribonucleotide reductase) of the same organism. Of these six introns, only the RIR-3 intron encodes a maturase protein and showed efficient RNA splicing when expressed in Escherichia coli cells. The other five introns do not encode a maturase protein and did not show RNA splicing in E. coli. But these maturase-less introns showed efficient RNA splicing when the RIR-3 intron-encoded maturase protein was co-expressed from a freestanding gene in the same cell. These findings demonstrated that an intron-encoded protein could function as a general maturase for multiple introns of different genes. Major implications may include an intron-mediated co-regulation of the different genes and a resemblance of the evolutionary origin of spliceosomal introns.

  6. The Agrobacterium rhizogenes GALLS gene encodes two secreted proteins required for genetic transformation of plants.


    Hodges, Larry D; Lee, Lan-Ying; McNett, Henry; Gelvin, Stanton B; Ream, Walt


    Agrobacterium tumefaciens and Agrobacterium rhizogenes are related pathogens that cause crown gall and hairy root diseases, which result from integration and expression of bacterial genes in the plant genome. Single-stranded DNA (T strands) and virulence proteins are translocated into plant cells by a type IV secretion system. VirD2 nicks a specific DNA sequence, attaches to the 5' end, and pilots the DNA into plant cells. A. tumefaciens translocates single-stranded DNA-binding protein VirE2 into plant cells where it likely binds T strands and may aid in targeting them into the nucleus. Although some A. rhizogenes strains lack VirE2, they transfer T strands efficiently due to the GALLS gene, which complements an A. tumefaciens virE2 mutant for tumor formation. Unlike VirE2, full-length GALLS (GALLS-FL) contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. GALLS-FL and VirE2 contain nuclear localization signals (NLS) and secretion signals. Mutations in any of these domains abolish the ability of the GALLS gene to substitute for virE2. Here, we show that the GALLS gene encodes two proteins from one open reading frame: GALLS-FL and a protein comprised of the C-terminal domain, which initiates at an internal in-frame start codon. On some hosts, both GALLS proteins were required to substitute for VirE2. GALLS-FL tagged with yellow fluorescent protein localized to the nucleus of tobacco cells in an NLS-dependent manner. In plant cells, the GALLS proteins interacted with themselves, VirD2, and each other. VirD2 interacted with GALLS-FL and localized inside the nucleus, where its predicted helicase activity may pull T strands into the nucleus. PMID:18952790

  7. The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes.


    Zhao, Huayan; Lü, Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P; Xiong, Liming


    The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

  8. Corepressor-dependent silencing of chromosomal regions encoding neuronal genes.


    Lunyak, Victoria V; Burgess, Robert; Prefontaine, Gratien G; Nelson, Charles; Sze, Sing-Hoi; Chenoweth, Josh; Schwartz, Phillip; Pevzner, Pavel A; Glass, Christopher; Mandel, Gail; Rosenfeld, Michael G


    The molecular mechanisms by which central nervous system-specific genes are expressed only in the nervous system and repressed in other tissues remain a central issue in developmental and regulatory biology. Here, we report that the zinc-finger gene-specific repressor element RE-1 silencing transcription factor/neuronal restricted silencing factor (REST/NRSF) can mediate extraneuronal restriction by imposing either active repression via histone deacetylase recruitment or long-term gene silencing using a distinct functional complex. Silencing of neuronal-specific genes requires the recruitment of an associated corepressor, CoREST, that serves as a functional molecular beacon for the recruitment of molecular machinery that imposes silencing across a chromosomal interval, including transcriptional units that do not themselves contain REST/NRSF response elements.

  9. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    SciTech Connect

    Parke, D.; Ornston, L.N.


    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  10. Concerted evolution of the tandemly repeated genes encoding primate U2 small nuclear RNA (the RNU2 locus) does not prevent rapid diversification of the (CT){sub n} {center_dot} (GA){sub n} microsatellite embedded within the U2 repeat unit

    SciTech Connect

    Liao, D.; Weiner, A.M.


    The RNU2 locus encoding human U2 small nuclear RNA (snRNA) is organized as a nearly perfect tandem array containing 5 to 22 copies of a 5.8-kb repeat unit. Just downstream of the U2 snRNA gene in each 5.8-kb repeat unit lies a large (CT){sub n}{center_dot}(GA){sub n} dinucleotide repeat (n {approx} 70). This form of genomic organization, in which one repeat is embedded within another, provides an unusual opportunity to study the balance of forces maintaining the homogeneity of both kinds of repeats. Using a combination of field inversion gel electrophoresis and polymerase chain reaction, we have been able to study the CT microsatellites within individual U2 tandem arrays. We find that the CT microsatellites within an RNU2 allele exhibit significant length polymorphism, despite the remarkable homogeneity of the surrounding U2 repeat units. Length polymorphism is due primarily to loss or gain of CT dinucleotide repeats, but other types of deletions, insertions, and substitutions are also frequent. Polymorphism is greatly reduced in regions where pure (CT){sub n} tracts are interrupted by occasional G residues, suggesting that irregularities stabilize both the length and the sequence of the dinucleotide repeat. We further show that the RNU2 loci of other catarrhine primates (gorilla, chimpanzee, ogangutan, and baboon) contain orthologous CT microsatellites; these also exhibit length polymorphism, but are highly divergent from each other. Thus, although the CT microsatellite is evolving far more rapidly than the rest of the U2 repeat unit, it has persisted through multiple speciation events spanning >35 Myr. The persistence of the CT microsatellite, despite polymorphism and rapid evolution, suggests that it might play a functional role in concerted evolution of the RNU2 loci, perhaps as an initiation site for recombination and/or gene conversion. 70 refs., 5 figs.

  11. How are exons encoding transmembrane sequences distributed in the exon-intron structure of genes?


    Sawada, Ryusuke; Mitaku, Shigeki


    The exon-intron structure of eukaryotic genes raises a question about the distribution of transmembrane regions in membrane proteins. Were exons that encode transmembrane regions formed simply by inserting introns into preexisting genes or by some kind of exon shuffling? To answer this question, the exon-per-gene distribution was analyzed for all genes in 40 eukaryotic genomes with a particular focus on exons encoding transmembrane segments. In 21 higher multicellular eukaryotes, the percentage of multi-exon genes (those containing at least one intron) within all genes in a genome was high (>70%) and with a mean of 87%. When genes were grouped by the number of exons per gene in higher eukaryotes, good exponential distributions were obtained not only for all genes but also for the exons encoding transmembrane segments, leading to a constant ratio of membrane proteins independent of the exon-per-gene number. The positional distribution of transmembrane regions in single-pass membrane proteins showed that they are generally located in the amino or carboxyl terminal regions. This nonrandom distribution of transmembrane regions explains the constant ratio of membrane proteins to the exon-per-gene numbers because there are always two terminal (i.e., the amino and carboxyl) regions - independent of the length of sequences.

  12. NBS-LRR-Encoding genes in sorghum and their role in plant defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nucleotide-binding site leucine-rich repeats (NBS-LRR) proteins are encoded by a large class of plant genes and many of them play an important role in plant defense against pest attack. Identification and characterization of the whole set of NBS-LRR genes in a plant genome will provide insights int...

  13. Genes encoding vitamin-K epoxide reductase are present in Drosophila and trypanosomatid protists.


    Robertson, Hugh M


    Vitamin-K epoxide reductase is encoded by the VKORC1 gene in mammals and other vertebrates, which also have a paralog, VKORC1L1. Single homologs are present in basal deuterostome and insect genomes, including Drosophila, and three trypanosomatid protists. VKOR is therefore an ancient gene/protein that can be studied in the Drosophila model system.

  14. ANKRD1, the Gene Encoding Cardiac Ankyrin Repeat Protein, Is a Novel Dilated Cardiomyopathy Gene

    PubMed Central

    Moulik, Mousumi; Vatta, Matteo; Witt, Stephanie H.; Arola, Anita M.; Murphy, Ross T.; McKenna, William J.; Boriek, Aladin M.; Oka, Kazuhiro; Labeit, Siegfried; Bowles, Neil E.; Arimura, Takuro; Kimura, Akinori; Towbin, Jeffrey A.


    Objectives We evaluated ankyrin repeat domain 1 (ANKRD1), the gene encoding cardiac ankyrin repeat protein (CARP), as a novel candidate gene for dilated cardiomyopathy (DCM) through mutation analysis of a cohort of familial or idiopathic DCM patients, based on the hypothesis that inherited dysfunction of mechanical stretch-based signaling is present in a subset of DCM patients. Background CARP, a transcription coinhibitor, is a member of the titin-N2A mechanosensory complex and translocates to the nucleus in response to stretch. It is up-regulated in cardiac failure and hypertrophy and represses expression of sarcomeric proteins. Its overexpression results in contractile dysfunction. Methods In all, 208 DCM patients were screened for mutations/variants in the coding region of ANKRD1 using polymerase chain reaction, denaturing high-performance liquid chromatography, and direct deoxyribonucleic acid sequencing. In vitro functional analyses of the mutation were performed using yeast 2-hybrid assays and investigating the effect on stretch-mediated gene expression in myoblastoid cell lines using quantitative real-time reverse transcription–polymerase chain reaction. Results Three missense heterozygous ANKRD1 mutations (P105S, V107L, and M184I) were identified in 4 DCM patients. The M184I mutation results in loss of CARP binding with Talin 1 and FHL2, and the P105S mutation in loss of Talin 1 binding. Intracellular localization of mutant CARP proteins is not altered. The mutations result in differential stretch-induced gene expression compared with wild-type CARP. Conclusions ANKRD1 is a novel DCM gene, with mutations present in 1.9% of DCM patients. The ANKRD1 mutations may cause DCM as a result of disruption of the normal cardiac stretch-based signaling. PMID:19608030

  15. Identification, mapping, and cloning of the gene encoding cyanase in Escherichia coli K-12.


    Sung, Y C; Parsell, D; Anderson, P M; Fuchs, J A


    The gene in Escherichia coli for cyanase, designated cynS, was localized to a BglII restriction site approximately 1.7 kilobases from the lacA end of the lac operon. The gene was cloned into the pUC13 vector. Maxicell analysis of plasmid-encoded proteins confirmed that the BglII site is in the region encoding the structural gene for cyanase. Cyanase-deficient strains had increased sensitivity to cyanate and were not able to use cyanate as a nitrogen source.

  16. Characterization of GM-CSF-inhibitory factor and Uracil DNA glycosylase encoding genes from camel pseudocowpoxvirus.


    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Narnaware, S D; Mehta, S C; Singh, P K; Singh, Raghvendar; Tuteja, F C; Patil, N V


    The present study describes the PCR amplification of GM-CSF-inhibitory factor (GIF) and Uracil DNA glycosylase (UDG) encoding genes of pseudocowpoxvirus (PCPV) from the Indian Dromedaries (Camelus dromedarius) infected with contagious ecthyma using the primers based on the corresponding gene sequences of human PCPV and reindeer PCPV, respectively. The length of GIF gene of PCPV obtained from camel is 795 bp and due to the addition of one cytosine residue at position 374 and one adenine residue at position 516, the open reading frame (ORF) got altered, resulting in the production of truncated polypeptide. The ORF of UDG encoding gene of camel PCPV is 696 bp encoding a polypeptide of 26.0 kDa. Comparison of amino acid sequence homologies of GIF and UDG of camel PCPV revealed that the camel PCPV is closer to ORFV and PCPV (reference stains of both human and reindeer), respectively. PMID:25816930

  17. Characterization of a gene encoding a DNA binding protein with specificity for a light-responsive element.

    PubMed Central

    Gilmartin, P M; Memelink, J; Hiratsuka, K; Kay, S A; Chua, N H


    The sequence element of box II (GTGTGGTTAATATG) is a regulatory component of a light-responsive element present within the upstream region of pea rbcS-3A. The nuclear protein GT-1 was defined previously as a DNA binding activity that interacts with box II. Here, we describe the isolation and characterization of cDNA sequences that encode a DNA binding protein with specificity for this element. The recombinant protein, tobacco GT-1a, shows similar sequence requirements for DNA binding to nuclear GT-1, as assayed by its ability to interact with previously defined 2-bp scanning mutations of box II, and is shown to be immunologically related to nuclear GT-1. The predicted structure of the 43-kD protein derived from the cDNA sequence suggests the presence of a novel helix-helix-turn-helix (HHTH) motif. Comparison between the predicted protein sequence encoded by the tobacco GT-1a cDNA and that of another GT binding protein, rice GT-2, reveals strong amino acid conservation over the HHTH region; this motif appears to be involved in the interaction between the recombinant protein and box II. Genomic DNA gel blot analysis indicated the presence of a small gene family of related sequences within the tobacco nuclear genome. RNA gel blot analysis of tobacco mRNA using the isolated cDNA as a probe showed that transcripts are present in several tissues, including both light-grown and dark-adapted leaves. PMID:1392598

  18. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae

    PubMed Central

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.


    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  19. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae.


    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K


    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  20. Absence of repellents in Ustilago maydis induces genes encoding small secreted proteins.


    Teertstra, Wieke R; Krijgsheld, Pauline; Wösten, Han A B


    The rep1 gene of the maize pathogen Ustilago maydis encodes a pre-pro-protein that is processed in the secretory pathway into 11 peptides. These so-called repellents form amphipathic amyloid fibrils at the surface of aerial hyphae. A SG200 strain in which the rep1 gene is inactivated (∆rep1 strain) is affected in aerial hyphae formation. We here assessed changes in global gene expression as a consequence of the inactivation of the rep1 gene. Microarray analysis revealed that only 31 genes in the ∆rep1 SG200 strain had a fold change in expression of ≥2. Twenty-two of these genes were up-regulated and half of them encode small secreted proteins (SSPs) with unknown functions. Seven of the SSP genes and two other genes that are over-expressed in the ∆rep1 SG200 strain encode proteins that can be classified as secreted cysteine-rich proteins (SCRPs). Interestingly, most of the SCRPs are predicted to form amyloids. The SCRP gene um00792 showed the highest up-regulation in the ∆rep1 strain. Using GFP as a reporter, it was shown that this gene is over-expressed in the layer of hyphae at the medium-air interface. Taken together, it is concluded that inactivation of rep1 hardly affects the expression profile of U. maydis, despite the fact that the mutant strain has a strong reduced ability to form aerial hyphae.

  1. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    SciTech Connect

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin


    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with I{kappa}B-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy.

  2. Cloning and expression of prion protein encoding gene of flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Zhang, Zhiwen; Sun, Xiuqin; Zhang, Jinxing; Zan, Jindong


    The prion protein (PrP) encoding gene of flounder ( Paralichthys olivaceus) was cloned. It was not interrupted by an intron. This gene has two promoters in its 5' upstream, indicating that its transcription may be intensive, and should have an important function. It was expressed in all 14 tissues tested, demonstrating that it is a house-keeping gene. Its expression in digestion and reproduction systems implies that the possible prions of fish may transfer horizontally.

  3. The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) (CHC1) is localized to human chromosome 1p36.1

    SciTech Connect

    Nishimoto, T.; Seino, H.; Seki, N. |; Hori, T.A.


    The human CHC1 gene encoding RCC1 (regulator of chromosome condensation) encodes a chromosomal protein of 45 kDa that has seven internal homologous repeats and functions as a guanine nucleotide releasing factor on the nuclear Ras-like small G protein. We report here the precise localization of the RCC1 gene to human chromosome 1p36.1. There is a conserved region of homology between the 1p36 region of human and a distal region of mouse chromosome 4. Thus, the assignment of the human gene encoding RCC1 adds another marker to the conserved region of homology between human chromosome 1p and mouse chromosome 4. 17 refs., 1 fig.

  4. A mutation of the yeast gene encoding PCNA destabilizes both microsatellite and minisatellite DNA sequences.

    PubMed Central

    Kokoska, R J; Stefanovic, L; Buermeyer, A B; Liskay, R M; Petes, T D


    The POL30 gene of the yeast Saccharomyces cerevisiae encodes the proliferating cell nuclear antigen (PCNA), a protein required for processive DNA synthesis by DNA polymerase delta and epsilon. We examined the effects of the pol30-52 mutation on the stability of microsatellite (1- to 8-bp repeat units) and minisatellite (20-bp repeat units) DNA sequences. It had previously been shown that this mutation destabilizes dinucleotide repeats 150-fold and that this effect is primarily due to defects in DNA mismatch repair. From our analysis of the effects of pol30-52 on classes of repetitive DNA with longer repeat unit lengths, we conclude that this mutation may also elevate the rate of DNA polymerase slippage. The effect of pol30-52 on tracts of repetitive DNA with large repeat unit lengths was similar, but not identical, to that observed previously for pol3-t, a temperature-sensitive mutation affecting DNA polymerase delta. Strains with both pol30-52 and pol3-t mutations grew extremely slowly and had minisatellite mutation rates considerably greater than those observed in either single mutant strain. PMID:9927447

  5. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    PubMed Central

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.


    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians. PMID:27311567

  6. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    NASA Astrophysics Data System (ADS)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.


    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  7. The Brassica rapa elongated internode (EIN) gene encodes phytochrome B.


    Devlin, P F; Somers, D E; Quail, P H; Whitelam, G C


    The elongated internode (ein) mutation of Brassica rapa leads to a deficiency in immunochemically detectable phytochrome B. Molecular analysis of the PHYB gene from ein indicates a deletion in the flanking DNA 5' of the ATG start codon, which could interfere either with PHYB transcription or processing of the PHYB transcript. Restriction fragment length polymorphisms and inverse PCR fragments generated from the PHYB gene of wild-type and ein seedlings demonstrate the deletion to be 500 bp in length. Seedlings of heterozygote, EIN/ein, contain about 50% of the level of immunochemically detectable phytochrome B of equivalent wild-type EIN/EIN seedlings. Etiolated seedlings of EIN/ein show a responsiveness to red light almost intermediate between that of ein/ein and EIN/EIN homozygotes. Furthermore, whereas the ein/ein homozygote is poorly responsive to low red/far-red ratio light, the presence of one functional allele of EIN in the heterozygote confers an elongation response intermediate between that of the homozygotes EIN/EIN and ein/ein in these light conditions. The partial dominance of ein indicates a close relationship between phytochrome B level and phenotype.

  8. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    PubMed Central

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael


    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  9. Transposition of the gene encoding a TEM-12 extended-spectrum beta-lactamase.

    PubMed Central

    Heritage, J; Hawkey, P M; Todd, N; Lewis, I J


    An isolate of Klebsiella oxytoca from the blood culture of a child with leukemia was found to produce two beta-lactamases, at least one of which conferred resistance to ceftazidime. Genes encoding both enzymes were located on a single self-transmissible 100-kb plasmid, pOZ201. This plasmid was introduced into Escherichia coli UB5201 (pACYC184), and the gene encoding one beta-lactamase was transposed onto plasmid pACYC184 by exploiting a gene dosage effect. The transposable gene was found to encode a TEM-12 enzyme as determined by nucleotide sequencing. This gene was subsequently transposed onto plasmid pUB307. The transposable element encoding the TEM-12 enzyme has been designated Tn841. Both plasmids pACYC184::Tn841 and pUB307::Tn841 were shown to encode a beta-lactamase with the same isoelectric point and substrate profile as the TEM-12 beta-lactamase. Transposon Tn841, at approximately 7 kb, is larger than TnA (4.8 kb) and transposes at a lower frequency. Although it produced a resolvase which can complement the resolvase of Tn3, its transposase function was not able to complement the transposition of a TnA element which lacked transposase. The occurrence of a gene encoding an extended-spectrum beta-lactamase on a transposable element in a clinically significant bacterium is potentially a cause for concern for the spread of resistance to the extended-spectrum cephalosporins. PMID:1329636

  10. Co-expression of a Saccharomyces diastaticus glucoamylase-encoding gene and a Bacillus amyloliquefaciens alpha-amylase-encoding gene in Saccharomyces cerevisiae.


    Steyn, A J; Pretorius, I S


    A glucoamylase-encoding gene (STA2) from Saccharomyces diastaticus and an alpha-amylase-encoding gene (AMY) from Bacillus amyloliquefaciens were cloned separately into a yeast-integrating shuttle vector (YIp5), generating recombinant plasmids pSP1 and pSP2, respectively. The STA2 and AMY genes were jointly cloned into YIp5, generating plasmid pSP3. Subsequently, the dominant selectable marker APH1, encoding resistance to Geneticin G418 (GtR), was cloned into pSP3, resulting in pSP4. For enhanced expression of GtR, the APH1 gene was fused to the GAL10 promoter and terminated by the URA3 terminator, resulting in pSP5. Plasmid pSP5 was converted to a circular minichromosome (pSP6) by the addition of the ARS1 and CEN4 sequences. Laboratory strains of Saccharomyces cerevisiae transformed with plasmids pSP1 through pSP6, stably produced and secreted glucoamylase and/or alpha-amylase. Brewers' and distillers' yeast transformed with pSP6 were also capable of secreting amylolytic enzymes. Yeast transformants containing pSP1, pSP2 and pSP3 assimilated soluble starch with an efficiency of 69%, 84% and 93%, respectively. The major starch hydrolysis products produced by crude amylolytic enzymes found in the culture broths of the pSP1-, pSP2- and pSP3-containing transformants, were glucose, glucose and maltose (1:1), and glucose and maltose (3:1), respectively. These results confirmed that co-expression of the STA2 and AMY genes synergistically enhanced starch degradation.

  11. Analysis of Genes Encoding an Alternative Nitrogenase in the Archaeon Methanosarcina barkeri 227

    PubMed Central

    Chien, Yueh-Tyng; Auerbuch, Victoria; Brabban, Andrew D.; Zinder, Stephen H.


    Methanosarcina barkeri 227 possesses two clusters of genes potentially encoding nitrogenases. We have previously demonstrated that one cluster, called nif2, is expressed under molybdenum (Mo)-sufficient conditions, and the deduced amino acid sequences for nitrogenase structural genes in that cluster most closely resemble those for the Mo nitrogenase of the gram-positive eubacterium Clostridium pasteurianum. The previously cloned nifH1 from M. barkeri shows phylogenetic relationships with genes encoding components of eubacterial Mo-independent eubacterial alternative nitrogenases and other methanogen nitrogenases. In this study, we cloned and sequenced nifD1 and part of nifK1 from M. barkeri 227. The deduced amino acid sequence encoded by nifD1 from M. barkeri showed great similarity with vnfD gene products from vanadium (V) nitrogenases, with an 80% identity at the amino acid level with the vnfD gene product from Anabaena variabilis. Moreover, there was a small open reading frame located between nifD1 and nifK1 with clear homology to vnfG, a hallmark of eubacterial alternative nitrogenases. Stimulation of diazotrophic growth of M. barkeri 227 by V in the absence of Mo was demonstrated. The unusual complement of nif genes in M. barkeri 227, with one cluster resembling that from a gram-positive eubacterium and the other resembling a eubacterial V nitrogenase gene cluster, suggests horizontal genetic transfer of those genes. PMID:10809706

  12. NUCLEAR FUSION DEFECTIVE1 encodes the Arabidopsis RPL21M protein and is required for karyogamy during female gametophyte development and fertilization.


    Portereiko, Michael F; Sandaklie-Nikolova, Linda; Lloyd, Alan; Dever, Chad A; Otsuga, Denichiro; Drews, Gary N


    Karyogamy, or nuclear fusion, is essential for sexual reproduction. In angiosperms, karyogamy occurs three times: twice during double fertilization of the egg cell and the central cell and once during female gametophyte development when the two polar nuclei fuse to form the diploid central cell nucleus. The molecular mechanisms controlling karyogamy are poorly understood. We have identified nine female gametophyte mutants in Arabidopsis (Arabidopsis thaliana), nuclear fusion defective1 (nfd1) to nfd9, that are defective in fusion of the polar nuclei. In the nfd1 to nfd6 mutants, failure of fusion of the polar nuclei is the only defect detected during megagametogenesis. nfd1 is also affected in karyogamy during double fertilization. Using transmission electron microscopy, we showed that nfd1 nuclei fail to undergo fusion of the outer nuclear membranes. nfd1 contains a T-DNA insertion in RPL21M that is predicted to encode the mitochondrial 50S ribosomal subunit L21, and a wild-type copy of this gene rescues the mutant phenotype. Consistent with the predicted function of this gene, an NFD1-green fluorescent protein fusion protein localizes to mitochondria and the NFD1/RPL21M gene is expressed throughout the plant. The nfd3, nfd4, nfd5, and nfd6 mutants also contain T-DNA insertions in genes predicted to encode proteins that localize to mitochondria, suggesting a role for this organelle in nuclear fusion.

  13. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    NASA Technical Reports Server (NTRS)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.


    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  14. Experimental strategies for cloning or identifying genes encoding DNA-binding proteins.


    Carey, Michael F; Peterson, Craig L; Smale, Stephen T


    This article describes experimental strategies for cloning or identifying genes encoding DNA-binding proteins. DNA-binding proteins are most commonly identified by electrophoretic mobility-shift assay (EMSA) or DNase I footprinting. To identify the gene encoding a protein detected by EMSA or DNase footprinting, the protein often needs to be purified and its sequence analyzed, as described here. Other methods are also available which do not resort to protein purification, including the one-hybrid screen, in vitro expression library screen, and mammalian expression cloning. These methods are outlined, and their advantages and disadvantages are discussed. PMID:22301659

  15. Human Genetic Disorders Caused by Mutations in Genes Encoding Biosynthetic Enzymes for Sulfated Glycosaminoglycans*

    PubMed Central

    Mizumoto, Shuji; Ikegawa, Shiro; Sugahara, Kazuyuki


    A number of genetic disorders are caused by mutations in the genes encoding glycosyltransferases and sulfotransferases, enzymes responsible for the synthesis of sulfated glycosaminoglycan (GAG) side chains of proteoglycans, including chondroitin sulfate, dermatan sulfate, and heparan sulfate. The phenotypes of these genetic disorders reflect disturbances in crucial biological functions of GAGs in human. Recent studies have revealed that mutations in genes encoding chondroitin sulfate and dermatan sulfate biosynthetic enzymes cause various disorders of connective tissues. This minireview focuses on growing glycobiological studies of recently described genetic diseases caused by disturbances in biosynthetic enzymes for sulfated GAGs. PMID:23457301

  16. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus

    PubMed Central

    Richards, Amber D.; Vargas-Muñiz, José M.; Renshaw, Hilary; Steinbach, William J.


    Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus) that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs) form a complex with calcineurin in the presence of FK506 (FKBP12-FK506) and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn’t localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don’t play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn’t show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated “paradoxical growth effect” at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  17. How sugars might coordinate chloroplast and nuclear gene expression during acclimation to high light intensities.


    Häusler, Rainer E; Heinrichs, Luisa; Schmitz, Jessica; Flügge, Ulf-Ingo


    The concept of retrograde control of nuclear gene expression assumes the generation of signals inside the chloroplasts, which are either released from or sensed inside of the organelle. In both cases, downstream signaling pathways lead eventually to a differential regulation of nuclear gene expression and the production of proteins required in the chloroplast. This concept appears reasonable as the majority of the over 3000 predicted plastidial proteins are encoded by nuclear genes. Hence, the nucleus needs information on the status of the chloroplasts, such as during acclimation responses, which trigger massive changes in the protein composition of the thylakoid membrane and in the stroma. Here, we propose an additional control mechanism of nuclear- and plastome-encoded photosynthesis genes, taking advantage of pathways involved in sugar- or hormonal signaling. Sugars are major end products of photosynthesis and their contents respond very sensitively to changes in light intensities. Based on recent findings, we ask the question as to whether the carbohydrate status outside the chloroplast can be directly sensed within the chloroplast stroma. Sugars might synchronize the responsiveness of both genomes and thereby help to coordinate the expression of plastome- and nuclear-encoded photosynthesis genes in concert with other, more specific retrograde signals.

  18. LEA (Late Embryogenesis Abundant) proteins and their encoding genes in Arabidopsis thaliana

    PubMed Central

    Hundertmark, Michaela; Hincha, Dirk K


    Background LEA (late embryogenesis abundant) proteins have first been described about 25 years ago as accumulating late in plant seed development. They were later found in vegetative plant tissues following environmental stress and also in desiccation tolerant bacteria and invertebrates. Although they are widely assumed to play crucial roles in cellular dehydration tolerance, their physiological and biochemical functions are largely unknown. Results We present a genome-wide analysis of LEA proteins and their encoding genes in Arabidopsis thaliana. We identified 51 LEA protein encoding genes in the Arabidopsis genome that could be classified into nine distinct groups. Expression studies were performed on all genes at different developmental stages, in different plant organs and under different stress and hormone treatments using quantitative RT-PCR. We found evidence of expression for all 51 genes. There was only little overlap between genes expressed in vegetative tissues and in seeds and expression levels were generally higher in seeds. Most genes encoding LEA proteins had abscisic acid response (ABRE) and/or low temperature response (LTRE) elements in their promoters and many genes containing the respective promoter elements were induced by abscisic acid, cold or drought. We also found that 33% of all Arabidopsis LEA protein encoding genes are arranged in tandem repeats and that 43% are part of homeologous pairs. The majority of LEA proteins were predicted to be highly hydrophilic and natively unstructured, but some were predicted to be folded. Conclusion The analyses indicate a wide range of sequence diversity, intracellular localizations, and expression patterns. The high fraction of retained duplicate genes and the inferred functional diversification indicate that they confer an evolutionary advantage for an organism under varying stressful environmental conditions. This comprehensive analysis will be an important starting point for future efforts to elucidate

  19. Cloning and expression of genes encoding Haemophilus somnus antigens.

    PubMed Central

    Corbeil, L B; Chikami, G; Yarnall, M; Smith, J; Guiney, D G


    A genomic library of Haemophilus somnus 2336, a virulent isolate from a calf with pneumonia (later used to reproduce H. somnus experimental pneumonia), was constructed in the cosmid vector pHC79. The gene bank in Escherichia coli DH1 was screened by filter immunoassay with convalescent-phase serum, which reacted with several outer membrane antigens of H. somnus. On Western blotting (immunoblotting) of immunoreactive colonies, five clones were found to express proteins which comigrated with H. somnus surface antigens. Three clones (DH1 pHS1, pHS3, and pHS4) expressed both a 120-kilodalton (kDa) antigen and a 76-kDa antigen, one clone (DH1 pHS2) expressed only the 76-kDa antigen, and the fifth clone (DH1 pHS5) expressed a 60-kDa antigen. The 120-kDa and 76-kDa antigens were found internally, whereas the 60-kDa protein was detected in the DH1 pHS5 culture supernatant as membrane blebs or insoluble protein. Both the H. somnus 120-kDa antigen and the recombinant 120-kDa antigen had immunoglobulin Fc-binding activity. Restriction endonuclease mapping demonstrated that the genomic DNA inserts of clones expressing the 76-kDa antigen shared a common 28.4-kilobase-pair region, and the three clones also expressing the 120-kDa antigen shared an additional 7.0-kilobase-pair region. The restriction endonuclease map of pHS5, which expressed the 60-kDa antigen, was not similar to the maps of the other four plasmids. Since these three H. somnus antigens reacted with protective convalescent-phase serum, the recombinants which express these proteins should be useful in further studies of protective immunity in bovine H. somnus disease. Images PMID:2843469

  20. Distal antenna and distal antenna related encode nuclear proteins containing pipsqueak motifs involved in antenna development in Drosophila.


    Emerald, B Starling; Curtiss, Jennifer; Mlodzik, Marek; Cohen, Stephen M


    Legs and antennae are considered to be homologous appendages. The fundamental patterning mechanisms that organize spatial pattern are conserved, yet appendages with very different morphology develop. A genetic hierarchy for specification of antennal identity has been partly elucidated. We report identification of a novel family of genes with roles in antennal development. The distal antenna (dan) and distal antenna-related (danr) genes encode novel nuclear proteins that are expressed in the presumptive distal antenna, but not in the leg imaginal disc. Ectopic expression of dan or danr causes partial transformation of distal leg structure toward antennal identity. Mutants that remove dan and danr activity cause partial transformation of antenna toward leg identity. Therefore we suggest that dan and danr contribute to differentiation of antenna-specific characteristics. Antenna-specific expression of dan and danr depends on a regulatory hierarchy involving homothorax and Distal-less, as well as cut and spineless. We propose that dan and danr are effector genes that act downstream of these genes to control differentiation of distal antennal structures.

  1. Ribosomal proteins are encoded by single copy genes in Dictyostelium discoideum.


    Steel, L F; Jacobson, A


    Five recombinant plasmids which encode ribosomal proteins (r-proteins) from Dictyostelium discoideum have been isolated. Poly(A) + RNA was size-fractionated by preparative agarose gel electrophoresis and a fraction encoding proteins of less than 35 kDa was used to construct a cDNA library in the plasmid vector pBR322. Individual clones from the library were screened by hybrid-selected translation and those encoding r-proteins were identified by co-migration of the translation products in two-dimensional gel electrophoresis with marker proteins purified from Dictyostelium ribosomes. Initial characterization using the five cDNA plasmids indicates that these r-proteins are encoded by single copy genes and that they are not tightly clustered in the genome.

  2. Biovar diversity is reflected by variations of genes encoding urease of Ureaplasma urealyticum.


    Ruifu, Y; Minli, Z; Guo, Z; Wang, X


    Five oligonucleotide primers derived from the gene encoding urease of Ureaplasma urealyticum were designed to evaluate the relationship between the urease gene and biovar diversity of this organism. Five combinations of these primers were tested by PCR and the result revealed that there were variations in urease genes among different serovars of U. urealyticum. This result, in agreement with other PCRs based on other functionally unrelated (rRNA and MB antigen) genes, may reflect the phylogenetic relationship among organisms taxonomically classified as U. urealyticum.

  3. The rnhB gene encoding RNase HII of Streptococcus pneumoniae and evidence of conserved motifs in eucaryotic genes.

    PubMed Central

    Zhang, Y B; Ayalew, S; Lacks, S A


    A single RNase H enzyme was detected in extracts of Streptococcus pneumoniae. The gene encoding this enzyme was cloned and expressed in Escherichia coli, as demonstrated by its ability to complement a double-mutant rnhA recC strain. Sequence analysis of the cloned DNA revealed an open reading frame of 290 codons that encodes a polypeptide of 31.9 kDa. The predicted protein exhibits a low level of homology (19% identity of amino acid residues) to RNase HII encoded by rnhB of E. coli. Identification of the S. pneumoniae RNase HII translation start site by amino-terminal sequencing of the protein and of mRNA start sites by primer extension with reverse transcriptase showed that the major transcript encoding rnhB begins at the protein start site. Comparison of the S. pneumoniae and E. coli RNase HII sequences and sequences of other, putative bacterial rnhB gene products surmised from sequencing data revealed three conserved motifs. Use of these motifs to search for homologous genes in eucaryotes demonstrated the presence of rnhB genes in a yeast and a roundworm. Partial rnhB gene sequences were detected among expressed sequences of mouse and human cells. From these data, it appears that RNase HII is universally present in living cells. PMID:9190796

  4. Molecular cloning of Phaseolus vulgaris cDNA encoding proliferating cell nuclear antigen.


    Strzalka, Wojciech; Ziemienowicz, Alicja


    A cDNA fragment encoding a common bean (Phaseolus vulgaris) proliferating cell nuclear antigen (PCNA) was isolated using rapid amplification of cDNA 3' end (3' RACE) method, cloned and sequenced. The nucleotide sequence of this clone contains an open reading frame of 798 nucleotides encoding a protein of 265 amino acids. Alignment of the common bean PCNA predicted sequence shows its high degree of identity with PCNA from other plant species. Analysis of PCNA content in the germinating embryos of common bean showed a decrease in the protein level after 60h of germination. Moreover, PCNA was not detected in the tested plant organs (root, stem, leaf and flower). The presence of PCNA in the germinating seeds and its absence from mature plants suggests that this protein plays a crucial role during early stages of plant development.

  5. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin

    PubMed Central

    Pelegrino, Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz, Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos


    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(−) vector and expressed in E. coli TOP10. PMID:26552984

  6. fosI Is a New Integron-Associated Gene Cassette Encoding Reduced Susceptibility to Fosfomycin.


    Pelegrino, Karla de Oliveira; Campos, Juliana Coutinho; Sampaio, Suely Carlos Ferreira; Lezirovitz, Karina; Seco, Bruna Mara; Pereira, Mayne de Oliveira; Rocha, Darlan Augusto da Costa; Jové, Thomas; Nicodemo, Antonio Carlos; Sampaio, Jorge Luiz Mello


    In this work, we demonstrate that the fosI gene encodes a predicted small protein with 134 amino acids and determines reduced susceptibility to fosfomycin. It raised the MIC from 0.125 to 6 μg/ml when the pBRA100 plasmid was introduced into Escherichia coli TOP10 and to 16 μg/ml when the gene was cloned into the pBC_SK(-) vector and expressed in E. coli TOP10.

  7. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.


    Muñoz-Martínez, Francisco; García-Fontana, Cristina; Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino


    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  8. Cloning of human genes encoding novel G protein-coupled receptors

    SciTech Connect

    Marchese, A.; Docherty, J.M.; Heiber, M.


    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  9. Two genes encoding new carotenoid-modifying enzymes in the green sulfur bacterium Chlorobium tepidum.


    Maresca, Julia A; Bryant, Donald A


    The green sulfur bacterium Chlorobium tepidum produces chlorobactene as its primary carotenoid. Small amounts of chlorobactene are hydroxylated by the enzyme CrtC and then glucosylated and acylated to produce chlorobactene glucoside laurate. The genes encoding the enzymes responsible for these modifications of chlorobactene, CT1987, and CT0967, have been identified by comparative genomics, and these genes were insertionally inactivated in C. tepidum to verify their predicted function. The gene encoding chlorobactene glucosyltransferase (CT1987) has been named cruC, and the gene encoding chlorobactene lauroyltransferase (CT0967) has been named cruD. Homologs of these genes are found in the genomes of all sequenced green sulfur bacteria and filamentous anoxygenic phototrophs as well as in the genomes of several nonphotosynthetic bacteria that produce similarly modified carotenoids. The other bacteria in which these genes are found are not closely related to green sulfur bacteria or to one another. This suggests that the ability to synthesize modified carotenoids has been a frequently transferred trait.

  10. Structure of the three beta-tubulin-encoding genes of the unicellular alga, Polytomella agilis.


    Conner, T W; Thompson, M D; Silflow, C D


    The quadriflagellate, unicellular, colorless alga, Polytomella agilis, contains several distinct microtubule arrays. To study the genetic basis of microtubule heterogeneity in P. agilis, we characterized its tubulin(Tub)-encoding genes (tub). The three beta tub genes detected in blots of P. agilis DNA were isolated from a genomic library. The structure and organization of the genes were examined by restriction mapping and nucleotide (nt) sequencing. S1 nuclease protection studies showed that all three genes are expressed. The predicted amino acid (aa) sequences are more than 98% conserved with the Chlamydomonas reinhardtii and Volvox carteri beta-Tubs, underscoring the close phylogenetic relationship of these species. Evolutionary divergence among the P. agilis genes is demonstrated by differences in intron number, nt sequences in noncoding regions, and silent nt substitutions in the coding regions. However, the proteins encoded by the beta 1 and beta 3 tub genes are identical; the beta 2 gene product differs by one conservative aa substitution. These results are in striking contrast to the C-terminal aa diversity reported within beta tub gene families in animal, higher plant and fungal systems. The data support the hypothesis that those tub genes whose products assemble into axonemal microtubules are subject PMID:2533130

  11. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.


    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto


    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens. PMID:26907753

  12. NUP145 encodes a novel yeast glycine-leucine-phenylalanine-glycine (GLFG) nucleoporin required for nuclear envelope structure

    PubMed Central


    We have isolated and characterized the gene encoding a fourth yeast glycine-leucine-phenylalanine-glycine (GLFG) repeat nucleoporin with a calculated molecular mass of 145.3 kD, and therefore termed NUP145. The amino-terminal half of Nup145p is similar to two previously identified GLFG nucleoporins, Nup116p and Nup100p (Wente, S. R., M. P. Rout, and G. Blobel. 1992. J. Cell Biol. 119:705-723). A deletion/disruption in the amino-terminal half of NUP145 (nup145 delta N) had only a slight effect on cell growth at temperatures between 17 and 37 degrees C. However, immunofluorescence microscopy of nup145 delta N cells with antinucleoporin antibodies showed that the characteristic punctate nuclear staining normally seen in wild-type yeast cells was reduced, with the majority of the signal located in one or two intense spots at the nuclear periphery. Thin section electron microscopy analysis revealed the presence of what appeared to be successive herniations of the nuclear envelope forming grape-like structures at primarily one site on the nup145 delta N nuclei. These successive herniations contained numerous NPC-like structures, correlating to the limited bright patches of anti-nucleoporin immunofluorescence signal. In some cases the successive herniations were small. Occasionally, however, multi-lobulated nuclei were seen. We suggest that the ultrastructural phenotype of nup145 delta N cells is due to a defective interaction of nup145 delta N NPCs with the surrounding pore membrane domain of the nuclear envelope. We have also analyzed the synthetic lethal phenotypes among GLFG nucleoporin mutant alleles, and found that strains harboring nup116 and either nup100 or nup145 mutations were not viable. This, in combination with the morphological analysis, may reflect overlapping yet distinct roles for these three GLFG nucleoporins in NPC-nuclear envelope interactions. PMID:8195299

  13. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    PubMed Central

    Hays, Shan M; Swanson, Johanna; Selker, Eric U


    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged H4 variant (hH4v) not described in other species. The hH4-1 and hH4-2 genes, which are 96% identical in their coding regions and encode identical proteins, were inactivated independently. Strains with inactivating mutations in either gene were phenotypically wild type, in terms of growth rates and fertility, but the double mutants were inviable. As expected, we were unable to isolate null alleles of hH2A, hH2B, or hH3. The genomic arrangement of the histone and histone variant genes was determined. hH2Az and the hH3-hH4-1 gene pair are on LG IIR, with hH2Az centromere-proximal to hH3-hH4-1 and hH3 centromere-proximal to hH4-1. hH3v and hH4-2 are on LG IIIR with hH3v centromere-proximal to hH4-2. hH4v is on LG IVR and the hH2A-hH2B pair is located immediately right of the LG VII centromere, with hH2A centromere-proximal to hH2B. Except for the centromere-distal gene in the pairs, all of the histone genes are transcribed toward the centromere. Phylogenetic analysis of the N. crassa histone genes places them in the Euascomycota lineage. In contrast to the general case in eukaryotes, histone genes in euascomycetes are few in number and contain introns. This may be a reflection of the evolution of the RIP (repeat-induced point mutation) and MIP (methylation induced premeiotically) processes that detect sizable duplications and silence associated genes. PMID:11901114

  14. Structure of an invertebrate gene encoding cytoplasmic intermediate filament (IF) proteins: implications for the origin and the diversification of IF proteins.

    PubMed Central

    Dodemont, H; Riemer, D; Weber, K


    The structure of the single gene encoding the cytoplasmic intermediate filament (IF) proteins in non-neuronal cells of the gastropod Helix aspersa is described. Genomic and cDNA sequences show that the gene is composed of 10 introns and 11 exons, spanning greater than 60 kb of DNA. Alternative RNA processing accounts for two mRNA families which encode two IF proteins differing only in their C-terminal sequence. The intron/exon organization of the Helix rod domain is identical to that of the vertebrate type III IF genes in spite of low overall protein sequence homology and the presence of an additional 42 residues in coil 1b of the invertebrate sequence. Intron position homology extends to the entire coding sequence comprising both the rod and tail domains when the invertebrate IF gene is compared with the nuclear lamin LIII gene of Xenopus laevis presented in the accompanying report of Döring and Stick. In contrast the intron patterns of the tail domains of the invertebrate IF and the lamin genes differ from those of the vertebrate type III genes. The combined data are in line with an evolutionary descent of cytoplasmic IF proteins from a nuclear lamin-like progenitor and suggest a mechanism for this derivation. The unique position of intron 7 in the Helix IF gene indicates that the archetype IF gene arose by the elimination of the nuclear localization sequence due to the recruitment of a novel splice site. The presumptive structural organization of the archetype IF gene allows predictions with respect to the later diversification of metazoan IF genes. Whereas models proposing a direct derivation of neurofilament genes seem unlikely, the earlier speculation of an mRNA transposition mechanism is compatible with current results. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 6. PMID:2249666

  15. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.


    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  16. Molecular cloning of a gene encoding an ARS binding factor from the yeast Saccharomyces cerevisiae.

    PubMed Central

    Biswas, E E; Stefanec, M J; Biswas, S B


    We report the isolation of the gene for origin binding factor 1 (OBF1) from the yeast Saccharomyces cerevisiae by screening a yeast genomic DNA library in lambda gt11 with an ARS-specific oligonucleotide probe. One recombinant encoded a fusion protein of approximately 180 kDa that bound ARS-specific oligonucleotide probes in vitro. The restriction map of this gene was determined after isolation of the complete gene by screening a yeast genomic DNA library in YEp24. Characterization of the gene for OBF1 by pulsed-field gel electrophoresis and Northern and Southern blot analyses demonstrated that (i) the gene is located in chromosome IV, (ii) the gene is a single-copy gene, (iii) the mRNA is approximately 3.8 kilobases, which could code for an approximately 130-kDa polypeptide, consistent with the reported size of OBF1. An antibody, affinity-purified using the lysogen-encoded fusion protein, specifically detected an approximately 130-kDa polypeptide in yeast extract. The isolation of the gene for OBF1 should allow further analysis of the mechanism of action of this protein in vitro and in vivo. Images PMID:1697686

  17. Systematic Identification and Characterization of Novel Human Skin-Associated Genes Encoding Membrane and Secreted Proteins

    PubMed Central

    Buhren, Bettina Alexandra; Martinez, Cynthia; Schrumpf, Holger; Gasis, Marcia; Grether-Beck, Susanne; Krutmann, Jean


    Through bioinformatics analyses of a human gene expression database representing 105 different tissues and cell types, we identified 687 skin-associated genes that are selectively and highly expressed in human skin. Over 50 of these represent uncharacterized genes not previously associated with skin and include a subset that encode novel secreted and plasma membrane proteins. The high levels of skin-associated expression for eight of these novel therapeutic target genes were confirmed by semi-quantitative real time PCR, western blot and immunohistochemical analyses of normal skin and skin-derived cell lines. Four of these are expressed specifically by epidermal keratinocytes; two that encode G-protein-coupled receptors (GPR87 and GPR115), and two that encode secreted proteins (WFDC5 and SERPINB7). Further analyses using cytokine-activated and terminally differentiated human primary keratinocytes or a panel of common inflammatory, autoimmune or malignant skin diseases revealed distinct patterns of regulation as well as disease associations that point to important roles in cutaneous homeostasis and disease. Some of these novel uncharacterized skin genes may represent potential biomarkers or drug targets for the development of future diagnostics or therapeutics. PMID:23840300

  18. Saccharomyces cerevisiae MPS2 Encodes a Membrane Protein Localized at the Spindle Pole Body and the Nuclear Envelope

    PubMed Central

    Muñoz-Centeno, María de la Cruz; McBratney, Susan; Monterrosa, Antonio; Byers, Breck; Mann, Carl; Winey, Mark


    The MPS2 (monopolar spindle two) gene is one of several genes required for the proper execution of spindle pole body (SPB) duplication in the budding yeast Saccharomyces cerevisiae (Winey et al., 1991). We report here that the MPS2 gene encodes an essential 44-kDa protein with two putative coiled-coil regions and a hydrophobic sequence. Although MPS2 is required for normal mitotic growth, some null strains can survive; these survivors exhibit slow growth and abnormal ploidy. The MPS2 protein was tagged with nine copies of the myc epitope, and biochemical fractionation experiments show that it is an integral membrane protein. Visualization of a green fluorescent protein (GFP) Mps2p fusion protein in living cells and indirect immunofluorescence microscopy of 9xmyc-Mps2p revealed a perinuclear localization with one or two brighter foci of staining corresponding to the SPB. Additionally, immunoelectron microscopy shows that GFP-Mps2p localizes to the SPB. Our analysis suggests that Mps2p is required as a component of the SPB for insertion of the nascent SPB into the nuclear envelope. PMID:10397772

  19. The Arabidopsis thaliana ortholog of a purported maize cholinesterase gene encodes a GDSL-lipase.


    Muralidharan, Mrinalini; Buss, Kristina; Larrimore, Katherine E; Segerson, Nicholas A; Kannan, Latha; Mor, Tsafrir S


    Acetylcholinesterase is an enzyme that is intimately associated with regulation of synaptic transmission in the cholinergic nervous system and in neuromuscular junctions of animals. However the presence of cholinesterase activity has been described also in non-metazoan organisms such as slime molds, fungi and plants. More recently, a gene purportedly encoding for acetylcholinesterase was cloned from maize. We have cloned the Arabidopsis thaliana homolog of the Zea mays gene, At3g26430, and studied its biochemical properties. Our results indicate that the protein encoded by the gene exhibited lipase activity with preference to long chain substrates but did not hydrolyze choline esters. The At3g26430 protein belongs to the SGNH clan of serine hydrolases, and more specifically to the GDS(L) lipase family. PMID:23430565

  20. Expression patterns of genes encoding plasma membrane aquaporins during fruit development in cucumber (Cucumis sativus L.).


    Shi, Jin; Wang, Jinfang; Li, Ren; Li, Dianbo; Xu, Fengfeng; Sun, Qianqian; Zhao, Bin; Mao, Ai-Jun; Guo, Yang-Dong


    Aquaporins are membrane channels precisely regulating water movement through cell membranes in most living organisms. Despite the advances in the physiology of fruit development, their participation during fruit development in cucumber still barely understood. In this paper, the expressions of 12 genes encoding plasma membrane intrinsic proteins (PIPs) were analyzed during cucumber fruit development in our work. Based on the homology search with known PIPs from rice, Arabidopsis and strawberry, 12 cucumber PIP genes subfamily members were identified. Cellular localization assays indicated that CsPIPs were localized in the plasma membrane. The qRT-PCR analysis of CsPIPs showed that 12 CsPIPs were differentially expressed during fruit development. These results suggest that 12 genes encoding plasma membrane intrinsic proteins (CsPIPs) play very important roles in cucumber life cycle and the data generated will be helpful in understanding their precise roles during fruit development in cucumber.

  1. Characterization of the gene encoding a fibrinogen-related protein expressed in Crassostrea gigas hemocytes.


    Skazina, M A; Gorbushin, A M


    Four exons of the CgFrep1 gene (3333 bp long) encode a putative fibrinogen-related protein (324 aa) bearing a single C-terminal FBG domain. Transcripts of the gene obtained from hemocytes of different Pacific oysters show prominent individual variation based on SNP and indels of tandem repeats resulted in polymorphism of N-terminus of the putative CgFrep1 polypeptide. The polypeptide chain bears N-terminal coiled-coil region potentially acting as inter-subunit interface in the protein oligomerization. It is suggested that CgFrep1 gene encodes the oligomeric lectin composed of at least two subunits. PMID:27189918

  2. Cloning and expression analysis of a prion protein encoding gene in guppy ( Poecilia reticulata)

    NASA Astrophysics Data System (ADS)

    Wu, Suihan; Wei, Qiwei; Yang, Guanpin; Wang, Dengqiang; Zou, Guiwei; Chen, Daqing


    The full length cDNA of a prion protein (PrP) encoding gene of guppy ( Poecilia reticulata) and the corresponding genomic DNA were cloned. The cDNA was 2245 bp in length and contained an open reading frame (ORF) of 1545 bp encoding a protein of 515 amino acids, which held all typical structural characteristics of the functional PrP. The cloned genomic DNA fragment corresponding to the cDNA was 3720 bp in length, consisting of 2 introns and 2 exons. The 5' untranslated region of cDNA originated from the 2 exons, while the ORF originated from the second exon. Although the gene was transcribed in diverse tissues including brain, eye, liver, intestine, muscle and tail, its transcript was most abundant in the brain. In addition, the transcription of the gene was enhanced by 5 salinity, implying that it was associated with the response of guppy to saline stress.

  3. Isolation and Characterization of the Epoxide Hydrolase-Encoding Gene from Xanthophyllomyces dendrorhous

    PubMed Central

    Visser, Hans; de Bont, Jan A. M.; Verdoes, Jan C.


    The epoxide hydrolase (EH)-encoding gene (EPH1) from the basidiomycetous yeast Xanthophyllomyces dendrorhous was isolated. The genomic sequence has a 1,236-bp open reading frame which is interrupted by eight introns that encode a 411-amino-acid polypeptide with a calculated molecular mass of 46.2 kDa. The amino acid sequence is similar to that of microsomal EH and belongs to the α/β hydrolase fold family. The EPH1 gene was not essential for growth of X. dendrorhous in rich medium under laboratory conditions. The Eph1-encoding cDNA was functionally expressed in Escherichia coli. A sixfold increase in specific activity was observed when we used resting cells rather than X. dendrorhous. The epoxides 1,2-epoxyhexane and 1-methylcyclohexene oxide were substrates for both native and recombinant Eph1. Isolation and characterization of the X. dendrorhous EH-encoding gene are essential steps in developing a yeast EH-based epoxide biotransformation system. PMID:10584004

  4. Two genes encoding midgut-specific maltase-like polypeptides from Anopheles gambiae.


    Zheng, L; Whang, L H; Kumar, V; Kafatos, F C


    Full-length cDNA clones of two genes have been isolated from the African malaria vector mosquito, Anopheles gambiae. These genes, designated Agm1 and Agm2, encode maltase-like polypeptides of 498 and 599 residues, respectively. Deduced amino acid sequences contain a putative signal peptide sequence and four potential glycosylation sites. Agm1 and Agm2 show highest similarities to the Mal1 gene from Aedes aegypti and three clustered maltase genes from Drosophila melanogaster. Both genes are located at position 46D, in the terminal division of the left arm of the third chromosome. Agm2 has very strict tissue and temporal specificity, being expressed exclusively in the adult midgut. The specificity of Agm1 is similar but appears slightly broader; transcripts of this gene are detected at a low level in the pupae, and occasionally in the adult carcass after removal of the midgut.

  5. The two yeast histone H2A genes encode similar protein subtypes.

    PubMed Central

    Choe, J; Kolodrubetz, D; Grunstein, M


    The sequences of the two histones H2A genes in the yeast Saccharomyces cerevisiae have been determined. These genes encode two histone H2A subtypes which are 131 amino acids in length but differ at 2 amino acid positions: an Ala leads to Thr and a Thr leads to Ala change at positions 124 and 125. Thus, the two histone H2A subtypes have identical amino acid compositions. The coding regions of the two H2A genes are homologous at 369 of 393 bases (94%), with all but 2 of the 24 changes being silent. There is only 30% homology in the 5' flanking sequences of the two H2A genes. Like other eukaryotic histone genes, the yeast H2A genes are not interrupted by intervening sequences. When the yeast H2A histones are compared to those from other eukaryotes, there is at least 80% homology in amino acid sequence. PMID:7041122

  6. Horse cDNA clones encoding two MHC class I genes

    SciTech Connect

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.


    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  7. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    PubMed Central

    Karlyshev, A.V.; Thacker, G.; Jones, M.A.; Clements, M.O.; Wren, B.W.


    According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection. PMID:24918062

  8. Making sense of nuclear localization: A zinc-finger protein encoded by a cytoplasmically replicating plant RNA virus acts a transcription factor

    PubMed Central

    Lukhovitskaya, Nina I.; Gushchin, Vladimir A.; Solovyev, Andrey G.; Savenkov, Eugene I.


    Recent studies have uncovered numerous nucleus-localized proteins encoded by plant RNA viruses. Whereas for some of these viruses nuclear (or, more specifically, nucleolar) passage of the proteins is needed for the virus movement within the plant or suppression of host defense, the nuclear function of these proteins remains largely unknown. Recently, the situation has been clarified for one group of plant RNA viruses, the Carlaviruses. Being positive-stranded RNA viruses, carlaviruses multiply exclusively in the cytoplasm. Chrysanthemum virus B (CVB, a carlavirus) encodes a zinc-finger protein p12 targeted to the nucleus in a nuclear localization signal-dependent manner. In a recent work, we demonstrated that p12 directly interacts with chromatin and plant promoters, thus, acts as a eukaryotic transcription factor (TF) and activates expression of a host TF involved in regulation of cell size and proliferation to favor virus infection. Therefore our studies identified a novel nuclear stage of in CVB infection involving modulation of host gene expression and plant development. Whereas it is well established that any RNA virus actively replicating in the cell causes changes in the transcriptome, our study expanded this view by showing that some positive-stranded RNA viruses can directly manipulate host transcription by encoding eukaryotic TFs. PMID:23759549

  9. A family of potato genes that encode Kunitz-type proteinase inhibitors: structural comparisons and differential expression.


    Ishikawa, A; Ohta, S; Matsuoka, K; Hattori, T; Nakamura, K


    Potato tubers contain a complex group of proteins of 20 to 24 kDa that exhibit homology to Kunitz-type proteinase inhibitors. We isolated three cDNAs and two genomic clones that encode members of the potato Kunitz-type proteinase inhibitor (PKPI) family. Comparison of the structures of these and other cloned genes indicated that genes of the PKPI family can be classified into three major homology groups, namely, A, B and C. The PKPI-A and -B genes exhibit higher homology to one another than to the PKPI-C genes. Determination of the N-terminal amino acid sequences of 18 polypeptides from the complex group of 20- to 24-kDa proteins that had been separated by column chromatography and subsequently gel electrophoresis revealed three different sequences that corresponded to PKPI-A, -B, and -C. PKPI-A genes include those coding for a cathepsin D inhibitor, while PKPI-B and -C genes include those coding for trypsin and/or chymotrypsin inhibitors and a subtilisin inhibitor. Precursors to PKPIs are synthesized with an N-terminal extra peptide that appears to contain, in addition to the signal peptide, a short propeptide with a highly conserved Asn-Pro-Ile-Xxx-Leu-Pro motif that is identical to the potential vacuolar-sorting determinant in the N-terminal propeptide of a precursor to sporamin of sweet potato. Expression of the PKPI-A and -B genes is differentially regulated: PKPI-A mRNA but not PKPI-B mRNA were induced in leaves after wounding or upon treatment with methyl jasmonate. Nuclear genes for PKPI-A and -B do not contain introns, and the homology between the two types of gene extends only 72 bp upstream from the site of initiation of transcription.

  10. Complex Formation among Murine Cytomegalovirus US22 Proteins Encoded by Genes M139, M140, and M141

    PubMed Central

    Karabekian, Zaruhi; Hanson, Laura K.; Slater, Jacquelyn S.; Krishna, Neel K.; Bolin, Lisa L.; Kerry, Julie A.; Campbell, Ann E.


    The murine cytomegalovirus (MCMV) proteins encoded by US22 genes M139, M140, and M141 function, at least in part, to regulate replication of this virus in macrophages. Mutant MCMV having one or more of these genes deleted replicates poorly in macrophages in culture and in the macrophage-dense environment of the spleen. In this report, we demonstrate the existence of stable complexes formed by the products of all three of these US22 genes, as well as a complex composed of the products of M140 and M141. These complexes form in the absence of other viral proteins; however, the pM140/pM141 complex serves as a requisite binding partner for the M139 gene products. Products from all three genes colocalize to a perinuclear region of the cell juxtaposed to or within the cis-Golgi region but excluded from the trans-Golgi region. Interestingly, expression of pM141 redirects pM140 from its predominantly nuclear residence to the perinuclear, cytoplasmic locale where these US22 proteins apparently exist in complex. Thus, complexing of these nonessential, early MCMV proteins likely confers a function(s) independent of each individual protein and important for optimal replication of MCMV in its natural host. PMID:15731247

  11. The first nuclear-encoded complex I mutation in a patient with Leigh syndrome.

    PubMed Central

    Loeffen, J; Smeitink, J; Triepels, R; Smeets, R; Schuelke, M; Sengers, R; Trijbels, F; Hamel, B; Mullaart, R; van den Heuvel, L


    Nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase (complex I) is the largest multiprotein enzyme complex of the respiratory chain. The nuclear-encoded NDUFS8 (TYKY) subunit of complex I is highly conserved among eukaryotes and prokaryotes and contains two 4Fe4S ferredoxin consensus patterns, which have long been thought to provide the binding site for the iron-sulfur cluster N-2. The NDUFS8 cDNA contains an open reading frame of 633 bp, coding for 210 amino acids. Cycle sequencing of amplified NDUFS8 cDNA of 20 patients with isolated enzymatic complex I deficiency revealed two compound heterozygous transitions in a patient with neuropathologically proven Leigh syndrome. The first mutation was a C236T (P79L), and the second mutation was a G305A (R102H). Both mutations were absent in 70 control alleles and cosegregated within the family. A progressive clinical phenotype proceeding to death in the first months of life was expressed in the patient. In the 19 other patients with enzymatic complex I deficiency, no mutations were found in the NDUFS8 cDNA. This article describes the first molecular genetic link between a nuclear-encoded subunit of complex I and Leigh syndrome. PMID:9837812

  12. Sequence and regulation of a gene encoding a human 89-kilodalton heat shock protein.

    PubMed Central

    Hickey, E; Brandon, S E; Smale, G; Lloyd, D; Weber, L A


    Vertebrate cells synthesize two forms of the 82- to 90-kilodalton heat shock protein that are encoded by distinct gene families. In HeLa cells, both proteins (hsp89 alpha and hsp89 beta) are abundant under normal growth conditions and are synthesized at increased rates in response to heat stress. Only the larger form, hsp89 alpha, is induced by the adenovirus E1A gene product (M. C. Simon, K. Kitchener, H. T. Kao, E. Hickey, L. Weber, R. Voellmy, N. Heintz, and J. R. Nevins, Mol. Cell. Biol. 7:2884-2890, 1987). We have isolated a human hsp89 alpha gene that shows complete sequence identity with heat- and E1A-inducible cDNA used as a hybridization probe. The 5'-flanking region contained overlapping and inverted consensus heat shock control elements that can confer heat-inducible expression on a beta-globin reporter gene. The gene contained 10 intervening sequences. The first intron was located adjacent to the translation start codon, an arrangement also found in the Drosophila hsp82 gene. The spliced mRNA sequence contained a single open reading frame encoding an 84,564-dalton polypeptide showing high homology with the hsp82 to hsp90 proteins of other organisms. The deduced hsp89 alpha protein sequence differed from the human hsp89 beta sequence reported elsewhere (N. F. Rebbe, J. Ware, R. M. Bertina, P. Modrich, and D. W. Stafford (Gene 53:235-245, 1987) in at least 99 out of the 732 amino acids. Transcription of the hsp89 alpha gene was induced by serum during normal cell growth, but expression did not appear to be restricted to a particular stage of the cell cycle. hsp89 alpha mRNA was considerably more stable than the mRNA encoding hsp70, which can account for the higher constitutive rate of hsp89 synthesis in unstressed cells. Images PMID:2527334

  13. Distribution of Genes Encoding Nucleoid-Associated Protein Homologs in Plasmids

    PubMed Central

    Takeda, Toshiharu; Yun, Choong-Soo; Shintani, Masaki; Yamane, Hisakazu; Nojiri, Hideaki


    Bacterial nucleoid-associated proteins (NAPs) form nucleoprotein complexes and influence the expression of genes. Recent studies have shown that some plasmids carry genes encoding NAP homologs, which play important roles in transcriptional regulation networks between plasmids and host chromosomes. In this study, we determined the distributions of the well-known NAPs Fis, H-NS, HU, IHF, and Lrp and the newly found NAPs MvaT and NdpA among the whole-sequenced 1382 plasmids found in Gram-negative bacteria. Comparisons between NAP distributions and plasmid features (size, G+C content, and putative transferability) were also performed. We found that larger plasmids frequently have NAP gene homologs. Plasmids with H-NS gene homologs had less G+C content. It should be noted that plasmids with the NAP gene homolog also carried the relaxase gene involved in the conjugative transfer of plasmids more frequently than did those without the NAP gene homolog, implying that plasmid-encoded NAP homologs positively contribute to transmissible plasmids. PMID:21350637

  14. The Saccharomyces Cerevisiae Spt7 Gene Encodes a Very Acidic Protein Important for Transcription in Vivo

    PubMed Central

    Gansheroff, L. J.; Dollard, C.; Tan, P.; Winston, F.


    Mutations in the SPT7 gene of Saccharomyces cerevisiae originally were identified as suppressors of Ty and {delta small} insertion mutations in the 5' regions of the HIS4 and LYS2 genes. Other genes that have been identified in mutant hunts of this type have been shown to play a role in transcription. In this work we show that SPT7 is also important for proper transcription in vivo. We have cloned and sequenced the SPT7 gene and have shown that it encodes a large, acidic protein that is localized to the nucleus. The SPT7 protein contains a bromodomain sequence; a deletion that removes the bromodomain from the SPT7 protein causes no detectable mutant phenotype. Strains that contain an spt7 null mutation are viable but grow very slowly and have transcriptional defects at many loci including insertion mutations, Ty elements, the INO1 gene and the MFA1 gene. These transcriptional defects and other mutant phenotypes are similar to those caused by certain mutations in SPT15, which encodes the TATA binding protein (TBP). The similarity of the phenotypes of spt7 and spt15 mutants, including effects of spt7 mutations on the transcription start site of certain genes, suggests that SPT7 plays an important role in transcription initiation in vivo. PMID:7713415

  15. Expression of a synthetic gene encoding P2 ribonuclease from the extreme thermoacidophilic archaebacterium Sulfolobus solfataricus in mesophylic hosts.


    Fusi, P; Grisa, M; Mombelli, E; Consonni, R; Tortora, P; Vanoni, M


    This work reports the molecular cloning and expression of a synthetic gene encoding P2, a 7-kDa ribonuclease (RNase) previously isolated in our laboratory from the archaebacterium Sulfolobus solfataricus [Fusi et al., Eur. J. Biochem. 211 (1993) 305-310]. The P2-encoding synthetic gene was expressed in E. coli and in Saccharomyces cerevisiae. The recombinant (re-) protein was produced to approx. 1.5% of the total protein content in S. cerevisiae using the galactose-inducible GAL1 promoter and to 3% (tac/lac tandem promoters) or 6.5% (T7 promoter) in E. coli as judged by immunological and biochemical criteria. E. coli-produced P2 was purified to electrophoretic homogeneity through a one-step procedure, i.e., DEAE-Sephacel chromatography at pH 9.3. S. cerevisiae-produced P2 additionally required filtration through a Centricon-10 microconcentrator to obtain the same purity. The re-P2 was found to be indistinguishable from the Su. solfataricus enzyme on the basis of heat stability, pH optimum and RNA digestion pattern. Furthermore, monodimensional nuclear magnetic resonance showed that the E. coli- and Su. solfataricus-produced enzymes were structurally identical, the only exceptions being that Lys4 and Lys6 were not methylated in the re-enzyme, thus showing that lysine methylation does not play a role in P2 thermostabilization.

  16. Gene silencing by nuclear orphan receptors.


    Zhang, Ying; Dufau, Maria L


    Nuclear orphan receptors represent a large and diverse subgroup in the nuclear receptor superfamily. Although putative ligands for these orphan members remain to be identified, some of these receptors possess intrinsic activating, inhibitory, or dual regulatory functions in development, differentiation, homeostasis, and reproduction. In particular, gene-silencing events elicited by chicken ovalbumin upstream promoter-transcription factors (COUP-TFs); dosage-sensitive sex reversal-adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (DAX-1); germ cell nuclear factor (GCNF); short heterodimer partner (SHP); and testicular receptors 2 and 4 (TR2 and TR4) are among the best characterized. These orphan receptors are critical in controlling basal activities or hormonal responsiveness of numerous target genes. They employ multiple and distinct mechanisms to mediate target gene repression. Complex cross-talk exists between these orphan receptors at their cognate DNA binding elements and an array of steroid?nonsteroid hormone receptors, other transcriptional activators, coactivators and corepressors, histone modification enzyme complexes, and components of basal transcriptional components. Therefore, perturbation induced by these orphan receptors at multiple levels, including DNA binding activities, receptor homo- or heterodimerization, recruitment of cofactor proteins, communication with general transcriptional machinery, and changes at histone acetylation status and chromatin structures, may contribute to silencing of target gene expression in a specific promoter or cell-type context. Moreover, the findings derived from gene-targeting studies have demonstrated the significance of these orphan receptors' function in physiologic settings. Thus, COUP-TFs, DAX-1, GCNF, SHP, and TR2 and 4 are known to be required for multiple physiologic and biologic functions, including neurogenesis and development of the heart and vascular system steroidogenesis and sex

  17. Mutation in the Novel Nuclear-Encoded Mitochondrial Protein CHCHD10 in a Family with Autosomal Dominant Mitochondrial Myopathy

    PubMed Central

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E.; Mootha, Vamsi K.; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J.; Heiman-Patterson, Terry D.; Siddique, Teepu


    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or the nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of a previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established C22orf16 (later designated as CHCHD10) as the only high scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double missense mutation (R15S; G58R) in cis in CHCHD10 which encodes a coiled-coil helix coiled-coil helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria. PMID:25193783

  18. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin


    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  19. Isolation and expression of two aquaporin-encoding genes from the marine phanerogam Posidonia oceanica.


    Maestrini, Pierluigi; Giordani, Tommaso; Lunardi, Andrea; Cavallini, Andrea; Natali, Lucia


    Seagrasses such as Posidonia oceanica (L.) Delile are marine phanerogams, widespread in various seas, where they form large prairies representing dynamic substrates exceeding the area of the sediment surface several times over and allowing settlement of epiphyte organisms. Studying mechanisms involved in water transport in marine plants, we isolated two aquaporin-encoding genes, PoPIP1;1 and PoTIP1;1, showing high similarity to plasma membrane- and tonoplast-intrinsic protein-encoding genes, respectively. PoPIP1;1 is unique in the genome of P. oceanica, while PoTIP1;1 belongs to an aquaporin subfamily of at least four members. PoPIP1;1 and PoTIP1;1 encode functional proteins, as indicated by expression experiments in Xenopus oocytes. Both genes are constitutively expressed in the leaves, with higher levels of transcripts in young than in differentiated leaf tissues. Variations of salt concentration in aquarium determined different PoPIP1;1 and PoTIP1;1 transcript accumulation, indicating the existence of adaptation mechanisms related to gene expression also in marine plants, i.e. adapted to very high salt concentrations. Hyposalinity induced lower levels of PIP1 transcripts, while hypersalinity determined more PIP1 transcripts than normal salinity. TIP1 transcripts increased in response to both hypo- and hypersalinity after 2 days of treatment and went back to control levels after 5 d.

  20. Isolation and expression of two aquaporin-encoding genes from the marine phanerogam Posidonia oceanica.


    Maestrini, Pierluigi; Giordani, Tommaso; Lunardi, Andrea; Cavallini, Andrea; Natali, Lucia


    Seagrasses such as Posidonia oceanica (L.) Delile are marine phanerogams, widespread in various seas, where they form large prairies representing dynamic substrates exceeding the area of the sediment surface several times over and allowing settlement of epiphyte organisms. Studying mechanisms involved in water transport in marine plants, we isolated two aquaporin-encoding genes, PoPIP1;1 and PoTIP1;1, showing high similarity to plasma membrane- and tonoplast-intrinsic protein-encoding genes, respectively. PoPIP1;1 is unique in the genome of P. oceanica, while PoTIP1;1 belongs to an aquaporin subfamily of at least four members. PoPIP1;1 and PoTIP1;1 encode functional proteins, as indicated by expression experiments in Xenopus oocytes. Both genes are constitutively expressed in the leaves, with higher levels of transcripts in young than in differentiated leaf tissues. Variations of salt concentration in aquarium determined different PoPIP1;1 and PoTIP1;1 transcript accumulation, indicating the existence of adaptation mechanisms related to gene expression also in marine plants, i.e. adapted to very high salt concentrations. Hyposalinity induced lower levels of PIP1 transcripts, while hypersalinity determined more PIP1 transcripts than normal salinity. TIP1 transcripts increased in response to both hypo- and hypersalinity after 2 days of treatment and went back to control levels after 5 d. PMID:15653802

  1. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.


    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J


    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family. PMID:10080699

  2. Identification and transcriptional control of Caulobacter crescentus genes encoding proteins containing a cold shock domain.


    Lang, Elza A S; Marques, Marilis V


    The cold shock proteins are small peptides that share a conserved domain, called the cold shock domain (CSD), that is important for nucleic acid binding. The Caulobacter crescentus genome has four csp genes that encode proteins containing CSDs. Three of these (cspA, cspB, and cspC) encode peptides of about 7 kDa and are very similar to the cold shock proteins of other bacteria. Analysis by reverse transcription-PCR of the fourth gene (cspD), which was previously annotated as encoding a 7-kDa protein, revealed that the mRNA is larger and probably encodes a putative 21-kDa protein, containing two CSDs. A search in protein sequences databases revealed that this new domain arrangement has thus far only been found among deduced peptides of alpha-proteobacteria. Expression of each Caulobacter csp gene was studied both in response to cold shock and to growth phase, and we have found that only cspA and cspB are induced by cold shock, whereas cspC and cspD are induced at stationary phase, with different induction rates. The transcription start sites were determined for each gene, and a deletion mapping of the cspD promoter region defined a sequence required for maximal levels of expression, indicating that regulation of this gene occurs at the transcriptional level. Deletion of cspA, but not cspD, caused a reduction in viability when cells were incubated at 10 degrees C for prolonged times, suggesting that cspA is important for adaptation to a low temperature.

  3. Diversity of plasmids encoding histidine decarboxylase gene in Tetragenococcus spp. isolated from Japanese fish sauce.


    Satomi, Masataka; Furushita, Manabu; Oikawa, Hiroshi; Yano, Yutaka


    Nineteen isolates of histamine producing halophilic bacteria were isolated from four fish sauce mashes, each mash accumulating over 1000 ppm of histamine. The complete sequences of the plasmids encoding the pyruvoyl dependent histidine decarboxylase gene (hdcA), which is harbored in histamine producing bacteria, were determined. In conjunction, the sequence regions adjacent to hdcA were analyzed to provide information regarding its genetic origin. As reference strains, Tetragenococcus halophilus H and T. muriaticus JCM10006(T) were also studied. Phenotypic and 16S rRNA gene sequence analyses identified all isolates as T. halophilus, a predominant histamine producing bacteria present during fish sauce fermentation. Genetic analyses (PCR, Southern blot, and complete plasmid sequencing) of the histamine producing isolates confirmed that all the isolates harbored approximately 21-37 kbp plasmids encoding a single copy of the hdc cluster consisting of four genes related to histamine production. Analysis of hdc clusters, including spacer regions, indicated >99% sequence similarity among the isolates. All of the plasmids sequenced encoded traA, however genes related to plasmid conjugation, namely mob genes and oriT, were not identified. Two putative mobile genetic elements, ISLP1-like and IS200-like, respectively, were identified in the up- and downstream region of the hdc cluster of all plasmids. Most of the sequences, except hdc cluster and two adjacent IS elements, were diverse among plasmids, suggesting that each histamine producers harbored a different histamine-related plasmid. These results suggested that the hdc cluster was not spread by clonal dissemination depending on the specific plasmid and that the hdc cluster in tetragenococcal plasmid was likely encoded on transformable elements. PMID:21616548

  4. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    SciTech Connect

    Chen, Lei


    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  5. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.


    Perumal, N; Murugesan, S; Krishnan, P


    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates. PMID:27514959

  6. Overlapping protein-encoding genes in Pseudomonas fluorescens Pf0-1.


    Silby, Mark W; Levy, Stuart B


    The annotated genome sequences of prokaryotes seldom include overlapping genes encoded opposite each other by the same stretch of DNA. However, antisense transcription is becoming recognized as a widespread phenomenon in eukaryotes, and examples have been linked to important biological processes. Pseudomonas fluorescens inhabits aquatic and terrestrial environments, and can be regarded as an environmental generalist. The genetic basis for this ecological success is not well understood. In a previous search for soil-induced genes in P. fluorescens Pf0-1, ten antisense genes were discovered. These were termed 'cryptic' genes, as they had escaped detection by gene-hunting algorithms, and lacked easily recognizable promoters. In this communication, we designate such genes as 'non-predicted' or 'hidden'. Using reverse transcription PCR, we show that at each of six non-predicted gene loci chosen for study, transcription occurs from both 'sense' and 'antisense' DNA strands. Further, at least one of these hidden antisense genes, iiv14, encodes a protein, as does the sense transcript, both identified by poly-histidine tags on the C-terminus of the proteins. Mutational and complementation studies showed that this novel antisense gene was important for efficient colonization of soil, and multiple copies in the wildtype host improved the speed of soil colonization. Introduction of a stop codon early in the gene eliminated complementation, further implicating the protein in colonization of soil. We therefore designate iiv14 "cosA". These data suggest that, as is the case with eukaryotes, some bacterial genomes are more densely coded than currently recognized.

  7. Mammalian ets-1 and ets-2 genes encode highly conserved proteins

    SciTech Connect

    Watson, D.K.; McWilliams, M.J.; Lapis, P.; Lautenberger, J.A.; Schweinfest, C.W.; Papas, T.S. )


    Cellular ets sequences homologous to v-ets of the avian leukemia virus E26 are highly conserved. In mammals the ets sequences are dispersed on two separate chromosomal loci, called ets-1 and ets-2. To determine the structure of these two genes and identify the open reading frames that code for the putative proteins, the authors have sequenced human ets-1 cDNAs and ets-2 cDNA clones obtained from both human and mouse. The human ETS1 gene is capable of encoding a protein of 441 amino acids. This protein is >95% identical to the chicken c-ets-1 gene product. Thus, the human ETS1 gene is homologous to the chicken c-ets-1 gene, the protooncogene that the E26 virus transduced. Human and mouse ets-2 cDNA clones are closely related and contain open reading frames capable of encoding proteins of 469 and 468 residues, respectively. Direct comparison of these data with previously published finding indicates that ets is a family of genes whose members share distinct domains.

  8. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.


    de Boer, A P; van der Oost, J; Reijnders, W N; Westerhoff, H V; Stouthamer, A H; van Spanning, R J


    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994) Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans, Antonie Leeu wenhoek 66, 111-127]. norC and norB encode the cytochrome-c-containing subunit II and cytochrome b-containing subunit I of nitric-oxide reductase (NO reductase), respectively. norQ encodes a protein with an ATP-binding motif and has high similarity to NirQ from Pseudomonas stutzeri and Pseudomonas aeruginosa and CbbQ from Pseudomonas hydrogenothermophila. norE encodes a protein with five putative transmembrane alpha-helices and has similarity to CoxIII, the third subunit of the aa3-type cytochrome-c oxidases. norF encodes a small protein with two putative transmembrane alpha-helices. Mutagenesis of norC, norB, norQ and norD resulted in cells unable to grow anaerobically. Nitrite reductase and NO reductase (with succinate or ascorbate as substrates) and nitrous oxide reductase (with succinate as substrate) activities were not detected in these mutant strains. Nitrite extrusion was detected in the medium, indicating that nitrate reductase was active. The norQ and norD mutant strains retained about 16% and 23% of the wild-type level of NorC, respectively. The norE and norF mutant strains had specific growth rates and NorC contents similar to those of the wild-type strain, but had reduced NOR and NIR activities, indicating that their gene products are involved in regulation of enzyme activity. Mutant strains containing the norCBQDEF region on the broad-host-range vector pEG400 were able to grow anaerobically, although at a lower specific growth rate and with lower

  9. The Role of Nuclear Bodies in Gene Expression and Disease

    PubMed Central

    Morimoto, Marie; Boerkoel, Cornelius F.


    This review summarizes the current understanding of the role of nuclear bodies in regulating gene expression. The compartmentalization of cellular processes, such as ribosome biogenesis, RNA processing, cellular response to stress, transcription, modification and assembly of spliceosomal snRNPs, histone gene synthesis and nuclear RNA retention, has significant implications for gene regulation. These functional nuclear domains include the nucleolus, nuclear speckle, nuclear stress body, transcription factory, Cajal body, Gemini of Cajal body, histone locus body and paraspeckle. We herein review the roles of nuclear bodies in regulating gene expression and their relation to human health and disease. PMID:24040563

  10. Human TOP3: a single-copy gene encoding DNA topoisomerase III.

    PubMed Central

    Hanai, R; Caron, P R; Wang, J C


    A human cDNA encoding a protein homologous to the Escherichia coli DNA topoisomerase I subfamily of enzymes has been identified through cloning and sequencing. Expressing the cloned human cDNA in yeast (delta)top1 cells lacking endogenous DNA topoisomerase I yielded an activity in cell extracts that specifically reduces the number of supercoils in a highly negatively supercoiled DNA. On the basis of these results, the human gene containing the cDNA sequence has been denoted TOP3, and the protein it encodes has been denoted DNA topoisomerase III. Screening of a panel of human-rodent somatic hybrids and fluorescence in situ hybridization of cloned TOP3 genomic DNA to metaphase chromosomes indicate that human TOP3 is a single-copy gene located at chromosome 17p11.2-12. Images Fig. 2 PMID:8622991

  11. Identification of pKM101-encoded loci specifying potentially lethal gene products.

    PubMed Central

    Winans, S C; Walker, G C


    Two pKM101-encoded loci (designated kilA and kilB) have been identified which elaborate products that are potentially lethal to the bacterial cell. The lethal effects of each of these products is inhibited by two other plasmid-encoded loci, designated korA and korB (for kil override). Both korA and korB are required to control the lethality of either kil gene. In the presence of korA and korB both kil genes have other phenotypes: kilB is necessary for conjugal transfer, whereas kilA is responsible for the small-colony morphology on defined media that is characteristic of pKM101-containing strains (the Slo phenotype). PMID:3881396

  12. Brassica rapa has three genes that encode proteins associated with different neutral lipids in plastids of specific tissues.


    Kim, H U; Wu, S S; Ratnayake, C; Huang, A H


    Plastid lipid-associated protein (PAP), a predominant structural protein associated with carotenoids and other non-green neutral lipids in plastids, was shown to be encoded by a single nuclear gene in several species. Here we report three PAP genes in the diploid Brassica rapa; the three PAPs are associated with different lipids in specific tissues. Pap1 and Pap2 are more similar to each other (84% amino acid sequence identity) than to Pap3 (46% and 44%, respectively) in the encoded mature proteins. Pap1 transcript was most abundant in the maturing anthers (tapetum) and in lesser amounts in leaves, fruit coats, seeds, and sepals; Pap2 transcript was abundant only in the petals; and Pap3 transcript had a wide distribution, but at minimal levels in numerous organs. Immunoblotting after sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that most organs had several nanograms of PAP1 or PAP2 per milligram of total protein, the highest amounts being in the anthers (10.9 microg x mg(-1) PAP1) and petals (6.6 microg x mg(-1) PAP2), and that they had much less PAP3 (<0.02 microg x mg(-1)). In these organs PAP was localized in isolated plastid fractions. Plants were subjected to abiotic stresses; drought and ozone reduced the levels of the three Pap transcripts, whereas mechanical wounding and altering the light intensity enhanced their levels. We conclude that the PAP gene family consists of several members whose proteins are associated with different lipids and whose expressions are controlled by distinct mechanisms. Earlier reports of the expression of one Pap gene in various organs in a species need to be re-examined.

  13. Brassica rapa Has Three Genes That Encode Proteins Associated with Different Neutral Lipids in Plastids of Specific Tissues1

    PubMed Central

    Kim, Hyun Uk; Wu, Sherry S.H.; Ratnayake, Chandra; Huang, Anthony H.C.


    Plastid lipid-associated protein (PAP), a predominant structural protein associated with carotenoids and other non-green neutral lipids in plastids, was shown to be encoded by a single nuclear gene in several species. Here we report three PAP genes in the diploid Brassica rapa; the three PAPs are associated with different lipids in specific tissues. Pap1 and Pap2 are more similar to each other (84% amino acid sequence identity) than to Pap3 (46% and 44%, respectively) in the encoded mature proteins. Pap1 transcript was most abundant in the maturing anthers (tapetum) and in lesser amounts in leaves, fruit coats, seeds, and sepals; Pap2 transcript was abundant only in the petals; and Pap3 transcript had a wide distribution, but at minimal levels in numerous organs. Immunoblotting after sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that most organs had several nanograms of PAP1 or PAP2 per milligram of total protein, the highest amounts being in the anthers (10.9 μg mg−1 PAP1) and petals (6.6 μg mg−1 PAP2), and that they had much less PAP3 (<0.02 μg mg−1). In these organs PAP was localized in isolated plastid fractions. Plants were subjected to abiotic stresses; drought and ozone reduced the levels of the three Pap transcripts, whereas mechanical wounding and altering the light intensity enhanced their levels. We conclude that the PAP gene family consists of several members whose proteins are associated with different lipids and whose expressions are controlled by distinct mechanisms. Earlier reports of the expression of one Pap gene in various organs in a species need to be re-examined. PMID:11351096

  14. Transcript encoded on the opposite strand of the human steroid 21-hydroxylase/complement component C4 gene locus.

    PubMed Central

    Morel, Y; Bristow, J; Gitelman, S E; Miller, W L


    The gene encoding human adrenal steroid 21-hydroxylase (P450c21) and its highly similar pseudogene are duplicated in tandem with the two genes encoding the fourth component of human serum hemolytic complement (C4). This 60-kilobase gene complex, which lies within the major histocompatibility complex on the short arm of human chromosome 6, has been studied in considerable detail because genetic disorders in steroid 21-hydroxylation and in C4 are common. We have cloned a cDNA encoded by a previously unidentified gene in this region. This gene lies on the strand of DNA opposite from the strand containing the P450c21 and C4 genes, and it overlaps the last exon of P450c21. The newly identified gene encodes mRNAs of 3.5 and 1.8 kilobases that are expressed in the adrenal and in a Leydig cell tumor but are not expressed in nonsteroidogenic tissues. The sequence of the longest cDNA (2.7 kilobases) shows no similarity to known sequences available in two computerized data bases. The 5' end of this sequence is characterized by three repeats, each encoding about 100 amino acids flanked by potential sites for proteolytic cleavage. Although numerous studies have shown that gene deletions causing congenital adrenal hyperplasia occur in this region, none of these gene deletions extends into this newly identified gene, suggesting that it encodes an essential function. Images PMID:2475872

  15. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant.


    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes


    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  16. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.


    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting


    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  17. Cloning, sequencing, and expression of the gene encoding methylmalonyl-coenzyme A mutase from Streptomyces cinnamonensis.

    PubMed Central

    Birch, A; Leiser, A; Robinson, J A


    In streptomycetes, the conversion of succinyl-coenzyme A (CoA) into methylmalonyl-CoA, catalyzed by methylmalonyl-CoA mutase, most likely represents an important source of building blocks for polyketide antibiotic biosynthesis. In this work, the structural gene for methylmalonyl-CoA mutase from Streptomyces cinnamonensis was cloned by using a heterologous gene probe encoding the mutase from Propionibacterium shermanii. A 5,732-bp fragment was sequenced, within which four open reading frames were identified on one DNA strand. The two largest (mutA and mutB) overlap by 1 nucleotide and encode proteins of 616 and 733 residues showing high amino acid sequence similarities to each other and to methylmalonyl-CoA mutases from P. shermanii and mammalian sources. The transcriptional start of the mutA-mutB message, determined by S1 mapping, coincides with the first nucleotide of the translational start codon. Evidence that these two open reading frames encode a functional mutase in S. cinnamonensis was obtained by subcloning and expression in Streptomyces lividans TK64. The mutA and mutB gene products were detected in Western blots (immunoblots) with mutase-specific antibodies and by direct detection of mutase activity with a newly developed assay method. The methylmalonyl-CoA mutase was unable to catalyze the conversion of isobutyryl-CoA into n-butyryl-CoA, another closely related adenosylcobalamin-dependent rearrangement known to occur in S. cinnamonensis. Images PMID:8099072

  18. Localization of the human genes encoding the two subunits of general transcription factor TFIIE.


    Purrello, M; Di Pietro, C; Rapisarda, A; Motta, S; Pavone, L; Grzeschik, K H; Sichel, G


    TFIIE is a general transcription factor for class II genes composed of two types of subunits, a large one of 56 kDa and a small of 34 kDa. By Southern analysis at high and at low stringency of a panel of mouse/human hybrid cell lines and by in situ chromosomal hybridization, we have demonstrated that both polypeptides are encoded by genes that are single copy in the human genome and are localized at 3q13-q21 and at 8p12, respectively. A TaqI RFLP (heterozygosity index of 0.07) was detected at the locus for the 56-kDa subunit.

  19. Isolation of a GPD gene from Debaryomyces hansenii encoding a glycerol 3-phosphate dehydrogenase (NAD+).


    Thomé, Patricia E


    A gene homologous to GPD1, coding for glycerol-3-phosphate dehydrogenase (sn-glycerol 3-phosphate: NAD(+) oxidoreductase, EC, has been isolated from the halophilic yeast Debaryomyces hansenii by complementation of a Saccharomyces cerevisiae gpd1 Delta mutant. DNA sequencing of the complementing genomic clone indicated the existence of an open reading frame encoding a protein with 369 amino acids. Comparative analysis of the deduced amino acid sequence showed high similarity to homologous genes described for other eukaryotic GPD enzymes. The sequence has been submitted to the GenBank database under Accession No. AY333427.

  20. Molecular cloning, nucleotide sequence and expression of a Sulfolobus solfataricus gene encoding a class II fumarase.


    Colombo, S; Grisa, M; Tortora, P; Vanoni, M


    Fumarase catalyzes the interconversion of L-malate and fumarate. A Sulfolobus solfataricus fumarase gene (fumC) was cloned and sequenced. Typical archaebacterial regulatory sites were identified in the region flanking the fumC open reading frame. The fumC gene encodes a protein of 438 amino acids (47,899 Da) which shows several significant similarities with class II fumarases from both eubacterial and eukariotic sources as well as with aspartases. S. solfataricus fumarase expressed in Escherichia coli retains enzymatic activity and its thermostability is comparable to that of S. solfataricus purified enzyme despite a 11 amino acid C-terminal deletion.

  1. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    NASA Astrophysics Data System (ADS)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi


    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  2. Four genes from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin.


    Hammer, P E; Hill, D S; Lam, S T; Van Pée, K H; Ligon, J M


    Pyrrolnitrin is a secondary metabolite of Pseudomonas and Burkholderia sp. strains with strong antifungal activity. Production of pyrrolnitrin has been correlated with the ability of some bacteria to control plant diseases caused by fungal pathogens, including the damping-off pathogen Rhizoctonia solani. Pseudomonas fluorescens BL915 has been reported to produce pyrrolnitrin and to be an effective biocontrol agent for this pathogen. We have isolated a 32-kb genomic DNA fragment from this strain that contains genes involved in the biosynthesis of pyrrolnitrin. Marker-exchange mutagenesis of this DNA with Tn5 revealed the presence of a 6.2-kb region that contains genes required for the synthesis of pyrrolnitrin. The nucleotide sequence of the 6.2-kb region was determined and found to contain a cluster of four genes that are required for the production of pyrrolnitrin. Deletion mutations in any of the four genes resulted in a pyrrolnitrin-nonproducing phenotype. The putative coding sequences of the four individual genes were cloned by PCR and fused to the tac promoter from Escherichia coli. In each case, the appropriate tac promoter-pyrrolnitrin gene fusion was shown to complement the pyrrolnitrin-negative phenotype of the corresponding deletion mutant. Transfer of the four gene cluster to E. coli resulted in the production of pyrrolnitrin by this organism, thereby demonstrating that the four genes are sufficient for the production of this metabolite and represent all of the genes required to encode the pathway for pyrrolnitrin biosynthesis.

  3. Organization, structure, and expression of the gene encoding the rat substance P receptor.


    Hershey, A D; Dykema, P E; Krause, J E


    The gene for the rat substance P receptor has been cloned, its genomic structure determined, and the patterns of mRNA expression extensively analyzed. Unlike many genes encoding G protein-coupled receptors, the protein-coding region of this gene is divided into five exons consisting of 965, 195, 151, 197, and 2,010 base pairs. The substance P receptor gene extends more than 45 kilobases in length, and the splice sites for the exons occur at the borders of the sequences encoding putative membrane-spanning domains. The transcription initiation site has been defined by solution hybridization-nuclease protection and nucleotide sequence analyses, and lies downstream of a conventional TATA sequence. Substance P receptor mRNA levels in various tissues have been quantitated using solution hybridization-nuclease protection assays and were found to comprise from 0.00008 to 0.0016% of total RNA levels. Relatively high levels of substance P receptor mRNA are seen in the urinary bladder and the sublingual salivary gland, whereas moderate levels are observed for the submandibular salivary gland, striatum, hippocampus, midbrain, and olfactory bulb with lower levels in the remainder of the central nervous system and alimentary canal. These results are discussed in relation to the evolutionary role of multiple exons for a G protein-coupled receptor and with regard to the locations and mechanisms of substance P receptor gene expression.

  4. Structure, expression and phylogenetic analysis of the gene encoding actin I in Pneumocystis carinii.


    Fletcher, L D; McDowell, J M; Tidwell, R R; Meagher, R B; Dykstra, C C


    Actin is a major component of the cytoskeleton and one of the most abundant proteins found in eukaryotic cells. Comparative sequence analysis shows that this essential gene has been highly conserved throughout eukaryotic evolution making it useful for phylogenetic analysis. Complete cDNA clones for the actin-encoding gene were isolated and characterized from Pneumocystis carinii purified from immunosuppressed rat lungs. The nucleotide sequence encodes a protein of 376 amino acids. The predicted actin protein of P. carinii shares a high degree of conservation to other known actins. Only one major actin gene was found in P. carinii. The P. carinii actin sequence was compared with 30 other actin sequences. Gene phylogenies constructed using both neighbor-joining and protein parsimony methods places the P. carinii actin sequence closest to the majority of the fungi. Since the phylogenetic relationship of P. carinii to fungi and protists has been questioned, these data on the actin gene phylogeny support the grouping of P. carinii with the fungi.

  5. Harvesting of novel polyhydroxyalkanaote (PHA) synthase encoding genes from a soil metagenome library using phenotypic screening.


    Schallmey, Marcus; Ly, Anh; Wang, Chunxia; Meglei, Gabriela; Voget, Sonja; Streit, Wolfgang R; Driscoll, Brian T; Charles, Trevor C


    We previously reported the construction of metagenomic libraries in the IncP cosmid vector pRK7813, enabling heterologous expression of these broad-host-range libraries in multiple bacterial hosts. Expressing these libraries in Sinorhizobium meliloti, we have successfully complemented associated phenotypes of polyhydroxyalkanoate synthesis mutants. DNA sequence analysis of three clones indicates that the complementing genes are homologous to, but substantially different from, known polyhydroxyalkanaote synthase-encoding genes. Thus we have demonstrated the ability to isolate diverse genes for polyhydroxyalkanaote synthesis by functional complementation of defined mutants. Such genes might be of use in the engineering of more efficient systems for the industrial production of bioplastics. The use of functional complementation will also provide a vehicle to probe the genetics of polyhydroxyalkanaote metabolism and its relation to carbon availability in complex microbial assemblages. PMID:21631577

  6. Neurally expressed Drosophila genes encoding homologs of the NSF and SNAP secretory proteins.

    PubMed Central

    Ordway, R W; Pallanck, L; Ganetzky, B


    Several lines of investigation have now converged to indicate that the neurotransmitter release apparatus is formed by assembly of cytosolic proteins with proteins of the synaptic vesicle and presynaptic terminal membranes. We are undertaking a genetic approach in Drosophila melanogaster to investigate the functions of two types of cytosolic proteins thought to function in this complex: N-ethylmaleimide-sensitive fusion protein (NSF) and the soluble NSF attachment proteins (SNAPs). We have identified Drosophila homologs of the vertebrate and yeast NSF and SNAP genes. Both Drosophila genes encode polypeptides that closely resemble their vertebrate counterparts and are expressed in the nervous system; neither appears to be in a family of closely related Drosophila genes. These results indicate that the Drosophila NSF and SNAP genes are excellent candidates for mutational analysis of neurotransmitter release. Images PMID:8202553

  7. funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi

    PubMed Central


    Background RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. Description To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. Conclusions funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi. PMID:25522231

  8. Clusters of genes encoding fructan biosynthesizing enzymes in wheat and barley.


    Huynh, Bao-Lam; Mather, Diane E; Schreiber, Andreas W; Toubia, John; Baumann, Ute; Shoaei, Zahra; Stein, Nils; Ariyadasa, Ruvini; Stangoulis, James C R; Edwards, James; Shirley, Neil; Langridge, Peter; Fleury, Delphine


    Fructans are soluble carbohydrates with health benefits and possible roles in plant adaptation. Fructan biosynthetic genes were isolated using comparative genomics and physical mapping followed by BAC sequencing in barley. Genes encoding sucrose:sucrose 1-fructosyltransferase (1-SST), fructan:fructan 1-fructosyltransferase (1-FFT) and sucrose:fructan 6-fructosyltransferase (6-SFT) were clustered together with multiple copies of vacuolar invertase genes and a transposable element on two barley BAC. Intron-exon structures of the genes were similar. Phylogenetic analysis of the fructosyltransferases and invertases in the Poaceae showed that the fructan biosynthetic genes may have evolved from vacuolar invertases. Quantitative real-time PCR was performed using leaf RNA extracted from three wheat cultivars grown under different conditions. The 1-SST, 1-FFT and 6-SFT genes had correlated expression patterns in our wheat experiment and in existing barley transcriptome database. Single nucleotide polymorphism (SNP) markers were developed and successfully mapped to a major QTL region affecting wheat grain fructan accumulation in two independent wheat populations. The alleles controlling high- and low- fructan in parental lines were also found to be associated in fructan production in a diverse set of 128 wheat lines. To the authors' knowledge, this is the first report on the mapping and sequencing of a fructan biosynthetic gene cluster and in particular, the isolation of a novel 1-FFT gene from barley.

  9. Identification and characterization of multiple Spidroin 1 genes encoding major ampullate silk proteins in Nephila clavipes.


    Gaines, W A; Marcotte, W R


    Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSps) that consist of a large repeat array flanked by nonrepetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species.

  10. Identification and Characterization of Multiple Spidroin 1 Genes Encoding Major Ampullate Silk Proteins in Nephila clavipes

    PubMed Central

    Gaines, William A.; Marcotte, William R.


    Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSp) that consist of a large repeat array flanked by non-repetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We have experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species. PMID:18828837

  11. Clusters of genes encoding fructan biosynthesizing enzymes in wheat and barley.


    Huynh, Bao-Lam; Mather, Diane E; Schreiber, Andreas W; Toubia, John; Baumann, Ute; Shoaei, Zahra; Stein, Nils; Ariyadasa, Ruvini; Stangoulis, James C R; Edwards, James; Shirley, Neil; Langridge, Peter; Fleury, Delphine


    Fructans are soluble carbohydrates with health benefits and possible roles in plant adaptation. Fructan biosynthetic genes were isolated using comparative genomics and physical mapping followed by BAC sequencing in barley. Genes encoding sucrose:sucrose 1-fructosyltransferase (1-SST), fructan:fructan 1-fructosyltransferase (1-FFT) and sucrose:fructan 6-fructosyltransferase (6-SFT) were clustered together with multiple copies of vacuolar invertase genes and a transposable element on two barley BAC. Intron-exon structures of the genes were similar. Phylogenetic analysis of the fructosyltransferases and invertases in the Poaceae showed that the fructan biosynthetic genes may have evolved from vacuolar invertases. Quantitative real-time PCR was performed using leaf RNA extracted from three wheat cultivars grown under different conditions. The 1-SST, 1-FFT and 6-SFT genes had correlated expression patterns in our wheat experiment and in existing barley transcriptome database. Single nucleotide polymorphism (SNP) markers were developed and successfully mapped to a major QTL region affecting wheat grain fructan accumulation in two independent wheat populations. The alleles controlling high- and low- fructan in parental lines were also found to be associated in fructan production in a diverse set of 128 wheat lines. To the authors' knowledge, this is the first report on the mapping and sequencing of a fructan biosynthetic gene cluster and in particular, the isolation of a novel 1-FFT gene from barley. PMID:22864927

  12. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.


    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B


    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity.

  13. Identification of two rodent genes encoding homologues to seminal vesicle autoantigen: a gene family including the gene for prolactin-inducible protein.


    Yoshida, M; Kaneko, M; Kurachi, H; Osawa, M


    We cloned two new paralogous genes that encode proteins homologous to seminal vesicle autoantigen (SVA) in rodents. The open reading frame of one mouse gene encodes a polypeptide consisting of 151 amino acid residues which has 43% identity to SVA. RT-PCR analysis showed selective expression in the colon, and thus the protein was tentatively named "SVA-like protein in the colon (SLP-C)". The other mouse gene has an open reading frame encoding 144 amino acid residues with 46 and 65% identity to SVA and SLP-C, respectively. Expression of this gene was detected in the mammary, submaxillary, parotid, and lacrimal glands, and this protein was named "SLP in the mammary gland (SLP-M)". Orthologs of both genes were also found in rats. The three homologous genes coding for SVA, SLP-C, and SLP-M may have been generated by gene duplication with divergence of tissue expression in the course of evolution. They comprise a unique structurally-related gene family. Moreover, these genes share significant sequence homology with that of another secretory glycoprotein, prolactin-inducible protein.

  14. Cloning and identification of a novel human RNPC3 gene that encodes a protein with two RRM domains and is expressed in the cell nucleus.


    Zhao, Enpeng; Li, Jinsong; Xie, Yi; Jin, Wei; Zhang, Zhen; Chen, Jinzhong; Zeng, Li; Yin, Gang; Qian, Ji; Wu, Hai; Ying, Kang; Zhao, Robert Chunhua; Mao, YuMin


    The RNA recognition motifs (RRM) domain is one of the most common eukaryotic protein folds. Proteins containing RRM domains function in important steps of posttranscriptional regulation of gene expression and are involved in processing and transport of mRNA precursors. Here we describe the cloning and characterization of a novel human RNPC3 gene containing two RNA recognition motifs. The 1870 bp cDNA encodes a protein with 517 amino acids. It also contains two bipartite nuclear targeting sequences, which is important for nuclear targeting for proteins, especially those functioning in the cell nucleus. The GFP location of the RNPC3 gene product shows that this protein is located in the cell nucleus. RT-PCR reveals that it is abundantly expressed in kidney and pancreas.

  15. Organization, structure and alternate splicing of the murine RFC-1 gene encoding a folate transporter.


    Tolner, B; Roy, K; Sirotnak, F M


    The structural organization of the murine RFC-1 gene encoding a folate transporter has been determined. The entire nucleotide sequence of the L1210 cell RFC-1 cDNA, the 3'- and 5'-untranslated regions and the coding sequence were found to be distributed in eight exons, including six primary exons and alternates to exon 1 and exon 5, spanning 10.4 kb. Splice variants were identified in an L1210 cell cDNA library. The most common incorporates exons 1 through 6, encoding a 58-kDa polypeptide. The two least common incorporate exons 1 and 2, a truncated version of exon 3 and exons 4 through 6; or exons 1 through 4, an alternate to exon 5, and exon 6, encoding polypeptides of 53.6 and 43.4 kDa, respectively. A fourth variant reported earlier (GenBank/EMBL accession No. L36539) by others incorporates what we have found to be an alternate of exon 1 and exons 2 through 6. A relatively GC-rich region of the genome just 5' of exon 1 as well as exon 1a appears to be distinctly promoter-like and encodes a number of putative cis-acting elements. The findings pertaining to alternates of exon 1 suggest that the transcription of RFC-1 variants results from two different promoters.

  16. Response of NBS encoding resistance genes linked to both heat and fungal stress in Brassica oleracea.


    Kim, Young-Wook; Jung, Hee-Jeong; Park, Jong-In; Hur, Yoonkang; Nou, Ill-Sup


    Environmental stresses, including both abiotic and biotic stresses, cause considerable yield loss in crops and can significantly affect their development. Under field conditions, crops are exposed to a variety of concurrent stresses. Among abiotic and biotic stresses, heat and Fusarium oxysporum, are the most important factors affecting development and yield productivity of Brassica oleracea. Genes encoding the nucleotide-binding site (NBS) motif are known to be related to responses to abiotic and biotic stresses in many plants. Hence, this study was conducted to characterize the NBS encoding genes obtained from transcriptome profiles of two cabbage genotypes with contrasting responses to heat stress, and to test expression levels of selected NBS- leucine reich repeat (LRR) genes in F. oxysporum infected plants. We selected 80 up-regulated genes from a total of 264 loci, among which 17 were confirmed to be complete and incomplete members of the TIR-NBS-LRR (TNL) class families, and another identified as an NFYA-HAP2 family member. Expression analysis using qRT-PCR revealed that eight genes showed significant responses to heat shock treatment and F. oxysporum infection. Additionally, in the commercial B. oleracea cultivars with resistance to F. oxysporum, the Bol007132, Bol016084, and Bol030522 genes showed dramatically higher expression in the F. oxysporum resistant line than in the intermediate and susceptible lines. The results of this study will facilitate the identification and the development of molecular markers based on multiple stress resistance genes related to heat and fungal stress under field conditions in B. oleracea. PMID:25461701

  17. Mesocestoides corti (syn. vogae, cestoda): characterization of genes encoding cysteine-rich secreted proteins (CRISP).


    Britos, Leticia; Lalanne, Ana Inés; Castillo, Estela; Cota, Germán; Señorale, Mario; Marín, Mónica


    With the aim of identifying genes involved in development and parasite adaptation in cestodes, four coding sequences were isolated from the cyclophyllidean Mesocestoides corti larval stage (tetrathyridium). Genes showed significant similarity to the cysteine-rich secreted protein (CRISP) encoding genes, a large family that includes stage and tissue-specific genes from diverse organisms, many associated with crucial biological processes. The full-length McCrisp2 cDNA encodes a predicted protein of 202 residues in length, containing 10 cysteines and a putative signal peptide. The expression level of McCrisp2 was estimated by Real-time PCR, relative to GAPDH, showing an increase of 75% in segmented worms compared to tetrathyridia. By in situ hybridization, McCrisp2 expression was localized mainly at the larvae apical region of tetrathyridia and in the proglottids of segmented worms. Taken together our results suggest a possible role for M. corti CRISP proteins as ES products, potentially involved in differentiation processes as proposed for homologs in other organisms.

  18. A corm-specific gene encodes tarin, a major globulin of taro (Colocasia esculenta L. Schott).


    Bezerra, I C; Castro, L A; Neshich, G; de Almeida, E R; de Sá, M F; Mello, L V; Monte-Neshich, D C


    A gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (G1, ca. 28 kDa) was isolated from a lambda Charon 35 library, using a cDNA derived from a highly abundant corm-specific mRNA, as probe. The gene, named tar1, and the corresponding cDNA were characterized and compared. No introns were found. The major transcription start site was determined by primer extension analysis. The gene has an open reading frame (ORF) of 765 bp, and the deduced amino acid sequence indicated a precursor polypeptide of 255 residues that is post-translationally processed into two subunits of about 12.5 kDa each. The deduced protein is 45% homologous to curculin, a sweet-tasting protein found in the fruit pulp of Curculigo latifolia and 40% homologous to a mannose-binding lectin from Galanthus nivalis. Significant similarity was also found at the nucleic acid sequence level with genes encoding lectins from plant species of the Amaryllidaceae and Lilliaceae families.

  19. Comparative sequence analysis of double stranded RNA binding protein encoding gene of parapoxviruses from Indian camels.


    Nagarajan, G; Swami, Shelesh Kumar; Dahiya, Shyam Singh; Sivakumar, G; Tuteja, F C; Narnaware, S D; Mehta, S C; Singh, Raghvendar; Patil, N V


    The dsRNA binding protein (RBP) encoding gene of parapoxviruses (PPVs) from the Dromedary camels, inhabitating different geographical region of Rajasthan, India were amplified by polymerase chain reaction using the primers of pseudocowpoxvirus (PCPV) from Finnish reindeer and cloned into pGEM-T for sequence analysis. Analysis of RBP encoding gene revealed that PPV DNA from Bikaner shared 98.3% and 76.6% sequence identity at the amino acid level, with Pali and Udaipur PPV DNA, respectively. Reference strains of Bovine papular stomatitis virus (BPSV) and PCPV (reindeer PCPV and human PCPV) shared 52.8% and 86.9% amino acid identity with RBP gene of camel PPVs from Bikaner, respectively. But different strains of orf virus (ORFV) from different geographical areas of the world shared 69.5-71.7% amino acid identity with RBP gene of camel PPVs from Bikaner. These findings indicate that the camel PPVs described are closely related to bovine PPV (PCPV) in comparison to caprine and ovine PPV (ORFV). PMID:25685494

  20. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.


    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro


    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. PMID:26276404

  1. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    PubMed Central

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou


    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens. PMID:25514417

  2. West syndrome caused by homozygous variant in the evolutionary conserved gene encoding the mitochondrial elongation factor GUF1.


    Alfaiz, Ali Abdullah; Müller, Verena; Boutry-Kryza, Nadia; Ville, Dorothée; Guex, Nicolas; de Bellescize, Julitta; Rivier, Clotilde; Labalme, Audrey; des Portes, Vincent; Edery, Patrick; Till, Marianne; Xenarios, Ioannis; Sanlaville, Damien; Herrmann, Johannes M; Lesca, Gaétan; Reymond, Alexandre


    West syndrome (WS), defined by the triad of infantile spasms, pathognomonic hypsarrhythmia and developmental regression, is a rare epileptic disease affecting about 1:3500 live births. To get better insights on the genetic of this pathology, we exome-sequenced the members of a consanguineous family affected with isolated WS. We identified a homozygous variant (c.1825G>T/p.(Ala609Ser)) in the GUF1 gene in the three affected siblings. GUF1 encodes a protein essential in conditions that counteract faithful protein synthesis: it is able to remobilize stuck ribosomes and transiently inhibit the elongation process to optimize protein synthesis. The variant identified in the WS family changes an alanine residue conserved in all eukaryotic organisms and positioned within the tRNA-binding moiety of this nuclear genome-encoded mitochondrial translational elongation factor. Yeast complementation assays show that the activity of GUF1(A609S) is modified in suboptimal environments. We suggest a new link between improper assembly of respiratory chain complexes and WS.

  3. A baculovirus gene with a novel transcription pattern encodes a polypeptide with a zinc finger and a leucine zipper.

    PubMed Central

    Thiem, S M; Miller, L K


    An Autographa californica nuclear polyhedrosis virus gene encoding a 30-kilodalton polypeptide with two different sequence motifs characteristic of DNA-binding proteins was identified immediately downstream of the major capsid protein gene (vp39). The gene, CG30, was characterized by sequencing, transcriptional mapping, in vitro translation of hybrid-selected RNA, and comparison of the derived polypeptide sequence with published data bases. The initial ATG of the 792-base-pair CG30 open reading frame is two nucleotides downstream of the vp39 terminal TAA codon. Early transcripts of CG30 initiate within the vp39 coding sequence. At late times, bicistronic transcripts initiate from the vp39 promoter, continue through CG30, and terminate at the same site as the early transcripts. In vitro translation of hybrid-selected early CG30 RNA yields a polypeptide of 30 kilodaltons. The predicted CG30 polypeptide sequence has characteristics of a eucaryotic transcriptional activator and is novel in having two potential DNA-binding domains. A stretch of acidic residues bridges a zinc finger at the amino terminus and a leucine zipper with a flanking basic region at the carboxyl terminus. Images PMID:2507791

  4. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.


    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos


    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  5. Evolutionary fate of duplicate genes encoding aspartic proteinases. Nothepsin case study.


    Borrelli, Lucia; De Stasio, Roberta; Filosa, Silvana; Parisi, Elio; Riggio, Marilisa; Scudiero, Rosaria; Trinchella, Francesca


    Gene duplication is considered an important evolutionary mechanism leading to new gene functions. According to the classical model, one gene copy arising from gene duplication retains the ancestral function, whilst the other becomes subject to directional selection for some novel functions. Hence, according to this model, long-term persistence of two paralogous genes is possible only with the acquisition of functional innovation. In the absence of neofunctionalization, one of the duplicate genes may be lost following accumulation of deleterious mutations, ultimately leading to the loss of function. Recently, new mechanisms have been proposed according to which both paralogs are maintained without apparent neofunctionalization. In this paper we describe the molecular evolution of the aspartic proteinase gene family, with particular regard for the nothepsin gene, a sex- and tissue-specific form of aspartic proteinase active in fish. The finding of nothepsin in a reptile is indicative of the presence of this gene in organisms other than fish. However, the failure to find any nothepsin-like gene in avian, murine and human genome suggests that the gene has been lost in certain lineages during evolution. At variance with piscine nothepsin expressed exclusively in female liver under the estrogens action, the reptilian counterpart lacks both tissue and sex specificity, as it is constitutively expressed in different tissues of male and female specimens. The expression of the nothepsin gene in fish and lizard is accompanied by the expression of a paralogous gene encoding for cathepsin D. Functional divergence analysis indicates that cathepsin D accumulated amino acid substitutions, whereas nothepsin retained most of the ancestral functions. Phylogenetic analysis shows a preponderance of replacement substitutions compared to silent substitutions in the branch leading to the cathepsin D clade, whilst nothepsin evolves under negative selection. To explain the loss of the

  6. SUI-family genes encode phosphatidylserine synthases and regulate stem development in rice.


    Yin, Hengfu; Gao, Peng; Liu, Chengwu; Yang, Jun; Liu, Zhongchi; Luo, Da


    In vascular plants, the regulation of stem cell niche determines development of aerial shoot which consists of stems and lateral organs. Intercalary meristem (IM) controls internode elongation in rice and other grasses, however little attention has been paid to the underlying mechanism of stem cell maintenance. Here, we investigated the stem development in rice and showed that the Shortened Uppermost Internode 1 (SUI1) family of genes are pivotal for development of rice stems. We demonstrated that SUI-family genes regulate the development of IM for internode elongation and also the cell expansion of the panicle stem rachis in rice. The SUI-family genes encoded base-exchange types of phosphatidylserine synthases (PSSs), which possessed enzymatic activity in a yeast complementary assay. Overexpression of SUI1 and SUI2 caused outgrowths of internodes during vegetative development, and we showed that expression patterns of Oryza Sativa Homeobox 15 (OSH15) and Histone4 were impaired. Furthermore, genome-wide gene expression analysis revealed that overexpression and RNA knockdown of SUI-family genes affected downstream gene expression related to phospholipid metabolic pathways. Moreover, using Ultra-performance liquid chromatography-quadrupole time of flight-mass spectrometry, we analyzed PS contents in different genetic backgrounds of rice and showed that the quantity of very long chain fatty acids PS is affected by transgene of SUI-family genes. Our study reveals a new mechanism conveyed by the SUI1 pathway and provides evidence to link lipid metabolism with plant stem cell maintenance.

  7. Developmental expression of tobacco pistil-specific genes encoding novel extensin-like proteins.

    PubMed Central

    Goldman, M H; Pezzotti, M; Seurinck, J; Mariani, C


    We have sought to identify pistil-specific genes that can be used as molecular markers to study pistil development. For this purpose, a cDNA library was constructed from poly(A)+ RNA extracted from tobacco stigmas and styles at different developmental stages. Differential screening of this library led to the isolation of cDNA clones that correspond to genes preferentially or specifically expressed in the pistil. Seven of these cDNA clones encode proteins containing repetitions of the pentapeptide Ser-Pro4, which is a typical motif found in extensins. Unlike extensin genes, the extensin-like genes described here are not induced under stress conditions. RNA gel blot hybridizations demonstrated the organ-specific expression of the extensin-like genes and their temporal regulation during pistil development. After pollination, the transcript levels of the pistil-specific extensin-like genes change relative to levels in unpollinated pistils. In situ hybridization experiments showed that at least one of these pistil-specific genes is specifically expressed in cells of the transmitting tissue. The possible roles of the extensin-like proteins in pistils are discussed. PMID:1392607

  8. Structure and regulated expression of genes encoding fructose biphosphate aldolase in Trypanosoma brucei.

    PubMed Central

    Clayton, C E


    Low stringency hybridisation with a rabbit aldolase cDNA was used to select cDNA clones encoding fructose biphosphate aldolase in Trypanosoma brucei. A clone which is almost full length encodes a protein of 41 027 daltons which has 50% identity with rabbit aldolase A and slightly lower homology with B-type aldolases. The homologous mRNA is at least 6-fold more abundant in bloodstream trypomastigotes than in procyclic forms, as expected from measurements of enzyme activity. Genomic mapping results indicate that trypanosomes have four copies of the aldolase gene arranged as two copies of a tandem repeat. The protein has a short N-terminal extension (relative to other known aldolases) which could be involved in the glycosomal localisation of the enzyme. Images Fig. 1. Fig. 5. PMID:2998772

  9. [Identification of the Gene Encoding Nucleostemin in the Eye Tissues of Pleurodeles waltl].


    Markitantova, Y V; Avdonin, P P; Grigoryan, E N


    Nucleotide sequences were identified in the eye tissues (lens, retina, and retinal pigment epithelium) of the adult newt Pleurodeles waltl by the polymerase chain reaction with primers for the Ns gene. Sequencing showed that these nucleotide sequences belong to the Ns gene of the newt P. walt, which encodes the nucleolar protein nucleostemin. Structural analysis revealed a high homology of Ns nucleotide sequences of P. walt! with those of newts. Cynops pyrrhogaster and Notophthalmus viridescens. The expression of the Ns gene of P. walt, identified in the specialized eye cells of adult newts of the studied species, indicates that these differentiated cells retain some of the molecular characteristics inherent to the undifferentiated cells. PMID:26638232

  10. Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis.

    PubMed Central

    Dickinson, D P; Kubiniec, M A; Yoshimura, F; Genco, R J


    The gene encoding the fimbrial subunit protein of Bacteroides gingivalis 381, fimbrilin, has been cloned and sequenced. The gene was present as a single copy on the bacterial chromosome, and the codon usage in the gene conformed closely to that expected for an abundant protein. The predicted size of the mature protein was 35,924 daltons, and the secretory form may have had a 10-amino-acid, hydrophilic leader sequence similar to the leader sequences of the MePhe fimbriae family. The protein sequence had no marked similarity to known fimbrial sequences, and no homologous sequences could be found in other black-pigmented Bacteroides species, suggesting that fimbrillin represents a class of fimbrial subunit protein of limited distribution. Images PMID:2895100

  11. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease

    NASA Astrophysics Data System (ADS)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin


    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  12. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    SciTech Connect

    Kashtanov, S.N.; Kazakova, T.I.


    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  13. Genetic analysis of the gene cluster encoding nonfimbrial adhesin I from an Escherichia coli uropathogen.

    PubMed Central

    Ahrens, R; Ott, M; Ritter, A; Hoschützky, H; Bühler, T; Lottspeich, F; Boulnois, G J; Jann, K; Hacker, J


    The chromosomally encoded nonfimbrial adhesion I (NFA-I) from Escherichia coli urinary tract isolate 827 (O83:K1:H4) mediates agglutination of human erythrocytes. Subclones were constructed from an NFA-I-expressing recombinant E. coli K-12 clone, derived from a genomic library of E. coli 827. Minicell analysis and nucleotide sequencing revealed that proteins of 30.5, 9, 80, 15, and 19 kDa encoded on a stretch of approximately 6 kb are involved in the expression of NFA-I. NFA-I exhibits a polymeric structure, which disintegrates with elevated temperature into a 19-kDa monomer but with some relatively stable dimers. By using gold-conjugated monoclonal antibodies directed against NFA-I in electron microscopy, the adhesin could be localized on the outer surface of the recombinant E. coli K-12 bacteria. The nucleotide sequence of the nfaA gene encoding the monomeric structural subunit of the adhesin was determined. An open reading frame of 184 amino acids encoding the NfaA precursor, which is processed to the mature protein, was found; it consisted of 156 amino acids with a calculated molecular weight of 16,000. Peptide sequencing of the NFA-I subunit protein confirmed that this open reading frame corresponds to the NfaA coding locus. Furthermore, the nucleotide sequence of the open reading frame termed NfaE, located at the proximal part of the DNA stretch responsible for NFA-I expression, was elaborated. NfaE consists of 247 amino acids, including a presumptive 29-amino-acid signal peptide, leading to a molecular weight of 24,000 for the mature protein. The nfaE sequence shares homology with the 27-kDa CS3 protein, which is involved in the assembly of CS3 fibrillae, and might encode the 30.5-kDa protein, detected in minicells. Images PMID:8099066

  14. Cloning of the genes encoding two murine and human cochlear unconventional type I myosins

    SciTech Connect

    Crozet, F.; El Amraoui, Z.; Blanchard, S.


    Several lines of evidence indicate a crucial role for unconventional myosins in the function of the sensory hair cells of the inner ear. We report here the characterization of the cDNAs encoding two unconventional type I myosins from a mouse cochlear cDNA library. The first cDNA encodes a putative protein named Myo1c, which is likely to be the murine orthologue of the bullfrog myosin I{beta} and which may be involved in the gating of the mechanotransduction channel of the sensory hair cells. This myosin belongs to the group of short-tailed myosins I, with its tail ending shortly after a polybasic, TH-1-like domain. The second cDNA encodes a novel type I myosin Myo1f which displays three regions: a head domain with the conserved ATP- and actin-binding sites, a neck domain with a single IQ motif, and a tail domain with the tripartite structure initially described in protozoan myosins I. The tail of Myo1f includes (1) a TH-1 region rich in basic residues, which may interact with anionic membrane phospholipids; (2) a TH-2 proline-rich region, expected to contain an ATP-insensitive actin-binding site; and (3) an SH-3 domain found in a variety of cytoskeletal and signaling proteins. Northern blot analysis indicated that the genes encoding Myo1c and Myo1f display a widespread tissue expression in the adult mouse. Myo1c and Myo1f were mapped by in situ hybridization to the chromosomal regions 11D-11E and 17B-17C, respectively. The human orthologuous genes MYO1C and MYO1F were also characterized, and mapped to the human chromosomal regions 17p13 and 19p13.2- 19p1.3.3, respectively. 45 refs., 5 figs., 2 tabs.

  15. A gene encoding phosphatidylethanolamine N-methyltransferase from Acetobacter aceti and some properties of its disruptant.


    Hanada, T; Kashima, Y; Kosugi, A; Koizumi, Y; Yanagida, F; Udaka, S


    Phosphatidylcholine (PC) is a major component of membranes not only in eukaryotes, but also in several bacteria, including Acetobacter. To identify the PC biosynthetic pathway and its role in Acetobacter sp., we have studied Acetobacter aceti IFO3283, which is characterized by high ethanol oxidizing ability and high resistance to acetic acid. The pmt gene of A. aceti, encoding phosphatidylethanolamine N-methyltransferase (Pmt), which catalyzes methylation of phosphatidylethanolamine (PE) to PC, has been cloned and sequenced. One recombinant plasmid that complemented the PC biosynthesis was isolated from a gene library of the genomic DNA of A. aceti. The pmt gene encodes a polypeptide with molecular mass of either 25125, 26216, or 29052 for an about 27-kDa protein. The sequence of this gene showed significant similarity (44.3% identity in the similar sequence region) with the Rhodobacter sphaeroides pmtA gene which is involved in PE N-methylation. When the pmt gene was expressed in E. coli, which lacks PC, the Pmt activity and PC formation were clearly demonstrated. A. aceti strain harboring an interrupted pmt allele, pmt::Km, was constructed. The pmt disruption was confirmed by loss of Pmt and PC, and by Southern blot analyses. The null pmt mutant contained no PC, but tenfold more PE and twofold more phosphatidylglycerol (PG). The pmt disruptant did not show any dramatic effects on growth in basal medium supplemented with ethanol, but the disruption caused slow growth in basal medium supplemented with acetate. These results suggest that the lack of PC in the A. aceti membrane may be compensated by the increases of PE and PG by an unknown mechanism, and PC in A. aceti membrane is related to its acetic acid tolerance.

  16. Evolutionary Characteristics of Missing Proteins: Insights into the Evolution of Human Chromosomes Related to Missing-Protein-Encoding Genes.


    Xu, Aishi; Li, Guang; Yang, Dong; Wu, Songfeng; Ouyang, Hongsheng; Xu, Ping; He, Fuchu


    Although the "missing protein" is a temporary concept in C-HPP, the biological information for their "missing" could be an important clue in evolutionary studies. Here we classified missing-protein-encoding genes into two groups, the genes encoding PE2 proteins (with transcript evidence) and the genes encoding PE3/4 proteins (with no transcript evidence). These missing-protein-encoding genes distribute unevenly among different chromosomes, chromosomal regions, or gene clusters. In the view of evolutionary features, PE3/4 genes tend to be young, spreading at the nonhomology chromosomal regions and evolving at higher rates. Interestingly, there is a higher proportion of singletons in PE3/4 genes than the proportion of singletons in all genes (background) and OTCSGs (organ, tissue, cell type-specific genes). More importantly, most of the paralogous PE3/4 genes belong to the newly duplicated members of the paralogous gene groups, which mainly contribute to special biological functions, such as "smell perception". These functions are heavily restricted into specific type of cells, tissues, or specific developmental stages, acting as the new functional requirements that facilitated the emergence of the missing-protein-encoding genes during evolution. In addition, the criteria for the extremely special physical-chemical proteins were first set up based on the properties of PE2 proteins, and the evolutionary characteristics of those proteins were explored. Overall, the evolutionary analyses of missing-protein-encoding genes are expected to be highly instructive for proteomics and functional studies in the future.

  17. Regulation of genes encoding cellulolytic enzymes by Pal-PacC signaling in Aspergillus nidulans.


    Kunitake, Emi; Hagiwara, Daisuke; Miyamoto, Kentaro; Kanamaru, Kyoko; Kimura, Makoto; Kobayashi, Tetsuo


    Cellulosic biomass represents a valuable potential substitute for fossil-based fuels. As such, there is a strong need to develop efficient biotechnological processes for the enzymatic hydrolysis of cellulosic biomass via the optimization of cellulase production by fungi. Ambient pH is an important factor affecting the industrial production of cellulase. In the present study, we demonstrate that several Aspergillus nidulans genes encoding cellulolytic enzymes are regulated by Pal-PacC-mediated pH signaling, as evidenced by the decreased cellulase productivity of the palC mutant and pacC deletants of A. nidulans. The deletion of pacC was observed to result in delayed induction and decreased expression of the cellulase genes based on time course expression analysis. The genome-wide identification of PacC-regulated genes under cellobiose-induced conditions demonstrated that genes expressed in a PacC-dependent manner included 82 % of ClrB (a transcriptional activator of the cellulase genes)-regulated genes, including orthologs of various transporter and β-glucosidase genes considered to be involved in cellobiose uptake or production of stronger inducer molecules. Together with the significant overlap between ClrB- and PacC-regulated genes, the results suggest that PacC-mediated regulation of the cellulase genes involves not only direct regulation by binding to their promoter regions but also indirect regulation via modulation of the expression of genes involved in ClrB-dependent transcriptional activation. Our findings are expected to contribute to the development of more efficient industrial cellulase production methods.

  18. Structure and expression of chicken protein kinase PITSLRE-encoding genes.


    Li, H; Grenet, J; Valentine, M; Lahti, J M; Kidd, V J


    The human PITSLRE protein kinases (PK), members of the p34cdc2 kinase family named according to the single amino acid (aa) code of an important (PSTAIRE) regulatory region [Meyerson et al., EMBO J. 11 (1992) 2909-2917], are candidate tumor suppressor gene(s) localized to human chromosome 1p36.2 and a syntenic region of mouse chromosome 4 [Lahti et al., Nature Genet. 7 (1994) 370-375; Mock et al., Mammal. Genome 5 (1994) 191-192]. At least ten isoforms of this PK family are expressed from three duplicated and tandemly linked genes in humans [Xiang et al., J. Biol. Chem. 269 (1994) 15786-15794]. We have now isolated two different species of PITSLRE PK cDNAs from chicken that encode identical polypeptides, but are clearly expressed from different genes, based on nucleotide (nt) differences. Isolation of one of the corresponding chicken PITSLRE PK genes confirms that only one of the two species of PITSLRE mRNA is expressed from this gene. Comparison of the predicted avian PITSLRE PK aa sequence to human and mouse sequences shows a high degree of sequence identity (> 91%). Like humans, the PITSLRE PK genes in chickens must be closely linked, based on fluorescent in situ hybridization (FISH) localization of these genes to a single chicken microchromosome. PITSLRE PK mRNAs are expressed in two avian B- and T-cell lines. These results suggest that the PITSLRE PK gene family has been well conserved evolutionarily, that the gene duplication observed in humans is not a recent event, and that expression of redundant PITSLRE mRNAs is observed in different vertebrate species.

  19. A family of wound-induced genes in Populus shares common features with genes encoding vegetative storage proteins.


    Davis, J M; Egelkrout, E E; Coleman, G D; Chen, T H; Haissig, B E; Riemenschneider, D E; Gordon, M P


    Two wound-inducible cDNAs from poplar leaves show sequence identity to vegetative storage proteins (VSP) that accumulate seasonally in poplar bark tissues. We have compared the genomic organization, cDNA sequences and expression of the genes encoding the wound-inducible cDNAs (win4) with that of a bark VSP (called bark storage protein, or BSP). There appear to be several win4 genes in the poplar genome which segregate as a single locus and are therefore likely to be clustered. The same is true of the BSP genes. The win4 locus is linked (map distance of 5 cM) to the BSP locus, consistent with a common evolutionary origin of the genes. A near full-length win4 cDNA shows 75% sequence identity to BSP cDNAs. Both win4 and BSP are systemically wound-inducible; win4 transcripts accumulate in leaves and stems, whereas BSP transcripts accumulate almost exclusively in stems. A phloem transport-dependent signaling mechanism appears to be involved in systemic win4 expression after wounding. In contrast to BSP gene expression, win4 genes are not expressed in response to short day conditions. The data indicate win4 and BSP genes are differentially regulated, and their products may play important roles in the storage and reallocation of nitrogen in perennial plants.

  20. Full-genome identification and characterization of NBS-encoding disease resistance genes in wheat.


    Bouktila, Dhia; Khalfallah, Yosra; Habachi-Houimli, Yosra; Mezghani-Khemakhem, Maha; Makni, Mohamed; Makni, Hanem


    Host resistance is the most economical, effective and ecologically sustainable method of controlling diseases in crop plants. In bread wheat, despite the high number of resistance loci that have been cataloged to date, only few have been cloned, underlying the need for genomics-guided investigations capable of providing a prompt and acute knowledge on the identity of effective resistance genes that can be used in breeding programs. Proteins with a nucleotide-binding site (NBS) encoded by the major plant disease resistance (R) genes play an important role in the responses of plants to various pathogens. In this study, a comprehensive analysis of NBS-encoding genes within the whole wheat genome was performed, and the genome scale characterization of this gene family was established. From the recently published wheat genome sequence, we used a data mining and automatic prediction pipeline to identify 580 complete ORF candidate NBS-encoding genes and 1,099 partial-ORF ones. Among complete gene models, 464 were longer than 200 aa, among them 436 had less than 70 % of sequence identity to each other. This gene models set was deeply characterized. (1) First, we have analyzed domain architecture and identified, in addition to typical domain combinations, the presence of particular domains like signal peptides, zinc fingers, kinases, heavy-metal-associated and WRKY DNA-binding domains. (2) Functional and expression annotation via homology searches in protein and transcript databases, based on sufficient criteria, enabled identifying similar proteins for 60 % of the studied gene models and expression evidence for 13 % of them. (3) Shared orthologous groups were defined using NBS-domain proteins of rice and Brachypodium distachyon. (4) Finally, alignment of the 436 NBS-containing gene models to the full set of scaffolds from the IWGSC's wheat chromosome survey sequence enabled high-stringence anchoring to chromosome arms. The distribution of the R genes was found balanced

  1. The PCBP1 gene encoding poly(rC) binding protein I is recurrently mutated in Burkitt lymphoma.


    Wagener, Rabea; Aukema, Sietse M; Schlesner, Matthias; Haake, Andrea; Burkhardt, Birgit; Claviez, Alexander; Drexler, Hans G; Hummel, Michael; Kreuz, Markus; Loeffler, Markus; Rosolowski, Maciej; López, Cristina; Möller, Peter; Richter, Julia; Rohde, Marius; Betts, Matthew J; Russell, Robert B; Bernhart, Stephan H; Hoffmann, Steve; Rosenstiel, Philip; Schilhabel, Markus; Szczepanowski, Monika; Trümper, Lorenz; Klapper, Wolfram; Siebert, Reiner


    The genetic hallmark of Burkitt lymphoma is the translocation t(8;14)(q24;q32), or one of its light chain variants, resulting in IG-MYC juxtaposition. However, these translocations alone are insufficient to drive lymphomagenesis, which requires additional genetic changes for malignant transformation. Recent studies of Burkitt lymphoma using next generation sequencing approaches have identified various recurrently mutated genes including ID3, TCF3, CCND3, and TP53. Here, by using similar approaches, we show that PCBP1 is a recurrently mutated gene in Burkitt lymphoma. By whole-genome sequencing, we identified somatic mutations in PCBP1 in 3/17 (18%) Burkitt lymphomas. We confirmed the recurrence of PCBP1 mutations by Sanger sequencing in an independent validation cohort, finding mutations in 3/28 (11%) Burkitt lymphomas and in 6/16 (38%) Burkitt lymphoma cell lines. PCBP1 is an intron-less gene encoding the 356 amino acid poly(rC) binding protein 1, which contains three K-Homology (KH) domains and two nuclear localization signals. The mutations predominantly (10/12, 83%) affect the KH III domain, either by complete domain loss or amino acid changes. Thus, these changes are predicted to alter the various functions of PCBP1, including nuclear trafficking and pre-mRNA splicing. Remarkably, all six primary Burkitt lymphomas with a PCBP1 mutation expressed MUM1/IRF4, which is otherwise detected in around 20-40% of Burkitt lymphomas. We conclude that PCBP1 mutations are recurrent in Burkitt lymphomas and might contribute, in cooperation with other mutations, to its pathogenesis.

  2. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )


    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  3. Primary structure of the gene encoding the bifunctional dihydrofolate reductase-thymidylate synthase of Leishmania major.

    PubMed Central

    Beverley, S M; Ellenberger, T E; Cordingley, J S


    We have determined the nucleotide sequence of the dihydrofolate reductase-thymidylate synthetase (DHFR-TS) gene of the protozoan parasite Leishmania major (dihydrofolate reductase, EC and thymidylate synthase, EC The DHFR-TS protein is encoded by a single 1560-base-pair open reading frame within genomic DNA, in contrast to vertebrate DHFRs or mouse and phage T4 TSs, which contain intervening sequences. Comparisons of the DHFR-TS sequence with DHFR and TS sequences of other organisms indicate that the order of enzymatic activities within the bifunctional polypeptide chain is DHFR followed by TS, the Leishmania bifunctional DHFR-TS evolved independently and not through a phage T4-related intermediate, and the rate of evolution of both the DHFR and TS domains has not detectably changed despite the acquisition of new functional properties by the bifunctional enzyme. The Leishmania gene is 86% G+C in the third codon position, in contrast to genes of the parasite Plasmodium falciparum, which exhibit an opposite bias toward A+T. The DHFR-TS locus is encoded within a region of DNA amplified in methotrexate-resistant lines, as previously proposed. PMID:3458220

  4. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    SciTech Connect

    Lindner, I.; Ehlers, B. . E-mail:; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.


    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1{sub h}, ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1{sub h} and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation.

  5. Pollen specific expression of maize genes encoding actin depolymerizing factor-like proteins.

    PubMed Central

    Lopez, I; Anthony, R G; Maciver, S K; Jiang, C J; Khan, S; Weeds, A G; Hussey, P J


    In pollen development, a dramatic reorganization of the actin cytoskeleton takes place during the passage of the pollen grain into dormancy and on activation of pollen tube growth. A role for actin-binding proteins is implicated and we report here the identification of a small gene family in maize that encodes actin depolymerizing factor (ADF)-like proteins. The ADF group of proteins are believed to control actin polymerization and depolymerization in response to both intracellular and extracellular signals. Two of the maize genes ZmABP1 and ZmABP2 are expressed specifically in pollen and germinating pollen suggesting that the protein products may be involved in pollen actin reorganization. A third gene, ZmABP3, encodes a protein only 56% and 58% identical to ZmABP1 and ZmABP2, respectively, and its expression is suppressed in pollen and germinated pollen. The fundamental biochemical characteristics of the ZmABP proteins has been elucidated using bacterially expressed ZmABP3 protein. This has the ability to bind monomeric actin (G-actin) and filamentous actin (F-actin). Moreover, it decreases the viscosity of polymerized actin solutions consistent with an ability to depolymerize filaments. These biochemical characteristics, taken together with the sequence comparisons, support the inclusion of the ZmABP proteins in the ADF group. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8693008

  6. Cloning and characterization of glyceraldehyde-3-phosphate dehydrogenase encoding gene in Gracilaria/Gracilariopsis lemaneiformis

    NASA Astrophysics Data System (ADS)

    Ren, Xueying; Sui, Zhenghong; Zhang, Xuecheng


    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays important roles in various cellular processes. A cytosolic GAPDH encoding gene ( gpd) of Gracilaria/Gracilariopsis lemaneiformis was cloned and characterized. Deduced amino acid sequence of the enzyme of G. lemaneiformis had high homology with those of seven red algae. The 5'-untranslated regions of the GAPDHs encoding genes of these red algae varied greatly. GAPDHs of these red algae shared the highly conserved glyceraldehyde 3-phosphate dehydrogenase active site ASCTTNCL. However, such active site of Cyanidium caldarium was different from those of the other six algae at the last two residues (CL to LF), thus the spatial structure of its GAPDH active center may be different from those of the other six. Phylogenetic analysis indicated that GAPDH of G. lemaneiformis might have undergone an evolution similar to those of Porphyra yezoensis, Chondrus crispus, and Gracilaria verrucosa. C. caldarium had a closer evolutionary relationship with Cyanidioschyzon merolae than with Cyanidium sp. Virtual Northern blot analysis revealed that gpd of G. lemaneiformis expressed constitutively, which suggested that it might be house-keeping and could be adapted as an inner control in gene expression analysis of G. lemaneiformis.

  7. Characterization of the genes encoding beta-ketoadipate: succinyl-coenzyme A transferase in Pseudomonas putida.

    PubMed Central

    Parales, R E; Harwood, C S


    beta-Ketoadipate:succinyl-coenzyme A transferase (beta-ketoadipate:succinyl-CoA transferase) (EC carries out the penultimate step in the conversion of benzoate and 4-hydroxybenzoate to tricarboxylic acid cycle intermediates in bacteria utilizing the beta-ketoadipate pathway. This report describes the characterization of a DNA fragment from Pseudomonas putida that encodes this enzyme. The fragment complemented mutants defective in the synthesis of the CoA transferase, and two proteins of sizes appropriate to encode the two nonidentical subunits of the enzyme were produced in Escherichia coli when the fragment was placed under the control of a phage T7 promoter. DNA sequence analysis revealed two open reading frames, designated pcaI and pcaJ, that were separated by 8 bp, suggesting that they may comprise an operon. A comparison of the deduced amino acid sequence of the P. putida CoA transferase genes with the sequences of two other bacterial CoA transferases and that of succinyl-CoA:3-ketoacid CoA transferase from pig heart suggests that the homodimeric structure of the mammalian enzyme may have resulted from a gene fusion of the bacterial alpha and beta subunit genes during evolution. Conserved functional groups important to the catalytic activity of CoA transferases were also identified. Images PMID:1624453

  8. Cloning and characterization of oah, the gene encoding oxaloacetate hydrolase in Aspergillus niger.


    Pedersen, H; Hjort, C; Nielsen, J


    The enzyme oxaloacetate hydrolase (EC, which is involved in oxalate formation, was purified from Aspergillus niger. The native enzyme has a molecular mass of 360-440 kDa, and the denatured enzyme has a molecular mass of 39 kDa, as determined by gel electrophoresis. Enzyme activity is maximal at pH 7.0 and 45 degrees C. The fraction containing the enzyme activity contained at least five proteins. The N-terminal amino acid sequences of four of these proteins were determined. The amino acid sequences were aligned with EST sequences from A. niger, and an EST sequence that showed 100% identity to all four sequences was identified. Using this EST sequence the gene encoding oxaloacetate hydrolase (oah) was cloned by inverse PCR. It consists of an ORF of 1227 bp with two introns of 92 and 112 bp, respectively. The gene encodes a protein of 341 amino acids with a molecular mass of 37 kDa. Under the growth conditions tested, the highest oah expression was found for growth on acetate as carbon source. The gene was expressed only at pH values higher than 4.0.

  9. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    SciTech Connect

    Reynolds, P.; Weber, S.; Prakash, L.


    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures.

  10. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.


    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro


    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  11. Plant eR Genes That Encode Photorespiratory Enzymes Confer Resistance against Disease

    PubMed Central

    Taler, Dvir; Galperin, Marjana; Benjamin, Ido; Cohen, Yigal; Kenigsbuch, David


    Downy mildew caused by the oomycete pathogen Pseudoperonospora cubensis is a devastating foliar disease of cucurbits worldwide. We previously demonstrated that the wild melon line PI 124111F (PI) is highly resistant to all pathotypes of P. cubensis. That resistance was controlled genetically by two partially dominant, complementary loci. Here, we show that unlike other plant disease resistance genes, which confer an ability to resist infection by pathogens expressing corresponding avirulence genes, the resistance of PI to P. cubensis is controlled by enhanced expression of the enzymatic resistance (eR) genes At1 and At2. These constitutively expressed genes encode the photorespiratory peroxisomal enzyme proteins glyoxylate aminotransferases. The low expression of At1 and At2 in susceptible melon lines is regulated mainly at the transcriptional level. This regulation is independent of infection with the pathogen. Transgenic melon plants overexpressing either of these eR genes displayed enhanced activity of glyoxylate aminotransferases and remarkable resistance against P. cubensis. The cloned eR genes provide a new resource for developing downy mildew–resistant melon varieties. PMID:14688292

  12. Organization, structure, chromosomal assignment, and expression of the gene encoding the human endothelin-A receptor.


    Hosoda, K; Nakao, K; Tamura, N; Arai, H; Ogawa, Y; Suga, S; Nakanishi, S; Imura, H


    We have isolated and characterized the gene for the human endothelin-A receptor. Southern blot analyses demonstrated a single copy gene for the receptor. The gene spans more than 40 kilobases and contains eight exons and seven introns. Intron 1 exists in the 5'-noncoding region, and introns 2-7 occur in the coding region. The locations of introns 2-7 exist before or after the regions encoding the membrane-spanning domains. The transcription start site, determined by primer extension experiments, is 502 base pairs upstream of the methionine initiation codon. The 5'-flanking region lacks a typical TATA box but contains a potential SP-1-binding site 27 base pairs upstream of the transcription start site. Using human-rodent somatic hybrid cell DNA, the gene was assigned to human chromosome 4. Northern blot analyses revealed a 4.3-kilobase mRNA in a wide variety of human tissues, at the highest level in the aorta and at a substantial level in the cultured human mesangial cells. This is the first report of cloning of a gene for a member of the endothelin receptor family. The present study should give a clue to the discovery of possible disorders of the endothelin-A receptor, as well as facilitate the elucidation of the mechanisms by which the gene expression is regulated.

  13. Divergence among Genes Encoding the Elongation Factor Tu of Yersinia Species▿

    PubMed Central

    Isabel, Sandra; Leblanc, Éric; Boissinot, Maurice; Boudreau, Dominique K.; Grondin, Myrian; Picard, François J.; Martel, Eric A.; Parham, Nicholas J.; Chain, Patrick S. G.; Bader, Douglas E.; Mulvey, Michael R.; Bryden, Louis; Roy, Paul H.; Ouellette, Marc; Bergeron, Michel G.


    Elongation factor Tu (EF-Tu), encoded by tuf genes, carries aminoacyl-tRNA to the ribosome during protein synthesis. Duplicated tuf genes (tufA and tufB), which are commonly found in enterobacterial species, usually coevolve via gene conversion and are very similar to one another. However, sequence analysis of tuf genes in our laboratory has revealed highly divergent copies in 72 strains spanning the genus Yersinia (representing 12 Yersinia species). The levels of intragenomic divergence between tufA and tufB sequences ranged from 8.3 to 16.2% for the genus Yersinia, which is significantly greater than the 0.0 to 3.6% divergence observed for other enterobacterial genera. We further explored tuf gene evolution in Yersinia and other Enterobacteriaceae by performing directed sequencing and phylogenetic analyses. Phylogenetic trees constructed using concatenated tufA and tufB sequences revealed a monophyletic genus Yersinia in the family Enterobacteriaceae. Moreover, Yersinia strains form clades within the genus that mostly correlate with their phenotypic and genetic classifications. These genetic analyses revealed an unusual divergence between Yersinia tufA and tufB sequences, a feature unique among sequenced Enterobacteriaceae and indicative of a genus-wide loss of gene conversion. Furthermore, they provided valuable phylogenetic information for possible reclassification and identification of Yersinia species. PMID:18790860

  14. The priA gene encoding the primosomal replicative n' protein of Escherichia coli.

    PubMed Central

    Lee, E H; Masai, H; Allen, G C; Kornberg, A


    The Escherichia coli gene encoding protein n' has been isolated and named priA for primosomal protein A. Protein n' is absolutely required for the conversion of single-stranded phi X174 DNA to the duplex replicative form in an in vitro-reconstituted system. The gene maps to 88.7 minutes on the chromosome adjacent to the cytR locus. Soluble protein extracts from cells harboring the priA gene on a multicopy plasmid contained 45-fold more n' replication activity than wild-type extracts. Enhanced overproduction of greater than 1000-fold was achieved by replacing the natural Shine-Dalgarno sequence with that of the phage T7 phi 10 gene and placing this priA under the control of the T7 phage promoter and RNA polymerase. The priA sequence reveals a 732-amino acid open reading frame and a nucleotide-binding consensus site consistent with the size and ATPase activity of the purified protein. The gene for protein n has been named priB and the putative gene for protein n", priC. Images PMID:2162050

  15. A novel MFS transporter encoding gene in Fusarium verticillioides probably involved in iron-siderophore transport.


    López-Errasquín, Elena; González-Jaén, M Teresa; Callejas, Carmen; Vázquez, Covadonga


    The major facilitator superfamily (MFS) is a ubiquitous group of proteins involved in the transport of a wide range of compounds, including toxins produced by fungal species. In this paper, a novel MFS encoding gene (Fusarium iron related gene or FIR1), which had shown an up-regulation in fumonisin-inducing conditions, has been identified and characterized. The deduced protein sequence, which predicted 14 transmembrane domains typical of MFS transporters and its phylogenetic relationships with representative members of MFS transporters suggested a possible function of FIR1 as a siderophore transporter. A real-time RT-PCR protocol has been developed to analyse the expression pattern of the FIR1 gene in relation to siderophore production. The results indicated that the synthesis of extracellular siderophores by F. verticillioides observed in absence of extracellular iron was repressed in iron-supplemented cultures and showed a good correspondence with FIR1 gene expression. However, the pattern of FIR1 gene expression observed suggested that this gene did not seem to be functionally related to fumonisin production.

  16. KNQ1, a Kluyveromyces lactis gene encoding a transmembrane protein, may be involved in iron homeostasis.


    Marchi, Emmanuela; Lodi, Tiziana; Donnini, Claudia


    The original purpose of the experiments described in this article was to identify, in the biotechnologically important yeast Kluyveromyces lactis, gene(s) that are potentially involved in oxidative protein folding within the endoplasmic reticulum (ER), which often represents a bottleneck for heterologous protein production. Because treatment with the membrane-permeable reducing agent dithiothreitol inhibits disulfide bond formation and mimics the reducing effect that the normal transit of folding proteins has in the ER environment, the strategy was to search for genes that conferred higher levels of resistance to dithiothreitol when present in multiple copies. We identified a gene (KNQ1) encoding a drug efflux permease for several toxic compounds that in multiple copies conferred increased dithiothreitol resistance. However, the KNQ1 product is not involved in the excretion of dithiothreitol or in recombinant protein secretion. We generated a knq1 null mutant, and showed that both overexpression and deletion of the KNQ1 gene resulted in increased resistance to dithiothreitol. KNQ1 amplification and deletion resulted in enhanced transcription of iron transport genes, suggesting, for the membrane-associated protein Knq1p, a new, unexpected role in iron homeostasis on which dithiothreitol tolerance may depend.

  17. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.


    Jung, Yangjin; Matthews, Karl R


    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. PMID:27554144

  18. Ovine herpesvirus-2-encoded microRNAs target virus genes involved in virus latency.


    Riaz, Aayesha; Dry, Inga; Levy, Claire S; Hopkins, John; Grey, Finn; Shaw, Darren J; Dalziel, Robert G


    Herpesviruses encode microRNAs (miRNAs) that target both virus and host genes; however, their role in herpesvirus biology is understood poorly. We identified previously eight miRNAs encoded by ovine herpesvirus-2 (OvHV-2), the causative agent of malignant catarrhal fever (MCF), and have now investigated the role of these miRNAs in regulating expression of OvHV-2 genes that play important roles in virus biology. ORF20 (cell cycle inhibition), ORF50 (reactivation) and ORF73 (latency maintenance) each contain predicted targets for several OvHV-2 miRNAs. Co-transfection of miRNA mimics with luciferase reporter constructs containing the predicted targets showed the 5' UTRs of ORF20 and ORF73 contain functional targets for ovhv-miR-2 and ovhv2-miR-8, respectively, and the 3' UTR of ORF50 contains a functional target for ovhv2-miR-5. Transfection of BJ1035 cells (an OvHV-2-infected bovine T-cell line) with the relevant miRNA mimic resulted in a significant decrease in ORF50 and a smaller but non-significant decrease in ORF20. However, we were unable to demonstrate a decrease in ORF73. MCF is a disease of dysregulated lymphocyte proliferation; miRNA inhibition of ORF20 expression may play a role in this aberrant lymphocyte proliferation. The proteins encoded by ORF50 and ORF73 play opposing roles in latency. It has been hypothesized that miRNA-induced inhibition of virus genes acts to ensure that fluctuations in virus mRNA levels do not result in reactivation under conditions that are unfavourable for viral replication and our data supported this hypothesis. PMID:24172907

  19. Cloning and characterization of the gene encoding 1-cyclohexenylcarbonyl coenzyme A reductase from Streptomyces collinus.

    PubMed Central

    Wang, P; Denoya, C D; Morgenstern, M R; Skinner, D D; Wallace, K K; Digate, R; Patton, S; Banavali, N; Schuler, G; Speedie, M K; Reynolds, K A


    We report the cloning of the gene encoding the 1-cyclohexenylcarbonyl coenzyme A reductase (ChcA) of Streptomyces collinus, an enzyme putatively involved in the final reduction step in the formation of the cyclohexyl moiety of ansatrienin from shikimic acid. The cloned gene, with a proposed designation of chcA, encodes an 843-bp open reading frame which predicts a primary translation product of 280 amino acids and a calculated molecular mass of 29.7 kDa. Highly significant sequence similiarity extending along almost the entire length of the protein was observed with members of the short-chain alcohol dehydrogenase superfamily. The S. collinus chcA gene was overexpressed in Escherichia coli by using a bacteriophage T7 transient expression system, and a protein with a specific ChcA activity was detected. The E. coli-produced ChcA protein was purified and shown to have similar steady-state kinetics and electrophoretic mobility on sodium dodecyl sulfate-polyacrylamide gels as the enoyl-coenzyme A reductase protein prepared from S. collinus. The enzyme demonstrated the ability to catalyze, in vitro, three of the reductive steps involved in the formation of cyclohexanecarboxylic acid. An S. collinus chcA mutant, constructed by deletion of a genomic region comprising the 5' end of chcA, lost the ChcA activity and the ability to synthesize either cyclohexanecarboxylic acid or ansatrienin. These results suggest that chcA encodes the ChcA that is involved in catalyzing multiple reductive steps in the pathway that provides the cyclohexanecarboxylic acid from shikimic acid. PMID:8955309

  20. Nuclear AXIN2 represses MYC gene expression

    SciTech Connect

    Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S.


    Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling.

  1. The c-myc-regulated gene mrl encodes plasminogen activator inhibitor 1.

    PubMed Central

    Prendergast, G C; Diamond, L E; Dahl, D; Cole, M D


    The DNA sequence of the c-myc-regulated gene mrl (G. C. Prendergast and M. D. Cole, Mol. Cell. Biol. 9:124-134, 1989) reveals that it encodes plasminogen activator inhibitor 1 (PAI-1), a regulator of extracellular proteolysis. Comparison of the human and mouse PAI-1 promoters and cDNA 3' noncoding regions revealed several highly conserved sequence domains, potential targets for c-myc and other factors influencing PAI-1 expression. We discuss possible roles for PAI-1 in normal and neoplastic cell growth control. PMID:2406566

  2. Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida

    SciTech Connect

    Irie, S.; Doi, S.; Yorifuji, T.; Takagi, M.; Yano, K.


    The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed.

  3. Isolation and functional characterisation of the genes encoding Δ(8)-sphingolipid desaturase from Brassica rapa.


    Li, Shu-Fen; Song, Li-Ying; Yin, Wei-Bo; Chen, Yu-Hong; Chen, Liang; Li, Ji-Lin; Wang, Richard R-C; Hu, Zan-Min


    Δ(8)-Sphingolipid desaturase is the key enzyme that catalyses desaturation at the C8 position of the long-chain base of sphingolipids in higher plants. There have been no previous studies on the genes encoding Δ(8)-sphingolipid desaturases in Brassica rapa. In this study, four genes encoding Δ(8)-sphingolipid desaturases from B. rapa were isolated and characterised. Phylogenetic analyses indicated that these genes could be divided into two groups: BrD8A, BrD8C and BrD8D in group I, and BrD8B in group II. The two groups of genes diverged before the separation of Arabidopsis and Brassica. Though the four genes shared a high sequence similarity, and their coding desaturases all located in endoplasmic reticulum, they exhibited distinct expression patterns. Heterologous expression in Saccharomyces cerevisiae revealed that BrD8A/B/C/D were functionally diverse Δ(8)-sphingolipid desaturases that catalyse different ratios of the two products 8(Z)- and 8(E)-C18-phytosphingenine. The aluminium tolerance of transgenic yeasts expressing BrD8A/B/C/D was enhanced compared with that of control cells. Expression of BrD8A in Arabidopsis changed the ratio of 8(Z):8(E)-C18-phytosphingenine in transgenic plants. The information reported here provides new insights into the biochemical functional diversity and evolutionary relationship of Δ(8)-sphingolipid desaturase in plants and lays a foundation for further investigation of the mechanism of 8(Z)- and 8(E)-C18-phytosphingenine biosynthesis.

  4. Expression of Agrobacterium Homolog Genes Encoding T-complex Recruiting Protein under Virulence Induction Conditions

    PubMed Central

    Yang, Jing; Wu, Meixia; Zhang, Xin; Guo, Minliang; Huang, Zhiwei


    The proteins encoded by three Agrobacterial genes, atu5117, atu4860, and atu4856, are highly homologous to each other in amino acid sequence. All three proteins can bind to VirD2 and are named VBP1, VBP2, and VBP3 (VirD2-binding protein), respectively. VBP is involved in T-DNA transfer by recruiting the T-complex from the cytosol to the polar transport apparatus T4SS (type IV secretion system) and is defined as the “T-complex recruiting protein.” However, it remains unknown how these three homologous genes co-exist in a relatively small prokaryotic genome. To understand whether these three homologous genes are expressed differentially under virulence induction conditions, we examined the effects of virulence induction conditions, including various pH values, temperatures and acetosyringone (AS, an effective virulence inducer to Agrobacterium tumefaciens) concentrations, on the expression of the three VBP-encoding genes. Our data showed that vbp1 (atu5117) and vbp3 (atu4856) maintained constant expression under the tested induction conditions, whereas the expression of vbp2 (atu4860) was affected by the conditions. Culture conditions favorable to the expression of vbp2 differed from the reported induction conditions for other virulence proteins. In particular, the pH value was a crucial factor for the expression of vbp2. In addition, the deletion of vbp1 affected the expression of vbp2. Taken together, these results suggest that the mechanisms regulating the expression of these three homologous genes are different from the virulence induction mechanism and that VBP homologs are presumably involved in other biological processes in addition to T-complex recruitment. PMID:26696988

  5. Expression of Agrobacterium Homolog Genes Encoding T-complex Recruiting Protein under Virulence Induction Conditions.


    Yang, Jing; Wu, Meixia; Zhang, Xin; Guo, Minliang; Huang, Zhiwei


    The proteins encoded by three Agrobacterial genes, atu5117, atu4860, and atu4856, are highly homologous to each other in amino acid sequence. All three proteins can bind to VirD2 and are named VBP1, VBP2, and VBP3 (VirD2-binding protein), respectively. VBP is involved in T-DNA transfer by recruiting the T-complex from the cytosol to the polar transport apparatus T4SS (type IV secretion system) and is defined as the "T-complex recruiting protein." However, it remains unknown how these three homologous genes co-exist in a relatively small prokaryotic genome. To understand whether these three homologous genes are expressed differentially under virulence induction conditions, we examined the effects of virulence induction conditions, including various pH values, temperatures and acetosyringone (AS, an effective virulence inducer to Agrobacterium tumefaciens) concentrations, on the expression of the three VBP-encoding genes. Our data showed that vbp1 (atu5117) and vbp3 (atu4856) maintained constant expression under the tested induction conditions, whereas the expression of vbp2 (atu4860) was affected by the conditions. Culture conditions favorable to the expression of vbp2 differed from the reported induction conditions for other virulence proteins. In particular, the pH value was a crucial factor for the expression of vbp2. In addition, the deletion of vbp1 affected the expression of vbp2. Taken together, these results suggest that the mechanisms regulating the expression of these three homologous genes are different from the virulence induction mechanism and that VBP homologs are presumably involved in other biological processes in addition to T-complex recruitment. PMID:26696988

  6. Transcription of genes encoding iron and heme acquisition proteins of Haemophilus influenzae during acute otitis media.

    PubMed Central

    Whitby, P W; Sim, K E; Morton, D J; Patel, J A; Stull, T L


    Unencapsulated Haemophilus influenzae is the second most common etiologic agent of otitis media in children. H. influenzae requires heme for aerobic growth in vitro and is able to utilize hemoglobin and complexes of heme-hemopexin, heme-albumin, and hemoglobin-haptoglobin and ferritransferrin as sources of iron and heme in vitro. Several of the acquisition mechanisms have been characterized and been shown to be heme repressible in vitro. However, little is known about the expression of heme and/or iron acquisition mechanisms during infections in the middle ear. This study was performed to determine if the genes encoding heme and iron acquisition proteins are transcribed during in vivo growth and to compare these findings with those for samples grown in vitro. Reverse transcriptase PCR (RT-PCR) was used to analyze total RNA fractions derived from in vitro- and in vivo-grown H. influenzae. Genes encoding the transferrin-binding proteins TbpA and TbpB, the 100-kDa hemopexin-binding protein HxuA, and the hemoglobin-binding protein HgpA were transcribed during otitis media. Twelve middle ear fluid samples were analyzed by blind RT-PCR to determine the transcriptional status of these genes in H. influenzae during otitis media. Five isolates had transcripts corresponding to tbpA, tbpB, and hxuA. The presence of hgpA transcripts was variable, depending on the presence of hgpA in the genome of the H. influenzae isolate. Samples without H. influenzae gene transcripts contained other etiologic agents commonly causing otitis media. These data demonstrate that H. influenzae iron and/or heme acquisition genes are transcribed during otitis media and suggest that the microenvironment during acute otitis media starves H. influenzae of heme. PMID:9353052

  7. Metabolic regulation of the gene encoding glutamine-dependent asparagine synthetase in Arabidopsis thaliana.

    PubMed Central

    Lam, H M; Peng, S S; Coruzzi, G M


    Here, we characterize a cDNA encoding a glutamine-dependent asparagine synthetase (ASN1) from Arabidopsis thaliana and assess the effects of metabolic regulation on ASN1 mRNA levels. Sequence analysis shows that the predicted ASN1 peptide contains a purF-type glutamine-binding domain. Southern blot experiments and cDNA clone analysis suggest that ASN1 is the only gene encoding glutamine-dependent asparagine synthetase in A. thaliana. The ASN1 gene is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. This negative effect of light on ASN1 mRNA levels was shown to be mediated, at least in part, via the photoreceptor phytochrome. We also investigated whether light-induced changes in nitrogen to carbon ratios might exert a metabolic regulation of the ASN1 mRNA accumulation. These experiments demonstrated that the accumulation of ASN1 mRNA in dark-grown plants is strongly repressed by the presence of exogenous sucrose. Moreover, this sucrose repression of ASN1 expression can be partially rescued by supplementation with exogenous amino acids such as asparagine, glutamine, and glutamate. These findings suggest that the expression of the ASN1 gene is under the metabolic control of the nitrogen to carbon ratio in cells. This is consistent with the fact that asparagine, synthesized by the ASN1 gene product, is a favored compound for nitrogen storage and nitrogen transport in dark-grown plants. We have put forth a working model suggesting that when nitrogen to carbon ratios are high, the gene product of ASN1 functions to re-direct the flow of nitrogen into asparagine, which acts as a shunt for storage and/or long-distance transport of nitrogen. PMID:7846154

  8. Haploinsufficiency for NR3C1, the gene encoding the glucocorticoid receptor, in blastic plasmacytoid dendritic cell neoplasms.


    Emadali, Anouk; Hoghoughi, Neda; Duley, Samuel; Hajmirza, Azadeh; Verhoeyen, Els; Cosset, Francois-Loic; Bertrand, Philippe; Roumier, Christophe; Roggy, Anne; Suchaud-Martin, Céline; Chauvet, Martine; Bertrand, Sarah; Hamaidia, Sieme; Rousseaux, Sophie; Josserand, Véronique; Charles, Julie; Templier, Isabelle; Maeda, Takahiro; Bruder-Costa, Juliana; Chaperot, Laurence; Plumas, Joel; Jacob, Marie-Christine; Bonnefoix, Thierry; Park, Sophie; Gressin, Remy; Tensen, Cornelis P; Mecucci, Cristina; Macintyre, Elizabeth; Leroux, Dominique; Brambilla, Elisabeth; Nguyen-Khac, Florence; Luquet, Isabelle; Penther, Dominique; Bastard, Christian; Jardin, Fabrice; Lefebvre, Christine; Garnache, Francine; Callanan, Mary B


    Blastic plasmacytoid dendritic cell neoplasm (BPDCN) is a rare and highly aggressive leukemia for which knowledge on disease mechanisms and effective therapies are currently lacking. Only a handful of recurring genetic mutations have been identified and none is specific to BPDCN. In this study, through molecular cloning in an index case that presented a balanced t(3;5)(q21;q31) and molecular cytogenetic analyses in a further 46 cases, we identify monoallelic deletion of NR3C1 (5q31), encoding the glucocorticoid receptor (GCR), in 13 of 47 (28%) BPDCN patients. Targeted deep sequencing in 36 BPDCN cases, including 10 with NR3C1 deletion, did not reveal NR3C1 point mutations or indels. Haploinsufficiency for NR3C1 defined a subset of BPDCN with lowered GCR expression and extremely poor overall survival (P = .0006). Consistent with a role for GCR in tumor suppression, functional analyses coupled with gene expression profiling identified corticoresistance and loss-of-EZH2 function as major downstream consequences of NR3C1 deletion in BPDCN. Subsequently, more detailed analyses of the t(3;5)(q21;q31) revealed fusion of NR3C1 to a long noncoding RNA (lncRNA) gene (lincRNA-3q) that encodes a novel, nuclear, noncoding RNA involved in the regulation of leukemia stem cell programs and G1/S transition, via E2F. Overexpression of lincRNA-3q was a consistent feature of malignant cells and could be abrogated by bromodomain and extraterminal domain (BET) protein inhibition. Taken together, this work points to NR3C1 as a haploinsufficient tumor suppressor in a subset of BPDCN and identifies BET inhibition, acting at least partially via lncRNA blockade, as a novel treatment option in BPDCN.

  9. Haploinsufficiency for NR3C1, the gene encoding the glucocorticoid receptor, in blastic plasmacytoid dendritic cell neoplasms

    PubMed Central

    Emadali, Anouk; Hoghoughi, Neda; Duley, Samuel; Hajmirza, Azadeh; Verhoeyen, Els; Cosset, Francois-Loic; Bertrand, Philippe; Roumier, Christophe; Roggy, Anne; Suchaud-Martin, Céline; Chauvet, Martine; Bertrand, Sarah; Hamaidia, Sieme; Rousseaux, Sophie; Josserand, Véronique; Charles, Julie; Templier, Isabelle; Maeda, Takahiro; Bruder-Costa, Juliana; Chaperot, Laurence; Plumas, Joel; Jacob, Marie-Christine; Bonnefoix, Thierry; Park, Sophie; Gressin, Remy; Tensen, Cornelis P.; Mecucci, Cristina; Macintyre, Elizabeth; Leroux, Dominique; Brambilla, Elisabeth; Nguyen-Khac, Florence; Luquet, Isabelle; Penther, Dominique; Bastard, Christian; Jardin, Fabrice; Lefebvre, Christine; Garnache, Francine


    Blastic plasmacytoid dendritic cell neoplasm (BPDCN) is a rare and highly aggressive leukemia for which knowledge on disease mechanisms and effective therapies are currently lacking. Only a handful of recurring genetic mutations have been identified and none is specific to BPDCN. In this study, through molecular cloning in an index case that presented a balanced t(3;5)(q21;q31) and molecular cytogenetic analyses in a further 46 cases, we identify monoallelic deletion of NR3C1 (5q31), encoding the glucocorticoid receptor (GCR), in 13 of 47 (28%) BPDCN patients. Targeted deep sequencing in 36 BPDCN cases, including 10 with NR3C1 deletion, did not reveal NR3C1 point mutations or indels. Haploinsufficiency for NR3C1 defined a subset of BPDCN with lowered GCR expression and extremely poor overall survival (P = .0006). Consistent with a role for GCR in tumor suppression, functional analyses coupled with gene expression profiling identified corticoresistance and loss-of-EZH2 function as major downstream consequences of NR3C1 deletion in BPDCN. Subsequently, more detailed analyses of the t(3;5)(q21;q31) revealed fusion of NR3C1 to a long noncoding RNA (lncRNA) gene (lincRNA-3q) that encodes a novel, nuclear, noncoding RNA involved in the regulation of leukemia stem cell programs and G1/S transition, via E2F. Overexpression of lincRNA-3q was a consistent feature of malignant cells and could be abrogated by bromodomain and extraterminal domain (BET) protein inhibition. Taken together, this work points to NR3C1 as a haploinsufficient tumor suppressor in a subset of BPDCN and identifies BET inhibition, acting at least partially via lncRNA blockade, as a novel treatment option in BPDCN. PMID:27060168

  10. Construction, cloning, and expression of synthetic genes encoding spider dragline silk.


    Prince, J T; McGrath, K P; DiGirolamo, C M; Kaplan, D L


    Synthetic genes encoding recombinant spider silk proteins have been constructed, cloned, and expressed. Protein sequences were derived from Nephila clavipes dragline silk proteins and reverse-translated to the corresponding DNA sequences. Codon selection was chosen to maximize expression levels in Escherichia coli. DNA "monomer" sequences were multimerized to encode high molecular weight synthetic spider silks using a "head-to-tail" construction strategy. Multimers were cloned into a prokaryotic expression vector and the encoded silk proteins were expressed in E. coli upon induction with IPTG. Four multimer, ranging in size from 14.7 to 41.3 kDa, were chosen for detailed analysis. These proteins were isolated by immobilized metal affinity chromatography and purified using reverse-phase HPLC. The composition and identity of the purified proteins were confirmed by amino acid composition analysis, N-terminal sequencing, laser desorption mass spectroscopy, and Western analysis using antibodies reactive to native spider dragline silk. Circular dichroism measurements indicate that the synthetic spider silks have substantial beta-sheet structure.

  11. The HER-2/neu receptor tyrosine kinase gene encodes a secreted autoinhibitor

    PubMed Central

    Doherty, Joni K.; Bond, Chris; Jardim, Armando; Adelman, John P.; Clinton, Gail M.


    HER-2/neu (erbB-2) encodes an 185-kDa orphan receptor tyrosine kinase that is constitutively active as a dimer and displays potent oncogenic activity when overexpressed. Here we describe a secreted protein of ≈68 kDa, designated herstatin, as the product of an alternative HER-2 transcript that retains intron 8. This alternative transcript specifies 340 residues identical to subdomains I and II from the extracellular domain of p185HER-2 followed by a unique C-terminal sequence of 79 aa encoded by intron 8. The recombinant product of the alternative transcript specifically binds to HER-2-transfected cells with a KD of ≈14 nM and was chemically crosslinked to p185HER-2, whereas the intron encoded sequence alone also binds with high affinity to transfected cells and associates with p185 solubilized from cell extracts. The herstatin mRNA is expressed in normal human fetal kidney and liver, but is at reduced levels relative to p185HER-2 mRNA in carcinoma cells that contain an amplified HER-2 gene. Herstatin appears to be an inhibitor of p185HER-2, because it disrupts dimers, reduces tyrosine phosphorylation of p185, and inhibits the anchorage-independent growth of transformed cells that overexpress HER-2. PMID:10485918

  12. MHC class I-like genes in cattle, MHCLA, with similarity to genes encoding NK cell stimulatory ligands.


    Larson, Joshua H; Rebeiz, Mark J; Stiening, Chad M; Windish, Ryan L; Beever, Jonathan E; Lewin, Harris A


    A comparative genomics approach for mining databases of expressed sequence tags (ESTs) was used to identify two members of a novel MHC class I gene family in cattle. These paralogous genes, named MHC class I-like gene family A1 ( MHCLA1) and MHCLA2, were shown by phylogenetic analysis to be related to human and mouse genes encoding NK cell stimulatory ligands, ULBP, RAET, H60 and Raet-1. Radiation hybrid mapping placed cattle MHCLA1 on BTA9, which, on the basis of existing comparative mapping data, identified the ULBP, RAET1, H60 and Raet1 genes as homologues of the cattle MHCLA genes. However, the human and mouse orthologues of MHCLA1 and MHCLA2 could not be defined due to extensive sequence divergence from all known members of the ULBP1/ RAET1/H60/Raet1 gene family. The cattle MHCLA1 molecule is predicted to be missing an alpha(3) domain, similar to the human and mouse homologues. Like the human ULBP genes, MHCLA1 was found to be transcribed constitutively in a variety of fetal and adult tissues by RT-PCR. The patterns of hybridization obtained by Southern blotting using MHCLA1 as a probe and DNA from 14 species representing five mammalian orders suggests that the MHCLA genes evolved rapidly in the Cetartiodactyla. Previous findings demonstrating that ULBPs serve as ligands for the NK cell NKG2D stimulatory receptor, and that this interaction can be blocked by a human cytomegalovirus glycoprotein that binds to ULBPs, suggests that the extensive divergence found among the cattle, human and mouse MHCLA homologues is due to selection exerted by viral pathogens.

  13. Gene structure and spatiotemporal expression profile of tomato genes encoding YUCCA-like flavin monooxygenases: the ToFZY gene family.


    Expósito-Rodríguez, Marino; Borges, Andrés A; Borges-Pérez, Andrés; Pérez, José A


    The flavin monooxygenases (FMO) encoded by plant YUCCA genes are thought to catalyze a rate-limiting step in the tryptamine pathway for indole-3-acetic acid biosynthesis. Recent experiments with different plant models have indicate that YUCCA genes play essential roles in growth and development through their contribution to the local pool of free auxin. In this study we have characterized five new genes that encode YUCCA-like FMOs in the tomato genome (ToFZY2 to ToFZY6), including gene structure, conserved motifs and phylogenetic analyses. As a first step towards clarifying the individual functions of ToFZY genes, we have used quantitative real-time RT-PCR to conduct a systematic comparison of the steady-state mRNA levels of 6 ToFZY genes, in 33 samples representing major organs and the entire tomato life cycle. We followed an absolute quantification strategy which allowed us to cross-compare transcript levels among different ToFZY genes in a given spatiotemporal coordinate. Our results indicate that expression of ToFZY genes is temporally and spatially regulated, and that the distinctive expression pattern of each ToFZY gene partially overlaps with other members of the multigenic family. We compare our data with previous results in other plant species and make some predictions about the role of tryptamine pathway in tomato growth and development.

  14. The GyrA encoded gene: A pertinent marker for the phylogenetic revision of Helicobacter genus.


    Ménard, Armelle; Buissonnière, Alice; Prouzet-Mauléon, Valérie; Sifré, Elodie; Mégraud, Francis


    Phylogeny of Epsilonproteobacteria is based on sequencing of the 16S rRNA gene. However, this gene is not sufficiently discriminatory in Helicobacter species and alternative markers would be useful. In this study, the 16S rRNA, gyrA, hsp60, gyrB, and ureA-ureB gene sequences, as well as GyrA, HSP60 and GyrB protein sequences were analyzed as tools to support Helicobacter species phylogeny: 72 Helicobacter strains, belonging to 41 species of which 36 are validated species, were included. Results of the phylogenetic reconstructions of the GyrA gene encoded protein (approximately 730 residues) indicated the most stable trees to bootstrap resampling with a good separation of Helicobacter taxa, especially between gastric and enterohepatic species. Moreover, the GyrA tree revealed high similarity with that of the gyrB and ureA-ureB genes (restricted to urease-positive Helicobacter species). However, some differences in clustering were observed when compared to the hsp60 and 23S rRNA gene trees. Altogether, these revised phylogenies (except the 16S rRNA gene for enterohepatic Helicobacters) enabled reliable clustering of Helicobacter cinaedi and 'Flexispira' strains, determined a reliable position for Helicobacter mustelae (except the hsp60 gene) and for novel Helicobacter species proposed such as 'Helicobacter sanguini', 'Helicobacter apodemus' or 'Helicobacter winghamensis', and suggest that Helicobacter species MIT 09-6949 and MIT 05-5293 isolated from rodents constitute novel species. Although they are not commonly used to study the phylogeny of Epsilonproteobacteria, protein sequences and, in particular, the GyrA protein sequence may constitute pertinent phylogenetic markers for Helicobacter genus.

  15. Generation of Interleukin-2 Receptor Gamma Gene Knockout Pigs from Somatic Cells Genetically Modified by Zinc Finger Nuclease-Encoding mRNA

    PubMed Central

    Watanabe, Masahito; Nakano, Kazuaki; Matsunari, Hitomi; Matsuda, Taisuke; Maehara, Miki; Kanai, Takahiro; Kobayashi, Mirina; Matsumura, Yukina; Sakai, Rieko; Kuramoto, Momoko; Hayashida, Gota; Asano, Yoshinori; Takayanagi, Shuko; Arai, Yoshikazu; Umeyama, Kazuhiro; Nagaya, Masaki; Hanazono, Yutaka; Nagashima, Hiroshi


    Zinc finger nuclease (ZFN) is a powerful tool for genome editing. ZFN-encoding plasmid DNA expression systems have been recently employed for the generation of gene knockout (KO) pigs, although one major limitation of this technology is the use of potentially harmful genome-integrating plasmid DNAs. Here we describe a simple, non-integrating strategy for generating KO pigs using ZFN-encoding mRNA. The interleukin-2 receptor gamma (IL2RG) gene was knocked out in porcine fetal fibroblasts using ZFN-encoding mRNAs, and IL2RG KO pigs were subsequently generated using these KO cells through somatic cell nuclear transfer (SCNT). The resulting IL2RG KO pigs completely lacked a thymus and were deficient in T and NK cells, similar to human X-linked SCID patients. Our findings demonstrate that the combination of ZFN-encoding mRNAs and SCNT provides a simple robust method for producing KO pigs without genomic integration. PMID:24130776

  16. The neurofibromatosis 2 (NF2) tumor suppressor gene encodes multiple alternatively spliced transcripts.


    Pykett, M J; Murphy, M; Harnish, P R; George, D L


    Neurofibromatosis type 2 (NF2) is an autosomal dominantly-inherited disorder predisposing affected individuals to tumors of multiple cell types in the central nervous system, including meningiomas. A candidate tumor suppressor gene for this disorder has recently been cloned; the protein product of this gene has a predicted role in linking integral membrane proteins with the cytoskeleton. Utilizing reverse transcription-polymerase chain reaction (RT-PCR) analyses, we have identified a number of alternatively spliced transcription products encoded by the NF2 gene. These alternative splice variants were detected in RNA isolated from several sources, including primary leptomeningeal tissue and an established line of leptomeningeal cells (LMC). Several of these variants delete previously identified coding regions of this gene. Moreover, two of these splice variants add previously unrecognized exons to the NF2 coding region. These identified splice forms will serve as natural reagents for the functional dissection of the NF2 protein product(s). They also should be considered in studies investigating mutations of this gene in members of NF2 families and in tumor analyses.

  17. Localization of genes encoding three distinct flavin-containing monooxygenases to human chromosome 1q

    SciTech Connect

    Shephard, E.A.; Fox, M.F.; Povey, S. ); Dolphin, C.T.; Phillips, I.R.; Smith, R. )


    The authors have used the polymerase chain reaction to map the gene encoding human flavin-containing monooxygenase (FMO) form II (N. Lomri, Q. Gu, and J. R. Cashman, 1992, Proc. Natl. Acad. Sci. USA 89: 1685--1689) to chromosome 1. They propose the designation FMO3 for this gene as it is the third FMO gene to be mapped. The two other human FMO genes identified to date, FMO1 and FMO2, are also located on chromosome 1 (C. Dolphin, E. A. Shephard, S. Povey, C. N. A. Palmer, D. M. Ziegler, R. Ayesh, R. L. Smith, and 1. R. Phillips, 1991, J. Biol. Chem. 266: 12379--12385; C. Dolphin, E. A. Shephard, S. F. Povey, R. L. Smith, and I. R. Phillips, 1992, Biochem. J. 286: 261--267). The localization of FMO1, FMO2, and FMO3 has been refined to the long arm of chromosome 1. Analysis of human metaphase chromosomes by in situ hybridization confirmed the mapping of FMO1 and localized this gene more precisely to 1 q23-q25. 28 refs., 3 figs., 2 tabs.

  18. The Maltase Involved in Starch Metabolism in Barley Endosperm Is Encoded by a Single Gene.


    Andriotis, Vasilios M E; Saalbach, Gerhard; Waugh, Robbie; Field, Robert A; Smith, Alison M


    During germination and early seedling growth of barley (Hordeum vulgare), maltase is responsible for the conversion of maltose produced by starch degradation in the endosperm to glucose for seedling growth. Despite the potential relevance of this enzyme for malting and the production of alcoholic beverages, neither the nature nor the role of maltase is fully understood. Although only one gene encoding maltase has been identified with certainty, there is evidence for the existence of other genes and for multiple forms of the enzyme. It has been proposed that maltase may be involved directly in starch granule degradation as well as in maltose hydrolysis. The aim of our work was to discover the nature of maltase in barley endosperm. We used ion exchange chromatography to fractionate maltase activity from endosperm of young seedlings, and we partially purified activity for protein identification. We compared maltase activity in wild-type barley and transgenic lines with reduced expression of the previously-characterised maltase gene Agl97, and we used genomic and transcriptomic information to search for further maltase genes. We show that all of the maltase activity in the barley endosperm can be accounted for by a single gene, Agl97. Multiple forms of the enzyme most likely arise from proteolysis and other post-translational modifications. PMID:27011041

  19. Expression of the subtilisin Carlsberg-encoding gene in Bacillus licheniformis and Bacillus subtilis.


    Jacobs, M F


    The cloning and sequence of the 5' untranslated region (5'-UTR) of the Bacillus licheniformis (Bl) 6816 subtilisin Carlsberg gene (subC) are reported here. The 5' and 3' ends of subC transcripts were characterized, and the promoter identified. Expression was studied using a fused lacZ reporter gene integrated into the chromosome of heterologous host Bacillus subtilis (Bs). beta Gal activities of mutants deleted within the promoter region identified a region which is required for stimulation by the transcriptional activator proteins, DegU and DegQ. This region is close to the transcription start point (tsp), and is adjacent to a sequence homologous to that involved in DegU/Q stimulation of the Bs subtilisin gene, aprE. Expression of subC in Bs was optimized by the use of heterologous promoter and by the deletion of UTR sequences predicted to be involved in secondary structures in the native subC mRNA. Sequence comparison with other subtilisin Carlsberg-type-encoding genes revealed a high degree of conservation of the entire 5'-UTR, including regulatory sequences and promoter, as well as part of the structural gene.

  20. Characterization of the pelL gene encoding a novel pectate lyase of Erwinia chrysanthemi 3937.


    Lojkowska, E; Masclaux, C; Boccara, M; Robert-Baudouy, J; Hugouvieux-Cotte-Pattat, N


    Erwinia chrysanthemi 3937 secretes five major isoenzymes of pectate lyases encoded by the pelA, pelB, pelC, pelD and pelE genes. Recently, a new set of pectate lyases was identified in E. chrysanthemi mutants deleted of those pel genes. We cloned the pelL gene, encoding one of these secondary pectate lyases of E. chrysanthemi 3937, from a genomic bank of a strain deleted of the five major pel genes. The nucleotide sequence of the region containing the pelL gene was determined. The pelL reading frame is 1275 bases long, corresponding to a protein of 425 amino acids including a typical amino-terminal signal sequence of 25 amino acids. Comparison of the amino acid sequences of PelL and the exo-pectate lyase PelX of E. chrysanthemi EC16 revealed a low homology, limited to 220 residues of the central part of the proteins. No homology was detected with other bacterial pectinolytic enzymes. Regulation of pelL transcription was analysed using gene fusion. As shown for the other pel genes, the transcription of pelL is dependent on various environmental conditions. It is induced by pectic catabolic products and affected by growth phase, temperature, iron starvation, osmolarity, anaerobiosis, nitrogen starvation and catabolite repression. Regulation of pelL expression appeared to be independent of the KdgR repressor, which controls all the steps of pectin catabolism. In contrast, the pecS gene, which is involved in regulation of the synthesis of the major pectate lyases and of cellulase, also appeared to be involved in pelL expression. The PelL protein is able to macerate plant tissue. This enzyme has a basic isoelectric point, presents an endo-cleaving activity on polygalacturonate or partially methylated pectin, with a basic pH optimum and an absolute requirement for Ca2+. The pelL mutant displayed a reduced virulence on potato tubers and Saintpaulia ionantha plants, demonstrating the important role of this enzyme in soft-rot disease. PMID:8577252

  1. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    NASA Astrophysics Data System (ADS)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin


    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  2. Expression of the gene encoding growth hormone in the human mammary gland

    SciTech Connect

    Mol, J.A.; Misdorp, W.; Rijnberk, A.


    Progestins cause a syndrome of growth hormone (GH) excess and enhanced mammary tumorigenesis in the dog. This has been regarded as being specific for the dog. Recently we reported that progestin-induced GH excess originates from foci of hyperplastic ductular epithelium of the mammary gland in the dog. In the present report we demonstrate by reverse-transcriptase PCR and immunohistochemistry that a main factor involved in tissue growth, i.e. GH, is also expressed in normal and neoplastic human mammary glands. The gene expressed in the human mammary gland proved to be identical to the gene encoding GH in the pituitary gland. The role of progesterone in the GH expression of the human mammary gland needs, however, to be proven. It is hypothesized that this locally produced hGH may play a pathogenetic role in breast cancer. 21 refs., 2 figs., 1 tab.

  3. [Lignocellulose degrading bacteria and their genes encoding cellulase/hemicellulase in rumen--a review].


    Chen, Furong; Zhu, Yaxin; Dong, Xiuzhu; Liu, Lihua; Huang, Li; Dai, Xin


    Rumen of ruminant animals is known as a natural reactor involved in highly efficient lignocelluloses degradation. Rumen fibrolytic microbes have attracted an increasing attention for their potential value in biofuel research. Studies on rumen microbes have traditionally entailed the isolation of fibrolytic bacteria and subsequent analysis of fibrolytic enzymes. Developments in genomic and metagenomic approaches have made it possible to isolate directly genes and gene clusters encoding fibrolytic activities from rumen samples, permitting a global analysis of mechanisms of degradation of lignocellulose in rumen. Research in this field shows that lignocellulose degradation in rumen is a complex process involving a number of different microbes and is effected by a huge array of hydrolytic enzymes in a concerted fashion. This review briefly summarizes results from recent studies, especially metagenomic studies, on lignocellulose degradation in rumen.

  4. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F


    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  5. Diversity of Arabidopsis Genes Encoding Precursors for Phytosulfokine, a Peptide Growth Factor1

    PubMed Central

    Yang, Heping; Matsubayashi, Yoshikatsu; Nakamura, Kenzo; Sakagami, Youji


    Phytosulfokine-α (PSK-α), a unique plant peptide growth factor, was originally isolated from conditioned medium of asparagus (Asparagus officinalis) mesophyll cell cultures. PSK-α has several biological activities including promoting plant cell proliferation. Four genes that encode precursors of PSK-α have been identified from Arabidopsis. Analysis of cDNAs for two of these, AtPSK2 and AtPSK3, shows that both of these genes consist of two exons and one intron. The predicted precursors have N-terminal signal peptides and only a single PSK-α sequence located close to their carboxyl termini. Both precursors contain dibasic processing sites flanking PSK, analogous to animal and yeast prohormones. Although the PSK domain including the sequence of PSK-α and three amino acids preceding it are perfectly conserved, the precursors bear very limited similarity among Arabidopsis and rice (Oryza sativa), suggesting a new level of diversity among polypeptides that are processed into the same signaling molecule in plants, a scenario not found in animals and yeast. Unnatural [serine-4]PSK-β was found to be secreted by transgenic Arabidopsis cells expressing a mutant of either AtPSK2 or AtPSK3 cDNAs, suggesting that both AtPSK2 and AtPSK3 encode PSK-α precursors. AtPSK2 and AtPSK3 were expressed demonstrably not only in cultured cells but also in intact plants, suggesting that PSK-α may be essential for plant cell proliferation in vivo as well as in vitro. Overexpression of either precursor gene allowed the transgenic calli to grow twice as large as the controls. However, the transgenic cells expressing either antisense cDNA did not dramatically decrease mitogenic activity, suggesting that these two genes may act redundantly. PMID:11706167

  6. Bacteriophage-encoding cytolethal distending toxin type V gene induced from nonclinical Escherichia coli isolates.


    Allué-Guardia, Anna; García-Aljaro, Cristina; Muniesa, Maite


    Cytolethal distending toxin (Cdt) is produced by a variety of pathogenic bacteria, including pathogenic serotypes of Shiga toxin-producing Escherichia coli (STEC). The Cdt family comprises five variants (Cdt-I to Cdt-V) encoded by three genes located within the chromosome or plasmids or, in the case of Cdt-I, within bacteriophages. In this study, we evaluated the occurrence of the cdt gene in a collection of 140 environmental STEC isolates. cdt was detected in 12.1% of strains, of which five strains carried inducible bacteriophages containing the Cdt-V variant. Two Cdt-V phages of the Siphoviridae morphology lysogenized Shigella sonnei, generating two lysogens: a single Cdt phage lysogen and a double lysogen, containing a Cdt phage and an Stx phage, both from the wild-type strain. The rates of induction of Cdt phages were evaluated by quantitative PCR, and spontaneous induction of Cdt-V phage was observed, whereas induction of Stx phage in the double lysogen was mitomycin C dependent. The Cdt distending effect was observed in HeLa cells inoculated with the supernatant of the Cdt-V phage lysogen. A ClaI fragment containing the cdt-V gene of one phage was cloned, and sequencing confirmed the presence of Cdt-V, as well as a fragment downstream from the cdt homolog to gpA, encoding a replication protein of bacteriophage P2. Evaluation of Cdt-V phages in nonclinical water samples showed densities of 10(2) to 10(9) gene copies in 100 ml, suggesting the high prevalence of Cdt phages in nonclinical environments. PMID:21646456

  7. A turquoise mutant genetically separates expression of genes encoding phycoerythrin and its associated linker peptides.


    Seib, Laura Ort; Kehoe, David M


    During complementary chromatic adaptation (CCA), cyanobacterial light harvesting structures called phycobilisomes are restructured in response to ambient light quality shifts. Transcription of genes encoding components of the phycobilisome is differentially regulated during this process: red light activates cpcB2A2, whereas green light coordinately activates the cpeCDE and cpeBA operons. Three signal transduction components that regulate CCA have been isolated to date: a sensor-photoreceptor (RcaE) and two response regulators (RcaF and RcaC). Mutations in the genes encoding these components affect the accumulation of both cpcB2A2 and cpeBA gene products. We have isolated and characterized a new pigmentation mutant called Turquoise 1. We demonstrate that this mutant phenotype is due to a dramatic decrease in cpeBA transcript abundance and results from a lesion in the cpeR gene. However, in this mutant cpeCDE RNA levels remain near those found in wild-type cells. Our results show that the coordinate regulation of cpeBA and cpeCDE by green light can be uncoupled by the loss of CpeR, and we furnish the first genetic evidence that different regulatory mechanisms control these two operons. Sequence analysis of CpeR reveals that it shares limited sequence similarity to members of the PP2C class of protein serine/threonine phosphatases. We also demonstrate that cpeBA and cpeCDE retain light quality responsiveness in a mutant lacking the RcaE photoreceptor. This provides compelling evidence for the partial control of CCA through an as-yet-uncharacterized second light quality sensing system.

  8. Isolation and gene disruption of the Tox5 gene encoding trichodiene synthase in Gibberella pulicaris.


    Hohn, T M; Desjardins, A E


    The trichodiene synthase gene (Tox5) was isolated from Gibberella pulicaris, and its nucleotide sequence was determined. Tox5 was disrupted through transformation with a plasmid carrying a doubly truncated copy of the coding region and a selectable marker for resistance to hygromycin B (Hygr). Analysis of 82 transformants for their ability to produce the trichothecene, 4,15-diacetoxyscirpenol (DAS), resulted in the identification of five DAS- strains. Southern hybridization analysis of DAS- Hygr transformants indicated that the plasmid integrated at the Tox5 locus. The disrupted Tox5 gene was shown to be mitotically stable. Analysis of nine tetrads revealed either the cosegregation of the disrupter plasmid and the DAS- phenotype or the loss of the disrupter plasmid. These results demonstrate the feasibility of using gene disruption in G. pulicaris and suggest a general method for obtaining Tox5- mutants in other trichothecene-producing fungi. PMID:1421511

  9. Association between Common Variation in Genes Encoding Sweet Taste Signaling Components and Human Sucrose Perception

    PubMed Central

    Fushan, Alexey A.; Simons, Christopher T.; Slack, Jay P.


    Variation in taste perception of different chemical substances is a well-known phenomenon in both humans and animals. Recent advances in the understanding of sweet taste signaling have identified a number of proteins involved in this signal transduction. We evaluated the hypothesis that sequence variations occurring in genes encoding taste signaling molecules can influence sweet taste perception in humans. Our population consisted of unrelated individuals (n = 160) of Caucasian, African–American, and Asian descent. Threshold and suprathreshold sensitivities of participants for sucrose were estimated using a sorting test and signal detection analysis that produced cumulative R-index area under the curve (AUC) scores. Genetic association analysis revealed significant correlation of sucrose AUC scores with genetic variation occurring in the GNAT3 gene (single point P = 10−3 to 10−4), which encodes the taste-specific Gα protein subunit gustducin. Subsequent sequencing identified additional GNAT3 variations having significant association with sucrose AUC scores. Collectively, GNAT3 polymorphisms explain 13% of the variation in sucrose perception. Our findings underscore the importance of common genetic variants influencing human taste perception. PMID:20660057

  10. Yeast spindle pole body duplication gene MPS1 encodes an essential dual specificity protein kinase.

    PubMed Central

    Lauzé, E; Stoelcker, B; Luca, F C; Weiss, E; Schutz, A R; Winey, M


    The MPS1 gene has been previously identified by a mutant allele that shows defects in spindle pole body (SPB) duplication and cell cycle control. The SPB is the centrosome-equivalent organelle in the yeast Saccharomyces cerevisiae, and it nucleates all the microtubules in the cell. We report the isolation of the MPS1 gene, which encodes an essential protein kinase homolog. The MPS1 open reading frame has been fused to those that encode the LexA protein or the GST protein and both of these constructs function in yeast. The fusion proteins have been affinity-purified from yeast extracts and the GST chimeric protein has been found to be a phosphoprotein. Both proteins have been used to demonstrate intrinsic in vitro protein kinase activity of Mps1p against exogenous substrates and itself (autophosphorylation). A mutation predicted to abolish kinase function not only eliminates in vitro protein kinase activity, but also behaves like a null mutation in vivo, suggesting that kinase activity contributes to the essential function of the protein. Phosphoamino acid analysis of substrates phosphorylated by Mps1p indicates that this kinase can phosphorylate serine, threonine and tyrosine residues, identifying Mps1p as a dual specificity protein kinase. Images PMID:7737118

  11. Transfection, expression, and DNA sequence of a gene encoding a BoLA-A11 antigen

    SciTech Connect

    Sawhney, S.M.S.; Hasima, N.N.; Glass, E.J.; Al-Murrani, S.W.K.; Nichani, A.K.; Spooner, R.L.; Williams, J.L.; Russell, G.C.


    Cattle major histocompatibility complex [(MHC) (BoLA)] class I molecules are heterodimeric glycoproteins which present endogenous antigenic peptides to CD8{sup +} T lymphocytes, initiating a cellular immune response. The MHC-encoded heavy chains are highly polymorphic and, in cattle, have been characterized mainly by using allo-antisera raised by reciprocal calf/dam immunizations. This has enabled the identification of about 50 serlogical specificities, most of which behave as alleles of a single highly polymorphic class I locus. However, evidence from biochemical and molecular biological studies suggest that more than one BoLA class I locus is expressed. These loci are apparently in linkage disequilibrium, making them difficult to distinguish by conventional methods. In order to investigate the expression and function of individual class I locus products, we are correlating BoLA class I gene sequences with the expressed products by the transfection and characterization of genomic class I clones. Shotgun transfection and expression of BoLA class I molecules has been described previously, but the genes involved were not isolated. In this paper we report the isolation, DNA sequencing, transfection, and expression of a genomic clone encoding a BoLA-A11 determinant from an animal expressing A10 and A11 serological specificities. 23 refs., 3 figs.

  12. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.


    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José


    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  13. 5'-structural analysis of genes encoding polymorphic antigens of chemically induced tumors

    SciTech Connect

    Srivastava, R.K.; Chen, Y.T.; Old, L.J.


    The authors have proposed that the distinct tumor rejection antigens of chemically induced sarcomas in inbred mice belong to a family of M/sub r/ 96,000 glycoproteins (gp96). An identical 14-amino acid sequence was found at the amino terminus of gp96 from two antigenically distinct BALB/c sarcomas. Oligonucleotide probes, end-labeled with (/sup 12/P)-ATP, derived from this sequence permitted isolation of 5' cDNA and genomic fragments coding for gp96. Three short exons interrupted by relatively long introns were identified at the 5' terminus of the gp96 gene. The first exon encodes a signal peptide, which is consistent with gp96 being a cell surface antigen. Southern blot analysis indicated that the gp96 family is encoded by a single gene, and 3-kilobase transcripts were detected in all normal and tumor cells tested. Nucleotide and deduced amino acid sequences from 311 base pairs at the 5' terminus showed no homology with any know protein. The availability of molecular probes for the gp96 system permits analysis of the structural polymorphism of these antigens.

  14. Expression of Epstein-Barr virus encoded latent genes in nasal T cell lymphomas.

    PubMed Central

    van Gorp, J; Brink, A; Oudejans, J J; van den Brule, A J; van den Tweel, J G; Jiwa, N M; de Bruin, P C; Meijer, C J


    AIMS: To determine the expression of Epstein-Barr (EB) virus encoded latent genes in nasal T-cell lymphomas in The Netherlands. METHODS: Seven europid (Dutch) cases of nasal T cell lymphoma were investigated for the presence of EB virus by RNA in situ hybridisation (EBER). The expression of the EB virus encoded genes BARF0, EBNA1, EBNA2, LMP1, LMP2A, LMP2B, and ZEBRA was studied at the mRNA level using reverse transcriptase polymerase chain reaction. At the protein level the expression was investigated of EBNA2 and LMP1 by immunohistochemistry. RESULTS: In all seven nasal T cell lymphomas EBER was detected in the nuclei of virtually all tumour cells. BARF0 mRNA was detected in all samples. EBNA1 mRNA was found in six cases, LMP1 mRNA in five, LMP2A mRNA in three, LMP2B mRNA in one, and ZEBRA mRNA in one. EBNA2 mRNA was not found in any case. At the protein level occasional LMP1 positive tumour cells were seen in only one case. The EBNA2 protein was not detected. CONCLUSIONS: Nasal T cell lymphomas in The Netherlands are strongly associated with EB virus. The virus shows a type II latency pattern (EBNA1+, LMP1+, EBNA2-) that seems to be similar to the EB virus associated nasal T cell lymphomas in oriental countries. Images PMID:8666691

  15. In vivo gene therapy of murine melanoma mediated by recombinant vaccinia virus encoding human IL-2 gene.


    Wan, T; Cao, X; Ju, D; Aces, B


    Direct gene transfer into somatic tissue iii vivo is a developing technology with potential application for cancer gene therapy. In this study, recombinant vaccinia virus encoding human IL-2 gene (rVV-IL-2) was used as a candidate vector in mediating iii vivo gene therapy. After rVV-IL-2 was expanded in VERO cells for 72 h, high titer (10(8)-10(10) PFU/ml) rVV-IL-2 were harvested. When 10(6) murine melanoma cells (F16-F10) were infected with rVV-IL-2, about 200 U/ml IL-2 activity was detected in the supernatants at 8 h, and the up-regulation of ICAM-1 and MHC-I expressions on the melanoma cells were observed. The treatment of murine melanoma model by local injection of rVV-IL-2 into the tumor site showed that rVV-IL-2 transfection significantly inhibited the tumor growth and prolonged the survival time of tumor-bearing mice. The splenocytes from rVV-IL-2 treated mice showed higher cytotoxicities of NK, LAK and CTL in comparison with those from the controls. These results suggest that in vivo transfection mediated by rVV-IL-2 has potential effectiveness in enhancing host immunity and would be a useful approach to cancer gene therapy. PMID:21533434

  16. Phylogeny of the bears (Ursidae) based on nuclear and mitochondrial genes.


    Yu, Li; Li, Qing-wei; Ryder, O A; Zhang, Ya-ping


    The taxomic classification and phylogenetic relationships within the bear family remain argumentative subjects in recent years. Prior investigation has been concentrated on the application of different mitochondrial (mt) sequence data, herein we employ two nuclear single-copy gene segments, the partial exon 1 from gene encoding interphotoreceptor retinoid binding protein (IRBP) and the complete intron 1 from transthyretin (TTR) gene, in conjunction with previously published mt data, to clarify these enigmatic problems. The combined analyses of nuclear IRBP and TTR datasets not only corroborated prior hypotheses, positioning the spectacled bear most basally and grouping the brown and polar bear together but also provided new insights into the bear phylogeny, suggesting the sister-taxa association of sloth bear and sun bear with strong support. Analyses based on combination of nuclear and mt genes differed from nuclear analysis in recognizing the sloth bears as the earliest diverging species among the subfamily ursine representatives while the exact placement of the sun bear did not resolved. Asiatic and American black bears clustered as sister group in all analyses with moderate levels of bootstrap support and high posterior probabilities. Comparisons between the nuclear and mtDNA findings suggested that our combined nuclear dataset have the resolving power comparable to mtDNA dataset for the phylogenetic interpretation of the bear family. As can be seen from present study, the unanimous phylogeny for this recently derived family was still not produced and additional independent genetic markers were in need. PMID:15223031

  17. Sequence analysis of the Alcaligenes eutrophus chromosomally encoded ribulose bisphosphate carboxylase large and small subunit genes and their gene products.

    PubMed Central

    Andersen, K; Caton, J


    The nucleotide sequence of the chromosomally encoded ribulose bisphosphate carboxylase/oxygenase (RuBPCase) large (rbcL) and small (rbcS) subunit genes of the hydrogen bacterium Alcaligenes eutrophus ATCC 17707 was determined. We found that the two coding regions are separated by a 47-base-pair intergenic region, and both genes are preceded by plausible ribosome-binding sites. Cotranscription of the rbcL and rbcS genes has been demonstrated previously. The rbcL and rbcS genes encode polypeptides of 487 and 135 amino acids, respectively. Both genes exhibited similar codon usage which was highly biased and different from that of other organisms. The N-terminal amino acid sequence of both subunit proteins was determined by Edman degradation. No processing of the rbcS protein was detected, while the rbcL protein underwent a posttranslational loss of formylmethionyl. The A. eutrophus rbcL and rbcS proteins exhibited 56.8 to 58.3% and 35.6 to 38.5% amino acid sequence homology, respectively, with the corresponding proteins from cyanobacteria, eucaryotic algae, and plants. The A. eutrophus and Rhodospirillum rubrum rbcL proteins were only about 32% homologous. The N- and C-terminal sequences of both the rbcL and the rbcS proteins were among the most divergent regions. Known or proposed active site residues in other rbcL proteins, including Lys, His, Arg, and Asp residues, were conserved in the A. eutrophus enzyme. The A. eutrophus rbcS protein, like those of cyanobacteria, lacks a 12-residue internal sequence that is found in plant RuBPCase. Comparison of hydropathy profiles and secondary structure predictions by the method described by Chou and Fasman (P. Y. Chou and G. D. Fasman, Adv. Enzymol. 47:45-148, 1978) revealed striking similarities between A. eutrophus RuBPCase and other hexadecameric enzymes. This suggests that folding of the polypeptide chains is similar. The observed sequence homologies were consistent with the notion that both the rbcL and rbcS genes of the

  18. Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

    SciTech Connect

    Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.


    The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end of the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.

  19. Aeromonas salmonicida possesses two genes encoding homologs of the major outer membrane protein, OmpA.

    PubMed Central

    Costello, G M; Vipond, R; MacIntyre, S


    Two homologs of the outer membrane protein OmpA were identified in Aeromonas salmonicida by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, immunoblotting, and amino-terminal sequence analyses. An A. salmonicida genomic DNA library was constructed by using lambda GEM-11 and recombinant phage carrying both genes ompAI and ompAII) selected by immunoscreening. A 5.0-kb BamHI fragment containing the two genes in tandem was subcloned in pBluescript and used for further subcloning and sequencing of the genes. The encoded proteins (Mr = 33,564 and 32,536 for mature OmpAI and OmpAII, respectively) had only 64% identity with each other and otherwise had the highest level of homology to OmpA proteins from the members of the family Enterobacteriaceae. Based on the Escherichia coli OmpA model, an eight-stranded amphipathic beta-barrel model for the membrane assembly of the N-terminal half of OmpAI and OmpAII was predicted. Most variation between the two proteins was localized to the predicted surface loops and periplasmic turns, while the transmembrane strands and C-terminals domains were highly conserved. Expression of ompAI and ompAII separately in E. coli indicated that both genes could be independently transcribed from their own promoters and that both gene products were assembled into the E. coli outer membrane. A survey of different Aeromonas spp. by PCR revealed that possession of two tandem ompA genes was widespread among this genus. This is the first report of any bacterial species possessing two genes for homologs of this major outer membrane protein. PMID:8626290

  20. On the role of PDZ domain-encoding genes in Drosophila border cell migration.


    Aranjuez, George; Kudlaty, Elizabeth; Longworth, Michelle S; McDonald, Jocelyn A


    Cells often move as collective groups during normal embryonic development and wound healing, although the mechanisms governing this type of migration are poorly understood. The Drosophila melanogaster border cells migrate as a cluster during late oogenesis and serve as a powerful in vivo genetic model for collective cell migration. To discover new genes that participate in border cell migration, 64 out of 66 genes that encode PDZ domain-containing proteins were systematically targeted by in vivo RNAi knockdown. The PDZ domain is one of the largest families of protein-protein interaction domains found in eukaryotes. Proteins that contain PDZ domains participate in a variety of biological processes, including signal transduction and establishment of epithelial apical-basal polarity. Targeting PDZ proteins effectively assesses a larger number of genes via the protein complexes and pathways through which these proteins function. par-6, a known regulator of border cell migration, was a positive hit and thus validated the approach. Knockdown of 14 PDZ domain genes disrupted migration with multiple RNAi lines. The candidate genes have diverse predicted cellular functions and are anticipated to provide new insights into the mechanisms that control border cell movement. As a test of this concept, two genes that disrupted migration were characterized in more detail: big bang and the Dlg5 homolog CG6509. We present evidence that Big bang regulates JAK/STAT signaling, whereas Dlg5/CG6509 maintains cluster cohesion. Moreover, these results demonstrate that targeting a selected class of genes by RNAi can uncover novel regulators of collective cell migration. PMID:23173089

  1. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  2. Characterization of five subgroups of the sieve element occlusion gene family in Glycine max reveals genes encoding non-forisome P-proteins, forisomes and forisome tails.


    Zielonka, Sascia; Ernst, Antonia M; Hawat, Susan; Twyman, Richard M; Prüfer, Dirk; Noll, Gundula A


    P-proteins are structural phloem proteins discussed to be involved in the rapid sealing of injured sieve elements. P-proteins are found in all dicotyledonous and some monocotyledonous plants, but additional crystalloid P-proteins, known as forisomes, have evolved solely in the Fabaceae. Both types are encoded by members of the sieve element occlusion (SEO) gene family, which comprises seven phylogenetic subgroups. The Fabaceae-specific subgroup 1 contains genes encoding forisome subunits in e.g. Medicago truncatula, Vicia faba, Dipteryx panamensis and Canavalia gladiata whereas basal subgroup 5 encodes P-proteins in Nicotiana tabacum (tobacco) and Arabidopsis thaliana. The function of remaining subgroups is still unknown. We chose Glycine max (soybean) as a model to investigate SEO proteins representing different subgroups in one species. We isolated native P-proteins to determine the SEO protein composition and analyzed the expression pattern, localization and structure of the G. max SEO proteins representing five of the subgroups. We found that subgroup 1 GmSEO genes encode forisome subunits, a member of subgroup 5 encodes a non-forisome P-protein and subgroup 2 GmSEO genes encode the components of forisome tails, which are present in a restricted selection of Fabaceaen species. We therefore present the first molecular characterization of a Fabaceae non-forisome P-protein and the first evidence that forisome tails are encoded by a phylogenetically-distinct branch of the SEO gene family.

  3. Purification of two chitinases from Rhizopus oligosporus and isolation and sequencing of the encoding genes.

    PubMed Central

    Yanai, K; Takaya, N; Kojima, N; Horiuchi, H; Ohta, A; Takagi, M


    Two chitinases were purified from Rhizopus oligosporus, a filamentous fungus belonging to the class Zygomycetes, and designated chitinase I and chitinase II. Their N-terminal amino acid sequences were determined, and two synthetic oligonucleotide probes corresponding to these amino acid sequences were synthesized. Southern blot analyses of the total genomic DNA from R. oligosporus with these oligonucleotides as probes indicated that one of the two genes encoding these two chitinases was contained in a 2.9-kb EcoRI fragment and in a 3.6-kb HindIII fragment and that the other one was contained in a 2.9-kb EcoRI fragment and in a 11.5-kb HindIII fragment. Two DNA fragments were isolated from the phage bank of R. oligosporus genomic DNA with the synthetic oligonucleotides as probes. The restriction enzyme analyses of these fragments coincided with the Southern blot analyses described above and the amino acid sequences deduced from their nucleotide sequences contained those identical to the determined N-terminal amino acid sequences of the purified chitinases, indicating that each of these fragments contained a gene encoding chitinase (designated chi 1 and chi 2, encoding chitinase I and II, respectively). The deduced amino acid sequences of these two genes had domain structures similar to that of the published sequence of chitinase of Saccharomyces cerevisiae, except that they had an additional C-terminal domain. Furthermore, there were significant differences between the molecular weights experimentally determined with the two purified enzymes and those deduced from the nucleotide sequences for both genes. Analysis of the N- and C-terminal amino acid sequences of both chitinases and comparison of them with the amino acid sequences deduced from the nucleotide sequences revealed posttranslational processing not only at the N-terminal signal sequences but also at the C-terminal domains. It is concluded that these chitinases are synthesized with pre- and prosequences in

  4. Molecular and genetic analysis of the gene encoding the Saccharomyces cerevisiae strand exchange protein Sep1.


    Tishkoff, D X; Johnson, A W; Kolodner, R D


    Vegetatively grown Saccharomyces cerevisiae cells contain an activity that promotes a number of homologous pairing reactions. A major portion of this activity is due to strand exchange protein 1 (Sep1), which was originally purified as a 132,000-Mr species (R. Kolodner, D. H. Evans, and P. T. Morrison, Proc. Natl. Acad. Sci. USA 84:5560-5564, 1987). The gene encoding Sep1 was cloned, and analysis of the cloned gene revealed a 4,587-bp open reading frame capable of encoding a 175,000-Mr protein. The protein encoded by this open reading frame was overproduced and purified and had a relative molecular weight of approximately 160,000. The 160,000-Mr protein was at least as active in promoting homologous pairing as the original 132,000-Mr species, which has been shown to be a fragment of the intact 160,000-Mr Sep1 protein. The SEP1 gene mapped to chromosome VII within 20 kbp of RAD54. Three Tn10LUK insertion mutations in the SEP1 gene were characterized. sep1 mutants grew more slowly than wild-type cells, showed a two- to fivefold decrease in the rate of spontaneous mitotic recombination between his4 heteroalleles, and were delayed in their ability to return to growth after UV or gamma irradiation. Sporulation of sep1/sep1 diploids was defective, as indicated by both a 10- to 40-fold reduction in spore formation and reduced spore viability of approximately 50%. The majority of sep1/sep1 diploid cells arrested in meiosis after commitment to recombination but prior to the meiosis I cell division. Return-to-growth experiments showed that sep1/sep1 his4X/his4B diploids exhibited a five- to sixfold greater meiotic induction of His+ recombinants than did isogenic SEP1/SEP1 strains. sep1/sep1 mutants also showed an increased frequency of exchange between HIS4, LEU2, and MAT and a lack of positive interference between these markers compared with wild-type controls. The interaction between sep1, rad50, and spo13 mutations suggested that SEP1 acts in meiosis in a pathway that is

  5. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    PubMed Central

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja


    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  6. Evolution of the gene lineage encoding the carbon dioxide receptor in insects.


    Robertson, Hugh M; Kent, Lauren B


    A heterodimer of the insect chemoreceptors Gr21a and Gr63a has been shown to be the carbon dioxide receptor in Drosophila melanogaster (Meigen) (Diptera: Drosophilidae). Comparison of the genes encoding these two proteins across the 12 available drosophilid fly genomes allows refined definition of their N-termini. These genes are highly conserved, along with a paralog of Gr21a, in the Anopheles gambiae, Aedes aegypti, and Culex pipiens mosquitoes, as well as in the silk moth Bombyx mori and the red flour beetle Tribolium castaneum. In the latter four species we name these three proteins Gr1, Gr2, and Gr3. Intron evolution within this distinctive three gene lineage is considerable, with at least 13 inferred gains and 39 losses. Surprisingly, this entire ancient gene lineage is absent from all other available more basal insect and related arthropod genomes, specifically the honey bee, parasitoid wasp, human louse, pea aphid, waterflea, and blacklegged tick genomes. At least two of these species can detect carbon dioxide, suggesting that they evolved other means to do so. PMID:19613462

  7. Regulation of the ald gene encoding alanine dehydrogenase by AldR in Mycobacterium smegmatis.


    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon; Oh, Jeong-Il


    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding L-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of L-alanine. The purified AldR protein exists as a homodimer in the absence of L-alanine, while it adopts the quaternary structure of a homohexamer in the presence of L-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by L-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N₂-ATC-N₂-TC and one putative AldR binding site with the sequence GA-N₂-GTT-N₂-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of L-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine.

  8. Unexpected Diversity of pepA Genes Encoding Leucine Aminopeptidases in Sediments from a Freshwater Lake.


    Tsuboi, Shun; Yamamura, Shigeki; Imai, Akio; Iwasaki, Kazuhiro


    We herein designed novel PCR primers for universal detection of the pepA gene, which encodes the representative leucine aminopeptidase gene, and investigated the genetic characteristics and diversity of pepA genes in sediments of hypereutrophic Lake Kasumigaura, Japan. Most of the amino acid sequences deduced from the obtained clones (369 out of 370) were related to PepA-like protein sequences in the M17 family of proteins. The developed primers broadly detected pepA-like clones associated with diverse bacterial phyla-Alpha-, Beta-, Gamma-, and Deltaproteobacteria, Acidobacteria, Actinobacteria, Aquificae, Chlamydiae, Chloroflexi, Cyanobacteria, Firmicutes, Nitrospirae, Planctomycetes, and Spirochetes as well as the archaeal phylum Thaumarchaeota, indicating that prokaryotes in aquatic environments possessing leucine aminopeptidase are more diverse than previously reported. Moreover, prokaryotes related to the obtained pepA-like clones appeared to be r- and K-strategists, which was in contrast to our previous findings showing that the neutral metalloprotease gene clones obtained were related to the r-strategist genus Bacillus. Our results suggest that an unprecedented diversity of prokaryotes with a combination of different proteases participate in sedimentary proteolysis. PMID:26936797

  9. Unexpected Diversity of pepA Genes Encoding Leucine Aminopeptidases in Sediments from a Freshwater Lake

    PubMed Central

    Tsuboi, Shun; Yamamura, Shigeki; Imai, Akio; Iwasaki, Kazuhiro


    We herein designed novel PCR primers for universal detection of the pepA gene, which encodes the representative leucine aminopeptidase gene, and investigated the genetic characteristics and diversity of pepA genes in sediments of hypereutrophic Lake Kasumigaura, Japan. Most of the amino acid sequences deduced from the obtained clones (369 out of 370) were related to PepA-like protein sequences in the M17 family of proteins. The developed primers broadly detected pepA-like clones associated with diverse bacterial phyla—Alpha-, Beta-, Gamma-, and Deltaproteobacteria, Acidobacteria, Actinobacteria, Aquificae, Chlamydiae, Chloroflexi, Cyanobacteria, Firmicutes, Nitrospirae, Planctomycetes, and Spirochetes as well as the archaeal phylum Thaumarchaeota, indicating that prokaryotes in aquatic environments possessing leucine aminopeptidase are more diverse than previously reported. Moreover, prokaryotes related to the obtained pepA-like clones appeared to be r- and K-strategists, which was in contrast to our previous findings showing that the neutral metalloprotease gene clones obtained were related to the r-strategist genus Bacillus. Our results suggest that an unprecedented diversity of prokaryotes with a combination of different proteases participate in sedimentary proteolysis. PMID:26936797

  10. The neuropeptide F (NPF) encoding gene from the cestode, Moniezia expansa.


    Mair, G R; Halton, D W; Shaw, C; Maule, A G


    Neuropeptide F (NPF) is an abundantly expressed neuropeptide in platyhelminth nervous systems, and exhibits a moderate, myogenic effect on muscle preparations of parasitic flatworms. NPF displays structural similarities to peptides from molluscs and vertebrate members of the neuropeptide Y (NPY)-superfamily of peptides. NPY is one of the most abundant and highly conserved neuropeptides within vertebrates and similarities between the gene organization of NPY, pancreatic polypeptide (PP) and peptide tyrosine tyrosine (PYY), suggest a common evolutionary origin of this peptide family. Dual localization analyses coupled with confocal scanning laser microscopy revealed a close spatial relationship between NPF-containing nerves and muscle fibres in M. expansa. Molecular cloning techniques identified the M. expansa NPF (mxNPF) precursor and characterized the isolated transcript which encodes an open reading frame of 57 amino acids. The transcript possesses a 17 amino acid signal peptide and the mature NPF sequence (39 amino acids) followed by a carboxyterminal glycyl extension. Sequence analysis of genomic DNA identified a product which possessed a 54 base pair intron with consensus sequences for 5' and 3' splice sites. The M. expansa npf gene possesses a phase 2 intron within the penultimate arginyl residue, a characteristic feature of NPY superfamily peptide-genes. The intron-exon organization of the npf gene, coupled with the abundant expression of NPF within the nervous systems of flatworms, suggests an early evolutionary origin for this peptide transmitter family within the nervous systems of basal bilaterian metazoans.

  11. The Saccharomyces cerevisiae YPR184w gene encodes the glycogen debranching enzyme.


    Teste, M A; Enjalbert, B; Parrou, J L; François, J M


    The YPR184w gene encodes a 1536-amino acid protein that is 34-39% identical to the mammal, Drosophila melanogaster and Caenorhabditis elegans glycogen debranching enzyme. The N-terminal part of the protein possesses the four conserved sequences of the alpha-amylase superfamily, while the C-terminal part displays 50% similarity with the C-terminal of other eukaryotic glycogen debranching enzymes. Reliable measurement of alpha-1,4-glucanotransferase and alpha-1, 6-glucosidase activity of the yeast debranching enzyme was determined in strains overexpressing YPR184w. The alpha-1, 4-glucanotransferase activity of a partially purified preparation of debranching enzyme preferentially transferred maltosyl units than maltotriosyl. Deletion of YPR184w prevents glycogen degradation, whereas overexpression had no effect on the rate of glycogen breakdown. In response to stress and growth conditions, the transcriptional control of YPR184w gene, renamed GDB1 (for Glycogen DeBranching gene), is strictly identical to that of other genes involved in glycogen metabolism.

  12. BAGEL3: automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides

    PubMed Central

    van Heel, Auke J.; de Jong, Anne; Montalbán-López, Manuel; Kok, Jan; Kuipers, Oscar P.


    Identifying genes encoding bacteriocins and ribosomally synthesized and posttranslationally modified peptides (RiPPs) can be a challenging task. Especially those peptides that do not have strong homology to previously identified peptides can easily be overlooked. Extensive use of BAGEL2 and user feedback has led us to develop BAGEL3. BAGEL3 features genome mining of prokaryotes, which is largely independent of open reading frame (ORF) predictions and has been extended to cover more (novel) classes of posttranslationally modified peptides. BAGEL3 uses an identification approach that combines direct mining for the gene and indirect mining via context genes. Especially for heavily modified peptides like lanthipeptides, sactipeptides, glycocins and others, this genetic context harbors valuable information that is used for mining purposes. The bacteriocin and context protein databases have been updated and it is now easy for users to submit novel bacteriocins or RiPPs. The output has been simplified to allow user-friendly analysis of the results, in particular for large (meta-genomic) datasets. The genetic context of identified candidate genes is fully annotated. As input, BAGEL3 uses FASTA DNA sequences or folders containing multiple FASTA formatted files. BAGEL3 is freely accessible at PMID:23677608

  13. The pep4 gene encoding proteinase A is involved in dimorphism and pathogenesis of Ustilago maydis.


    Soberanes-Gutiérrez, Cinthia V; Juárez-Montiel, Margarita; Olguín-Rodríguez, Omar; Hernández-Rodríguez, César; Ruiz-Herrera, José; Villa-Tanaca, Lourdes


    Vacuole proteases have important functions in different physiological processes in fungi. Taking this aspect into consideration, and as a continuation of our studies on the analysis of the proteolytic system of Ustilago maydis, a phytopathogenic member of the Basidiomycota, we have analysed the role of the pep4 gene encoding the vacuolar acid proteinase PrA in the pathogenesis and morphogenesis of the fungus. After confirmation of the location of the protease in the vacuole using fluorescent probes, we obtained deletion mutants of the gene in sexually compatible strains of U. maydis (FB1 and FB2), and analysed their phenotypes. It was observed that the yeast to mycelium dimorphic transition induced by a pH change in the medium, or the use of a fatty acid as sole carbon source, was severely reduced in Δpep4 mutants. In addition, the virulence of the mutants in maize seedlings was reduced, as revealed by the lower proportion of plants infected and the reduction in size of the tumours induced by the pathogen, when compared with wild-type strains. All of these phenotypic alterations were reversed by complementation of the mutant strains with the wild-type gene. These results provide evidence of the importance of the pep4 gene for the morphogenesis and virulence of U. maydis.

  14. One of the fumarate reductase isoenzymes from Saccharomyces cerevisiae is encoded by the OSM1 gene.


    Muratsubaki, H; Enomoto, K


    Soluble fumarate reductase from yeast irreversibly catalyzes the reduction of fumarate to succinate and has noncovalently bound flavin adenine dinucleotide. In yeast, there are two isoenzymes of fumarate reductase, which can be distinguished on the basis of their absorption or nonabsorption to DE-52 columns. Previously, we have purified FRDS1 and isolated its gene (FRDS) from Saccharomyces cerevisiae. In the present study, FRDS2 was purified to homogeneity by four chromatography steps. The N-terminal and C-terminal amino acid sequences of FRDS2 were identical to the deduced amino acid sequence of the OSM1 gene (EMBL Database Accession No. L-26347), whose isolation and biochemical properties have not been studied up until now. From these results, we conclude that FRDS2 is encoded by the OSM1 gene. The deduced amino acid sequence of the OSM1 gene revealed that FRDS2 is synthesized as a precursor protein containing a presequence composed of 32 amino acid residues. The mature enzyme consists of a protein of 469 amino acid residues with a molecular weight of 51,370. The N-terminal extension had the characteristics of a typical signal sequence required for targeting and sorting to a noncytosolic destination. In fact, FRDS2 was found to be located in promitochondria.

  15. The sorghum photoperiod sensitivity gene, Ma3, encodes a phytochrome B.

    PubMed Central

    Childs, K L; Miller, F R; Cordonnier-Pratt, M M; Pratt, L H; Morgan, P W; Mullet, J E


    The Ma3 gene is one of six genes that regulate the photoperiodic sensitivity of flowering in sorghum (Sorghum bicolor [L.] Moench). The ma3R mutation of this gene causes a phenotype that is similar to plants that are known to lack phytochrome B, and ma3 sorghum lacks a 123-KD phytochrome that predominates in light-grown plants and that is present in non-ma3 plants. A population segregating for Ma3 and ma3 was created and used to identify two randomly amplified polymorphic DNA markers linked to Ma3. These two markers were cloned and mapped in a recombinant inbred population as restriction fragment length polymorphisms. cDNA clones of PHYA and PHYC were cloned and sequenced from a cDNA library prepared from green sorghum leaves. Using a genome-walking technique, a 7941-bp partial sequence of PHYB, was determined from genomic DNA from ma3 sorghum. PHYA, PHYB, and PHYC all mapped to the same linkage group. The Ma3-linked markers mapped with PHYB more than 121 centimorgans from PHYA and PHYC. A frameshift mutation resulting in a premature stop codon was found in the PHYB sequence from ma3 sorghum. Therefore, we conclude that the Ma3 locus in sorghum is a PHYB gene that encodes a 123-kD phytochrome. PMID:9046599

  16. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis.


    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu


    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  17. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.


    Otsuka, Chie; Minami, Ikuko; Oda, Kenji


    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia.

  18. The gusBC genes of Escherichia coli encode a glucuronide transport system.


    Liang, Wei-Jun; Wilson, Kate J; Xie, Hao; Knol, Jan; Suzuki, Shun'ichi; Rutherford, Nicholas G; Henderson, Peter J F; Jefferson, Richard A


    Two genes, gusB and gusC, from a natural fecal isolate of Escherichia coli are shown to encode proteins responsible for transport of beta-glucuronides with synthetic [(14)C]phenyl-1-thio-beta-d-glucuronide as the substrate. These genes are located in the gus operon downstream of the gusA gene on the E. coli genome, and their expression is induced by a variety of beta-d-glucuronides. Measurements of transport in right-side-out subcellular vesicles show the system has the characteristics of secondary active transport energized by the respiration-generated proton motive force. When the genes were cloned together downstream of the tac operator-promoter in the plasmid pTTQ18 expression vector, transport activity was increased considerably with isopropylthiogalactopyranoside as the inducer. Amplified expression of the GusB and GusC proteins enabled visualization and identification by N-terminal sequencing of both proteins, which migrated at ca. 32 kDa and 44 kDa, respectively. Separate expression of the GusB protein showed that it is essential for glucuronide transport and is located in the inner membrane, while the GusC protein does not catalyze transport but assists in an as yet unknown manner and is located in the outer membrane. The output of glucuronides as waste by mammals and uptake for nutrition by gut bacteria or reabsorption by the mammalian host is discussed. PMID:15774881

  19. Mutations in the Drosophila melanogaster gene encoding S-adenosylmethionine suppress position-effect variegation

    SciTech Connect

    Larsson, J.; Rasmuson-Lestander, A.; Zhang, Jingpu


    In Drosophila melanogaster, the study of trans-acting modifier mutations of position-effect variegation and Polycomb group (Pc-G) genes have been useful tools to investigate genes involved in chromatin structure. We have cloned a modifier gene, Suppressor of zeste 5 (Su(z)5), which encodes S-adenosylmethionine synthetase, and we present here molecular results and data concerning its expression in mutants and genetic interactions. The mutant alleles Su(z)5, l(2)R23 and l(2)M6 show suppression of w{sup m4} and also of two white mutants induced by roo element insertions in the regulatory region i.e., w{sup is} (in combination with z{sup 1}) and w{sup sp1}. Two of the Su(z)5 alleles, as well as a deletion of the gene, also act as enhancers of Polycomb by increasing the size of sex combes on midleg. The results suggest that Su(z)5 is connected with regulation of chromatin structure. The enzyme S-adenosylmethionine synthetase is involved in the synthesis of S-adenosylmethionine, a methyl group donor and also, after decarboxylation, a propylamino group donor in the biosynthesis of polyamines. Our results from HPLC analysis show that in ovaries from heterozygous Su(z)5 mutants the content of spermine is significantly reduced. Results presented here suggest that polyamines are an important molecule class in the regulation of chromatin structure. 50 refs., 5 figs., 3 tabs.

  20. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M


    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  1. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).


    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M


    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years.

  2. A human gene (DDX10) encoding a putative DEAD-box RNA helicase at 11q22-q23

    SciTech Connect

    Savitsky, K.; Ziv, Y.; Bar-Shira, A.


    A human gene encoding a putative RNA helicase, designated DDX10, was identified 400 kb telomeric to the ataxia-telangiectasia gene at chromosome 11q22-q23. The predicted amino acid sequence shows very high similarity to a subgroup of DEAD-box RNA helicases involved in ribosome biogenesis. This novel gene encodes a 3.2-kb transcript in a variety of human tissues. A processed pseudogene of DDX10 was detected at chromosome 9q21-q22. We observed a rare trinucleotide repeat length polymorphism within the coding sequence of DDX10. 39 refs., 5 figs.

  3. Shiga toxin-encoding genes (stx genes) in human faecal samples.


    Urdahl, Anne Margrete; Solheim, Heidi Tetlie; Vold, Line; Hasseltvedt, Viggo; Wasteson, Yngvild


    The aim of the two studies reported here was to investigate the distribution of stx genes in human faecal samples from volunteers and in faecal samples submitted to a regional microbiology hospital laboratory, and to isolate and characterize STEC from stx-positive samples. In total, faecal samples from 13.9% of 165 volunteers and 36.1% of 416 swabs from the regional microbiology hospital laboratory were positive for stx genes after screening by PCR. Isolation of STEC and of E. coli O157 from stx-positive faecal samples was performed by a filter-hybridization protocol and by automated immunomagnetic separation, respectively, and isolates were further characterized by serotyping, virulence typing by PCR and toxin production by the Vero cell assay. STEC were isolated from two samples only, an O146:H21 isolate from one of the volunteers and an O157:H7 isolate from a human case of diarrhoea. To conclude; the results show that it is not unusual to detect stx genes in faecal samples from humans in Norway, both from asymptomatic people and from people with gastrointestinal illness. This finding emphasizes the importance of correct diagnostic criteria for interpretation of the finding of an occasional stx-positive sample or an STEC isolate when searching for an aetiological agent of human cases of diarrhoea.

  4. Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

    SciTech Connect

    Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J.


    Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryotic expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.

  5. tvcp12: a novel Trichomonas vaginalis cathepsin L-like cysteine proteinase-encoding gene.


    León-Sicairos, Claudia R; León-Félix, Josefina; Arroyo, Rossana


    Trichomonas vaginalis is the causative agent of trichomoniasis, one of the most common sexually transmitted diseases in humans. This protozoan has multiple proteinases that are mainly of the cysteine proteinase (CP) type, some of which are known to be involved in the parasite's virulence. Here, a novel T. vaginalis CP-encoding gene, tvcp12, was identified and characterized. tvcp12 is 948 bp long and encodes a predicted 34.4 kDa protein that has the characteristics of the papain-like CP family. TvCP12 does not appear to have a signal peptide, suggesting that this is a cytoplasmic CP. By Southern blot assays, the tvcp12 gene was found as a single copy in the T. vaginalis genome. Remarkably, Northern blot experiments showed a single transcript band of approximately 1.3 kb in the mRNA obtained from parasites grown in low iron conditions and no transcript was observed in the mRNA from parasites grown in high iron conditions. By RT-PCR assays, a 270 bp band was amplified from the cDNA of parasites grown in low iron medium, which was very faint when cDNA from parasites grown in high iron conditions was used. Transcripts of the 3' region obtained in both iron conditions presented differences in their poly(A) tail length. These data suggest that tvcp12 is another gene that is negatively regulated by iron and that the length of the poly(A) tail may be one of the factors involved in the iron-modulated protein expression.

  6. Constraints on intron evolution in the gene encoding the myosin alkali light chain in Drosophila

    SciTech Connect

    Leicht, B.G.; Muse, S.V.; Hanczyc, M.


    Interspecific comparisons of intron sequences reveal conserved blocks of invariant nucleotides and several other departures from the strictly neutral model of molecular evolution. To distinguish the past action of evolutionary forces in introns known to have regulatory information, we examined nucleotide sequence variation at 991 sites in a random sample of 16 Drosophila melanogaster alleles of the gene encoding the myosin alkali light chain (Mlc1). The Mlc1 gene of D. melanogaster encodes two Mlc1 isoforms via developmentally regulated alternative pre-mRNA splicing. Analyses of these data reveal that introns 4 and 5, which flank the alternatively spliced exon 5, have reduced levels of both intraspecific polymorphism and interspecific divergence relative to intron 3. No polymorphism was observed in any of the exons examined in D. melanogaster. A genealogical analysis clearly demonstrates the occurrence of intragenic recombination in the ancestral history of Mlc1. Recombination events are estimated to be 13 times more likely than mutation events over the span of the sequenced region. Although there is little evidence for pairwise linkage disequilibrium in the Mlc1 region, higher order disequilibrium. does seem to be present in the 5{prime} half of the portion of the gene that was examined. Predictions of the folding free energy of the pre-mRNA reveal that sampled alleles have a significantly higher (less stable) free energy than do randomly permuted sequences. These results are consistent with the hypothesis that introns surrounding an alternatively spliced exon are subjected to additional constraints, perhaps due to specific aspects of secondary structure required for appropriate splicing of the pre-mRNA molecule. 48 refs., 5 figs., 3 tabs.

  7. A WRKY gene from creosote bush encodes an activator of the abscisic acid signaling pathway.


    Zou, Xiaolu; Seemann, Jeffrey R; Neuman, Dawn; Shen, Qingxi J


    The creosote bush (Larrea tridentata) is a xerophytic evergreen C3 shrub thriving in vast arid areas of North America. As the first step toward understanding the molecular mechanisms controlling the drought tolerance of this desert plant, we have isolated a dozen genes encoding transcription factors, including LtWRKY21 that encodes a protein of 314 amino acid residues. Transient expression studies with the GFP-LtWRKY21 fusion construct indicate that the LtWRKY21 protein is localized in the nucleus and is able to activate the promoter of an abscisic acid (ABA)-inducible gene, HVA22, in a dosage-dependent manner. The transactivating activity of LtWRKY21 relies on the C-terminal sequence containing the WRKY domain and a N-terminal motif that is essential for the repression activity of some regulators in ethylene signaling. LtWRKY21 interacts synergistically with ABA and transcriptional activators VP1 and ABI5 to control the expression of the HVA22 promoter. Co-expression of VP1, ABI5, and LtWRKY21 leads to a much higher expression of the HVA22 promoter than does the ABA treatment alone. In contrast, the Lt-WRKY21-mediated transactivation is inhibited by two known negative regulators of ABA signaling: 1-butanol, an inhibitor of phospholipase D, and abi1-1, a dominant negative mutant protein phosphatase. Interestingly, abi1-1 does not block the synergistic effect of LtWRKY21, VP1, and ABI5 co-expression, indicating that LtWRKY21, VP1, and ABI5 may form a complex that functions downstream of ABI1 to control ABA-regulated expression of genes.

  8. A nuclear gene of eubacterial origin in Euglena gracilis reflects cryptic endosymbioses during protist evolution.

    PubMed Central

    Henze, K; Badr, A; Wettern, M; Cerff, R; Martin, W


    Genes for glycolytic and Calvin-cycle glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of higher eukaryotes derive from ancient gene duplications which occurred in eubacterial genomes; both were transferred to the nucleus during the course of endosymbiosis. We have cloned cDNAs encoding chloroplast and cytosolic GAPDH from the early-branching photosynthetic protist Euglena gracilis and have determined the structure of its nuclear gene for cytosolic GAPDH. The gene contains four introns which possess unusual secondary structures, do not obey the GT-AG rule, and are flanked by 2- to 3-bp direct repeats. A gene phylogeny for these sequences in the context of eubacterial homologues indicates that euglenozoa, like higher eukaryotes, have obtained their GAPDH genes from eubacteria via endosymbiotic (organelle-to-nucleus) gene transfer. The data further suggest that the early-branching protists Giardia lamblia and Entamoeba histolytica--which lack mitochondria--and portions of the trypanosome lineage have acquired GAPDH genes from eubacterial donors which did not ultimately give rise to contemporary membrane-bound organelles. Evidence that "cryptic" (possibly ephemeral) endosymbioses during evolution may have entailed successful gene transfer is preserved in protist nuclear gene sequences. PMID:7568085

  9. A nuclear gene of eubacterial origin in Euglena gracilis reflects cryptic endosymbioses during protist evolution.


    Henze, K; Badr, A; Wettern, M; Cerff, R; Martin, W


    Genes for glycolytic and Calvin-cycle glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of higher eukaryotes derive from ancient gene duplications which occurred in eubacterial genomes; both were transferred to the nucleus during the course of endosymbiosis. We have cloned cDNAs encoding chloroplast and cytosolic GAPDH from the early-branching photosynthetic protist Euglena gracilis and have determined the structure of its nuclear gene for cytosolic GAPDH. The gene contains four introns which possess unusual secondary structures, do not obey the GT-AG rule, and are flanked by 2- to 3-bp direct repeats. A gene phylogeny for these sequences in the context of eubacterial homologues indicates that euglenozoa, like higher eukaryotes, have obtained their GAPDH genes from eubacteria via endosymbiotic (organelle-to-nucleus) gene transfer. The data further suggest that the early-branching protists Giardia lamblia and Entamoeba histolytica--which lack mitochondria--and portions of the trypanosome lineage have acquired GAPDH genes from eubacterial donors which did not ultimately give rise to contemporary membrane-bound organelles. Evidence that "cryptic" (possibly ephemeral) endosymbioses during evolution may have entailed successful gene transfer is preserved in protist nuclear gene sequences.

  10. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.


    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H


    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR.

  11. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters

    PubMed Central

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L.; Jáuregui, Ruy; Vilchez-Vargas, Ramiro


    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. PMID:26475106

  12. Localization, expression and genomic structure of the gene encoding the human serine protease testisin.


    Hooper, J D; Bowen, N; Marshall, H; Cullen, L M; Sood, R; Daniels, R; Stuttgen, M A; Normyle, J F; Higgs, D R; Kastner, D L; Ogbourne, S M; Pera, M F; Jazwinska, E C; Antalis, T M


    Testisin is a recently identified human serine protease expressed by premeiotic testicular germ cells and is a candidate tumor suppressor for testicular cancer. Here, we report the characterization of the gene encoding testisin, designated PRSS21, and its localization on the short arm of human chromosome 16 (16p13.3) between the microsatellite marker D16S246 and the radiation hybrid breakpoint CY23HA. We have further refined the localization to cosmid 406D6 in this interval and have established that the gene is approximately 4. 5 kb in length, and contains six exons and five intervening introns. The structure of PRSS21 is very similar to the human prostasin gene (PRSS8) which maps nearby on 16p11.2, suggesting that these genes may have evolved through gene duplication. Sequence analysis showed that the two known isoforms of testisin are generated by alternative pre-mRNA splicing. A major transcription initiation site was identified 97 nucleotides upstream of the testisin translation start and conforms to a consensus initiator element. The region surrounding the transcription initiation site lacks a TATA consensus sequence, but contains a CCAAT sequence and includes a CpG island. The 5'-flanking region contains several consensus response elements including Sp1, AP1 and several testis-specific elements. Analysis of testisin gene expression in tumor cell lines shows that testisin is not expressed in testicular tumor cells but is aberrantly expressed in some tumor cell lines of non-testis origin. These data provide the basis for identifying potential genetic alterations of PRSS21 that may underlie both testicular abnormalities and tumorigenesis. PMID:11004480

  13. A lectin gene encodes the alpha-amylase inhibitor of the common bean.

    PubMed Central

    Moreno, J; Chrispeels, M J


    An alpha-amylase inhibitor that inhibits insect and mammalian alpha-amylases but not plant alpha-amylases, is present in seeds of the common bean (Phaseolus vulgaris). We have purified the alpha-amylase inhibitor by using a selective heat treatment in acidic medium and affinity chromatography with porcine pancreas alpha-amylase coupled to agarose. Under sodium dodecyl sulfate gel electrophoresis, the purified inhibitor gave rise to five bands with mobilities corresponding to molecular masses ranging from 14 to 19 kDa. N-terminal sequencing (up to 15 amino acids) of the polypeptides obtained from these bands resulted in only two different sequences matching two stretches of the amino acid sequence deduced from an already described lectin gene [Hoffman, L. M. (1984) J. Mol. Appl. Gen. 2,447-453]. This gene is different from but closely related to the genes that code for phytohemagglutinin, the major lectin of bean. Further evidence based on amino acid composition, identification of a precursor, and recognition of the product of the gene (expressed in Escherichia coli) by an anti-alpha-amylase inhibitor serum confirms that the inhibitor is encoded by this or a closely related lectin gene. This finding assigns a biological function, which has been described at the molecular level, to a plant lectin gene product and supports the defense role postulated for seed lectins. The lack of homology with other families of enzyme inhibitors suggests that this may be the first member of a new family of plant enzyme inhibitors. Images PMID:2682631

  14. Multiple horizontally acquired genes from fungal and prokaryotic donors encode cellulolytic enzymes in the bdelloid rotifer Adineta ricciae.


    Szydlowski, L; Boschetti, C; Crisp, A; Barbosa, E G G; Tunnacliffe, A


    The bdelloid rotifer, Adineta ricciae, an anhydrobiotic microinvertebrate, exhibits a high rate of horizontal gene transfer (HGT), with as much as 10% of its transcriptome being of foreign origin. Approximately 80% of these foreign transcripts are involved in metabolic processes, and therefore bdelloids represent a useful model for assessing the contribution of HGT to biochemical diversity. To validate this concept, we focused on cellulose digestion, an unusual activity in animals, which is represented by at least 16 genes encoding cellulolytic enzymes in A. ricciae. These genes have been acquired from a variety of different donor organisms among the bacteria and fungi, demonstrating that bdelloids use diverse genetic resources to construct a novel biochemical pathway. A variable complement of the cellulolytic gene set was found in five other bdelloid species, indicating a dynamic process of gene acquisition, duplication and loss during bdelloid evolution. For example, in A. ricciae, gene duplications have led to the formation of three copies of a gene encoding a GH45 family glycoside hydrolase, at least one of which encodes a functional enzyme; all three of these gene copies are present in a close relative, Adineta vaga, but only one copy was found in each of four Rotaria species. Furthermore, analysis of expression levels of the cellulolytic genes suggests that a bacterial-origin cellobiase is upregulated upon desiccation. In summary, bdelloid rotifers have apparently developed cellulolytic functions by the acquisition and domestication of multiple foreign genes.

  15. Identification and functional analysis of the erh1(+) gene encoding enhancer of rudimentary homolog from the fission yeast Schizosaccharomyces pombe.


    Krzyzanowski, Marek K; Kozlowska, Ewa; Kozlowski, Piotr


    The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S.japonicus), but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1(+) is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1(+) have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1(+) in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol), inhibiting DNA replication (hydroxyurea), and destabilizing the plasma membrane (SDS); this hypersensitivity can be abolished by expression of S. pombe erh1(+) and, to a lesser extent, S. japonicus erh1(+) or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1(+) is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation.

  16. Characterization and nucleotide sequence of a chicken gene encoding an opal suppressor tRNA and its flanking DNA segments.

    PubMed Central

    Hatfield, D L; Dudock, B S; Eden, F C


    A naturally occurring opal suppressor serine tRNA has been purified from chicken liver and used as a probe to isolate the corresponding gene from a library of chicken DNA in bacteriophage lambda. This minor tRNA is encoded by a single-copy gene that is not part of a tRNA gene cluster. DNA sequence analysis of the gene and its flanking DNA segments shows that the gene is encoded in an 87-base-pair segment without intervening sequences and specifies a tRNA that reads the termination codon UGA. This gene has additional nucleotides in the 5' internal promoter region but has a normal 3' internal promoter sequence and the usual termination signal. Images PMID:6308662

  17. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s)

    PubMed Central

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V. Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. PMID:27060167

  18. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).


    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. PMID:27060167

  19. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).


    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar


    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js.

  20. [Phylogenetic relationships among Asiatic salamanders of the genus Salamandrella based on variability of nuclear genes].


    Maliarchuk, B A; Derenko, M V; Denisova, G A


    Based on sequence variation of three nuclear genome genes (BDNF, POMC, and RAG1), the phylogenetic relationships among Asiatic salamanders of the genus Salamandrella, Siberian salamander (S. keyserlingii) and Schrenk salamander (S. schrenkii), were examined. Both species demonstrated high levels of heterozygosity determined by intraspecific polymorphism. Fixed interspecific differences were revealed at one nucleotide position of the RAG1 gene, and thus the level of interspecific divergence over the three genes constituted only 0.04%. Analysis of the RAG1 polymorphism across the whole range of S. keyserlingii showed that only one gene variant, encoding for modified RAG1 recombinase, had the highest distribution to the north of the Amur region (west and northeast of Siberia). It is possible that the changes in the RAG1 gene in Siberian salamander are of an adaptive nature. However, cases of interspecific hybridization were identified in Jewish autonomous oblast (JAO), which contains one of the range borders between the two Salamandrella species. PMID:25857197

  1. Administration of DNA Encoding the Interleukin-27 Gene Augments Antitumour Responses through Non-adaptive Immunity.


    Li, Q; Sato, A; Shimozato, O; Shingyoji, M; Tada, Y; Tatsumi, K; Shimada, H; Hiroshima, K; Tagawa, M


    DNA-mediated immunization of a tumour antigen is a possible immunotherapy for cancer, and interleukin (IL)-27 has diverse functions in adaptive immunity. In this study, we examined whether IL-27 DNA administration enhanced antitumour effects in mice vaccinated with DNA encoding a putative tumour antigen, β-galactosidase (β-gal). An intramuscular injection of cardiotoxin before DNA administration facilitated the exogenous gene expression. In mice received β-gal and IL-27 DNA, growth of β-gal-positive P815 tumours was retarded and survival of the mice was prolonged. Development of β-gal-positive Colon 26 tumours was suppressed by vaccination of β-gal DNA and further inhibited by additional IL-27 DNA administration or IL-12 family cytokines. Nevertheless, a population of β-gal-specific CD8(+) T cells did not increase, and production of anti-β-gal antibody was not enhanced by IL-27 DNA administration. Spleen cells from mice bearing IL-27-expressing Colon 26 tumours showed greater YAC-1-targeted cytotoxicity although CD3(-)/DX5(+) natural killer (NK) cell numbers remained unchanged. Recombinant IL-27 enhanced YAC-1-targeted cytotoxicity of IL-2-primed splenic NK cells and augmented a phosphorylation of signal transducer and activator of transcription 3 and an expression of perforin. These data collectively indicate that IL-27 DNA administration activates NK cells and augments vaccination effects of DNA encoding a tumour antigen through non-adaptive immune responses. PMID:26095954

  2. Molecular cloning, characterization, and overexpression of ERG7, the Saccharomyces cerevisiae gene encoding lanosterol synthase.

    PubMed Central

    Corey, E J; Matsuda, S P; Bartel, B


    We report the cloning, characterization, and overexpression of Saccharomyces cerevisiae ERG7, which encodes lanosterol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, lanosterol forming), EC], the enzyme responsible for the complex cyclization/rearrangement step in sterol biosynthesis. Oligonucleotide primers were designed corresponding to protein sequences conserved between Candida albicans ERG7 and the related Arabidopsis thaliana cycloartenol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol forming), EC]. A PCR product was amplified from yeast genomic DNA using these primers and was used to probe yeast libraries by hybridization. Partial-length clones homologous to the two known epoxysqualene mutases were isolated, but a full-length sequence was found neither in cDNA nor genomic libraries, whether in phage or plasmids. Two overlapping clones were assembled to make a functional reconstruction of the gene, which contains a 2196-bp open reading frame capable of encoding an 83-kDa protein. The reconstruction complemented the erg7 mutation when driven from either its native promoter or the strong ADH1 promoter. Images PMID:8134375

  3. Modulation of Gene Expression by Polymer Nanocapsule Delivery of DNA Cassettes Encoding Small RNAs.


    Yan, Ming; Wen, Jing; Liang, Min; Lu, Yunfeng; Kamata, Masakazu; Chen, Irvin S Y


    Small RNAs, including siRNAs, gRNAs and miRNAs, modulate gene expression and serve as potential therapies for human diseases. Delivery to target cells remains the fundamental limitation for use of these RNAs in humans. To address this challenge, we have developed a nanocapsule delivery technology that encapsulates small DNA molecules encoding RNAs into a small (30 nm) polymer nanocapsule. For proof of concept, we transduced DNA expression cassettes for three small RNAs. In one application, the DNA cassette encodes an shRNA transcriptional unit that downregulates CCR5 and protects from HIV-1 infection. The DNA cassette nanocapsules were further engineered for timed release of the DNA cargo for prolonged knockdown of CCR5. Secondly, the nanocapsules provide an efficient means for delivery of gRNAs in the CRISPR/Cas9 system to mutate integrated HIV-1. Finally, delivery of microRNA-125b to mobilized human CD34+ cells enhances survival and expansion of the CD34+ cells in culture. PMID:26035832

  4. [Study on construct and expression of synthetic genes encoding spider dragline silk in Escherichia coli].


    Li, Min; Zhang, Wen-Xian; Huang, Zhi-Hua; Huang, Jian-Kun


    Dragline spider silk produced from Nephilia clavipes major ampullate is a natural fibrous protein with specific mechanical properties such as high tensile strength and elasticity. Synthetic gene monomer encoding recombinant spider silk protein, based on the known repetitive protein sequence and partial cDNA sequence of dragline silk, was constructed and expressed. DNA monomer sequences were multimerized to encode high molecular weight synthetic spider silks using a "head-to-tail" construction strategy. Multimer was cloned into pET30a(+), a prokaryotic high potency expression vector, and induced with IPTG. The protein from 8-unit repeat was produced in Escherichia coli at levels up to 20 mg/L. The protein was easily purified with high recovery by using an metal ion affinity chromatography and purity was over 90%. The results of SDS-PAGE and Western blot suggested that the mass of the expression product was about 37 kD. This value and amino acid analysis were consistent with those of theoretic calculation. PMID:12192868

  5. Mutations in α- and β-tubulin encoding genes: implications in brain malformations.


    Romaniello, Romina; Arrigoni, Filippo; Bassi, Maria Teresa; Borgatti, Renato


    The tubulin gene family is mainly expressed in post-mitotic neurons during cortical development with a specific spatial and temporal expression pattern. Members of this family encode dimeric proteins consisting of two closely related subunits (α and β), representing the major constituents of microtubules. Tubulin genes play a crucial role in the mechanisms of the Central Nervous System development such as neuronal migration and axonal guidance (axon outgrowth and maintenance). Different mutations in α/β-tubulin genes (TUBA1A, TUBA8, TUBB2A, TUBB4A, TUBB2B, TUBB3, and TUBB) might alter the dynamic properties and functions of microtubules in several ways, effecting a reduction in the number of functional tubulin heterodimers and causing alterations in GTP binding and disruptions of the binding of other proteins to microtubules (motor proteins and other microtubule interacting proteins). In recent years an increasing number of brain malformations has been associated with mutations in tubulin genes: malformations of cortical development such as lissencephaly and various grades of gyral disorganization, focal or diffuse polymicrogyria and open or closed-lips schizencephaly as likely consequences of an altered neuronal migration process; abnormalities or agenesis of the midline commissural structures (anterior commissure, corpus callosum and fornix), hypoplasia of the oculomotor and optic nerves, dysmorphisms of the hind-brain as expression of axon guidance disorders. Dysmorphisms of the basal ganglia (fusion between the caudate nucleus and putamen with absence of the anterior limb of the internal capsule) and hippocampi were also observed. A rare form of leukoencephalopathy characterized by hypomyelination with atrophy of the basal ganglia an cerebellum (H-ABC) was also recently described. The present review, describing the structural and functional features of tubulin genes, aims to revise the main cerebral associated malformations and related clinical aspects

  6. Knockdown of Five Genes Encoding Uncharacterized Proteins Inhibits Entamoeba histolytica Phagocytosis of Dead Host Cells.


    Sateriale, Adam; Miller, Peter; Huston, Christopher D


    Entamoeba histolytica is the protozoan parasite that causes invasive amebiasis, which is endemic to many developing countries and characterized by dysentery and liver abscesses. The virulence of E. histolytica correlates with the degree of host cell engulfment, or phagocytosis, and E. histolytica phagocytosis alters amebic gene expression in a feed-forward manner that results in an increased phagocytic ability. Here, we used a streamlined RNA interference screen to silence the expression of 15 genes whose expression was upregulated in phagocytic E. histolytica trophozoites to determine whether these genes actually function in the phagocytic process. When five of these genes were silenced, amebic strains with significant decreases in the ability to phagocytose apoptotic host cells were produced. Phagocytosis of live host cells, however, was largely unchanged, and the defects were surprisingly specific for phagocytosis. Two of the five encoded proteins, which we named E. histolytica ILWEQ (EhILWEQ) and E. histolytica BAR (EhBAR), were chosen for localization via SNAP tag labeling and localized to the site of partially formed phagosomes. Therefore, both EhILWEQ and EhBAR appear to contribute to E. histolytica virulence through their function in phagocytosis, and the large proportion (5/15 [33%]) of gene-silenced strains with a reduced ability to phagocytose host cells validates the previously published microarray data set demonstrating feed-forward control of E. histolytica phagocytosis. Finally, although only limited conclusions can be drawn from studies using the virulence-deficient G3 Entamoeba strain, the relative specificity of the defects induced for phagocytosis of apoptotic cells but not healthy cells suggests that cell killing may play a rate-limiting role in the process of Entamoeba histolytica host cell engulfment. PMID:26810036

  7. Knockdown of Five Genes Encoding Uncharacterized Proteins Inhibits Entamoeba histolytica Phagocytosis of Dead Host Cells

    PubMed Central

    Sateriale, Adam; Miller, Peter


    Entamoeba histolytica is the protozoan parasite that causes invasive amebiasis, which is endemic to many developing countries and characterized by dysentery and liver abscesses. The virulence of E. histolytica correlates with the degree of host cell engulfment, or phagocytosis, and E. histolytica phagocytosis alters amebic gene expression in a feed-forward manner that results in an increased phagocytic ability. Here, we used a streamlined RNA interference screen to silence the expression of 15 genes whose expression was upregulated in phagocytic E. histolytica trophozoites to determine whether these genes actually function in the phagocytic process. When five of these genes were silenced, amebic strains with significant decreases in the ability to phagocytose apoptotic host cells were produced. Phagocytosis of live host cells, however, was largely unchanged, and the defects were surprisingly specific for phagocytosis. Two of the five encoded proteins, which we named E. histolytica ILWEQ (EhILWEQ) and E. histolytica BAR (EhBAR), were chosen for localization via SNAP tag labeling and localized to the site of partially formed phagosomes. Therefore, both EhILWEQ and EhBAR appear to contribute to E. histolytica virulence through their function in phagocytosis, and the large proportion (5/15 [33%]) of gene-silenced strains with a reduced ability to phagocytose host cells validates the previously published microarray data set demonstrating feed-forward control of E. histolytica phagocytosis. Finally, although only limited conclusions can be drawn from studies using the virulence-deficient G3 Entamoeba strain, the relative specificity of the defects induced for phagocytosis of apoptotic cells but not healthy cells suggests that cell killing may play a rate-limiting role in the process of Entamoeba histolytica host cell engulfment. PMID:26810036

  8. Knockdown of Five Genes Encoding Uncharacterized Proteins Inhibits Entamoeba histolytica Phagocytosis of Dead Host Cells.


    Sateriale, Adam; Miller, Peter; Huston, Christopher D


    Entamoeba histolytica is the protozoan parasite that causes invasive amebiasis, which is endemic to many developing countries and characterized by dysentery and liver abscesses. The virulence of E. histolytica correlates with the degree of host cell engulfment, or phagocytosis, and E. histolytica phagocytosis alters amebic gene expression in a feed-forward manner that results in an increased phagocytic ability. Here, we used a streamlined RNA interference screen to silence the expression of 15 genes whose expression was upregulated in phagocytic E. histolytica trophozoites to determine whether these genes actually function in the phagocytic process. When five of these genes were silenced, amebic strains with significant decreases in the ability to phagocytose apoptotic host cells were produced. Phagocytosis of live host cells, however, was largely unchanged, and the defects were surprisingly specific for phagocytosis. Two of the five encoded proteins, which we named E. histolytica ILWEQ (EhILWEQ) and E. histolytica BAR (EhBAR), were chosen for localization via SNAP tag labeling and localized to the site of partially formed phagosomes. Therefore, both EhILWEQ and EhBAR appear to contribute to E. histolytica virulence through their function in phagocytosis, and the large proportion (5/15 [33%]) of gene-silenced strains with a reduced ability to phagocytose host cells validates the previously published microarray data set demonstrating feed-forward control of E. histolytica phagocytosis. Finally, although only limited conclusions can be drawn from studies using the virulence-deficient G3 Entamoeba strain, the relative specificity of the defects induced for phagocytosis of apoptotic cells but not healthy cells suggests that cell killing may play a rate-limiting role in the process of Entamoeba histolytica host cell engulfment.

  9. Diversity and Impact of Rare Variants in Genes Encoding the Platelet G Protein-Coupled Receptors

    PubMed Central

    Jones, Matthew L.; Norman, Jane E.; Morgan, Neil V.; Mundell, Stuart J.; Lordkipanidzé, Marie; Lowe, Gillian C.; Daly, Martina E.; Simpson, Michael A.; Drake, Sian; Watson, Steve P.


    Summary Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70% had global minor allele frequency (MAF) < 0.05%. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21%) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF<1% and 22 with MAF ≥ 1%). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes. PMID:25567036

  10. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.


    Gilbert, Lawrence I


    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway. PMID:15026169

  11. Cell-Free Phospholipid Biosynthesis by Gene-Encoded Enzymes Reconstituted in Liposomes

    PubMed Central

    Scott, Andrew; Noga, Marek J.; de Graaf, Paul; Westerlaken, Ilja; Yildirim, Esengul; Danelon, Christophe


    The goal of bottom-up synthetic biology culminates in the assembly of an entire cell from separate biological building blocks. One major challenge resides in the in vitro production and implementation of complex genetic and metabolic pathways that can support essential cellular functions. Here, we show that phospholipid biosynthesis, a multiple-step process involved in cell membrane homeostasis, can be reconstituted starting from the genes encoding for all necessary proteins. A total of eight E. coli enzymes for acyl transfer and headgroup modifications were produced in a cell-free gene expression system and were co-translationally reconstituted in liposomes. Acyl-coenzyme A and glycerol-3-phosphate were used as canonical precursors to generate a variety of important bacterial lipids. Moreover, this study demonstrates that two-step acyl transfer can occur from enzymes synthesized inside vesicles. Besides clear implications for growth and potentially division of a synthetic cell, we postulate that gene-based lipid biosynthesis can become instrumental for ex vivo and protein purification-free production of natural and non-natural lipids. PMID:27711229

  12. Sudden infant death syndrome caused by cardiac arrhythmias: only a matter of genes encoding ion channels?


    Sarquella-Brugada, Georgia; Campuzano, Oscar; Cesar, Sergi; Iglesias, Anna; Fernandez, Anna; Brugada, Josep; Brugada, Ramon


    Sudden infant death syndrome is the unexpected demise of a child younger than 1 year of age which remains unexplained after a complete autopsy investigation. Usually, it occurs during sleep, in males, and during the first 12 weeks of life. The pathophysiological mechanism underlying the death is unknown, and the lethal episode is considered multifactorial. However, in cases without a conclusive post-mortem diagnosis, suspicious of cardiac arrhythmias may also be considered as a cause of death, especially in families suffering from any cardiac disease associated with sudden cardiac death. Here, we review current understanding of sudden infant death, focusing on genetic causes leading to lethal cardiac arrhythmias, considering both genes encoding ion channels as well as structural proteins due to recent association of channelopathies and desmosomal genes. We support a comprehensive analysis of all genes associated with sudden cardiac death in families suffering of infant death. It allows the identification of the most plausible cause of death but also of family members at risk, providing cardiologists with essential data to adopt therapeutic preventive measures in families affected with this lethal entity.

  13. Isolation, hyperexpression, and sequencing of the aceA gene encoding isocitrate lyase in Escherichia coli.

    PubMed Central

    Matsuoka, M; McFadden, B A


    A structural gene for isocitrate lyase was isolated from a cosmid containing an ace locus of the Escherichia coli chromosome. Cloning and expression under control of the tac promoter in a multicopy plasmid showed that a 1.7-kilobase-pair DNA segment was sufficient for complementation of an aceA deletion mutation and overproduction of isocitrate lyase. DNA sequence analysis of the cloned gene and N-terminal protein sequencing of the cloned and wild-type enzymes revealed an entire aceA gene which encodes a 429-amino-acid residue polypeptide whose C-terminus is histidine. The deduced amino acid sequence for the 47.2-kilodalton subunit of E. coli isocitrate lyase could be aligned with that for the 64.8-kilodalton subunit of the castor bean enzyme with 39% identity except for limited N- and C-terminal regions and a 103-residue stretch that was unique for the plant enzyme and started approximately in the middle of that peptide. Images PMID:3049537

  14. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    PubMed Central

    Mousa, Walaa K.; Raizada, Manish N.


    The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produces a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins, and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous coding sequences (CDS). We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters. PMID:25914708

  15. Functional genomics and SNP analysis of human genes encoding proline metabolic enzymes

    PubMed Central

    Williams, D. Bart; Zhaorigetu, Siqin; Khalil, Shadi; Wan, Guanghua; Valle, David


    Proline metabolism in mammals involves two other amino acids, glutamate and ornithine, and five enzymatic activities, Δ1-pyrroline-5-carboxylate (P5C) reductase (P5CR), proline oxidase, P5C dehydrogenase, P5C synthase and ornithine-δ-aminotransferase (OAT). With the exception of OAT, which catalyzes a reversible reaction, the other 4 enzymes are unidirectional, suggesting that proline metabolism is purpose-driven, tightly regulated, and compartmentalized. In addition, this tri-amino-acid system also links with three other pivotal metabolic systems, namely the TCA cycle, urea cycle, and pentose phosphate pathway. Abnormalities in proline metabolism are relevant in several diseases: six monogenic inborn errors involving metabolism and/or transport of proline and its immediate metabolites have been described. Recent advances in the Human Genome Project, in silico database mining techniques, and research in dissecting the molecular basis of proline metabolism prompted us to utilize functional genomic approaches to analyze human genes which encode proline metabolic enzymes in the context of gene structure, regulation of gene expression, mRNA variants, protein isoforms, and single nucleotide polymorphisms. PMID:18506409

  16. Monoclonal antibody against a putative myristoylated membrane protein encoded by grouper iridovirus 59L gene.


    Chen, Zhi-Yu; Chiou, Pinwen Peter; Liou, Chian-Jiun; Lai, Yu-Shen


    Groupers (Epinephelus spp.) are economically important fish species worldwide, and ranaviruses are major viral pathogens causing heavy economic losses in grouper aquaculture. In this study, the 59L gene of grouper iridovirus (GIV-59L) was cloned and characterized. This gene is 1521 bp and encodes a protein of 506 amino acids with a predicted molecular mass of 53.9 kDa. Interestingly, GIV-59L and its homologs are found in all genera of the family Iridoviridae. A mouse monoclonal antibody specific for the C-terminal domain (amino acid positions 254-506) of the GIV-59L protein, GIV-59L(760-1518)-MAb-21, was produced and proved to be well suited for use in a number of GIV immunoassays. RT-PCR, Western blotting, and cycloheximide and cytosine arabinoside drug inhibition analyses indicated that GIV-59L is a viral late gene in GIV-infected grouper kidney cells. Immunofluorescence analysis revealed that GIV-59L protein mainly accumulates in the cytoplasm of infected cells and is finally packed into a whole virus particle. The GIV-59L(760-1518)-MAb-21 characterized in this study could have widespread application in GIV immunodiagnostics and other research on GIV. In addition, the results presented here offer important insights into the pathogenesis of GIV. PMID:25850399

  17. Analysis of a polygalacturonase gene of Ustilago maydis and characterization of the encoded enzyme.


    Castruita-Domínguez, José P; González-Hernández, Sandra E; Polaina, Julio; Flores-Villavicencio, Lérida L; Alvarez-Vargas, Aurelio; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Leal-Morales, Carlos A


    Ustilago maydis is a pathogenic fungus that produces the corn smut. It is a biotrophic parasite that depends on living plant tissues for its proliferation and development. Polygalacturonases are secreted by pathogens to solubilize the plant cell-wall and are required for pathogen virulence. In this paper, we report the isolation of a U. maydis polygalacturonase gene (Pgu1) and the functional and structural characterization of the encoded enzyme. The U. maydis Pgu1 gene is expressed when the fungus is grown in liquid culture media containing different carbon sources. In plant tissue, the expression increased as a function of incubation time. Pgu1 gene expression was detected during plant infection around 10 days post-infection with U. maydis FB-D12 strain in combination with teliospore formation. Synthesis and secretion of active recombinant PGU1 were achieved using Pichia pastoris, the purified enzyme had a optimum temperature of 34 °C, optimum pH of 4.5, a Km of 57.84 g/L for polygalacturonic acid, and a Vmax of 28.9 µg/min mg. Structural models of PGU1 based on homologous enzymes yielded a typical right-handed β-helix fold of pectinolytic enzymes classified in the glycosyl hydrolases family 28, and the U. maydis PGU1 is related with endo rather than exo polygalacturonases.

  18. Arabidopsis thaliana and Saccharomyces cerevisiae NHX1 genes encode amiloride sensitive electroneutral Na+/H+ exchangers.

    PubMed Central

    Darley, C P; van Wuytswinkel , O C; van der Woude , K; Mager, W H; de Boer , A H


    Sodium at high millimolar levels in the cytoplasm is toxic to plant and yeast cells. Sequestration of Na(+) ions into the vacuole is one mechanism to confer Na(+)-tolerance on these organisms. In the present study we provide direct evidence that the Arabidopsis thaliana At-NHX1 gene and the yeast NHX1 gene encode low-affinity electroneutral Na(+)/H(+) exchangers. We took advantage of the ability of heterologously expressed At-NHX1 to functionally complement the yeast nhx1-null mutant. Experiments on vacuolar vesicles isolated from yeast expressing At-NHX1 or NHX1 provided direct evidence for pH-gradient-energized Na(+) accumulation into the vacuole. A major difference between NHX1 and At-NHX1 is the presence of a cleavable N-terminal signal peptide (SP) in the former gene. Fusion of the SP to At-NHX1 resulted in an increase in the magnitude of Na(+)/H(+) exchange, indicating a role for the SP in protein targeting or regulation. Another distinguishing feature between the plant and yeast antiporters is their sensitivity to the diuretic compound amiloride. Whereas At-NHX1 was completely inhibited by amiloride, NHX1 activity was reduced by only 20-40%. These results show that yeast as a heterologous expression system provides a convenient model to analyse structural and regulatory features of plant Na(+)/H(+) antiporters. PMID:10998367

  19. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.


    Gilbert, Lawrence I


    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  20. The Drosophila prage Gene, Required for Maternal Transcript Destabilization in Embryos, Encodes a Predicted RNA Exonuclease

    PubMed Central

    Cui, Jun; Lai, Yun Wei; Sartain, Caroline V.; Zuckerman, Rebecca M.; Wolfner, Mariana F.


    Egg activation, the transition of mature oocytes into developing embryos, is critical for the initiation of embryogenesis. This process is characterized by resumption of meiosis, changes in the egg’s coverings and by alterations in the transcriptome and proteome of the egg; all of these occur in the absence of new transcription. Activation of the egg is prompted by ionic changes in the cytoplasm (usually a rise in cytosolic calcium levels) that are triggered by fertilization in some animals and by mechanosensitive cues in others. The egg’s transcriptome is dramatically altered during the process, including by the removal of many maternal mRNAs that are not needed for embryogenesis. However, the mechanisms and regulators of this selective RNA degradation are not yet fully known. Forward genetic approaches in Drosophila have identified maternal-effect genes whose mutations prevent the transcriptome changes. One of these genes, prage (prg), was identified by Tadros et al. in a screen for mutants that fail to destabilize maternal transcripts. We identified the molecular nature of the prg gene through a combination of deficiency mapping, complementation analysis, and DNA sequencing of both extant prg mutant alleles. We find that prg encodes a ubiquitously expressed predicted exonuclease, consistent with its role in maternal mRNA destabilization during egg activation. PMID:27172196

  1. Nuclear and mitochondrial genes for inferring Trichuris phylogeny.


    Callejón, Rocío; Cutillas, Cristina; Nadler, Steven A


    Nucleotide sequences of the triose phosphate isomerase (TPI) gene (624 bp) and mitochondrial cytochrome b (cob) gene (520 bp) were obtained by PCR and evaluated for utility in inferring the phylogenetic relationships among Trichuris species. Published sequences of one other nuclear gene (18S or SSU rRNA, 1816-1846 bp) and one additional mitochondrial (mtDNA) gene (cytochrome oxidase 1, cox1, 342 bp) were also analyzed. Maximum likelihood and Bayesian inference methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data (two genes), the combined nuclear data (two genes), and the total evidence (four gene) dataset. Few Trichuris clades were uniformly resolved across separate analyses of individual genes. For the mtDNA, the cob gene trees had greater phylogenetic resolution and tended to have higher support values than the cox1 analyses. For nuclear genes, the SSU gene trees had slightly greater resolution and support values than the TPI analyses, but TPI was the only gene with reliable support for the deepest nodes in the tree. Combined analyses of genes yielded strongly supported clades in most cases, with the exception of the relationship among Trichuris clades 1, 2, and 3, which showed conflicting results between nuclear and mitochondrial genes. Both the TPI and cob genes proved valuable for inferring Trichuris relationships, with greatest resolution and support values achieved through combined analysis of multiple genes. Based on the phylogeny of the combined analysis of nuclear and mitochondrial genes, parsimony mapping of definitive host utilization depicts artiodactyls as the ancestral hosts for these Trichuris, with host-shifts into primates, rodents, and Carnivora.

  2. Disorders of phospholipid metabolism: an emerging class of mitochondrial disease due to defects in nuclear genes.


    Lu, Ya-Wen; Claypool, Steven M


    The human nuclear and mitochondrial genomes co-exist within each cell. While the mitochondrial genome encodes for a limited number of proteins, transfer RNAs, and ribosomal RNAs, the vast majority of mitochondrial proteins are encoded in the nuclear genome. Of the multitude of mitochondrial disorders known to date, only a fifth are maternally inherited. The recent characterization of the mitochondrial proteome therefore serves as an important step toward delineating the nosology of a large spectrum of phenotypically heterogeneous diseases. Following the identification of the first nuclear gene defect to underlie a mitochondrial disorder, a plenitude of genetic variants that provoke mitochondrial pathophysiology have been molecularly elucidated and classified into six categories that impact: (1) oxidative phosphorylation (subunits and assembly factors); (2) mitochondrial DNA maintenance and expression; (3) mitochondrial protein import and assembly; (4) mitochondrial quality control (chaperones and proteases); (5) iron-sulfur cluster homeostasis; and (6) mitochondrial dynamics (fission and fusion). Here, we propose that an additional class of genetic variant be included in the classification schema to acknowledge the role of genetic defects in phospholipid biosynthesis, remodeling, and metabolism in mitochondrial pathophysiology. This seventh class includes a small but notable group of nuclear-encoded proteins whose dysfunction impacts normal mitochondrial phospholipid metabolism. The resulting human disorders present with a diverse array of pathologic consequences that reflect the variety of functions that phospholipids have in mitochondria and highlight the important role of proper membrane homeostasis in mitochondrial biology.

  3. Disorders of phospholipid metabolism: an emerging class of mitochondrial disease due to defects in nuclear genes

    PubMed Central

    Lu, Ya-Wen; Claypool, Steven M.


    The human nuclear and mitochondrial genomes co-exist within each cell. While the mitochondrial genome encodes for a limited number of proteins, transfer RNAs, and ribosomal RNAs, the vast majority of mitochondrial proteins are encoded in the nuclear genome. Of the multitude of mitochondrial disorders known to date, only a fifth are maternally inherited. The recent characterization of the mitochondrial proteome therefore serves as an important step toward delineating the nosology of a large spectrum of phenotypically heterogeneous diseases. Following the identification of the first nuclear gene defect to underlie a mitochondrial disorder, a plenitude of genetic variants that provoke mitochondrial pathophysiology have been molecularly elucidated and classified into six categories that impact: (1) oxidative phosphorylation (subunits and assembly factors); (2) mitochondrial DNA maintenance and expression; (3) mitochondrial protein import and assembly; (4) mitochondrial quality control (chaperones and proteases); (5) iron–sulfur cluster homeostasis; and (6) mitochondrial dynamics (fission and fusion). Here, we propose that an additional class of genetic variant be included in the classification schema to acknowledge the role of genetic defects in phospholipid biosynthesis, remodeling, and metabolism in mitochondrial pathophysiology. This seventh class includes a small but notable group of nuclear-encoded proteins whose dysfunction impacts normal mitochondrial phospholipid metabolism. The resulting human disorders present with a diverse array of pathologic consequences that reflect the variety of functions that phospholipids have in mitochondria and highlight the important role of proper membrane homeostasis in mitochondrial biology. PMID:25691889

  4. The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway.


    Silverstone, A L; Ciampaglio, C N; Sun, T


    The recessive rga mutation is able to partially suppress phenotypic defects of the Arabidopsis gibberellin (GA) biosynthetic mutant ga1-3. Defects in stem elongation, flowering time, and leaf abaxial trichome initiation are suppressed by rga. This indicates that RGA is a negative regulator of the GA signal transduction pathway. We have identified 10 additional alleles of rga from a fast-neutron mutagenized ga1-3 population and used them to isolate the RGA gene by genomic subtraction. Our data suggest that RGA may be functioning as a transcriptional regulator. RGA was found to be a member of the VHIID regulatory family, which includes the radial root organizing gene SCARECROW and another GA signal transduction repressor, GAI. RGA and GAI proteins share a high degree of homology, but their N termini are more divergent. The presence of several structural features, including homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif, indicates that the RGA protein may be a transcriptional regulator that represses the GA response. In support of the putative nuclear localization signal, we demonstrated that a transiently expressed green fluorescent protein-RGA fusion protein is localized to the nucleus in onion epidermal cells. Because the rga mutation abolished the high level of expression of the GA biosynthetic gene GA4 in the ga1-3 mutant background, we conclude that RGA may also play a role in controlling GA biosynthesis.

  5. The fas operon of Rhodococcus fascians encodes new genes required for efficient fasciation of host plants.

    PubMed Central

    Crespi, M; Vereecke, D; Temmerman, W; Van Montagu, M; Desomer, J


    Three virulence loci (fas, att, and hyp) of Rhodococcus fascians D188 have been identified on a 200-kb conjugative linear plasmid (pFiD188). The fas locus was delimited to a 6.5-kb DNA fragment by insertion mutagenesis, single homologous disruptive recombination, and in trans complementation of different avirulent insertion mutants. The locus is arranged as a large operon containing six open reading frames whose expression is specifically induced during the interaction with host plants. One predicted protein is homologous to P-450 cytochromes from actinomycetes. The putative ferredoxin component is of a novel type containing additional domains homologous to transketolases from chemoautotrophic, photosynthetic, and methylotrophic microorganisms. Genetic analysis revealed that fas encodes, in addition to the previously identified ipt, at least two new genes that are involved in fasciation development, one of which is only required on older tobacco plants. PMID:8169198

  6. Sequence Analysis of the Gene Encoding Amylosucrase from Neisseria polysaccharea and Characterization of the Recombinant Enzyme

    PubMed Central

    Potocki De Montalk, G.; Remaud-Simeon, M.; Willemot, R. M.; Planchot, V.; Monsan, P.


    The Neisseria polysaccharea gene encoding amylosucrase was subcloned and expressed in Escherichia coli. Sequencing revealed that the deduced amino acid sequence differs significantly from that previously published. Comparison of the sequence with that of enzymes of the α-amylase family predicted a (β/α)8-barrel domain. Six of the eight highly conserved regions in amylolytic enzymes are present in amylosucrase. Among them, four constitute the active site in α-amylases. These sites were also conserved in the sequence of glucosyltransferases and dextransucrases. Nevertheless, the evolutionary tree does not show strong homology between them. The amylosucrase was purified by affinity chromatography between fusion protein glutathione S-transferase–amylosucrase and glutathione-Sepharose 4B. The pure enzyme linearly elongated some branched chains of glycogen, to an average degree of polymerization of 75. PMID:9882648

  7. Cloning, expression and characterization of a new agarase-encoding gene from marine Pseudoalteromonas sp.


    Lu, Xinzhi; Chu, Yan; Wu, Qianqian; Gu, Yuchao; Han, Feng; Yu, Wengong


    The beta-agarase gene agaA, cloned from a marine bacterium, Pseudoalteromonas sp. CY24, consists of 1,359 nucleotides encoding 453 amino acids in a sequence corresponding to a catalytic domain of glycosyl hydrolase family 16 (GH16) and a carbohydrate-binding module type 13 (CBM13). The recombinant enzyme is an endo-type agarase that hydrolyzes beta-1,4-linkages of agarose, yielding neoagarotetraose and neoagarohexaose as the predominant products. In two cleavage patterns, AgaA digested the smallest substrate, neoagarooctaose, into neoagarobiose, neoagarotetraose and neoagarohexaose. Site directed mutation was performed to investigate the differences between AgaA and AgaD of Vibrio sp. PO-303, identifying residues V(109)VTS(112) as playing a key role in the enzyme reaction. PMID:19504047

  8. Immunochemical Proof that a Novel Rearranging Gene Encodes the T Cell Receptor δ Subunit

    NASA Astrophysics Data System (ADS)

    Band, Hamid; Hochstenbach, Frans; McLean, Joanne; Hata, Shingo; Krangel, Michael S.; Brenner, Michael B.


    The T cell receptor (TCR) δ protein is expressed as part of a heterodimer with TCR γ , in association with the CD3 polypeptides on a subset of functional peripheral blood T lymphocytes, thymocytes, and certain leukemic T cell lines. A monoclonal antibody directed against TCR δ was produced that binds specifically to the surface of several TCR γ δ cell lines and immunoprecipitates the TCR γ δ as a heterodimer from Triton X-100 detergent lysates and also immunoprecipitates the TCR δ subunit alone after chain separation. A candidate human TCR δ complementary DNA clone (IDP2 O-240/38), reported in a companion paper, was isolated by the subtractive library approach from a TCR γ δ cell line. This complementary DNA clone was used to direct the synthesis of a polypeptide that is specifically recognized by the monoclonal antibody to TCR δ . This complementary DNA clone thus corresponds to the gene that encodes the TCR δ subunit.

  9. Molecular characterization of a gene encoding a photolyase from Streptomyces griseus.

    PubMed Central

    Kobayashi, T; Takao, M; Oikawa, A; Yasui, A


    By using a synthetic DNA probe derived from an amino acid sequence in the most conserved region of three known photolyases (Escherichia coli, Anacystis nidulans and Saccharomyces cerevisiae), we isolated a DNA fragment containing two long open reading frames (ORFs) from a genomic DNA library of Streptomyces griseus. One ORF encodes a polypeptide of 455 amino acids (Mr 50594), which exhibits substantial similarities with the other three photolyases. Photoreactivation-repair deficient E. coli cells could be converted into photoreactivatable ones by introduction of plasmids harboring this ORF, indicating that this is the photolyase gene of S. griseus. The deduced aa sequence of Streptomyces photolyase was most similar to that of E. coli. The putative DNA binding site as well as cofactor binding regions were proposed. Images PMID:2501760

  10. Nuclear gene mutations as the cause of mitochondrial complex III deficiency

    PubMed Central

    Fernández-Vizarra, Erika; Zeviani, Massimo


    Complex III (CIII) deficiency is one of the least common oxidative phosphorylation defects associated to mitochondrial disease. CIII constitutes the center of the mitochondrial respiratory chain, as well as a crossroad for several other metabolic pathways. For more than 10 years, of all the potential candidate genes encoding structural subunits and assembly factors, only three were known to be associated to CIII defects in human pathology. Thus, leaving many of these cases unresolved. These first identified genes were MT-CYB, the only CIII subunit encoded in the mitochondrial DNA; BCS1L, encoding an assembly factor, and UQCRB, a nuclear-encoded structural subunit. Nowadays, thanks to the fast progress that has taken place in the last 3–4 years, pathological changes in seven more genes are known to be associated to these conditions. This review will focus on the strategies that have permitted the latest discovery of mutations in factors that are necessary for a correct CIII assembly and activity, in relation with their function. In addition, new data further establishing the molecular role of LYRM7/MZM1L as a chaperone involved in CIII biogenesis are provided. PMID:25914718

  11. Genome-wide identification and evolutionary analysis of nucleotide-binding site-encoding resistance genes in Lotus japonicus (Fabaceae).


    Song, H; Wang, P F; Li, T T; Xia, H; Zhao, S Z; Hou, L; Zhao, C Z


    Nucleotide-binding site (NBS) disease resistance genes play a crucial role in plant defense responses against pathogens and insect pests. Many NBS-encoding genes have been detected in Lotus japonicus, an important forage crop in many parts of the world. However, most NBS genes identified so far in L. japonicus were only partial sequences. We identified 45 full-length NBS-encoding genes in the L. japonicus genome, and analyzed gene duplications, motifs, and the molecular phylogeny to further understand the NBS gene family. We found that gene duplication events rarely occur in L. japonicus NBS-encoding (LjNBS) genes. In addition, LjNBS genes were subjected to selection pressure, and codon usage bias was evident. We tested for purifying selection (specifically in the CC-NBS-LRR and TIR-NBS-LRR groups), and found strong purifying selection in the TIR-domain-containing sequences, indicating that the CC-NBS-LRR group is more likely to undergo expansion than the TIR-NBS-LRR group. Moreover, our results showed that both selection and mutation contributed to LjNBS codon usage bias, but mutational bias was the major influence on codon usage.

  12. The human homolog of the JE gene encodes a monocyte secretory protein.

    PubMed Central

    Rollins, B J; Stier, P; Ernst, T; Wong, G G


    The mouse fibroblast gene, JE, was one of the first platelet-derived growth factor-inducible genes to be described as such. The protein encoded by JE (mJE) is the prototype of a large family of secreted, cytokinelike glycoproteins, all of whose members are induced by a mitogenic or activation signal in monocytes macrophages, and T lymphocytes; JE is the only member to have been identified in fibroblasts. We report the identification of a human homolog for murine JE, cloned from human fibroblasts. The protein predicted by the coding sequence of human JE (hJE) is 55 amino acids shorter than mJE, and its sequence is identical to that of a recently purified monocyte chemoattractant. When expressed in COS cells, the human JE cDNA directed the secretion of N-glycosylated proteins of Mr 16,000 to 18,000 as well as proteins of Mr 15,500, 15,000, and 13,000. Antibodies raised against mJE recognized these hJE species, all of which were secreted by human fibroblasts. hJE expression was stimulated in HL60 cells during phorbol myristate acetate-induced monocytoid differentiation. However, resting human monocytes constitutively secreted hJE; treatment with gamma interferon did not enhance hJE expression in monocytes, and treatment with phorbol myristate acetate or lipopolysaccharide inhibited its expression. Thus, human JE encodes yet another member of the large family of JE-related cytokinelike proteins, in this case a novel human monocyte and fibroblast secretory protein. Images PMID:2513477

  13. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.


    Rady, Hamada F; Dai, Guixiang; Huang, Weitao; Shellito, Judd E; Ramsay, Alistair J


    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  14. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant

    PubMed Central

    Rady, Hamada F.; Dai, Guixiang; Huang, Weitao; Shellito, Judd E.; Ramsay, Alistair J.


    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route. PMID:26844553

  15. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.


    Rady, Hamada F; Dai, Guixiang; Huang, Weitao; Shellito, Judd E; Ramsay, Alistair J


    Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad) vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC). DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route. PMID:26844553

  16. Crystallization and preliminary X-ray studies of I-PpoI: a nuclear, intron-encoded homing endonuclease from Physarum polycephalum.

    PubMed Central

    Flick, K. E.; McHugh, D.; Heath, J. D.; Stephens, K. M.; Monnat, R. J.; Stoddard, B. L.


    The homing endonuclease I-PpoI is encoded by an optional third intron, Pp LSU 3, found in nuclear, extrachromosomal copies of the Physarum polycephalum 26S rRNA gene. This endonuclease promotes the lateral transfer or "homing" of its encoding intron by recognizing and cleaving a partially symmetric, 15 bp homing site in 26S rDNA alleles that lack the Pp LSU 3 intron. The open reading frame encoding I-PpoI has been subcloned, and the endonuclease has been overproduced in E. coli. Purified recombinant I-PpoI has been co-crystallized with a 21 bp homing site DNA duplex. The crystals belong to space group P3(1)21, with unit cell dimensions a = b = 114 A, c = 89 A. The results of initial X-ray diffraction experiments indicate that the asymmetric unit contains an enzyme homodimer and one duplex DNA molecule, and that the unit cell has a specific volume of 3.4 A3/dalton. These experiments also provide strong evidence that I-PpoI contains several bound zinc ions as part of its structure. PMID:9416623

  17. Identification of Antithrombin-Modulating Genes. Role of LARGE, a Gene Encoding a Bifunctional Glycosyltransferase, in the Secretion of Proteins?

    PubMed Central

    de la Morena-Barrio, María Eugenia; Buil, Alfonso; Antón, Ana Isabel; Martínez-Martínez, Irene; Miñano, Antonia; Gutiérrez-Gallego, Ricardo; Navarro-Fernández, José; Aguila, Sonia; Souto, Juan Carlos; Vicente, Vicente; Soria, José Manuel; Corral, Javier


    The haemostatic relevance of antithrombin together with the low genetic variability of SERPINC1, and the high heritability of plasma levels encourage the search for modulating genes. We used a hypothesis-free approach to identify these genes, evaluating associations between plasma antithrombin and 307,984 polymorphisms in the GAIT study (352 individuals from 21 Spanish families). Despite no SNP reaching the genome wide significance threshold, we verified milder positive associations in 307 blood donors from a different cohort. This validation study suggested LARGE, a gene encoding a protein with xylosyltransferase and glucuronyltransferase activities that forms heparin-like linear polysaccharides, as a potential modulator of antithrombin based on the significant association of one SNPs, rs762057, with anti-FXa activity, particularly after adjustment for age, sex and SERPINC1 rs2227589 genotype, all factors influencing antithrombin levels (p = 0.02). Additional results sustained this association. LARGE silencing inHepG2 and HEK-EBNA cells did not affect SERPINC1 mRNA levels but significantly reduced the secretion of antithrombin with moderate intracellular retention. Milder effects were observed on α1-antitrypsin, prothrombin and transferrin. Our study suggests LARGE as the first known modifier of plasma antithrombin, and proposes a new role for LARGE in modulating extracellular secretion of certain glycoproteins. PMID:23705025

  18. Structure of the gene encoding the 14.5 kDa subunit of human RNA polymerase II.

    PubMed Central

    Acker, J; Wintzerith, M; Vigneron, M; Kedinger, C


    The structure of the gene encoding the 14.5 kDa subunit of the human RNA polymerase II (or B) has been elucidated. The gene consists of six exons, ranging from 52 to over 101 bp, interspaced with five introns ranging from 84 to 246 bp. It is transcribed into three major RNA species, present at low abundance in exponentially growing HeLa cells. The corresponding messenger RNAs contain the same open reading frame encoding a 125 amino acid residue protein, with a calculated molecular weight of 14,523 Da. This protein (named hRPB14.5) shares strong homologies with the homologous polymerase subunits encoded by the Drosophila (RpII15) and yeast (RPB9) genes. Cysteines characteristic of two zinc fingers are conserved in all three corresponding sequences and, like the yeast protein, the hRPB14.5 subunit exhibits zinc-binding activity. Images PMID:8265347

  19. Isolation of a strawberry gene fragment encoding an actin depolymerizing factor-like protein from genotypes resistant to Colletotrichum acutatum.


    Ontivero, Marta; Zamora, Gustavo Martínez; Salazar, Sergio; Ricci, Juan Carlos Díaz; Castagnaro, Atilio Pedro


    Actin depolymerizing factors (ADFs) have been recently implicated in plant defense against pathogenic fungi, associated with the cytoskeletal rearrangements that contribute to establish an effective barrier against fungal ingress. In this work, we identified a DNA fragment corresponding to a part of a gene predicted to encode an ADF-like protein in genotypes of Fragaria ananassa resistant to the fungus Colletotrichum acutatum. Bulked segregant analysis combined with AFLP was used to identify polymorphisms linked to resistance in hybrids derived from the cross between the resistant cultivar 'Sweet Charlie' and the susceptible cultivar 'Pájaro'. The sequence of one out of three polymorphic bands detected showed significant BLASTX hits to ADF proteins from other plants. Two possible exons were identified and bioinformatic analysis revealed the presence of the ADF homology domain with two actin-binding sites, an N-terminal phosphorylation site, and a nuclear localization signal. In addition to its possible application in strawberry breeding programs, these finding may contribute to investigate the role of ADFs in plant resistance against fungi. PMID:22107362

  20. The cryptomonad histone H4-encoding gene: structure and chromosomal localization.


    Müller, S B; Rensing, S A; Maier, U G


    Cryptomonads are unicellular flagellates whose plastids are surrounded by four membranes. A periplastidal compartment, containing eukaryote-type ribosomes, starch grains and a so-called nucleomorph, is located between the inner and outer membrane pairs. The nucleomorph has been shown to be the vestigial nucleus of a eukaryotic endosymbiont. In order to obtain more information about the chromatin structure of the nucleomorph and the host nuclear chromosomes, we studied the distribution of the histone, H4. H4 was not detectable in the nucleomorph by immunolocalization, thus supporting earlier findings by Gibbs [In: Wiesner et al. (Eds.), Experimental Phycology 1, 1990, pp. 145-157]. Likewise, no H4 DNA was demonstrable in the nucleomorph by Southern hybridization. Sequence analysis, and Southern and Northern blot data of a cryptomonad gene, H4, indicate an intermediate position for these genes between animals and plants.

  1. Regulation of the acuF gene, encoding phosphoenolpyruvate carboxykinase in the filamentous fungus Aspergillus nidulans.


    Hynes, Michael J; Draht, Oliver W; Davis, Meryl A


    Phosphoenolpyruvate carboxykinase (PEPCK) is a key enzyme required for gluconeogenesis when microorganisms grow on carbon sources metabolized via the tricarboxylic acid (TCA) cycle. Aspergillus nidulans acuF mutants isolated by their inability to use acetate as a carbon source specifically lack PEPCK. The acuF gene has been cloned and shown to encode a protein with high similarity to PEPCK from bacteria, plants, and fungi. The regulation of acuF expression has been studied by Northern blotting and by the construction of lacZ fusion reporters. Induction by acetate is abolished in mutants unable to metabolize acetate via the TCA cycle, and induction by amino acids metabolized via 2-oxoglutarate is lost in mutants unable to form 2-oxoglutarate. Induction by acetate and proline is not additive, consistent with a single mechanism of induction. Malate and succinate result in induction, and it is proposed that PEPCK is controlled by a novel mechanism of induction by a TCA cycle intermediate or derivative, thereby allowing gluconeogenesis to occur during growth on any carbon source metabolized via the TCA cycle. It has been shown that the facB gene, which mediates acetate induction of enzymes specifically required for acetate utilization, is not directly involved in PEPCK induction. This is in contrast to Saccharomyces cerevisiae, where Cat8p and Sip4p, homologs of FacB, regulate PEPCK as well as the expression of other genes necessary for growth on nonfermentable carbon sources in response to the carbon source present. This difference in the control of gluconeogenesis reflects the ability of A. nidulans and other filamentous fungi to use a wide variety of carbon sources in comparison with S. cerevisiae. The acuF gene was also found to be subject to activation by the CCAAT binding protein AnCF, a protein homologous to the S. cerevisiae Hap complex and the mammalian NFY complex.

  2. Regulation of the acuF Gene, Encoding Phosphoenolpyruvate Carboxykinase in the Filamentous Fungus Aspergillus nidulans

    PubMed Central

    Hynes, Michael J.; Draht, Oliver W.; Davis, Meryl A.


    Phosphoenolpyruvate carboxykinase (PEPCK) is a key enzyme required for gluconeogenesis when microorganisms grow on carbon sources metabolized via the tricarboxylic acid (TCA) cycle. Aspergillus nidulans acuF mutants isolated by their inability to use acetate as a carbon source specifically lack PEPCK. The acuF gene has been cloned and shown to encode a protein with high similarity to PEPCK from bacteria, plants, and fungi. The regulation of acuF expression has been studied by Northern blotting and by the construction of lacZ fusion reporters. Induction by acetate is abolished in mutants unable to metabolize acetate via the TCA cycle, and induction by amino acids metabolized via 2-oxoglutarate is lost in mutants unable to form 2-oxoglutarate. Induction by acetate and proline is not additive, consistent with a single mechanism of induction. Malate and succinate result in induction, and it is proposed that PEPCK is controlled by a novel mechanism of induction by a TCA cycle intermediate or derivative, thereby allowing gluconeogenesis to occur during growth on any carbon source metabolized via the TCA cycle. It has been shown that the facB gene, which mediates acetate induction of enzymes specifically required for acetate utilization, is not directly involved in PEPCK induction. This is in contrast to Saccharomyces cerevisiae, where Cat8p and Sip4p, homologs of FacB, regulate PEPCK as well as the expression of other genes necessary for growth on nonfermentable carbon sources in response to the carbon source present. This difference in the control of gluconeogenesis reflects the ability of A. nidulans and other filamentous fungi to use a wide variety of carbon sources in comparison with S. cerevisiae. The acuF gene was also found to be subject to activation by the CCAAT binding protein AnCF, a protein homologous to the S. cerevisiae Hap complex and the mammalian NFY complex. PMID:11741859

  3. Identification and molecular characterization of the aco genes encoding the Pelobacter carbinolicus acetoin dehydrogenase enzyme system.

    PubMed Central

    Oppermann, F B; Steinbüchel, A


    Use of oligonucleotide probes, which were deduced from the N-terminal sequences of the purified enzyme components, identified the structural genes for the alpha and beta subunits of E1 (acetoin:2,6-dichlorophenolindophenol oxidoreductase), E2 (dihydrolipoamide acetyltransferase), and E3 (dihydrolipoamide dehydrogenase) of the Pelobacter carbinolicus acetoin dehydrogenase enzyme system, which were designated acoA, acoB, acoC, and acoL, respectively. The nucleotide sequences of acoA (979 bp), acoB (1,014 bp), acoC (1,353 bp), and acoL (1,413 bp) as well as of acoS (933 bp), which encodes a protein with an M(r) of 34,421 exhibiting 64.7% amino acid identity to the Escherichia coli lipA gene product, were determined. These genes are clustered on a 6.1-kbp region. Heterologous expression of acoA, acoB, acoC, acoL, and acoS in E. coli was demonstrated. The amino acid sequences deduced from acoA, acoB, acoC, and acoL for E1 alpha (M(r), 34,854), E1 beta (M(r), 36,184), E2 (M(r), 47,281), and E3 (M(r), 49,394) exhibited striking similarities to the amino acid sequences of the components of the Alcaligenes eutrophus acetoin-cleaving system. Homologies of up to 48.7% amino acid identity to the primary structures of the enzyme components of various 2-oxo acid dehydrogenase complexes also were found. In addition, the respective genes of the 2-oxo acid dehydrogenase complexes and of the acetoin dehydrogenase enzyme system were organized very similarly, indicating a close relationship of the P. carbinolicus acetoin dehydrogenase enzyme system to 2-oxo acid dehydrogenase complexes. Images PMID:8110297

  4. A hot spot for hotfoot mutations in the gene encoding the delta2 glutamate receptor.


    Wang, Ying; Matsuda, Shinji; Drews, Valerie; Torashima, Takashi; Meisler, Miriam H; Yuzaki, Michisuke


    The orphan glutamate receptor delta2 is selectively expressed in Purkinje cells and plays a crucial role in cerebellar functions. Recently, ataxia in the hotfoot mouse ho4J was demonstrated to be caused by a deletion in the delta2 receptor gene (Grid2) removing the N-terminal 170 amino acids of the delta2 receptor. To understand how delta2 receptors function, we characterized mutations in eight additional spontaneously occurring hotfoot alleles of Grid2. The mouse Grid2 gene consists of 16 exons, spanning approximately 1.4 Mb. Genomic DNA analysis showed that seven hotfoot mutants had a deletion of one or more exons encoding the N-terminal domain of delta2 receptors. The exception is ho5J, which has a point mutation in exon 12. Deletions in ho7J, ho9J, ho11J and ho12J mice result in the in-frame deletion of between 40 and 95 amino acids. Expression of constructs containing these deletions in HEK293 cells resulted in protein retention in the endoplasmic reticulum or cis-Golgi without transport to the cell surface. Coimmunoprecipitation assays indicated that these deletions also reduce the intermolecular interaction between individual delta2 receptors. These results indicate that the deleted N-terminal regions are crucial for oligomerization of delta2 receptors and their subsequent transport to the cell surface of Purkinje cells. The relatively large size of the Grid2 gene may be one of the reasons why many spontaneous mutations occur in this gene. In addition, the frequent occurrence of in-frame deletions within the N-terminal domain in hotfoot mutants suggests the importance of this domain in the function of delta2 receptors.

  5. Expression of the Genes Encoding the Trk and Kdp Potassium Transport Systems of Mycobacterium tuberculosis during Growth In Vitro

    PubMed Central

    Cholo, Moloko C.; van Rensburg, Elizabeth J.; Osman, Ayman G.; Anderson, Ronald


    Two potassium (K+)-uptake systems, Trk and Kdp, are operative in Mycobacterium tuberculosis (Mtb), but the environmental factors triggering their expression have not been determined. The current study has evaluated the expression of these genes in the Mtb wild-type and a trk-gene knockout strain at various stages of logarithmic growth in relation to extracellular K+ concentrations and pH. In both strains, mRNA levels of the K+-uptake encoding genes were relatively low compared to those of the housekeeping gene, sigA, at the early- and mid-log phases, increasing during late-log. Increased gene expression coincided with decreased K+ uptake in the context of a drop in extracellular pH and sustained high extracellular K+ concentrations. In an additional series of experiments, the pH of the growth medium was manipulated by the addition of 1N HCl/NaOH. Decreasing the pH resulted in reductions in both membrane potential and K+ uptake in the setting of significant induction of genes encoding both K+ transporters. These observations are consistent with induction of the genes encoding the active K+ transporters of Mtb as a strategy to compensate for loss of membrane potential-driven uptake of K+ at low extracellular pH. Induction of these genes may promote survival in the acidic environments of the intracellular vacuole and granuloma. PMID:26351637

  6. Two N-myc polypeptides with distinct amino termini encoded by the second and third exons of the gene.

    PubMed Central

    Mäkelä, T P; Saksela, K; Alitalo, K


    The N-myc and c-myc genes encode closely related nuclear phosphoproteins. We found that the N-myc protein from human tumor cell lines appears as four closely migrating polypeptide bands (p58 to p64) in sodium dodecyl sulfate-polyacrylamide gels. This and the recent finding that the c-myc protein is synthesized from two translational initiation sites located in the first and second exons of the gene (S. R. Hann, M. W. King, D. L. Bentley, C. W. Anderson, and R. N. Eisenman, Cell 52:185-195, 1988) prompted us to study the molecular basis of the N-myc protein heterogeneity. Dephosphorylation by alkaline phosphatase reduced the four polypeptide bands to a doublet with an electrophoretic mobility corresponding to the two faster-migrating N-myc polypeptides (p58 and p60). When expressed transiently in COS cells, an N-myc deletion construct lacking the first exon produced polypeptides similar to the wild-type N-myc protein, indicating that the first exon of the N-myc gene is noncoding. Furthermore, mutants deleted of up to two thirds of C-terminal coding domains still retained the capacity to produce a doublet of polypeptides, suggesting distinct amino termini for the two N-myc polypeptides. The amino-terminal primary structure of the N-myc protein was studied by site-specific point mutagenesis of the 5' end of the long open reading frame and by N-terminal radiosequencing of the two polypeptides. Our results show that the N-myc polypeptides are initiated from two alternative in-phase AUG codons located 24 base pairs apart at the 5' end of the second exon. Both of these polypeptides are phosphorylated and localized to the nucleus even when expressed separately. Interestingly, DNA rearrangements activating the c-myc gene are often found in the 1.7-kilobase-pair region between the two c-myc translational initiation sites and correlate with the loss of the longer c-myc polypeptide. Thus the close spacing of the two N-myc initiation codons could explain the relative resistance

  7. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    PubMed Central

    Wong, Lee-Jun C; Dai, Pu; Lu, Jyh-Feng; Lou, Mary Ann; Clarke, Robert; Nazarov, Viktor


    Background The poly Q polymorphism in AIB1 (amplified in breast cancer) gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds) of AIB1 gene were found in 2 out of 9 (22%) ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330). The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1) and resistance to 4-hydroxy tamoxifen (4-OH TAM) (LCC2 and R27), ICI 182,780 (LCC9) or 4-OH TAM, KEO and LY 117018 (LY-2), AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (<20%) extra poly Q encoding sequence patterns that were derived from the original allele, presumably due to somatic instability. Although all MCF-7 cells and their variants had the same predominant poly Q encoding sequence pattern of (CAG)3CAA(CAG)9(CAACAG)3(CAACAGCAG)2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is

  8. Mutations in the YRB1 gene encoding yeast ran-binding-protein-1 that impair nucleocytoplasmic transport and suppress yeast mating defects.

    PubMed Central

    Künzler, M; Trueheart, J; Sette, C; Hurt, E; Thorner, J


    We identified two temperature-sensitive (ts) mutations in the essential gene, YRB1, which encodes the yeast homolog of Ran-binding-protein-1 (RanBP1), a known coregulator of the Ran GTPase cycle. Both mutations result in single amino acid substitutions of evolutionarily conserved residues (A91D and R127K, respectively) in the Ran-binding domain of Yrb1. The altered proteins have reduced affinity for Ran (Gsp1) in vivo. After shift to restrictive temperature, both mutants display impaired nuclear protein import and one also reduces poly(A)+ RNA export, suggesting a primary defect in nucleocytoplasmic trafficking. Consistent with this conclusion, both yrb1ts mutations display deleterious genetic interactions with mutations in many other genes involved in nucleocytoplasmic transport, including SRP1 (alpha-importin) and several beta-importin family members. These yrb1ts alleles were isolated by their ability to suppress two different types of mating-defective mutants (respectively, fus1Delta and ste5ts), indicating that reduction in nucleocytoplasmic transport enhances mating proficiency. Indeed, in both yrb1ts mutants, Ste5 (scaffold protein for the pheromone response MAPK cascade) is mislocalized to the cytosol, even in the absence of pheromone. Also, both yrb1ts mutations suppress the mating defect of a null mutation in MSN5, which encodes the receptor for pheromone-stimulated nuclear export of Ste5. Our results suggest that reimport of Ste5 into the nucleus is important in downregulating mating response. PMID:11238397

  9. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    NASA Technical Reports Server (NTRS)

    Lu, C.; Fedoroff, N.


    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  10. batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.


    Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L


    Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

  11. The Zebrafish pob Gene Encodes a Novel Protein Required for Survival of Red Cone Photoreceptor Cells

    PubMed Central

    Taylor, Michael R.; Kikkawa, Satoshi; Diez-Juan, Antonio; Ramamurthy, Visvanathan; Kawakami, Koichi; Carmeliet, Peter; Brockerhoff, Susan E.


    The zebrafish mutant, partial optokinetic response b (pob), was isolated using an N-ethyl N-nitrosourea (ENU)-based screening strategy designed to identify larvae with defective optokinetic responses in red but not white light. Previous studies showed that red-light blindness in pob is due to the specific loss of long-wavelength photoreceptor cells via an apoptotic mechanism. Here, we used positional cloning to identify the mutated pob gene. We find that pob encodes a highly conserved 30-kDa protein of unknown function. To demonstrate that the correct gene was isolated, we used the Tol2 transposon system to generate transgenic animals and rescue the mutant phenotype. The Pob protein contains putative transmembrane regions and protein-sorting signals. It is localized to the inner segment and synapse in photoreceptor cells, and when expressed in COS-7 cells it localizes to intracellular compartments. We also show that the degeneration of red cone photoreceptors in the mutants occurs independently of light. On the basis of our findings, we propose that Pob is not involved in phototransduction but rather plays an essential role in protein sorting and/or trafficking. PMID:15716502

  12. Fatty acid composition of beef is associated with exonic nucleotide variants of the gene encoding FASN.


    Oh, Dongyep; Lee, Yoonseok; La, Boomi; Yeo, Jungsou; Chung, Euiryong; Kim, Younyoung; Lee, Chaeyoung


    Genetic associations of fatty acid composition with exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase (FASN) were examined using 513 Korean cattle. All five individual SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A were associated with a variety of fatty acid compositions and further with marbling score (P < 0.05). Their genotypes of CC, TT, AA, TT, and GG were associated with increased monounsaturated fatty acids and with decreased saturated fatty acids (P < 0.05). The genotypes at all the SNPs also increased marbling score (P < 0.05). Further genetic associations with fatty acid composition suggested that homozygous genotype with the haplotype of ATG at g.15532, g.16907, and g.17924 in a linkage disequilibrium block increased monounsaturated fatty acids and marbling score (P < 0.05). We concluded that the five exonic SNPs of g.12870, g.13126, g.15532, g.16907, and g.17924 in the FASN gene could change fatty acid contents. Their genotypes of CC, TT, AA, TT, and GG and haplotype of ATG at g.15532, g.16907, and g.17924 were recommended for genetic improvement of beef quality.

  13. Systematic Global Analysis of Genes Encoding Protein Phosphatases in Aspergillus fumigatus

    PubMed Central

    Winkelströter, Lizziane K.; Dolan, Stephen K.; Fernanda dos Reis, Thaila; Bom, Vinícius Leite Pedro; Alves de Castro, Patrícia; Hagiwara, Daisuke; Alowni, Raneem; Jones, Gary W.; Doyle, Sean; Brown, Neil Andrew; Goldman, Gustavo H.


    Aspergillus fumigatus is a fungal pathogen that causes several invasive and noninvasive diseases named aspergillosis. This disease is generally regarded as multifactorial, considering that several pathogenicity determinants are present during the establishment of this illness. It is necessary to obtain an increased knowledge of how, and which, A. fumigatus signal transduction pathways are engaged in the regulation of these processes. Protein phosphatases are essential to several signal transduction pathways. We identified 32 phosphatase catalytic subunit-encoding genes in A. fumigatus, of which we were able to construct 24 viable deletion mutants. The role of nine phosphatase mutants in the HOG (high osmolarity glycerol response) pathway was evaluated by measuring phosphorylation of the p38 MAPK (SakA) and expression of osmo-dependent genes. We were also able to identify 11 phosphatases involved in iron assimilation, six that are related to gliotoxin resistance, and three implicated in gliotoxin production. These results present the creation of a fundamental resource for the study of signaling in A. fumigatus and its implications in the regulation of pathogenicity determinants and virulence in this important pathogen. PMID:25943523

  14. Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris.


    Smith, Frances J D; Irvine, Alan D; Terron-Kwiatkowski, Ana; Sandilands, Aileen; Campbell, Linda E; Zhao, Yiwei; Liao, Haihui; Evans, Alan T; Goudie, David R; Lewis-Jones, Sue; Arseculeratne, Gehan; Munro, Colin S; Sergeant, Ann; O'Regan, Gráinne; Bale, Sherri J; Compton, John G; DiGiovanna, John J; Presland, Richard B; Fleckman, Philip; McLean, W H Irwin


    Ichthyosis vulgaris (OMIM 146700) is the most common inherited disorder of keratinization and one of the most frequent single-gene disorders in humans. The most widely cited incidence figure is 1 in 250 based on a survey of 6,051 healthy English schoolchildren. We have identified homozygous or compound heterozygous mutations R501X and 2282del4 in the gene encoding filaggrin (FLG) as the cause of moderate or severe ichthyosis vulgaris in 15 kindreds. In addition, these mutations are semidominant; heterozygotes show a very mild phenotype with incomplete penetrance. The mutations show a combined allele frequency of approximately 4% in populations of European ancestry, explaining the high incidence of ichthyosis vulgaris. Profilaggrin is the major protein of keratohyalin granules in the epidermis. During terminal differentiation, it is cleaved into multiple filaggrin peptides that aggregate keratin filaments. The resultant matrix is cross-linked to form a major component of the cornified cell envelope. We find that loss or reduction of this major structural protein leads to varying degrees of impaired keratinization.

  15. The Schizosaccharomyces pombe fusion gene hal3 encodes three distinct activities.


    Molero, Cristina; Petrényi, Katalin; González, Asier; Carmona, Mercè; Gelis, Samuel; Abrie, J Albert; Strauss, Erick; Ramos, José; Dombradi, Viktor; Hidalgo, Elena; Ariño, Joaquín


    Saccharomyces cerevisiae Hal3 and Vhs3 are moonlighting proteins, forming an atypical heterotrimeric decarboxylase (PPCDC) required for CoA biosynthesis, and regulating cation homeostasis by inhibition of the Ppz1 phosphatase. The Schizosaccharomyces pombe ORF SPAC15E1.04 (renamed as Sp hal3) encodes a protein whose amino-terminal half is similar to Sc Hal3 whereas its carboxyl-terminal half is related to thymidylate synthase (TS). We show that Sp Hal3 and/or its N-terminal domain retain the ability to bind to and modestly inhibit in vitro S. cerevisiae Ppz1 as well as its S. pombe homolog Pzh1, and also exhibit PPCDC activity in vitro and provide PPCDC function in vivo, indicating that Sp Hal3 is a monogenic PPCDC in fission yeast. Whereas the Sp Hal3 N-terminal domain partially mimics Sc Hal3 functions, the entire protein and its carboxyl-terminal domain rescue the S. cerevisiae cdc21 mutant, thus proving TS function. Additionally, we show that the 70 kDa Sp Hal3 protein is not proteolytically processed under diverse forms of stress and that, as predicted, Sp hal3 is an essential gene. Therefore, Sp hal3 represents a fusion event that joined three different functional activities in the same gene. The possible advantage derived from this surprising combination of essential proteins is discussed. PMID:23962284

  16. AtGDI2, a novel Arabidopsis gene encoding a Rab GDP dissociation inhibitor.


    Ueda, T; Yoshizumi, T; Anai, T; Matsui, M; Uchimiya, H; Nakano, A


    The GTPase cycle of Rab/Ypt proteins is strictly controlled by several classes of regulators to ensure their proper roles in membrane traffic. GDP dissociation inhibitor (GDI) is known to play essential roles in regulating nucleotide states and subcellular localizations of Rab/Ypt proteins. To obtain further knowledge on this regulator molecule in plants, we isolated and characterized two genes of Arabidopsis thaliana that encode different GDIs. AtGDI1 has been identified by a novel functional cloning in yeast [Ueda et al. (1996) Plant Cell, 8, 2079-2091] and AtGDI2 was isolated by cross-hybridization in this study. AtGDI2, as well as AtGDI1, complements the yeast sec19/gdi1 mutant, indicating that they can replace the function of yeast GDI. Evidence is shown that both AtGDI1 and AtGDI2 can interact with Ara4, an Arabidopsis Rab protein, in the yeast ypt1 mutant cells. AtGDI2 is ubiquitously expressed in Arabidopsis tissues with some difference from AtGDI1 in expression level. Genomic DNA hybridization using specific probes reveals the presence of one more GDI gene in Arabidopsis. This may imply differentiated roles of GDI in higher plants.

  17. Isolation of cDNA from Jacaratia mexicana encoding a mexicain-like cysteine protease gene.


    Ramos-Martínez, Erick M; Herrera-Ramírez, Alejandra C; Badillo-Corona, Jesús Agustín; Garibay-Orijel, Claudio; González-Rábade, Nuria; Oliver-Salvador, María Del Carmen


    Cysteine proteases (CPs) from the C1 family, which are similar to papain, can be found in animals and plants, as well as some viruses and prokaryotes. These enzymes have diverse physiological functions and are thus very attractive for science and industry. Jacaratia mexicana, a member of the Caricaceae plant family, contains several CPs, the principal being mexicain, found to favorably compete against papain for many industrial applications due to its high stability and specific activity. In this study, leaves of J. mexicana were used to isolate a CP-coding gene, similar to those that code for mexicain and chymomexicain. By using rapid amplification of cDNA ends (RACE) as well as oligonucleotide design from papain-like conserved amino acids (aa), a sequence of 1404 bp consisting of a 5' terminal untranslated region (UTR) of 153 bp, a 3' terminal UTR of 131 bp, with a polyadenylation (poly(A)) signal sequence and a poly(A) tail, and an open reading frame (ORF) of 1046 bp, was obtained by overlapping three partial sequences. Two full-length cDNA sequences that encode for mexicain-like proteases were cloned from mRNA (JmCP4 and JmCP5). JmCP4 is predicted to have an ORF of 1044 bp, which codifies for polypeptides that have a 26 aa signal peptide region, a 108 aa propeptide region and a mature enzyme of 214 aa. A 969 bp fragment (JmCP5) encodes for a partial sequence of a CP gene, without the signal peptide region but with a full-length propeptide region. The sequence analysis showed that this protease presented a high similarity to other plant CPs from J. mexicana, Vasconcellea cundinamarcensis, Vasconcellea stipulata, and Carica papaya, among others, mainly at the conserved catalytic site. Obtaining the sequence of this CP gene from J. mexicana provides an alternative for production in a standard system and could be an initial step towards the commercialization of this enzyme.

  18. The oxen gene of Drosophila encodes a homolog of subunit 9 of yeast ubiquinol-cytochrome c oxidoreductase complex: evidence for modulation of gene expression in response to mitochondrial activity.


    Frolov, M V; Benevolenskaya, E V; Birchler, J A


    A P-element insertion in the oxen gene, ox(1), has been isolated in a search for modifiers of white gene expression. The mutation preferentially exerts a negative dosage effect upon the expression of three genes encoding ABC transporters involved in pigment precursor transport, white, brown, and scarlet. A precise excision of the P element reverts the mutant phenotype. Five different transcription units were identified around the insertion site. To distinguish a transcript responsible for the mutant phenotype, a set of deletions within the oxen region was generated. Analysis of gene expression within the oxen region in the case of deletions as well as generation of transgenic flies allowed us to identify the transcript responsible for oxen function. It encodes a 6.6-kD homolog of mitochondrial ubiquinol cytochrome c oxidoreductase (QCR9), subunit 9 of the bc(1) complex in yeast. In addition to white, brown, and scarlet, oxen regulates the expression of three of seven tested genes. Thus, our data provide additional evidence for a cellular response to changes in mitochondrial function. The oxen mutation provides a model for the genetic analysis in multicellular organisms of the effect of mitochondrial activity on nuclear gene expression. PMID:11102369

  19. Differential expression of genes encoding neuronal ion-channel subunits in major depression, bipolar disorder and schizophrenia: implications for pathophysiology.


    Smolin, Bella; Karry, Rachel; Gal-Ben-Ari, Shunit; Ben-Shachar, Dorit


    Evidence concerning ion-channel abnormalities in the pathophysiology of common psychiatric disorders is still limited. Given the significance of ion channels in neuronal activity, neurotransmission and neuronal plasticity we hypothesized that the expression patterns of genes encoding different ion channels may be altered in schizophrenia, bipolar and unipolar disorders. Frozen samples of striatum including the nucleus accumbens (Str-NAc) and the lateral cerebellar hemisphere of 60 brains from depressed (MDD), bipolar (BD), schizophrenic and normal subjects, obtained from the Stanley Foundation Brain Collection, were assayed. mRNA of 72 different ion-channel subunits were determined by qRT-PCR and alteration in four genes were verified by immunoblotting. In the Str-NAc the prominent change was observed in the MDD group, in which there was a significant up-regulation in genes encoding voltage-gated potassium-channel subunits. However, in the lateral cerebellar hemisphere (cerebellum), the main change was observed in schizophrenia specimens, as multiple genes encoding various ion-channel subunits were significantly down-regulated. The impaired expression of genes encoding ion channels demonstrates a disease-related neuroanatomical pattern. The alterations observed in Str-NAc of MDD may imply electrical hypo-activity of this region that could be of relevance to MDD symptoms and treatment. The robust unidirectional alteration of both excitatory and inhibitory ion channels in the cerebellum may suggests cerebellar general hypo-transcriptional activity in schizophrenia.

  20. Enzymes Catalyzing the Early Steps of Clavulanic Acid Biosynthesis Are Encoded by Two Sets of Paralogous Genes in Streptomyces clavuligerus

    PubMed Central

    Jensen, Susan E.; Elder, Kenneth J.; Aidoo, Kwamena A.; Paradkar, Ashish S.


    Genes encoding the proteins required for clavulanic acid biosynthesis and for cephamycin biosynthesis are grouped into a “supercluster” in Streptomyces clavuligerus. Nine open reading frames (ORFs) associated with clavulanic acid biosynthesis were located in a 15-kb segment of the supercluster, including six ORFs encoding known biosynthetic enzymes or regulatory proteins, two ORFs that have been reported previously but whose involvement in clavulanic acid biosynthesis is unclear, and one ORF not previously reported. Evidence for the involvement of these ORFs in clavulanic acid production was obtained by generating mutants and showing that all were defective for clavulanic acid production when grown on starch asparagine medium. However, when five of the nine mutants, including mutants defective in known clavulanic acid biosynthetic enzymes, were grown in a soy-based medium, clavulanic acid-producing ability was restored. This ability to produce clavulanic acid when seemingly essential biosynthetic enzymes have been mutated suggests that paralogous genes encoding functionally equivalent proteins exist for each of the five genes but that these paralogues are expressed only in the soy-based medium. The five genes that have paralogues encode proteins involved in the early steps of the pathway common to the biosynthesis of both clavulanic acid and the other clavam metabolites produced by this organism. No evidence was seen for paralogues of the four remaining genes involved in late, clavulanic acid-specific steps in the pathway. PMID:10681345

  1. Biotin supplementation increases expression of genes encoding interferon-gamma, interleukin-1beta, and 3-methylcrotonyl-CoA carboxylase, and decreases expression of the gene encoding interleukin-4 in human peripheral blood mononuclear cells.


    Wiedmann, Silke; Eudy, James D; Zempleni, Janos


    Stimulation of immune cells by antigens triggers changes in the transcription of genes encoding cytokines and other proteins; these changes in gene expression are part of the normal immune response. Previous studies have provided evidence that biotin status may affect secretion of cytokines by immune cells. Here we determined whether biotin supplementation affects gene expression in human immune cells. Peripheral blood mononuclear cells were isolated from healthy adults before and after supplementation with 8.8 micro mol biotin/d for 21 d. Cells were cultured ex vivo with concanavalin A for 21 h to simulate stimulation with antigens. Expression of genes that play roles in cytokine metabolism, cell proliferation, signal transduction, stress response, apoptosis and biotin homeostasis was quantified by using DNA microarrays and reverse transcriptase-polymerase chain reaction. The abundance of mRNA encoding interferon-gamma, interleukin-1beta, and 3-methylcrotonyl-CoA carboxylase was 4.3, 5.6 and 8.9 times greater, respectively, after supplementation with biotin compared with before supplementation. In contrast, the abundance of mRNA encoding interleukin-4 was 6.8 times greater before supplementation than after supplementation. These data suggest that biotin supplementation affects gene expression in human immune cells. Effects of biotin on gene expression are likely to modulate the response of immune cells to antigens.

  2. The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.


    Lerner, D R; Raikhel, N V


    Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain. PMID:1375935

  3. Non-hepatic tumors change the activity of genes encoding copper trafficking proteins in the liver.


    Babich, Polina S; Skvortsov, Alexey N; Rusconi, Paolo; Tsymbalenko, Nadezhda V; Mutanen, Marja; Puchkova, Ludmila V; Broggini, Massimo


    To assess the statistical relationship between tumor growth and copper metabolism, we performed a metaanalysis of studies in which patients with neoplasms were characterized according to any of the copper status indexes (atomic copper serum concentration, serum oxidase activity, ceruloplasmin protein content). Our metaanalysis shows that in the majority of cases (more than 3100 patients), tumor growth positively correlates with the copper status indexes. Nude athymic CD-1 nu/nu mice with subcutaneous tumors of human origin, C57Bl/6J mice with murine melanoma and Apc(Min) mice with spontaneously developing adenomas throughout the intestinal tract were studied to experimentally determine the relationship between tumor progression, liver copper metabolism, and copper status indexes. We showed that the copper status indexes increased significantly during tumor growth. In the liver tissue of tumor-bearing mice, ceruloplasmin gene expression, as well as the expression of genes related to ceruloplasmin metallation (CTR1 and ATP7B), increased significantly. Moreover, the presence of an mRNA splice variant encoding a form of ceruloplasmin anchored to the plasma membrane by glycosylphosphatidyl inositol, which is atypical for hepatocytes, was also detected. The ATP7A copper transporter gene, which is normally expressed in the liver only during embryonic copper metabolism, was also activated. Depletion of holo-ceruloplasmin resulted in retardation of human HCT116 colon carcinoma cell growth in nude mice and induced DNA fragmentation in tumor cells. In addition, the concentration of cytochrome c increased significantly in the cytosol, while decreasing in the mitochondria. We discuss a possible trans-effect of developing tumors on copper metabolism in the liver.

  4. Dioxygenase-encoding AtDAO1 gene controls IAA oxidation and homeostasis in Arabidopsis.


    Porco, Silvana; Pěnčík, Aleš; Rashed, Afaf; Voß, Ute; Casanova-Sáez, Rubén; Bishopp, Anthony; Golebiowska, Agata; Bhosale, Rahul; Swarup, Ranjan; Swarup, Kamal; Peňáková, Pavlína; Novák, Ondřej; Staswick, Paul; Hedden, Peter; Phillips, Andrew L; Vissenberg, Kris; Bennett, Malcolm J; Ljung, Karin


    Auxin represents a key signal in plants, regulating almost every aspect of their growth and development. Major breakthroughs have been made dissecting the molecular basis of auxin transport, perception, and response. In contrast, how plants control the metabolism and homeostasis of the major form of auxin in plants, indole-3-acetic acid (IAA), remains unclear. In this paper, we initially describe the function of the Arabidopsis thaliana gene DIOXYGENASE FOR AUXIN OXIDATION 1 (AtDAO1). Transcriptional and translational reporter lines revealed that AtDAO1 encodes a highly root-expressed, cytoplasmically localized IAA oxidase. Stable isotope-labeled IAA feeding studies of loss and gain of function AtDAO1 lines showed that this oxidase represents the major regulator of auxin degradation to 2-oxoindole-3-acetic acid (oxIAA) in Arabidopsis Surprisingly, AtDAO1 loss and gain of function lines exhibited relatively subtle auxin-related phenotypes, such as altered root hair length. Metabolite profiling of mutant lines revealed that disrupting AtDAO1 regulation resulted in major changes in steady-state levels of oxIAA and IAA conjugates but not IAA. Hence, IAA conjugation and catabolism seem to regulate auxin levels in Arabidopsis in a highly redundant manner. We observed that transcripts of AtDOA1 IAA oxidase and GH3 IAA-conjugating enzymes are auxin-inducible, providing a molecular basis for their observed functional redundancy. We conclude that the AtDAO1 gene plays a key role regulating auxin homeostasis in Arabidopsis, acting in concert with GH3 genes, to maintain auxin concentration at optimal levels for plant growth and development. PMID:27651491

  5. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    PubMed Central

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham


    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  6. Dioxygenase-encoding AtDAO1 gene controls IAA oxidation and homeostasis in Arabidopsis

    PubMed Central

    Porco, Silvana; Pěnčík, Aleš; Rashed, Afaf; Voß, Ute; Casanova-Sáez, Rubén; Bishopp, Anthony; Golebiowska, Agata; Swarup, Ranjan; Swarup, Kamal; Peňáková, Pavlína; Novák, Ondřej; Staswick, Paul; Hedden, Peter; Phillips, Andrew L.; Vissenberg, Kris


    Auxin represents a key signal in plants, regulating almost every aspect of their growth and development. Major breakthroughs have been made dissecting the molecular basis of auxin transport, perception, and response. In contrast, how plants control the metabolism and homeostasis of the major form of auxin in plants, indole-3-acetic acid (IAA), remains unclear. In this paper, we initially describe the function of the Arabidopsis thaliana gene DIOXYGENASE FOR AUXIN OXIDATION 1 (AtDAO1). Transcriptional and translational reporter lines revealed that AtDAO1 encodes a highly root-expressed, cytoplasmically localized IAA oxidase. Stable isotope-labeled IAA feeding studies of loss and gain of function AtDAO1 lines showed that this oxidase represents the major regulator of auxin degradation to 2-oxoindole-3-acetic acid (oxIAA) in Arabidopsis. Surprisingly, AtDAO1 loss and gain of function lines exhibited relatively subtle auxin-related phenotypes, such as altered root hair length. Metabolite profiling of mutant lines revealed that disrupting AtDAO1 regulation resulted in major changes in steady-state levels of oxIAA and IAA conjugates but not IAA. Hence, IAA conjugation and catabolism seem to regulate auxin levels in Arabidopsis in a highly redundant manner. We observed that transcripts of AtDOA1 IAA oxidase and GH3 IAA-conjugating enzymes are auxin-inducible, providing a molecular basis for their observed functional redundancy. We conclude that the AtDAO1 gene plays a key role regulating auxin homeostasis in Arabidopsis, acting in concert with GH3 genes, to maintain auxin concentration at optimal levels for plant growth and development. PMID:27651491

  7. Dimorphism in genes encoding sexual-stage proteins of Plasmodium ovale curtisi and Plasmodium ovale wallikeri☆

    PubMed Central

    Oguike, Mary C.; Sutherland, Colin J.


    Plasmodium ovale curtisi and Plasmodium ovale wallikeri are distinct species of malaria parasite which are sympatric throughout the tropics, except for the Americas. Despite this complete overlap in geographic range, these two species do not recombine. Although morphologically very similar, the two taxa must possess distinct characters which prevent recombination between them. We hypothesised that proteins required for sexual reproduction have sufficiently diverged between the two species to prevent recombination in any mosquito blood meal in which gametocytes of both species are ingested. In order to investigate possible barriers to inter-species mating between P. ovale curtisi and P. ovale wallikeri, homologues of genes encoding sexual stage proteins in other plasmodia were identified and compared between the two species. Database searches with motifs for 6-cysteine, Limulus Coagulation factor C domain-containing proteins and other relevant sexual stage proteins in the genus Plasmodium were performed in the available P. ovale curtisi partial genome database (Wellcome Trust Sanger Institute, UK). Sequence fragments obtained were used as the basis for PCR walking along each gene of interest in reference isolates of both P. ovale curtisi and P. ovale wallikeri. Sequence alignment of the homologues of each gene in each species showed complete dimorphism across all isolates. In conclusion, substantial divergence between sexual stage proteins in the two P. ovale spp. was observed, providing further evidence that these do not recombine in nature. Incompatibility of proteins involved in sexual development and fertilisation thus remains a plausible explanation for the observed lack of natural recombination between P. ovale curtisi and P. ovale wallikeri. PMID:25817462

  8. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product.


    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham


    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at -70°C. It was inhibited by high concentrations of H₂O₂ and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts.

  9. Dimorphism in genes encoding sexual-stage proteins of Plasmodium ovale curtisi and Plasmodium ovale wallikeri.


    Oguike, Mary C; Sutherland, Colin J


    Plasmodium ovale curtisi and Plasmodium ovale wallikeri are distinct species of malaria parasite which are sympatric throughout the tropics, except for the Americas. Despite this complete overlap in geographic range, these two species do not recombine. Although morphologically very similar, the two taxa must possess distinct characters which prevent recombination between them. We hypothesised that proteins required for sexual reproduction have sufficiently diverged between the two species to prevent recombination in any mosquito blood meal in which gametocytes of both species are ingested. In order to investigate possible barriers to inter-species mating between P. ovale curtisi and P. ovale wallikeri, homologues of genes encoding sexual stage proteins in other plasmodia were identified and compared between the two species. Database searches with motifs for 6-cysteine, Limulus Coagulation factor C domain-containing proteins and other relevant sexual stage proteins in the genus Plasmodium were performed in the available P. ovale curtisi partial genome database (Wellcome Trust Sanger Institute, UK). Sequence fragments obtained were used as the basis for PCR walking along each gene of interest in reference isolates of both P. ovale curtisi and P. ovale wallikeri. Sequence alignment of the homologues of each gene in each species showed complete dimorphism across all isolates. In conclusion, substantial divergence between sexual stage proteins in the two P. ovale spp. was observed, providing further evidence that these do not recombine in nature. Incompatibility of proteins involved in sexual development and fertilisation thus remains a plausible explanation for the observed lack of natural recombination between P. ovale curtisi and P. ovale wallikeri.

  10. Non-hepatic tumors change the activity of genes encoding copper trafficking proteins in the liver

    PubMed Central

    Babich, Polina S.; Skvortsov, Alexey N; Rusconi, Paolo; Tsymbalenko, Nadezhda V.; Mutanen, Marja; Puchkova, Ludmila V.; Broggini, Massimo


    To assess the statistical relationship between tumor growth and copper metabolism, we performed a metaanalysis of studies in which patients with neoplasms were characterized according to any of the copper status indexes (atomic copper serum concentration, serum oxidase activity, ceruloplasmin protein content). Our metaanalysis shows that in the majority of cases (more than 3100 patients), tumor growth positively correlates with the copper status indexes. Nude athymic CD-1 nu/nu mice with subcutaneous tumors of human origin, C57Bl/6J mice with murine melanoma and ApcMin mice with spontaneously developing adenomas throughout the intestinal tract were studied to experimentally determine the relationship between tumor progression, liver copper metabolism, and copper status indexes. We showed that the copper status indexes increased significantly during tumor growth. In the liver tissue of tumor-bearing mice, ceruloplasmin gene expression, as well as the expression of genes related to ceruloplasmin metallation (CTR1 and ATP7B), increased significantly. Moreover, the presence of an mRNA splice variant encoding a form of ceruloplasmin anchored to the plasma membrane by glycosylphosphatidyl inositol, which is atypical for hepatocytes, was also detected. The ATP7A copper transporter gene, which is normally expressed in the liver only during embryonic copper metabolism, was also activated. Depletion of holo-ceruloplasmin resulted in retardation of human HCT116 colon carcinoma cell growth in nude mice and induced DNA fragmentation in tumor cells. In addition, the concentration of cytochrome c increased significantly in the cytosol, while decreasing in the mitochondria. We discuss a possible trans-effect of developing tumors on copper metabolism in the liver. PMID:23792645

  11. Differential splicing creates a diversity of transcripts from a neurospecific developmentally regulated gene encoding a protein with new zinc-finger motifs.

    PubMed Central

    Buchman, V L; Ninkina, N N; Bogdanov, Y D; Bortvin, A L; Akopian, H N; Kiselev, S L; Krylova OYu; Anokhin, K V; Georgiev, G P


    We have cloned a novel neurospecific gene, named neuro-d4, by differential screening a rat cerebral cortex cDNA library. Northern blot hybridization showed that neuro-d4 expression is restricted to neuronal tissues both in newborn and adult animals. The level of neuro-d4 mRNA in the rat central nervous system is high during the later stages of embryonic development and gradually decreases during the postnatal period. In situ hybridization suggests that the gene transcripts are localized in neuronal cell bodies. Nucleotide sequences of overlapped cDNA clones and all 12 exons in genomic clone were determined. The deduced protein has consensus sequences for a nuclear localization signal, a Krüppel-type zinc-finger and a new type of cysteine/histidine-rich motif resembling zinc-fingers. Several differential splicing variants were found, each of which influences the structure of the encoded protein. Images PMID:1454523

  12. Structure and Evolution of Genes Encoding Polyubiquitin and Ubiquitin-like Proteins in Arabidopsis Thaliana Ecotype Columbia

    PubMed Central

    Callis, J.; Carpenter, T.; Sun, C. W.; Vierstra, R. D.


    The Arabidopsis thaliana ecotype Columbia ubiquitin gene family consists of 14 members that can be divided into three types of ubiquitin genes; polyubiquitin genes, ubiquitin-like genes and ubiquitin extension genes. The isolation and characterization of eight ubiquitin sequences, consisting of four polyubiquitin genes and four ubiquitin-like genes, are described here, and their relationships to each other and to previously identified Arabidopsis ubiquitin genes were analyzed. The polyubiquitin genes, UBQ3, UBQ10, UBQ11 and UBQ14, contain tandem repeats of the 228-bp ubiquitin coding region. Together with a previously described polyubiquitin gene, UBQ4, they differ in synonymous substitutions, number of ubiquitin coding regions, number and nature of nonubiquitin C-terminal amino acid(s) and chromosomal location, dividing into two subtypes; the UBQ3/UBQ4 and UBQ10/UBQ11/UBQ14 subtypes. Ubiquitin-like genes, UBQ7, UBQ8, UBQ9 and UBQ12, also contain tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. Nucleotide comparisons, K(s) value determinations and neighbor-joining analyses were employed to determine intra- and intergenic relationships. In general, the rate of synonymous substitution is too high to discern related repeats. Specific exceptions provide insight into gene relationships. The observed nucleotide relationships are consistent with previously described models involving gene duplications followed by both unequal crossing-over and gene conversion events. PMID:7713442

  13. Killing of cancer cells through the use of eukaryotic expression vectors harbouring genes encoding nucleases and ribonuclease inhibitor.


    Glinka, Elena M


    Cancer gene therapy vectors are promising tools for killing cancer cells with the purpose of eradicating malignant tumours entirely. Different delivery methods of vectors into the cancer cells, including both non-viral and viral, as well as promoters for the targeted expression of genes encoding anticancer proteins were developed for effective and selective killing of cancer cells without harming healthy cells. Many vectors have been created to kill cancer cells, and some vectors suppress malignant tumours with high efficiency. This review is focused on vectors bearing genes for nucleases such as deoxyribonucleases (caspase-activated DNase, deoxyribonuclease I-like 3, endonuclease G) and ribonucleases (human polynucleotide phosphorylase, ribonuclease L, α-sarcin, barnase), as well as vectors harbouring gene encoding ribonuclease inhibitor. The data concerning the functionality and the efficacy of such vectors are presented.

  14. The Role of Plastids in the Expression of Nuclear Genes for Thylakoid Proteins Studied with Chimeric [beta]-Glucuronidase Gene Fusions.

    PubMed Central

    Bolle, C.; Sopory, S.; Lubberstedt, T.; Klosgen, R. B.; Herrmann, R. G.; Oelmuller, R.


    We have analyzed plastid and nuclear gene expression in tobacco seedlings using the carotenoid biosynthesis inhibitor nor-flurazon. mRNA levels for three nuclear-encoded chlorophyll-binding proteins of photosystem I and photosystem II (CAB I and II and the CP 24 apoprotein) are no longer detectable in photobleached seedlings, whereas those for other components of the thylakoid membrane (the 33- and 23-kD polypeptides and Rieske Fe/S polypeptide) accumulate to some extent. Transgenic tobacco seedlings with promoter fusions from genes for thylakoid membrane proteins exhibit a similar expression behavior: a CAB-[beta]-glucuronidase (GUS) gene fusion is not expressed in herbicide-treated seedlings, whereas PC-, FNR-, PSAF-, and ATPC-promoter fusions are expressed, although at reduced levels. All identified segments in nuclear promoters analyzed that have been shown to respond to light also respond to photodamage to the plastids. Thus, the regulatory signal pathways either merge prior to gene regulation or interact with closely neighboring cis elements. These results indicate that plastids control nuclear gene expression via different and gene-specific cis-regulatory elements and that CAB gene expression is different from the expression of the other genes tested. Finally, a plastid-directing import sequence from the maize Waxy gene is capable of directing the GUS protein into the photodamaged organelle. Therefore, plastid import seems to be functional in photobleached organelles. PMID:12232290

  15. Transcripts encoding HAND genes are differentially expressed and regulated by BMP4 and GDNF in developing avian gut.


    Wu, Xiaodong; Howard, Marthe J


    Growth and transcription factors provide important developmental cues to neural crest-derived precursors of enteric neurons. The basic helix-loop-helix transcription factors, HAND2 and HAND1, are expressed in the gastrointestinal tract, but neither the growth factors that induce their expression nor the cell types that express them in the gut are known. We show that transcripts encoding HAND2 are expressed in all segments of the developing gut while those encoding HAND1 are confined to the small intestine and colon. Using in situ hybridization combined with immunostaining using cell type-specific antigens, we demonstrate that transcripts encoding HAND2 are expressed in neurons of both the myenteric and submucosal ganglia. Transcripts encoding HAND1 are expressed by cells in the epithelial lining of the small intestine and colon. The differential localization of HAND2 and HAND1 is reflected in nonoverlapping patterns of regulation by gut-derived factors. The expression of transcripts encoding HAND2 is increased in neural crest-derived cells when cocultured with E4 gut, suggesting a gut-derived factor regulates expression of HAND genes. Exposure of gut-derived neural crest-derived cells to BMP4 significantly increased the expression of HAND2 in all gut segments. In the esophagus and gizzard, where HAND1 is not normally expressed, treatment with BMP4 induced the expression of transcripts encoding HAND1 in nonneural crest-derived cells. GDNF failed to induce consistent expression of transcripts encoding HAND2 in neural crest cells but did support a modest increase in HAND2 expression in gut-derived crest cells obtained from the esophagus and colon. GDNF had no detectable effect on the expression of transcripts encoding HAND1. These results suggest; 1) that HAND2 has a function in the development of enteric neurons, and 2) that BMP and GDNF differentially regulate HAND2 and HAND1 gene expression in the developing gastrointestinal tract.

  16. Six mouse alpha-tubulin mRNAs encode five distinct isotypes: testis-specific expression of two sister genes.

    PubMed Central

    Villasante, A; Wang, D; Dobner, P; Dolph, P; Lewis, S A; Cowan, N J


    Five mouse alpha-tubulin isotypes are described, each distinguished by the presence of unique amino acid substitutions within the coding region. Most, though not all of these isotype-specific amino acids, are clustered at the carboxy terminus. One of the alpha-tubulin isotypes described is expressed exclusively in testis and is encoded by two closely related genes (M alpha 3 and M alpha 7) which have homologous 3' untranslated regions but which differ at multiple third codon positions and in their 5' untranslated regions. We show that a subfamily of alpha-tubulin genes encoding the same testis-specific isotype also exists in humans. Thus, we conclude that the duplication event leading to a pair of genes encoding a testis-specific alpha-tubulin isotype predated the mammalian radiation, and both members of the duplicated sequence have been maintained since species divergence. A second alpha-tubulin gene, M alpha 6, is expressed ubiquitously at a low level, whereas a third gene, M alpha 4, is unique in that it does not encode a carboxy-terminal tyrosine residue. This gene yields two transcripts: a 1.8-kilobase (kb) mRNA that is abundant in muscle and a 2.4-kb mRNA that is abundant in testis. Whereas the 1.8-kb mRNA encodes a distinct alpha-tubulin isotype, the 2.4-kb mRNA is defective in that the methionine residue required for translational initiation is missing. Patterns of developmental expression of the various alpha-tubulin isotypes are presented. Our data support the view that individual tubulin isotypes are capable of conferring functional specificity on different kinds of microtubules. Images PMID:3785200

  17. Cloning and characterization of the 2B4 gene encoding a molecule associated with non-MHC-restricted killing mediated by activated natural killer cells and T cells

    SciTech Connect

    Mathew, P.A.; Garni-Wagner, B.A.; Land, K.; Takashima, A.; Stoneman, E.; Bennett, M.; Kumar, V. )


    The authors have recently described a signal transducing molecule, 2B4, expressed on all NK and T cells that mediate non-MHC-restricted killing. The gene encoding this molecule was cloned and its nucleotide sequence determined. The encoded protein of 398 amino acids has a leader peptide of 18 amino acids and a transmembrane region of 24 amino acids. The predicted protein has eight N-linked glycosylation sites, suggesting that it is highly glycosylated. Comparison of 2B4 with sequences in the databanks indicates that 2B4 is a member of the Ig supergene family, and it shows homology to murine and rat CD48 and human LFA-3. Northern blot analysis has shown at least three transcripts for 2B4 in adherent lymphokine-activated killer cells of several mouse strains and TCR-[gamma]/[delta] dendritic epidermal T cell lines but not in allospecific T cell clones. These three mRNA are the products of differential splicing of heterogeneous nuclear RNA. Southern blot analysis of genomic DNA from several mouse strains revealed that 2B4 belongs to a family of closely related genes. The 2B4 gene has been mapped to mouse chromosome 1 by analysis of 2B4 expression in recombinant inbred mouse strains. 48 refs., 6 figs., 2 tabs.

  18. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    ERIC Educational Resources Information Center

    Mokin, Maxim; Keifer, Joyce


    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  19. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    SciTech Connect

    Parris, D.S. Institute of Virology, Glasgow ); Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S. ); Haarr, L. )


    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K{sub DBP}) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K{sub DBP}. Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K{sub DBP}, was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K{sub DBP}. The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K{sub DBP}, thus confirming the gene assignment.

  20. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.

    PubMed Central

    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B


    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. Images PMID:1840652

  1. The genome of the mustard leaf beetle encodes two active xylanases originally acquired from bacteria through horizontal gene transfer

    PubMed Central

    Pauchet, Yannick; Heckel, David G.


    The primary plant cell wall comprises the most abundant polysaccharides on the Earth and represents a rich source of energy for organisms which have evolved the ability to digest them. Enzymes able to degrade plant cell wall polysaccharides are widely distributed in micro-organisms but are generally absent in animals, although their presence in insects, especially phytophagous beetles from the superfamilies Chrysomeloidea and Curculionoidea, has recently begun to be appreciated. The observed patchy distribution of endogenous genes encoding these enzymes in animals has raised questions about their evolutionary origins. Recent evidence suggests that endogenous plant cell wall degrading enzymes-encoding genes have been acquired by animals through a mechanism known as horizontal gene transfer (HGT). HGT describes how genetic material is moved by means other than vertical inheritance from a parent to an offspring. Here, we provide evidence that the mustard leaf beetle, Phaedon cochleariae, possesses in its genome genes encoding active xylanases from the glycoside hydrolase family 11 (GH11). We also provide evidence that these genes were originally acquired by P. cochleariae from a species of gammaproteobacteria through HGT. This represents the first example of the presence of genes from the GH11 family in animals. PMID:23698014

  2. Gene electro transfer of plasmid encoding vascular endothelial growth factor for enhanced expression and perfusion in the ischemic swine heart.


    Hargrave, Barbara; Strange, Robert; Navare, Sagar; Stratton, Michael; Burcus, Nina; Murray, Len; Lundberg, Cathryn; Bulysheva, Anna; Li, Fanying; Heller, Richard


    Myocardial ischemia can damage heart muscle and reduce the heart's pumping efficiency. This study used an ischemic swine heart model to investigate the potential for gene electro transfer of a plasmid encoding vascular endothelial growth factor for improving perfusion and, thus, for reducing cardiomyopathy following acute coronary syndrome. Plasmid expression was significantly greater in gene electro transfer treated tissue compared to injection of plasmid encoding vascular endothelial growth factor alone. Higher gene expression was also seen in ischemic versus non-ischemic groups with parameters 20 Volts (p<0.03), 40 Volts (p<0.05), and 90 Volts (p<0.05), but not with 60 Volts (p<0.09) while maintaining a pulse width of 20 milliseconds. The group with gene electro transfer of plasmid encoding vascular endothelial growth factor had increased perfusion in the area at risk compared to control groups. Troponin and creatine kinase increased across all groups, suggesting equivalent ischemia in all groups prior to treatment. Echocardiography was used to assess ejection fraction, cardiac output, stroke volume, left ventricular end diastolic volume, and left ventricular end systolic volume. No statistically significant differences in these parameters were detected during a 2-week time period. However, directional trends of these variables were interesting and offer valuable information about the feasibility of gene electro transfer of vascular endothelial growth factor in the ischemic heart. The results demonstrate that gene electro transfer can be applied safely and can increase perfusion in an ischemic area. Additional study is needed to evaluate potential efficacy.

  3. The UmGcn5 gene encoding histone acetyltransferase from Ustilago maydis is involved in dimorphism and virulence.


    González-Prieto, Juan Manuel; Rosas-Quijano, Raymundo; Domínguez, Angel; Ruiz-Herrera, José


    We isolated a gene encoding a histone acetyltransferase from Ustilago maydis (DC.) Cda., which is orthologous to the Saccharomyces cerevisiae GCN5 gene. The gene was isolated from genomic clones identified by their specific hybridization to a gene fragment obtained by the polymerase chain reaction (PCR). This gene (Umgcn5; um05168) contains an open reading frame (ORF) of 1421bp that encodes a putative protein of 473 amino acids with a Mr. of 52.6kDa. The protein exhibits a high degree of homology with histone acetyltransferases from different organisms. Null a2b2 ΔUmgcn5 mutants were constructed by substitution of the region encoding the catalytic site with a hygromycin B resistance cassette. Null a1b1 ΔUmgcn5 mutants were isolated from genetic crosses of a2b2 ΔUmgcn5 and a1b1 wild-type strains in maize. Mutants displayed a slight reduction in growth rate under different conditions, and were more sensitive than the wild type to stress conditions, but more important, they grew as long mycelial cells, and formed fuzz-like colonies under all conditions where wild-type strains grew in the yeast-like morphology and formed smooth colonies. This phenotype was not reverted by cAMP addition. Mutants were not virulent to maize plants, and were unable to form teliospores. These phenotypic alterations of the mutants were reverted by their transformation with the wild-type gene.

  4. Transcriptional regulation of the genes encoding chitin and β-1,3-glucan synthases from Ustilago maydis.


    Robledo-Briones, Mariana; Ruiz-Herrera, José


    Transcriptional regulation of genes encoding chitin synthases (CHS) and β-1,3-glucan synthase (GLS) from Ustilago maydis was studied. Transcript levels were measured during the growth curve of yeast and mycelial forms, in response to ionic and osmotic stress, and during infection of maize plants. Expression of the single GLS gene was constitutive. In contrast, CHS genes expression showed differences depending on environmental conditions. Transcript levels were slightly higher in the mycelial forms, the highest levels occurring at the log phase. Ionic and osmotic stress induced alterations in the expression of CHS genes, but not following a defined pattern, some genes were induced and others repressed by the tested compounds. Changes in transcripts were more apparent during the pathogenic process. At early infection stages, only CHS6 gene showed significant transcript levels, whereas at the period of tumor formation CHS7 and CHS8 genes were also were induced.

  5. Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II {beta} subunit (CSNK2B)

    SciTech Connect

    Albertella, M.R.; Jones, H.; Thomson, W.


    A wide range of autoimmune and other diseases are known to be associated with the major histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility antigens in the class I and class II regions, but some appear to be more strongly associated with genes in the central 1100-kb class III region, making it important to characterize this region fully for the presence of novel genes. An {approximately}220-kb segment of DNA in the class III region separating the Hsp70 (HSPA1L) and BAT1 (D6S8IE) genes, which was previously known to contain 14 genes. Genomic DNA fragments spanning the gaps between the known genes were used as probes to isolate cDNAs corresponding to five new genes within this region. Evidence from Northern blot analysis and exon trapping experiments that suggested the presence of at least two more new genes was also obtained. Partial cDNA and complete exonic genomic sequencing of one of the new genes has identified it as the casein kinase II{beta} subunit (CSNK2B). Two of the other novel genes lie within a region syntenic to that implicated in susceptibility to experimental allergic orchitis in the mouse, an autoimmune disease of the testis, and represent additional candidates for the Orch-1 locus associated with this disease. In addition, characterization of the 13-kb intergenic gap separating the RD (D6545) and G11 (D6S60E) genes has revealed the presence of a gene encoding a 1246-amino-acid polypeptide that shows significant sequence similarity to the yeast anti-viral Ski2p gene product. 49 refs., 8 figs.

  6. Temperature-sensitive albino gene TCD5, encoding a monooxygenase, affects chloroplast development at low temperatures