The Nuclear Receptor HIZR-1 Uses Zinc as a Ligand to Mediate Homeostasis in Response to High Zinc
Warnhoff, Kurt; Roh, Hyun C.; Kocsisova, Zuzana; Tan, Chieh-Hsiang; Morrison, Andrew; Croswell, Damari; Schneider, Daniel L.; Kornfeld, Kerry
2017-01-01
Nuclear receptors were originally defined as endocrine sensors in humans, leading to the identification of the nuclear receptor superfamily. Despite intensive efforts, most nuclear receptors have no known ligand, suggesting new ligand classes remain to be discovered. Furthermore, nuclear receptors are encoded in the genomes of primitive organisms that lack endocrine signaling, suggesting the primordial function may have been environmental sensing. Here we describe a novel Caenorhabditis elegans nuclear receptor, HIZR-1, that is a high zinc sensor in an animal and the master regulator of high zinc homeostasis. The essential micronutrient zinc acts as a HIZR-1 ligand, and activated HIZR-1 increases transcription of genes that promote zinc efflux and storage. The results identify zinc as the first inorganic molecule to function as a physiological ligand for a nuclear receptor and direct environmental sensing as a novel function of nuclear receptors. PMID:28095401
Mediator-dependent Nuclear Receptor Functions
Chen, Wei; Roeder, Robert
2011-01-01
As gene-specific transcription factors, nuclear hormone receptors are broadly involved in many important biological processes. Their function on target genes requires the stepwise assembly of different coactivator complexes that facilitate chromatin remodeling and subsequent preinitiation complex (PIC) formation and function. Mediator has proved to be a crucial, and general, nuclear receptor-interacting coactivator, with demonstrated functions in transcription steps ranging from chromatin remodeling to subsequent PIC formation and function. Here we discuss (i) our current understanding of pathways that nuclear receptors and other interacting cofactors employ to recruit Mediator to target gene enhancers and promoters, including conditional requirements for the strong NR-Mediator interactions mediated by the NR AF2 domain and the MED1 LXXLLL motifs and (ii) mechanisms by which Mediator acts to transmit signals from enhancer-bound nuclear receptors to the general transcription machinery at core promoters to effect PIC formation and function. PMID:21854863
Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior
Molenda, Heather A.; Kilts, Caitlin P.; Allen, Rachel L.; Tetel, Marc J.
2009-01-01
Gonadal steroid hormones act throughout the body to elicit changes in gene expression that result in profound effects on reproductive physiology and behavior. Steroid hormones exert many of these effects by binding to their respective intracellular receptors, which are members of a nuclear receptor superfamily of transcriptional activators. A variety of in vitro studies indicate that nuclear receptor coactivators are required for efficient transcriptional activity of steroid receptors. Many of these coactivators are found in a variety of steroid hormone-responsive reproductive tissues, including the reproductive tract, mammary gland, and brain. While many nuclear receptor coactivators have been investigated in vitro, we are only now beginning to understand their function in reproductive physiology and behavior. In this review, we discuss the general mechanisms of action of nuclear receptor coactivators in steroid-dependent gene transcription. We then review some recent and exciting findings on the function of nuclear receptor coactivators in steroid-dependent brain development and reproductive physiology and behavior. PMID:12855594
An emerging link between LIM domain proteins and nuclear receptors.
Sala, Stefano; Ampe, Christophe
2018-06-01
Nuclear receptors are ligand-activated transcription factors that partake in several biological processes including development, reproduction and metabolism. Over the last decade, evidence has accumulated that group 2, 3 and 4 LIM domain proteins, primarily known for their roles in actin cytoskeleton organization, also partake in gene transcription regulation. They shuttle between the cytoplasm and the nucleus, amongst other as a consequence of triggering cells with ligands of nuclear receptors. LIM domain proteins act as important coregulators of nuclear receptor-mediated gene transcription, in which they can either function as coactivators or corepressors. In establishing interactions with nuclear receptors, the LIM domains are important, yet pleiotropy of LIM domain proteins and nuclear receptors frequently occurs. LIM domain protein-nuclear receptor complexes function in diverse physiological processes. Their association is, however, often linked to diseases including cancer.
Nuclear receptors and nonalcoholic fatty liver disease1
Cave, Matthew C.; Clair, Heather B.; Hardesty, Josiah E.; Falkner, K. Cameron; Feng, Wenke; Clark, Barbara J.; Sidey, Jennifer; Shi, Hongxue; Aqel, Bashar A.; McClain, Craig J.; Prough, Russell A.
2016-01-01
Nuclear receptors are transcription factors which sense changing environmental or hormonal signals and effect transcriptional changes to regulate core life functions including growth, development, and reproduction. To support this function, following ligand-activation by xenobiotics, members of subfamily 1 nuclear receptors (NR1s) may heterodimerize with the retinoid X receptor (RXR) to regulate transcription of genes involved in energy and xenobiotic metabolism and inflammation. Several of these receptors including the peroxisome proliferator-activated receptors (PPARs), the pregnane and xenobiotic receptor (PXR), the constitutive androstane receptor (CAR), the liver X receptor (LXR) and the farnesoid X receptor (FXR) are key regulators of the gut:liver:adipose axis and serve to coordinate metabolic responses across organ systems between the fed and fasting states. Non-alcoholic fatty liver disease (NAFLD) is the most common liver disease and may progress to cirrhosis and even hepatocellular carcinoma. NAFLD is associated with inappropriate nuclear receptor function and perturbations along the gut:liver:adipose axis including obesity, increased intestinal permeability with systemic inflammation, abnormal hepatic lipid metabolism, and insulin resistance. Environmental chemicals may compound the problem by directly interacting with nuclear receptors leading to metabolic confusion and the inability to differentiate fed from fasting conditions. This review focuses on the impact of nuclear receptors in the pathogenesis and treatment of NAFLD. Clinical trials including PIVENS and FLINT demonstrate that nuclear receptor targeted therapies may lead to the paradoxical dissociation of steatosis, inflammation, fibrosis, insulin resistance, dyslipidemia and obesity. Novel strategies currently under development (including tissue-specific ligands and dual receptor agonists) may be required to separate the beneficial effects of nuclear receptor activation from unwanted metabolic side effects. The impact of nuclear receptor crosstalk in NAFLD is likely to be profound, but requires further elucidation. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. PMID:26962021
Mahajan, Muktar A.; Samuels, Herbert H.
2000-01-01
We describe the cloning and characterization of a new family of nuclear receptor coregulators (NRCs) which modulate the function of nuclear hormone receptors in a ligand-dependent manner. NRCs are expressed as alternatively spliced isoforms which may exhibit different intrinsic activities and receptor specificities. The NRCs are organized into several modular structures and contain a single functional LXXLL motif which associates with members of the steroid hormone and thyroid hormone/retinoid receptor subfamilies with high affinity. Human NRC (hNRC) harbors a potent N-terminal activation domain (AD1), which is as active as the herpesvirus VP16 activation domain, and a second activation domain (AD2) which overlaps with the receptor-interacting LXXLL region. The C-terminal region of hNRC appears to function as an inhibitory domain which influences the overall transcriptional activity of the protein. Our results suggest that NRC binds to liganded receptors as a dimer and this association leads to a structural change in NRC resulting in activation. hNRC binds CREB-binding protein (CBP) with high affinity in vivo, suggesting that hNRC may be an important functional component of a CBP complex involved in mediating the transcriptional effects of nuclear hormone receptors. PMID:10866662
Phospholipid Regulation of the Nuclear Receptor Superfamily
Crowder, Mark K.; Seacrist, Corey D.; Blind, Raymond D.
2016-01-01
Nuclear receptors are ligand-activated transcription factors whose diverse biological functions are classically regulated by cholesterol-based small molecules. Over the past few decades, a growing body of evidence has demonstrated that phospholipids and other similar amphipathic molecules can also specifically bind and functionally regulate the activity of certain nuclear receptors, suggesting a critical role for these non-cholesterol-based molecules in transcriptional regulation. Phosphatidylcholines, phosphoinositides and sphingolipids are a few of the many phospholipid like molecules shown to quite specifically regulate nuclear receptors in mouse models, cell lines and in vitro. More recent evidence has also shown that certain nuclear receptors can “present” a bound phospholipid headgroup to key lipid signaling enzymes, which can then modify the phospholipid headgroup with very unique kinetic properties. Here, we review the broad array of phospholipid / nuclear receptor interactions, from the perspective of the chemical nature of the phospholipid, and the cellular abundance of the phospholipid. We also view the data in the light of well established paradigms for phospholipid mediated transcriptional regulation, as well as newer models of how phospholipids might effect transcription in the acute regulation of complex nuclear signaling pathways. Thus, this review provides novel insight into the new, non-membrane associated roles nuclear phospholipids play in regulating complex nuclear events, centered on the nuclear receptor superfamily of transcription factors. PMID:27838257
Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway
Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O.
2017-01-01
Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans. This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12–dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans. This finding suggests the existence of a conserved CYP4V2-POR–nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage. PMID:28760992
Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.
Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O
2017-08-15
Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12-dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans This finding suggests the existence of a conserved CYP4V2-POR-nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage.
Improved Dual-Luciferase Reporter Assays for Nuclear Receptors
Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank
2010-01-01
Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560
Nuclear Receptors, RXR, and the Big Bang.
Evans, Ronald M; Mangelsdorf, David J
2014-03-27
Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.
A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects
USDA-ARS?s Scientific Manuscript database
Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unu...
Minireview: The Role of Nuclear Receptors in Photoreceptor Differentiation and Disease
Swaroop, Anand
2012-01-01
Rod and cone photoreceptors are specialized sensory cells that mediate vision. Transcriptional controls are critical for the development and long-term survival of photoreceptors; when these controls become ineffective, retinal dysfunction or degenerative disease may result. This review discusses the role of nuclear receptors, a class of ligand-regulated transcription factors, at key stages of photoreceptor life in the mammalian retina. Nuclear receptors with known ligands, such as retinoids or thyroid hormone, together with several orphan receptors without identified physiological ligands, complement other classes of transcription factors in directing the differentiation and functional maintenance of photoreceptors. The potential of nuclear receptors to respond to ligands introduces versatility into the control of photoreceptor development and function and may suggest new opportunities for treatments of photoreceptor disease. PMID:22556342
Garapaty, Shivani; Mahajan, Muktar A; Samuels, Herbert H
2008-03-14
CCR4-NOT is an evolutionarily conserved, multicomponent complex known to be involved in transcription as well as mRNA degradation. Various subunits (e.g. CNOT1 and CNOT7/CAF1) have been reported to be involved in influencing nuclear hormone receptor activities. Here, we show that CCR4/CNOT6 and RCD1/CNOT9, members of the CCR4-NOT complex, potentiate nuclear receptor activity. RCD1 interacts in vivo and in vitro with NIF-1 (NRC-interacting factor), a previously characterized nuclear receptor cotransducer that activates nuclear receptors via its interaction with NRC. As with NIF-1, RCD1 and CCR4 do not directly associate with nuclear receptors; however, they enhance ligand-dependent transcriptional activation by nuclear hormone receptors. CCR4 mediates its effect through the ligand binding domain of nuclear receptors and small interference RNA-mediated silencing of endogenous CCR4 results in a marked decrease in nuclear receptor activation. Furthermore, knockdown of CCR4 results in an attenuated stimulation of RARalpha target genes (e.g. Sox9 and HoxA1) as shown by quantitative PCR assays. The silencing of endogenous NIF-1 also resulted in a comparable decrease in the RAR-mediated induction of both Sox9 and HoxA1. Furthermore, CCR4 associates in vivo with NIF-1. In addition, the CCR4-enhanced transcriptional activation by nuclear receptors is dependent on NIF-1. The small interference RNA-mediated knockdown of NIF-1 blocks the ligand-dependent potentiating effect of CCR4. Our results suggest that CCR4 plays a role in the regulation of certain endogenous RARalpha target genes and that RCD1 and CCR4 might mediate their function through their interaction with NIF-1.
Nuclear actions of insulin-like growth factor binding protein-3.
Baxter, Robert C
2015-09-10
In addition to its actions outside the cell, cellular uptake and nuclear import of insulin-like growth factor binding protein-3 (IGFBP-3) has been recognized for almost two decades, but knowledge of its nuclear actions has been slow to emerge. IGFBP-3 has a functional nuclear localization signal and interacts with the nuclear transport protein importin-β. Within the nucleus IGFBP-3 appears to have a role in transcriptional regulation. It can bind to the nuclear receptor, retinoid X receptor-α and several of its dimerization partners, including retinoic acid receptor, vitamin D receptor (VDR), and peroxisome proliferator-activated receptor-γ (PPARγ). These interactions modulate the functions of these receptors, for example inhibiting VDR-dependent transcription in osteoblasts and PPARγ-dependent transcription in adipocytes. Nuclear IGFBP-3 can be detected by immunohistochemistry in cancer and other tissues, and its presence in the nucleus has been shown in many cell culture studies to be necessary for its pro-apoptotic effect, which may also involve interaction with the nuclear receptor Nur77, and export from the nucleus. IGFBP-3 is p53-inducible and in response to DNA damage, forms a complex with the epidermal growth factor receptor (EGFR), translocating to the nucleus to interact with DNA-dependent protein kinase. Inhibition of EGFR kinase activity or downregulation of IGFBP-3 can inhibit DNA double strand-break repair by nonhomologous end joining. IGFBP-3 thus has the ability to influence many cell functions through its interactions with intranuclear pathways, but the importance of these interactions in vivo, and their potential to be targeted for therapeutic benefit, require further investigation. Copyright © 2015 Elsevier B.V. All rights reserved.
RORα, a Potential Tumor Suppressor and Therapeutic Target of Breast Cancer
Du, Jun; Xu, Ren
2012-01-01
The function of the nuclear receptor (NR) in breast cancer progression has been investigated for decades. The majority of the nuclear receptors have well characterized natural ligands, but a few of them are orphan receptors for which no ligand has been identified. RORα, one member of the retinoid orphan nuclear receptor (ROR) subfamily of orphan receptors, regulates various cellular and pathological activities. RORα is commonly down-regulated and/or hypoactivated in breast cancer compared to normal mammary tissue. Expression of RORα suppresses malignant phenotypes in breast cancer cells, in vitro and in vivo. Activity of RORα can be categorized into the canonical and non-canonical nuclear receptor pathways, which in turn regulate various breast cancer cellular function, including cell proliferation, apoptosis and invasion. This information suggests that RORα is a potent tumor suppressor and a potential therapeutic target for breast cancer. PMID:23443091
Umemoto, Tomoe; Fujiki, Yukio
2012-07-01
Peroxisome proliferator-activated receptors (PPARs) play important roles in diverse biological processes including metabolisms of sugars and lipids and differentiation of cells such as adipocytes. PPARs are transcription factors belonging to the ligand-dependent hormone receptor group. To function as transcription factors, PPARs translocate into nucleus where they associate with transcription apparatus. However, mechanisms underlying nuclear transport of PPARs remain enigmatic. We show here that PPARα and PPARγ dynamically shuttle between nucleus and cytoplasm, although they constitutively and predominantly appear in nucleus. With a series of truncation mutants, we identify that PPAR nuclear transport is mediated by at least two nuclear localization signals (NLSs) in DNA-binding domain (DBD)-hinge and activation function 1 (AF1) regions and their respective receptors including importinα/β, importin 7, and an unidentified receptor. PPARs also harbor two nuclear export signals in DBD and ligand-binding domain regions that are recognized by distinct export receptors, calreticulin and CRM1. Moreover, we show that nuclear-cytoplasmic shuttling of PPARs is regulated by respective PPAR ligands and Ca2+ concentration. Taken together, we suggest that the multiple pathways for the nuclear-cytoplasmic transport of PPARs regulate the biological functions of PPARs in response to external signals. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Sun, Kai; Montana, Vedrana; Chellappa, Karthikeyani; Brelivet, Yann; Moras, Dino; Maeda, Yutaka; Parpura, Vladimir; Paschal, Bryce M; Sladek, Frances M
2007-06-01
Nuclear receptors (NRs) are a superfamily of transcription factors whose genomic functions are known to be activated by lipophilic ligands, but little is known about how to deactivate them or how to turn on their nongenomic functions. One obvious mechanism is to alter the nuclear localization of the receptors. Here, we show that protein kinase C (PKC) phosphorylates a highly conserved serine (Ser) between the two zinc fingers of the DNA binding domain of orphan receptor hepatocyte nuclear factor 4alpha (HNF4alpha). This Ser (S78) is adjacent to several positively charged residues (Arg or Lys), which we show here are involved in nuclear localization of HNF4alpha and are conserved in nearly all other NRs, along with the Ser/threonine (Thr). A phosphomimetic mutant of HNF4alpha (S78D) reduced DNA binding, transactivation ability, and protein stability. It also impaired nuclear localization, an effect that was greatly enhanced in the MODY1 mutant Q268X. Treatment of the hepatocellular carcinoma cell line HepG2 with PKC activator phorbol 12-myristate 13-acetate also resulted in increased cytoplasmic localization of HNF4alpha as well as decreased endogenous HNF4alpha protein levels in a proteasome-dependent fashion. We also show that PKC phosphorylates the DNA binding domain of other NRs (retinoic acid receptor alpha, retinoid X receptor alpha, and thyroid hormone receptor beta) and that phosphomimetic mutants of the same Ser/Thr result in cytoplasmic localization of retinoid X receptor alpha and peroxisome proliferator-activated receptor alpha. Thus, phosphorylation of this conserved Ser between the two zinc fingers may be a common mechanism for regulating the function of NRs.
Design principles of nuclear receptor signaling: how complex networking improves signal transduction
Kolodkin, Alexey N; Bruggeman, Frank J; Plant, Nick; Moné, Martijn J; Bakker, Barbara M; Campbell, Moray J; van Leeuwen, Johannes P T M; Carlberg, Carsten; Snoep, Jacky L; Westerhoff, Hans V
2010-01-01
The topology of nuclear receptor (NR) signaling is captured in a systems biological graphical notation. This enables us to identify a number of ‘design' aspects of the topology of these networks that might appear unnecessarily complex or even functionally paradoxical. In realistic kinetic models of increasing complexity, calculations show how these features correspond to potentially important design principles, e.g.: (i) cytosolic ‘nuclear' receptor may shuttle signal molecules to the nucleus, (ii) the active export of NRs may ensure that there is sufficient receptor protein to capture ligand at the cytoplasmic membrane, (iii) a three conveyor belts design dissipating GTP-free energy, greatly aids response, (iv) the active export of importins may prevent sequestration of NRs by importins in the nucleus and (v) the unspecific nature of the nuclear pore may ensure signal-flux robustness. In addition, the models developed are suitable for implementation in specific cases of NR-mediated signaling, to predict individual receptor functions and differential sensitivity toward physiological and pharmacological ligands. PMID:21179018
The REV-ERBs and RORs: molecular links between circadian rhythms and lipid homeostasis
Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P
2011-01-01
Research efforts spanning the past two decades have established a clear link between nuclear receptor function, regulation of the circadian clock and lipid homeostasis. As such, this family of receptors represents an important area of research. Recent advances in the field have identified two nuclear receptor subfamilies, the REV-ERBs and the ‘retinoic acid receptor-related orphan receptors’ (RORs), as critical regulators of the circadian clock with significant roles in lipid homeostasis. In this review, the latest information garnered from cutting-edge research on these two nuclear receptor subfamilies will be discussed. Through direct targeting of the REV-ERBs and RORs with synthetic ligands, generation of novel tools aimed at characterizing their function in vivo have been developed, which may lead to novel therapeutics for the treatment of metabolic disorders. PMID:21526899
Patel, Hansa; Truant, Ray; Rachubinski, Richard A; Capone, John P
2005-01-01
Peroxisome proliferator-activated nuclear hormone receptors (PPAR) are ligand-activated transcription factors that play pivotal roles in governing metabolic homeostasis and cell growth. PPARs are primarily in the nucleus but, under certain circumstances, can be found in the cytoplasm. We show here that PPAR(alpha) interacts with the centrosome-associated protein CAP350. CAP350 also interacts with PPAR(delta), PPAR(gamma) and liver-X-receptor alpha, but not with the 9-cis retinoic acid receptor, RXR(alpha). Immunofluorescence analysis indicated that PPAR(alpha) is diffusely distributed in the nucleus and excluded from the cytoplasm. However, in the presence of coexpressed CAP350, PPAR(alpha) colocalizes with CAP350 to discrete nuclear foci and to the centrosome, perinuclear region and intermediate filaments. In contrast, the subcellular distribution of RXR(alpha) or of thyroid hormone receptor alpha was not altered by coexpression of CAP350. An amino-terminal fragment of CAP350 was localized exclusively to nuclear foci and was sufficient to recruit PPAR(alpha) to these sites. Mutation of the single putative nuclear hormone receptor interacting signature motif LXXLL present in this fragment had no effect on its subnuclear localization but abrogated recruitment of PPAR(alpha) to nuclear foci. Surprisingly, mutation of the LXXLL motif in this CAP350 subfragment did not prevent its binding to PPAR(alpha) in vitro, suggesting that this motif serves some function other than PPAR(alpha) binding in recruiting PPAR(alpha) to nuclear spots. CAP350 inhibited PPAR(alpha)-mediated transactivation in an LXXLL-dependent manner, suggesting that CAP350 represses PPAR(alpha) function. Our findings implicate CAP350 in a dynamic process that recruits PPAR(alpha) to discrete nuclear and cytoplasmic compartments and suggest that altered intracellular compartmentalization represents a regulatory process that modulates PPAR function.
Nuclear Receptor Regulation of Aquaglyceroporins in Metabolic Organs.
Tardelli, Matteo; Claudel, Thierry; Bruschi, Francesca Virginia; Trauner, Michael
2018-06-15
Nuclear receptors, such as the farnesoid X receptor (FXR) and the peroxisome proliferator-activated receptors gamma and alpha (PPAR-γ, -α), are major metabolic regulators in adipose tissue and the liver, where they govern lipid, glucose, and bile acid homeostasis, as well as inflammatory cascades. Glycerol and free fatty acids are the end products of lipid droplet catabolism driven by PPARs. Aquaporins (AQPs), a family of 13 small transmembrane proteins, facilitate the shuttling of water, urea, and/or glycerol. The peculiar role of AQPs in glycerol transport makes them pivotal targets in lipid metabolism, especially considering their tissue-specific regulation by the nuclear receptors PPARγ and PPARα. Here, we review the role of nuclear receptors in the regulation of glycerol shuttling in liver and adipose tissue through the function and expression of AQPs.
The Orphan Nuclear Receptors at Their 25th Year Reunion
Mullican, Shannon E.; DiSpirito, Joanna R.; Lazar, Mitchell A.
2013-01-01
The Nuclear Receptor superfamily includes many receptors identified based on their similarity to steroid hormone receptors but without a known ligand. The study of how these receptors are diversely regulated to interact with genomic regions to control a plethora of biological processes has provided critical insight into development, physiology and the molecular pathology of disease. Here we provide a compendium of these so-called Orphan Receptors, and focus on what has been learned about their modes of action, physiological functions, and therapeutic promise. PMID:24096517
Action mechanisms of Liver X Receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gabbi, Chiara; Warner, Margaret; Gustafsson, Jan-Åke, E-mail: jgustafs@central.uh.edu
2014-04-11
Highlights: • LXRα and LXRβ are ligand-activated nuclear receptors. • They share oxysterol ligands and the same heterodimerization partner, RXR. • LXRs regulate lipid and glucose metabolism, CNS and immune functions, and water transport. - Abstract: The two Liver X Receptors, LXRα and LXRβ, are nuclear receptors belonging to the superfamily of ligand-activated transcription factors. They share more than 78% homology in amino acid sequence, a common profile of oxysterol ligands and the same heterodimerization partner, Retinoid X Receptor. LXRs play crucial roles in several metabolic pathways: lipid metabolism, in particular in preventing cellular cholesterol accumulation; glucose homeostasis; inflammation; centralmore » nervous system functions and water transport. As with all nuclear receptors, the transcriptional activity of LXR is the result of an orchestration of numerous cellular factors including ligand bioavailability, presence of corepressors and coactivators and cellular context i.e., what other pathways are activated in the cell at the time the receptor recognizes its ligand. In this mini-review we summarize the factors regulating the transcriptional activity and the mechanisms of action of these two receptors.« less
Featured Article: Nuclear export of opioid growth factor receptor is CRM1 dependent.
Kren, Nancy P; Zagon, Ian S; McLaughlin, Patricia J
2016-02-01
Opioid growth factor receptor (OGFr) facilitates growth inhibition in the presence of its specific ligand opioid growth factor (OGF), chemically termed [Met(5)]-enkephalin. The function of the OGF-OGFr axis requires the receptor to translocate to the nucleus. However, the mechanism of nuclear export of OGFr is unknown. In this study, endogenous OGFr, as well as exogenously expressed OGFr-EGFP, demonstrated significant nuclear accumulation in response to leptomycin B (LMB), an inhibitor of CRM1-dependent nuclear export, suggesting that OGFr is exported in a CRM1-dependent manner. One consensus sequence for a nuclear export signal (NES) was identified. Mutation of the associated leucines, L217 L220 L223 and L225, to alanine resulted in decreased nuclear accumulation. NES-EGFP responded to LMB, indicating that this sequence is capable of functioning as an export signal in isolation. To determine why the sequence functions differently in isolation than as a full length protein, the localization of subNES was evaluated in the presence and absence of MG132, a potent inhibitor of proteosomal degradation. MG132 had no effect of subNES localization. The role of tandem repeats located at the C-terminus of OGFr was examined for their role in nuclear trafficking. Six of seven tandem repeats were removed to form deltaTR. DeltaTR localized exclusively to the nucleus indicating that the tandem repeats may contribute to the localization of the receptor. Similar to the loss of cellular proliferation activity (i.e. inhibition) recorded with subNES, deltaTR also demonstrated a significant loss of inhibitory activity indicating that the repeats may be integral to receptor function. These experiments reveal that OGFr contains one functional NES, L217 L220 L223 and L225 and can be exported from the nucleus in a CRM1-dependent manner. © 2015 by the Society for Experimental Biology and Medicine.
Sepuri, Naresh Babu V; Tammineni, Prasad; Mohammed, Fareed; Paripati, Arunkumar
2017-01-01
Noncanonical functions of several nuclear transcription factors in the mitochondria have been gaining exceptional traction over the years. These transcription factors include nuclear hormone receptors like estrogen, glucocorticoid, and thyroid hormone receptors: p53, IRF3, STAT3, STAT5, CREB, NF-kB, and MEF-2D. Mitochondria-localized nuclear transcription factors regulate mitochondrial processes like apoptosis, respiration and mitochondrial transcription albeit being nuclear in origin and having nuclear functions. Hence, the cell permits these multi-stationed transcription factors to orchestrate and fine-tune cellular metabolism at various levels of operation. Despite their ubiquitous distribution in different subcompartments of mitochondria, their targeting mechanism is poorly understood. Here, we review the current status of mitochondria-localized transcription factors and discuss the possible targeting mechanism besides the functional interplay between these factors.
Bisphenol A affects androgen receptor function via multiple mechanisms.
Teng, Christina; Goodwin, Bonnie; Shockley, Keith; Xia, Menghang; Huang, Ruili; Norris, John; Merrick, B Alex; Jetten, Anton M; Austin, Christopher P; Tice, Raymond R
2013-05-25
Bisphenol A (BPA), is a well-known endocrine disruptor compound (EDC) that affects the normal development and function of the female and male reproductive system, however the mechanisms of action remain unclear. To investigate the molecular mechanisms of how BPA may affect ten different nuclear receptors, stable cell lines containing individual nuclear receptor ligand binding domain (LBD)-linked to the β-Gal reporter were examined by a quantitative high throughput screening (qHTS) format in the Tox21 Screening Program of the NIH. The results showed that two receptors, estrogen receptor alpha (ERα) and androgen receptor (AR), are affected by BPA in opposite direction. To confirm the observed effects of BPA on ERα and AR, we performed transient transfection experiments with full-length receptors and their corresponding response elements linked to luciferase reporters. We also included in this study two BPA analogs, bisphenol AF (BPAF) and bisphenol S (BPS). As seen in African green monkey kidney CV1 cells, the present study confirmed that BPA and BPAF act as ERα agonists (half maximal effective concentration EC50 of 10-100 nM) and as AR antagonists (half maximal inhibitory concentration IC50 of 1-2 μM). Both BPA and BPAF antagonized AR function via competitive inhibition of the action of synthetic androgen R1881. BPS with lower estrogenic activity (EC50 of 2.2 μM), did not compete with R1881 for AR binding, when tested at 30 μM. Finally, the effects of BPA were also evaluated in a nuclear translocation assays using EGPF-tagged receptors. Similar to 17β-estradiol (E2) which was used as control, BPA was able to enhance ERα nuclear foci formation but at a 100-fold higher concentration. Although BPA was able to bind AR, the nuclear translocation was reduced. Furthermore, BPA was unable to induce functional foci in the nuclei and is consistent with the transient transfection study that BPA is unable to activate AR. Published by Elsevier Ireland Ltd.
Nuclear receptor coactivators: regulators of steroid action in brain and behaviour.
Tetel, M J; Acharya, K D
2013-11-01
Steroid hormones act in specific regions of the brain to alter behaviour and physiology. Although it has been well established that the bioavailability of the steroid and the expression of its receptor is critical for understanding steroid action in the brain, the importance of nuclear receptor coactivators in the brain is becoming more apparent. The present review focuses on the function of the p160 family of coactivators, which includes steroid receptor coactivator-1 (SRC-1), SRC-2 and SRC-3, in steroid receptor action in the brain. The expression, regulation and function of these coactivators in steroid-dependent gene expression in both brain and behaviour are discussed. © 2013 British Society for Neuroendocrinology.
Estrogen-related receptor β (ERRβ) – renaissance receptor or receptor renaissance?
Divekar, Shailaja D.; Tiek, Deanna M.; Fernandez, Aileen; Riggins, Rebecca B.
2016-01-01
Estrogen-related receptors (ERRs) are founding members of the orphan nuclear receptor (ONR) subgroup of the nuclear receptor superfamily. Twenty-seven years of study have yet to identify cognate ligands for the ERRs, though they have firmly placed ERRα and ERRγ at the intersection of cellular metabolism and oncogenesis. The pace of discovery for novel functions of ERRβ, however, has until recently been somewhat slower than that of its family members. ERRβ has also been largely ignored in summaries and perspectives of the ONR literature. Here, we provide an overview of established and emerging knowledge of ERRβ in mouse, man, and other species, highlighting unique aspects of ERRβ biology that set it apart from the other two estrogen-related receptors, with a focus on the impact of alternative splicing on the structure and function of this receptor. PMID:27507929
NR4A nuclear receptors support memory enhancement by histone deacetylase inhibitors
Hawk, Joshua D.; Bookout, Angie L.; Poplawski, Shane G.; Bridi, Morgan; Rao, Allison J.; Sulewski, Michael E.; Kroener, Brian T.; Manglesdorf, David J.; Abel, Ted
2012-01-01
The formation of a long-lasting memory requires a transcription-dependent consolidation period that converts a short-term memory into a long-term memory. Nuclear receptors compose a class of transcription factors that regulate diverse biological processes, and several nuclear receptors have been implicated in memory formation. Here, we examined the potential contribution of nuclear receptors to memory consolidation by measuring the expression of all 49 murine nuclear receptors after learning. We identified 13 nuclear receptors with increased expression after learning, including all 3 members of the Nr4a subfamily. These CREB-regulated Nr4a genes encode ligand-independent “orphan” nuclear receptors. We found that blocking NR4A activity in memory-supporting brain regions impaired long-term memory but did not impact short-term memory in mice. Further, expression of Nr4a genes increased following the memory-enhancing effects of histone deacetylase (HDAC) inhibitors. Blocking NR4A signaling interfered with the ability of HDAC inhibitors to enhance memory. These results demonstrate that the Nr4a gene family contributes to memory formation and is a promising target for improving cognitive function. PMID:22996661
Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward
2010-01-12
The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less
Fardoun, Riham Zein; Asghar, Mohammad; Lokhandwala, Mustafa
2009-01-01
Dopamine promotes sodium excretion, in part, via activation of D1 receptors in renal proximal tubules (PT) and subsequent inhibition of Na, K-ATPase. Recently, we have reported that oxidative stress causes D1 receptors-G-protein uncoupling via mechanisms involving Protein Kinase C (PKC) and G-protein Coupled Receptor Kinase 2 (GRK2) in the primary culture of renal PT of Sprague Dawley (SD) rats. There are reports suggesting that redox-sensitive nuclear transcription factor, NF-κB, is activated in conditions associated with oxidative stress. This study was designed to identify the role of NF-κB in oxidative stress–induced defective renal D1 receptor –G-protein coupling and function. Treatment of the PT with hydrogen peroxide (H2O2, 50 μM/20 min) induced the nuclear translocation of NF-κB, increased PKC activity, and triggered the translocation of GRK2 to the proximal tubular membranes. This was accompanied by hyperphosphorylation of D1 receptors and defective D1 receptor-G-protein coupling. The functional consequence of these changes was decreased D1 receptor activation-mediated inhibition of Na, K-ATPase activity. Interestingly, pre-treatment with pyrrolidine dithiocarbamate (PDTC, 25 μM/10min), an NF-κB inhibitor, blocked the H2O2-induced nuclear translocation of NF-κB, increase in PKC activity, as well as GRK2 translocation and hyperphosphorylation of D1 receptors in the proximal tubular membranes. Furthermore, PDTC restored D1 receptor G-protein coupling and D1 receptor agonist-mediated inhibition of the Na, KATPase activity. Therefore, we suggest that oxidative stress causes nuclear translocation of NF-κB in the renal proximal tubules, which contributes to defective D1-receptor-G-protein coupling and function via mechanism involving PKC, membranous translocation of GRK 2, and subsequent phosphorylation of dopamine D1 receptors. PMID:17320758
Phenobarbital Meets Phosphorylation of Nuclear Receptors
2017-01-01
Phenobarbital was the first therapeutic drug to be characterized for its induction of hepatic drug metabolism. Essentially at the same time, cytochrome P450, an enzyme that metabolizes drugs, was discovered. After nearly 50 years of investigation, the molecular target of phenobarbital induction has now been delineated to phosphorylation at threonine 38 of the constitutive androstane receptor (NR1I3), a member of the nuclear receptor superfamily. Determining this mechanism has provided us with the molecular basis to understand drug induction of drug metabolism and disposition. Threonine 38 is conserved as a phosphorylation motif in the majority of both mouse and human nuclear receptors, providing us with an opportunity to integrate diverse functions of nuclear receptors. Here, I review the works and accomplishments of my laboratory at the National Institutes of Health National Institute of Environmental Health Sciences and the future research directions of where our study of the constitutive androstane receptor might take us. PMID:28356313
Tyagi, Sandeep; Gupta, Paras; Saini, Arminder Singh; Kaushal, Chaitnya; Sharma, Saurabh
2011-01-01
Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors of nuclear hormone receptor superfamily comprising of the following three subtypes: PPARα, PPARγ, and PPARβ/δ. Activation of PPAR-α reduces triglyceride level and is involved in regulation of energy homeostasis. Activation of PPAR-γ causes insulin sensitization and enhances glucose metabolism, whereas activation of PPAR-β/δ enhances fatty acids metabolism. Thus, PPAR family of nuclear receptors plays a major regulatory role in energy homeostasis and metabolic function. The present review critically analyzes the protective and detrimental effect of PPAR agonists in dyslipidemia, diabetes, adipocyte differentiation, inflammation, cancer, lung diseases, neurodegenerative disorders, fertility or reproduction, pain, and obesity. PMID:22247890
Targeting Nuclear EGFR: Strategies for Improving Cetuximab Therapy in Lung Cancer
2014-09-01
Triple - negative breast cancer Mol Cancer Ther. 2014 May;13(5):1356-68. PMID: 24634415, PMCID: PMC4013210 6. Brand, TM, Iida, M...Receptor Is a Functional Molecular Target in Triple - Negative Breast Cancer . Molecular cancer therapeutics (2014). 11 26. Iida, M., Brand, T.M...2014). Brand, T.M., et al. Nuclear epidermal growth factor receptor is a functional molecular target in triple - negative breast cancer .
The Genomic Actions and Functional Implications of Nuclear PRLr in Human Breast Carcinoma
2011-03-01
Johnston CL, Cox HC, Gomm JJ, Coombes RC 1995 Fibroblast growth factor receptors ( FGFRs ) localize in different cellular compartments. A splice variant...has been observed (11). The Jak2/Stat5a pathway is widely shared with other transmembrane receptors such as epidermal growth factor receptor (EGFR...2005 Novel prognostic value of nuclear epidermal growth factor receptor in breast cancer. Cancer Res 65:338-348 13. Lin SY, Makino K, Xia W, Matin A
The Therapeutic Role of Xenobiotic Nuclear Receptors against Metabolic Syndrome.
Pu, Shuqi; Wu, Xiaojie; Yang, Xiaoying; Zhang, Yunzhan; Dai, Yunkai; Zhang, Yueling; Wu, Xiaoting; Liu, Yan; Cui, Xiaona; Jin, Haiyong; Cao, Jianhong; Li, Ruliu; Cai, Jiazhong; Cao, Qizhi; Hu, Ling; Gao, Yong
2018-06-10
Xenobiotic nuclear receptors (XNRs) are nuclear receptors that characterized by coordinately regulating the expression of genes encoding drug-metabolizing enzymes and transporters to essentially eliminate and detoxify xenobiotics and endobiotics from the body, including the peroxisome proliferator-activated receptor (PPAR), the farnesoid X receptor (FXR), the liver X receptor (LXR), the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR). Heretofore, increasing evidences have suggested that these five XNRs are not only involved in the regulation of xeno-/endo-biotics detoxication but also the development of human diseases, such as cancer, obesity and diabetes. PPAR, FXR, LXR, PXR and CAR, as the receptors for numerous natural or synthetic compounds may be the most effective therapeutic targets in the treatment of metabolic diseases. In this review, we will focus on these five XNRs and their recently discovered functions in diabetes and its complications. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W. Y.; Li, Zhen; Fu, Amy K. Y.; Ip, Nancy Y.
2014-01-01
Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators. PMID:25329792
Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W Y; Li, Zhen; Fu, Amy K Y; Ip, Nancy Y
2014-01-01
Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators.
Nuclear receptor/microRNA circuitry links muscle fiber type to energy metabolism.
Gan, Zhenji; Rumsey, John; Hazen, Bethany C; Lai, Ling; Leone, Teresa C; Vega, Rick B; Xie, Hui; Conley, Kevin E; Auwerx, Johan; Smith, Steven R; Olson, Eric N; Kralli, Anastasia; Kelly, Daniel P
2013-06-01
The mechanisms involved in the coordinate regulation of the metabolic and structural programs controlling muscle fitness and endurance are unknown. Recently, the nuclear receptor PPARβ/δ was shown to activate muscle endurance programs in transgenic mice. In contrast, muscle-specific transgenic overexpression of the related nuclear receptor, PPARα, results in reduced capacity for endurance exercise. We took advantage of the divergent actions of PPARβ/δ and PPARα to explore the downstream regulatory circuitry that orchestrates the programs linking muscle fiber type with energy metabolism. Our results indicate that, in addition to the well-established role in transcriptional control of muscle metabolic genes, PPARβ/δ and PPARα participate in programs that exert opposing actions upon the type I fiber program through a distinct muscle microRNA (miRNA) network, dependent on the actions of another nuclear receptor, estrogen-related receptor γ (ERRγ). Gain-of-function and loss-of-function strategies in mice, together with assessment of muscle biopsies from humans, demonstrated that type I muscle fiber proportion is increased via the stimulatory actions of ERRγ on the expression of miR-499 and miR-208b. This nuclear receptor/miRNA regulatory circuit shows promise for the identification of therapeutic targets aimed at maintaining muscle fitness in a variety of chronic disease states, such as obesity, skeletal myopathies, and heart failure.
PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex.
Surapureddi, Sailesh; Viswakarma, Navin; Yu, Songtao; Guo, Dongsheng; Rao, M Sambasiva; Reddy, Janardan K
2006-05-05
Ciprofibrate, a potent peroxisome proliferator, induces pleiotropic responses in liver by activating peroxisome proliferator-activated receptor alpha (PPARalpha), a nuclear receptor. Transcriptional regulation by liganded nuclear receptors involves the participation of coregulators that form multiprotein complexes possibly to achieve cell and gene specific transcription. SDS-PAGE and matrix-assisted laser desorption/ionization reflection time-of-flight mass spectrometric analyses of ciprofibrate-binding proteins from liver nuclear extracts obtained using ciprofibrate-Sepharose affinity matrix resulted in the identification of a new high molecular weight nuclear receptor coactivator, which we designated PRIC320. The full-length human cDNA encoding this protein has an open-reading frame that codes for a 320kDa protein containing 2882 amino acids. PRIC320 contains five LXXLL signature motifs that mediate interaction with nuclear receptors. PRIC320 binds avidly to nuclear receptors PPARalpha, CAR, ERalpha, and RXR, but only minimally with PPARgamma. PRIC320 also interacts with transcription cofactors CBP, PRIP, and PBP. Immunoprecipitation-immunoblotting as well as cellular localization studies confirmed the interaction between PPARalpha and PRIC320. PRIC320 acts as a transcription coactivator by stimulating PPARalpha-mediated transcription. We conclude that ciprofibrate, a PPARalpha ligand, binds a multiprotein complex and PRIC320 cloned from this complex functions as a nuclear receptor coactivator.
Pu, Jun; Yuan, Ancai; Shan, Peiren; Gao, Erhe; Wang, Xiaoliang; Wang, Yajing; Lau, Wayne Bond; Koch, Walter; Ma, Xin-Liang; He, Ben
2013-01-01
Aims Emerging evidence indicates that nuclear receptors play a critical regulatory role in cardiovascular physiology/pathology. Recently, farnesoid-X-receptor (FXR), a member of the metabolic nuclear receptor superfamily, has been demonstrated to be expressed in vascular cells, with important roles in vascular physiology/pathology. However, the potential cardiac function of FXR remains unclear. We investigated the cardiac expression and biological function of FXR. Methods and results Farnesoid-X-receptor was detected in both isolated neonatal rat cardiac myocytes and fibroblasts. Natural and synthetic FXR agonists upregulated cardiac FXR expression, stimulated myocyte apoptosis, and reduced myocyte viability dose- and time-dependently. Mechanistic studies demonstrated that FXR agonists disrupted mitochondria, characterized by mitochondrial permeability transition pores activation, mitochondrial potential dissipation, cytochrome c release, and both caspase-9 and -3 activation. Such mitochondrial apoptotic responses were abolished by siRNA-mediated silencing of endogenous FXR or pharmacological inhibition of mitochondrial death signalling. Furthermore, low levels of FXR were detected in the adult mouse heart, with significant (∼2.0-fold) upregulation after myocardial ischaemia/reperfusion (MI/R). Pharmacological inhibition or genetic ablation of FXR significantly reduced myocardial apoptosis by 29.0–53.4%, decreased infarct size by 23.4–49.7%, and improved cardiac function in ischaemic/reperfused myocardium. Conclusion These results demonstrate that nuclear receptor FXR acts as a novel functional receptor in cardiac tissue, regulates apoptosis in cardiomyocytes, and contributes to MI/R injury. PMID:22307460
Background: The androgen receptor (AR, NR3C4) is a nuclear receptor whose main function is acting as a transcription factor regulating gene expression for male sexual development and maintaining accessory sexual organ function. It is also a necessary component of female fertility...
Studying Nuclear Receptor Complexes in the Cellular Environment.
Schaufele, Fred
2016-01-01
The ligand-regulated structure and biochemistry of nuclear receptor complexes are commonly determined by in vitro studies of isolated receptors, cofactors, and their fragments. However, in the living cell, the complexes that form are governed not just by the relative affinities of isolated cofactors for the receptor but also by the cell-specific sequestration or concentration of subsets of competing or cooperating cofactors, receptors, and other effectors into distinct subcellular domains and/or their temporary diversion into other cellular activities. Most methods developed to understand nuclear receptor function in the cellular environment involve the direct tagging of the nuclear receptor or its cofactors with fluorescent proteins (FPs) and the tracking of those FP-tagged factors by fluorescence microscopy. One of those approaches, Förster resonance energy transfer (FRET) microscopy, quantifies the transfer of energy from a higher energy "donor" FP to a lower energy "acceptor" FP attached to a single protein or to interacting proteins. The amount of FRET is influenced by the ligand-induced changes in the proximities and orientations of the FPs within the tagged nuclear receptor complexes, which is an indicator of the structure of the complexes, and by the kinetics of the interaction between FP-tagged factors. Here, we provide a guide for parsing information about the structure and biochemistry of nuclear receptor complexes from FRET measurements in living cells.
Lazennec, G; Kern, L; Valotaire, Y; Salbert, G
1997-01-01
The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383
Nuclear Function of Smad7 Promotes Myogenesis▿
Miyake, Tetsuaki; Alli, Nezeka S.; McDermott, John C.
2010-01-01
In the “canonical” view of transforming growth factor β (TGF-β) signaling, Smad7 plays an inhibitory role. While Smad7 represses Smad3 activation by TGF-β, it does not reverse the inhibitory effect of TGF-β on myogenesis, suggesting a different function in myogenic cells. We previously reported a promyogenic role of Smad7 mediated by an interaction with MyoD. Based on this association, we hypothesized a possible nuclear function of Smad7 independent of its role at the level of the receptor. We therefore engineered a chimera of Smad7 with a nuclear localization signal (NLS), which serves to prevent and therefore bypass binding to the TGF-β receptor while concomitantly constitutively localizing Smad7 to the nucleus. This Smad7-NLS did not repress Smad3 activation by TGF-β but did retain its ability to enhance myogenic gene activation and phenotypic myogenesis, indicating that the nuclear, receptor-independent function of Smad7 is sufficient to promote myogenesis. Furthermore, Smad7 physically interacts with MyoD and antagonizes the repressive effects of active MEK on MyoD. Reporter and myogenic conversion assays indicate a pivotal regulation of MyoD transcriptional properties by the balance between Smad7 and active MEK. Thus, Smad7 has a nuclear coactivator function that is independent of TGF-β signaling and necessary to promote myogenic differentiation. PMID:19995910
Roderick, H L; Campbell, A K; Llewellyn, D H
1997-03-24
The multi-functional protein calreticulin (CRT) is normally found within the lumen of the endoplasmic reticulum (ER). However, some of its proposed functions require it to be located within the nucleus, where its presence is contentious. We have investigated this in live COS7, HeLa and LM(TK-) cells using green fluorescent protein (GFP)-fusion proteins. GFP-CRT, and GFP, with an ER signal peptide and a KDEL sequence (ER-GFP), were localised to the ER. In addition, GFP-CRT was located in the nucleus of all the cell types at low levels. The higher levels of nuclear fluorescence in LM(TK-) and HeLa cells suggested that glucocorticoid receptors might enhance nuclear localisation of calreticulin. Dexamethasone treatment of LM(TK-) cells doubled the amount of nuclear GFP-CRT, but did not affect the localisation of a GFP-CRT fusion in which the glucocorticoid receptor-binding N-domain of calreticulin had been deleted. Thus, despite ER targeting and retention signals, calreticulin is also located within the nucleus where its presence increases due to its interaction with glucocorticoid receptors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania
2015-04-03
Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin–myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify amore » new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK. - Highlights: • ROCK regulates nucleocytoplasmic shuttling of HDAC7 via phosphorylation of MYPT1. • Nuclear export of HDAC7 and upregulation of NR4A1 occurs with low ROCK activity. • High levels of ROCK activity due to OPHN1 loss of function downregulate NR4A1.« less
Nuclear deterrents: Intrinsic regulators of IL-1β-induced effects on hippocampal neurogenesis.
O'Léime, Ciarán S; Cryan, John F; Nolan, Yvonne M
2017-11-01
Hippocampal neurogenesis, the process by which new neurons are born and develop into the host circuitry, begins during embryonic development and persists throughout adulthood. Over the last decade considerable insights have been made into the role of hippocampal neurogenesis in cognitive function and the cellular mechanisms behind this process. Additionally, an increasing amount of evidence exists on the impact of environmental factors, such as stress and neuroinflammation on hippocampal neurogenesis and subsequent impairments in cognition. Elevated expression of the pro-inflammatory cytokine interleukin-1β (IL-1β) in the hippocampus is established as a significant contributor to the neuronal demise evident in many neurological and psychiatric disorders and is now known to negatively regulate hippocampal neurogenesis. In order to prevent the deleterious effects of IL-1β on neurogenesis it is necessary to identify signalling pathways and regulators of neurogenesis within neural progenitor cells that can interact with IL-1β. Nuclear receptors are ligand regulated transcription factors that are involved in modulating a large number of cellular processes including neurogenesis. In this review we focus on the signalling mechanisms of specific nuclear receptors involved in regulating neurogenesis (glucocorticoid receptors, peroxisome proliferator activated receptors, estrogen receptors, and nuclear receptor subfamily 2 group E member 1 (NR2E1 or TLX)). We propose that these nuclear receptors could be targeted to inhibit neuroinflammatory signalling pathways associated with IL-1β. We discuss their potential to be therapeutic targets for neuroinflammatory disorders affecting hippocampal neurogenesis and associated cognitive function. Copyright © 2017 Elsevier Inc. All rights reserved.
Phenobarbital Meets Phosphorylation of Nuclear Receptors.
Negishi, Masahiko
2017-05-01
Phenobarbital was the first therapeutic drug to be characterized for its induction of hepatic drug metabolism. Essentially at the same time, cytochrome P450, an enzyme that metabolizes drugs, was discovered. After nearly 50 years of investigation, the molecular target of phenobarbital induction has now been delineated to phosphorylation at threonine 38 of the constitutive androstane receptor (NR1I3), a member of the nuclear receptor superfamily. Determining this mechanism has provided us with the molecular basis to understand drug induction of drug metabolism and disposition. Threonine 38 is conserved as a phosphorylation motif in the majority of both mouse and human nuclear receptors, providing us with an opportunity to integrate diverse functions of nuclear receptors. Here, I review the works and accomplishments of my laboratory at the National Institutes of Health National Institute of Environmental Health Sciences and the future research directions of where our study of the constitutive androstane receptor might take us. U.S. Government work not protected by U.S. copyright.
Plant nuclear hormone receptors: a role for small molecules in protein-protein interactions.
Lumba, Shelley; Cutler, Sean; McCourt, Peter
2010-01-01
Plant hormones are a group of chemically diverse small molecules that direct processes ranging from growth and development to biotic and abiotic stress responses. Surprisingly, genome analyses suggest that classic animal nuclear hormone receptor homologs do not exist in plants. It now appears that plants have co-opted several protein families to perceive hormones within the nucleus. In one solution to the problem, the hormones auxin and jasmonate (JA) act as “molecular glue” that promotes protein-protein interactions between receptor F-boxes and downstream corepressor targets. In another solution, gibberellins (GAs) bind and elicit a conformational change in a novel soluble receptor family related to hormone-sensitive lipases. Abscisic acid (ABA), like GA, also acts through an allosteric mechanism involving a START-domain protein. The molecular identification of plant nuclear hormone receptors will allow comparisons with animal nuclear receptors and testing of fundamental questions about hormone function in plant development and evolution.
Mollema, Nissa J.; Yuan, Yang; Jelcick, Austin S.; Sachs, Andrew J.; von Alpen, Désirée; Schorderet, Daniel; Escher, Pascal; Haider, Neena B.
2011-01-01
The majority of diseases in the retina are caused by genetic mutations affecting the development and function of photoreceptor cells. The transcriptional networks directing these processes are regulated by genes such as nuclear hormone receptors. The nuclear hormone receptor gene Rev-erb alpha/Nr1d1 has been widely studied for its role in the circadian cycle and cell metabolism, however its role in the retina is unknown. In order to understand the role of Rev-erb alpha/Nr1d1 in the retina, we evaluated the effects of loss of Nr1d1 to the developing retina and its co-regulation with the photoreceptor-specific nuclear receptor gene Nr2e3 in the developing and mature retina. Knock-down of Nr1d1 expression in the developing retina results in pan-retinal spotting and reduced retinal function by electroretinogram. Our studies show that NR1D1 protein is co-expressed with NR2E3 in the outer neuroblastic layer of the developing mouse retina. In the adult retina, NR1D1 is expressed in the ganglion cell layer and is co-expressed with NR2E3 in the outer nuclear layer, within rods and cones. Several genes co-targeted by NR2E3 and NR1D1 were identified that include: Nr2c1, Recoverin, Rgr, Rarres2, Pde8a, and Nupr1. We examined the cyclic expression of Nr1d1 and Nr2e3 over a twenty-four hour period and observed that both nuclear receptors cycle in a similar manner. Taken together, these studies reveal a novel role for Nr1d1, in conjunction with its cofactor Nr2e3, in regulating transcriptional networks critical for photoreceptor development and function. PMID:21408158
Orphan Nuclear Receptors as Targets for Drug Development
Mukherjee, Subhajit
2012-01-01
Orphan nuclear receptors regulate diverse biological processes. These important molecules are ligand-activated transcription factors that act as natural sensors for a wide range of steroid hormones and xenobiotic ligands. Because of their importance in regulating various novel signaling pathways, recent research has focused on identifying xenobiotics targeting these receptors for the treatment of multiple human diseases. In this review, we will highlight these receptors in several physiologic and pathophysiologic actions and demonstrate how their functions can be exploited for the successful development of newer drugs. PMID:20372994
Jia, Yuzhi; Viswakarma, Navin; Reddy, Janardan K
2014-01-01
Several nuclear receptors regulate diverse metabolic functions that impact on critical biological processes, such as development, differentiation, cellular regeneration, and neoplastic conversion. In the liver, some members of the nuclear receptor family, such as peroxisome proliferator-activated receptors (PPARs), constitutive androstane receptor (CAR), farnesoid X receptor (FXR), liver X receptor (LXR), pregnane X receptor (PXR), glucocorticoid receptor (GR), and others, regulate energy homeostasis, the formation and excretion of bile acids, and detoxification of xenobiotics. Excess energy burning resulting from increases in fatty acid oxidation systems in liver generates reactive oxygen species, and the resulting oxidative damage influences liver regeneration and liver tumor development. These nuclear receptors are important sensors of exogenous activators as well as receptor-specific endogenous ligands. In this regard, gene knockout mouse models revealed that some lipid-metabolizing enzymes generate PPARα-activating ligands, while others such as ACOX1 (fatty acyl-CoA oxidase1) inactivate these endogenous PPARα activators. In the absence of ACOX1, the unmetabolized ACOX1 substrates cause sustained activation of PPARα, and the resulting increase in energy burning leads to hepatocarcinogenesis. Ligand-activated nuclear receptors recruit the multisubunit Mediator complex for RNA polymerase II-dependent gene transcription. Evidence indicates that the Med1 subunit of the Mediator is essential for PPARα, PPARγ, CAR, and GR signaling in liver. Med1 null hepatocytes fail to respond to PPARα activators in that these cells do not show induction of peroxisome proliferation and increases in fatty acid oxidation enzymes. Med1-deficient hepatocytes show no increase in cell proliferation and do not give rise to liver tumors. Identification of nuclear receptor-specific coactivators and Mediator subunits should further our understanding of the complexities of metabolic diseases associated with increased energy combustion in liver.
Zhang, Wei; Zhang, Jing; Fang, Leiping; Zhou, Ling; Wang, Shuai; Xiang, Zhijun; Li, Yuan; Wisely, Bruce; Zhang, Guifeng; An, Gang; Wang, Yonghui; Leung, Stewart; Zhong, Zhong
2012-10-01
In a screen for small-molecule inhibitors of retinoid acid-related orphan receptor γ (RORγ), we fortuitously discovered that a class of aryl amide compounds behaved as functional activators of the interleukin 17 (IL-17) reporter in Jurkat cells. Three of these compounds were selected for further analysis and found to activate the IL-17 reporter with potencies of ∼0.1 μM measured by EC₅₀. These compounds were shown to directly bind to RORγ by circular dichroism-based thermal stability experiments. Furthermore, they can enhance an in vitro Th17 differentiation process in human primary T cells. As RORγ remains an orphan nuclear receptor, discovery of these aryl amide compounds as functional agonists will now provide pharmacological tools for us to dissect functions of RORγ and facilitate drug discovery efforts for immune-modulating therapies.
Gervois, P; Torra, I P; Chinetti, G; Grötzinger, T; Dubois, G; Fruchart, J C; Fruchart-Najib, J; Leitersdorf, E; Staels, B
1999-09-01
The peroxisome proliferator-activated receptor alpha (PPARalpha) plays a key role in lipid and lipoprotein metabolism. However, important inter- and intraspecies differences exist in the response to PPARalpha activators. This incited us to screen for PPARalpha variants with different signaling functions. In the present study, using a RT-PCR approach a variant human PPARalpha mRNA species was identified, which lacks the entire exon 6 due to alternative splicing. This deletion leads to the introduction of a premature stop codon, resulting in the formation of a truncated PPARalpha protein (PPARalphatr) lacking part of the hinge region and the entire ligand-binding domain. RNase protection analysis demonstrated that PPARalphatr mRNA is expressed in several human tissues and cells, representing between 20-50% of total PPARalpha mRNA. By contrast, PPARalphatr mRNA could not be detected in rodent tissues. Western blot analysis using PPARalpha-specific antibodies demonstrated the presence of an immunoreactive protein migrating at the size of in vitro produced PPARalphatr protein both in human hepatoma HepG2 cells and in human hepatocytes. Both in the presence or absence of 9-cis-retinoic acid receptor, PPARalphatr did not bind to DNA in gel shift assays. Immunocytochemical analysis of transfected CV-1 cells indicated that, whereas transfected PPARalphawt was mainly nuclear localized, the majority of PPARalphatr resided in the cytoplasm, with presence in the nucleus depending on cell culture conditions. Whereas a chimeric PPARalphatr protein containing a nuclear localization signal cloned at its N-terminal localized into the nucleus and exhibited strong negative activity on PPARalphawt transactivation function, PPARalphatr interfered with PPARalphatr transactivation function only under culture conditions inducing its nuclear localization. Cotransfection of the coactivator CREB-binding protein relieved the transcriptional repression of PPARalphawt by PPARalphatr, suggesting that the dominant negative effect of PPARalphatr might occur through competition for essential coactivators. In addition, PPARalphatr interfered with transcriptional activity of other nuclear receptors such as PPARgamma, hepatic nuclear factor-4, and glucocorticoid receptor-alpha, which share CREB-binding protein/p300 as a coactivator. Thus, we have identified a human PPARalpha splice variant that may negatively interfere with PPARalphawt function. Factors regulating either the ratio of PPARalphawt vs. PPARalphatr mRNA or the nuclear entry of PPARalphatr protein should therefore lead to altered signaling via the PPARalpha and, possibly also, other nuclear receptor pathways.
Mapping the nuclear localization signal in the matrix protein of potato yellow dwarf virus.
Anderson, Gavin; Jang, Chanyong; Wang, Renyuan; Goodin, Michael
2018-05-01
The ability of the matrix (M) protein of potato yellow dwarf virus (PYDV) to remodel nuclear membranes is controlled by a di-leucine motif located at residues 223 and 224 of its primary structure. This function can be uncoupled from that of its nuclear localization signal (NLS), which is controlled primarily by lysine and arginine residues immediately downstream of the LL motif. In planta localization of green fluorescent protein fusions, bimolecular fluorescence complementation assays with nuclear import receptor importin-α1 and yeast-based nuclear import assays provided three independent experimental approaches to validate the authenticity of the M-NLS. The carboxy terminus of M is predicted to contain a nuclear export signal, which is belived to be functional, given the ability of M to bind the Arabidopsis nuclear export receptor 1 (XPO1). The nuclear shuttle activity of M has implications for the cell-to-cell movement of PYDV nucleocapsids, based upon its interaction with the N and Y proteins.
Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that function as ligand-activated transcription factors regulating lipid metabolism and homeostasis. In addition to their ability to regulate PPAR-mediated gene transcription, PPARalpha and gamma li...
Ichikawa-Tomikawa, Naoki; Sugimoto, Kotaro; Satohisa, Seiro; Nishiura, Keisuke; Chiba, Hideki
2011-01-01
Tight junctions are intercellular junctions localized at the most apical end of the lateral plasma membrane. They consist of four kinds of transmembrane proteins (occludin, claudins, junctional adhesion molecules, and tricellulin) and huge numbers of scaffolding proteins and contribute to the paracellular barrier and fence function. The mutation and deletion of these proteins impair the functions of tight junctions and cause various human diseases. In this paper, we provide an overview of recent studies on transmembrane proteins of tight junctions and highlight the functional significance of tight junctions, extracellular matrix, and nuclear receptors in epithelial differentiation. PMID:22162632
Céspedes, Miguel Angel; Galindo, Maximo Ibo; Couso, Juan Pablo
2010-01-01
The Aryl hydrocarbon receptor (Ahr) is the nuclear receptor mediating the toxicity of dioxins -widespread and persistent pollutants whose toxic effects include tumor promotion, teratogenesis, wasting syndrome and chloracne. Elimination of Ahr in mice eliminates dioxin toxicity but also produces adverse effects, some seemingly unrelated to dioxin. Thus the relationship between the toxic and dioxin-independent functions of Ahr is not clear, which hampers understanding and treatment of dioxin toxicity. Here we develop a Drosophila model to show that dioxin actually increases the in vivo dioxin-independent activity of Ahr. This hyperactivation resembles the effects caused by an increase in the amount of its dimerisation partner Ahr nuclear translocator (Arnt) and entails an increased transcriptional potency of Ahr, in addition to the previously described effect on nuclear translocation. Thus the two apparently different functions of Ahr, dioxin-mediated and dioxin-independent, are in fact two different levels (hyperactivated and basal, respectively) of a single function. PMID:21079739
An integrated mechanism of cardiomyocyte nuclear Ca(2+) signaling.
Ibarra, Cristián; Vicencio, Jose Miguel; Varas-Godoy, Manuel; Jaimovich, Enrique; Rothermel, Beverly A; Uhlén, Per; Hill, Joseph A; Lavandero, Sergio
2014-10-01
In cardiomyocytes, Ca(2+) plays a central role in governing both contraction and signaling events that regulate gene expression. Current evidence indicates that discrimination between these two critical functions is achieved by segregating Ca(2+) within subcellular microdomains: transcription is regulated by Ca(2+) release within nuclear microdomains, and excitation-contraction coupling is regulated by cytosolic Ca(2+). Accordingly, a variety of agonists that control cardiomyocyte gene expression, such as endothelin-1, angiotensin-II or insulin-like growth factor-1, share the feature of triggering nuclear Ca(2+) signals. However, signaling pathways coupling surface receptor activation to nuclear Ca(2+) release, and the phenotypic responses to such signals, differ between agonists. According to earlier hypotheses, the selective control of nuclear Ca(2+) signals by activation of plasma membrane receptors relies on the strategic localization of inositol trisphosphate receptors at the nuclear envelope. There, they mediate Ca(2+) release from perinuclear Ca(2+) stores upon binding of inositol trisphosphate generated in the cytosol, which diffuses into the nucleus. More recently, identification of such receptors at nuclear membranes or perinuclear sarcolemmal invaginations has uncovered novel mechanisms whereby agonists control nuclear Ca(2+) release. In this review, we discuss mechanisms for the selective control of nuclear Ca(2+) signals with special focus on emerging models of agonist receptor activation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Microsomal receptor for steroid hormones: functional implications for nuclear activity.
Muldoon, T G; Watson, G H; Evans, A C; Steinsapir, J
1988-01-01
Target tissues for steroid hormones are responsive by virtue of and to the extent of their content of functional intracellular receptors. Recent years have seen a shift in considerations of the cellular dynamics and distribution of these receptors, with current views favoring predominant intranuclear localization in the intact cell. This paper summarizes our analyses of the microsomal estrogen and androgen binding capability of rat uterine and ventral prostate tissue, respectively; these studies have revealed a set of high affinity sites that may act as a conduit for estrogen traversing the cell en route to the nucleus. These sites have many properties in common with cytosolic receptors, with the salient difference of a failure to activate to a more avid DNA-binding form under conditions which permit such activation of cytosolic receptors. The microsomal estrogen-binding proteins also have appreciable affinity for progesterone, another distinction from other known cellular estrogen receptor species. Various experimental approaches were employed to demonstrate that the microsomal receptors were not simply cytosol contaminants; the most convincing evidence is the recent successful separation of the cytosolic and microsomal forms by differential ammonium sulfate precipitation. Discrete subfractionation of subcellular components on successive sucrose gradients, with simultaneous assessments of binding capability and marker enzyme concentrations, indicates that the major portion of the binding is localized within the vesicles of the endoplasmic reticulum free of significant plasma membrane contamination. The microsomal receptors are readily solubilized by extraction with high- or low-salt-containing buffers or with steroid. The residual microsomes following such extraction have the characteristics of saturable acceptor sites for cytosolic estrogen-receptor complexes. The extent to which these sites will accept the cytosolic complexes is equal to the concentration of microsomal binding sites extracted. These observations suggest three possible roles for the microsomal receptor-like proteins: (a) modulation of estrogen access to nuclear binding sites; (b) formation of functional complexes which diffuse to other extranuclear sites to alter non-genomic cellular processes; (c) regulation of nuclear concentration of estrogen-receptor complexes by virtue of producing microsomal acceptor sites for uptake of free or loosely associated nuclear complexes, previously thought to exist in the cytoplasm.
RXR function requires binding to an endogenous terpenoid ligand
USDA-ARS?s Scientific Manuscript database
The issue of whether the nuclear receptor RXR must bind to an endogenous, nanomolar affinity ligand in order to perform its natural function is still unsettled (1). On the basis of our previous studies establishing that the Drosophilamelanogaster ortholog of the retinoid X receptor ("ultraspiracle,"...
Identification of SR1078, a synthetic agonist for the orphan nuclear receptors RORα and RORγ.
Wang, Yongjun; Kumar, Naresh; Nuhant, Philippe; Cameron, Michael D; Istrate, Monica A; Roush, William R; Griffin, Patrick R; Burris, Thomas P
2010-11-19
The retinoic acid receptor-related receptors (RORs) are members of the nuclear receptor (NR) superfamily of transcription factors. Several NRs are still characterized as orphan receptors because ligands have not yet been identified for these proteins. Here, we describe the identification of a synthetic RORα/RORγ ligand, SR1078. SR1078 modulates the conformation of RORγ in a biochemical assay and activates RORα and RORγ driven transcription. Furthermore, SR1078 stimulates expression of endogenous ROR target genes in HepG2 cells that express both RORα and RORγ. Pharmacokinetic studies indicate that SR1078 displays reasonable exposure following injection into mice, and consistent with SR1078 functioning as a RORα/RORγ agonist, expression of two ROR target genes, glucose-6-phosphatase and fibroblast growth factor 21, were stimulated in the liver. Thus, we have identified the first synthetic RORα/γ agonist, and this compound can be utilized as a chemical tool to probe the function of these receptors both in vitro and in vivo.
Identification of a Synthetic Agonist for the Orphan Nuclear Receptors RORα and RORγ, SR1078
Wang, Yongjun; Kumar, Naresh; Nuhant, Philippe; Cameron, Michael D.; Istrate, Monica A.; Roush, William R.; Griffin, Patrick R.; Burris, Thomas P.
2010-01-01
The retinoic acid receptor-related receptors (RORs) are members of the nuclear receptor (NR) superfamily of transcription factors. Several NRs are still characterized as orphan receptors since ligands have not yet been identified for these proteins. Here, we describe the identification of a synthetic RORα/RORγ ligand, SR1078. SR1078 modulates the conformation of RORγ in a biochemical assay and activates RORα and RORγ driven transcription. Furthermore, SR1078 stimulates expression of endogenous ROR target genes in HepG2 cells that express both RORα and RORγ. Pharmacokinetic studies indicate that SR1078 displays reasonable exposure following injection into mice and consistent with SR1078 functioning as a RORα/RORγ agonist, expression of two ROR target genes, glucose-6-phosphatase and fibroblast growth factor 21, were stimulated in the liver. Thus, we have identified the first synthetic RORα/γ agonist and this compound can be utilized as a chemical tool to probe the function of these receptors both in vitro and in vivo. PMID:20735016
Ariumi, Yasuo; Ego, Takeshi; Kaida, Atsushi; Matsumoto, Mikiko; Pandolfi, Pier Paolo; Shimotohno, Kunitada
2003-03-20
Several viruses target cellular promyelocytic leukemia (PML)-nuclear bodies (PML-NBs) to induce their disruption, marked morphological changes in these structures or the relocation to PML-NB components to the cytoplasm of infected cells. PML conversely interferes with viral replication. We demonstrate that PML acts as a coactivator for the human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein without direct binding. Tax was identified within interchromatin granule clusters (IGCs)/RNA splicing bodies (SBs), not PML-NBs; Tax expression did not affect PML-NB formation. Moreover, PML and CBP/p300 cooperatively activated Tax-mediated HTLV-1-LTR-dependent gene expression. Interestingly, two PML mutants, PML-RAR and PMLDelta216-331, which fail to form PML-NBs, could also coactivate Tax-mediated trans-acting function but had no effect on retinoic acid receptor (RAR)- or p53-dependent gene expression. In contrast, SMRT (silencing mediator for retinoic acid and thyroid hormone receptors), a nuclear corepressor found within the matrix-associated deacetylase (MAD) nuclear body, relocalized into Tax-associated nuclear bodies upon coexpression with Tax. SMRT coactivated the trans-acting function of Tax through direct binding. Coexpression of SMRT and PML resulted in an additive activation of Tax trans-acting function. Thus, crosstalk between distinct nuclear bodies may control Tax function.
ERRα: a metabolic function for the oldest orphan
Villena, Josep A.; Kralli, Anastasia
2009-01-01
Estrogen receptor related receptor (ERR)α was one of the first identified (1988) orphan nuclear receptors. Many of the orphan receptors identified after ERRα were deorphanized in a timely manner and appreciated as key transcriptional regulators of metabolic pathways. ERRα, however, remains an orphan. Nevertheless, recent studies have defined regulatory mechanisms and transcriptional targets of ERRα, allowing this receptor to join ranks with other nuclear receptors that control metabolism. Notably, mice lacking ERRα show defects when challenged with stressors that require a ‘shift of gears’ in energy metabolism, such as exposure to cold, cardiac overload or infection. These findings establish the importance of ERRα for adaptive energy metabolism, and suggest that strategies targeting ERRα may be useful in fighting metabolic diseases. PMID:18778951
Lin, Meng-Lay; Patel, Hetal; Remenyi, Judit; Banerji, Christopher R S; Lai, Chun-Fui; Periyasamy, Manikandan; Lombardo, Ylenia; Busonero, Claudia; Ottaviani, Silvia; Passey, Alun; Quinlan, Philip R; Purdie, Colin A; Jordan, Lee B; Thompson, Alastair M; Finn, Richard S; Rueda, Oscar M; Caldas, Carlos; Gil, Jesus; Coombes, R Charles; Fuller-Pace, Frances V; Teschendorff, Andrew E; Buluwela, Laki; Ali, Simak
2015-08-28
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other NR and there is evidence that ERα function may be recapitulated by other NRs in ERα-negative breast cancer. In order to examine the inter-relationships between nuclear receptors, and to obtain evidence for previously unsuspected roles for any NRs, we undertook quantitative RT-PCR and bioinformatics analysis to examine their expression in breast cancer. While most NRs were expressed, bioinformatic analyses differentiated tumours into distinct prognostic groups that were validated by analyzing public microarray data sets. Although ERα and progesterone receptor were dominant in distinguishing prognostic groups, other NR strengthened these groups. Clustering analysis identified several family members with potential importance in breast cancer. Specifically, RORγ is identified as being co-expressed with ERα, whilst several NRs are preferentially expressed in ERα-negative disease, with TLX expression being prognostic in this subtype. Functional studies demonstrated the importance of TLX in regulating growth and invasion in ERα-negative breast cancer cells.
Johnson, Howard M.; Noon-Song, Ezra; Ahmed, Chulbul M.
2011-01-01
The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation. PMID:22924155
Johnson, Howard M; Noon-Song, Ezra; Ahmed, Chulbul M
2011-09-03
The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation.
Cho, Hana; Park, Ok Hyun; Park, Joori; Ryu, Incheol; Kim, Jeonghan; Ko, Jesang; Kim, Yoon Ki
2015-03-31
Glucocorticoid receptor (GR), which was originally known to function as a nuclear receptor, plays a role in rapid mRNA degradation by acting as an RNA-binding protein. The mechanism by which this process occurs remains unknown. Here, we demonstrate that GR, preloaded onto the 5'UTR of a target mRNA, recruits UPF1 through proline-rich nuclear receptor coregulatory protein 2 (PNRC2) in a ligand-dependent manner, so as to elicit rapid mRNA degradation. We call this process GR-mediated mRNA decay (GMD). Although GMD, nonsense-mediated mRNA decay (NMD), and staufen-mediated mRNA decay (SMD) share upstream frameshift 1 (UPF1) and PNRC2, we find that GMD is mechanistically distinct from NMD and SMD. We also identify de novo cellular GMD substrates using microarray analysis. Intriguingly, GMD functions in the chemotaxis of human monocytes by targeting chemokine (C-C motif) ligand 2 (CCL2) mRNA. Thus, our data provide molecular evidence of a posttranscriptional role of the well-studied nuclear hormone receptor, GR, which is traditionally considered a transcription factor.
Nutrient-sensing nuclear receptors PPARα and FXR control liver energy balance.
Preidis, Geoffrey A; Kim, Kang Ho; Moore, David D
2017-04-03
The nuclear receptors PPARα (encoded by NR1C1) and farnesoid X receptor (FXR, encoded by NR1H4) are activated in the liver in the fasted and fed state, respectively. PPARα activation induces fatty acid oxidation, while FXR controls bile acid homeostasis, but both nuclear receptors also regulate numerous other metabolic pathways relevant to liver energy balance. Here we review evidence that they function coordinately to control key nutrient pathways, including fatty acid oxidation and gluconeogenesis in the fasted state and lipogenesis and glycolysis in the fed state. We have also recently reported that these receptors have mutually antagonistic impacts on autophagy, which is induced by PPARα but suppressed by FXR. Secretion of multiple blood proteins is a major drain on liver energy and nutrient resources, and we present preliminary evidence that the liver secretome may be directly suppressed by PPARα, but induced by FXR. Finally, previous studies demonstrated a striking deficiency in bile acid levels in malnourished mice that is consistent with results in malnourished children. We present evidence that hepatic targets of PPARα and FXR are dysregulated in chronic undernutrition. We conclude that PPARα and FXR function coordinately to integrate liver energy balance.
[Roles of G protein-coupled estrogen receptor in the male reproductive system].
Chen, Kai-hong; Zhang, Xian; Jiang, Xue-wu
2016-02-01
The G protein-coupled estrogen receptor (GPER), also known as G protein-coupled receptor 30 (GPR30), was identified in the recent years as a functional membrane receptor different from the classical nuclear estrogen receptors. This receptor is widely expressed in the cortex, cerebellum, hippocampus, heart, lung, liver, skeletal muscle, and the urogenital system. It is responsible for the mediation of nongenomic effects associated with estrogen and its derivatives, participating in the physiological activities of the body. The present study reviews the molecular structure, subcellular localization, signaling pathways, distribution, and function of GPER in the male reproductive system.
Mullaney, Brendan; Ashrafi, Kaveh
2010-01-01
Summary Acyl-CoA synthases are important for lipid synthesis and breakdown, generation of signaling molecules and lipid modification of proteins, highlighting the challenge of understanding metabolic pathways within intact organisms. From a C. elegans mutagenesis screen, we found that loss of ACS-3, a long-chain acyl-CoA synthase, causes enhanced intestinal lipid uptake, de novo fat synthesis, and accumulation of enlarged, neutral lipid rich intestinal depots. Here, we show that ACS-3 functions in seam cells, epidermal cells anatomically distinct from sites of fat uptake and storage, and that acs-3 mutant phenotypes require the nuclear hormone receptor NHR-25, a key regulator of C. elegans molting. Our findings suggest that ACS-3 derived long chain fatty acyl-CoAs, perhaps incorporated into complex ligands such as phosphoinositides, modulate NHR-25 function, which in turn regulates an endocrine program of lipid uptake and synthesis. These results reveal a link between acyl-CoA synthase function and an NR5A family nuclear receptor in C. elegans. PMID:20889131
Mills, Ian G; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E
2005-07-18
Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription.
Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto
2009-12-18
The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins aremore » known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.« less
Epigenetic regulation of the expression of genes involved in steroid hormone biosynthesis and action
Martinez-Arguelles, Daniel B.; Papadopoulos, Vassilios
2010-01-01
Steroid hormones participate in organ development, reproduction, body homeostasis, and stress responses. The steroid machinery is expressed in a development- and tissue-specific manner, with the expression of these factors being tightly regulated by an array of transcription factors (TFs). Epigenetics provides an additional layer of gene regulation through DNA methylation and histone tail modifications. Evidence of epigenetic regulation of key steroidogenic enzymes is increasing, though this does not seem to be a predominant regulatory pathway. Steroid hormones exert their action in target tissues through steroid nuclear receptors belonging to the NR3A and NR3C families. Nuclear receptor expression levels and post-translational modifications regulate their function and dictate their sensitivity to steroid ligands. Nuclear receptors and TFs are more likely to be epigenetically regulated than proteins involved in steroidogenesis and have secondary impact on the expression of these steroidogenic enzymes. Here we review evidence for epigenetic regulation of enzymes, transcription factors, and nuclear receptors related to steroid biogenesis and action. PMID:20156469
NR4A nuclear receptors are orphans but not lonesome.
Kurakula, Kondababu; Koenis, Duco S; van Tiel, Claudia M; de Vries, Carlie J M
2014-11-01
The NR4A subfamily of nuclear receptors consists of three mammalian members: Nur77, Nurr1, and NOR-1. The NR4A receptors are involved in essential physiological processes such as adaptive and innate immune cell differentiation, metabolism and brain function. They act as transcription factors that directly modulate gene expression, but can also form trans-repressive complexes with other transcription factors. In contrast to steroid hormone nuclear receptors such as the estrogen receptor or the glucocorticoid receptor, no ligands have been described for the NR4A receptors. This lack of known ligands might be explained by the structure of the ligand-binding domain of NR4A receptors, which shows an active conformation and a ligand-binding pocket that is filled with bulky amino acid side-chains. Other mechanisms, such as transcriptional control, post-translational modifications and protein-protein interactions therefore seem to be more important in regulating the activity of the NR4A receptors. For Nur77, over 80 interacting proteins (the interactome) have been identified so far, and roughly half of these interactions has been studied in more detail. Although the NR4As show some overlap in interacting proteins, less information is available on the interactome of Nurr1 and NOR-1. Therefore, the present review will describe the current knowledge on the interactomes of all three NR4A nuclear receptors with emphasis on Nur77. Copyright © 2014 Elsevier B.V. All rights reserved.
Remenyi, Judit; Banerji, Christopher R.S.; Lai, Chun-Fui; Periyasamy, Manikandan; Lombardo, Ylenia; Busonero, Claudia; Ottaviani, Silvia; Passey, Alun; Quinlan, Philip R.; Purdie, Colin A.; Jordan, Lee B.; Thompson, Alastair M.; Finn, Richard S.; Rueda, Oscar M.; Caldas, Carlos; Gil, Jesus; Coombes, R. Charles; Fuller-Pace, Frances V.; Teschendorff, Andrew E.; Buluwela, Laki; Ali, Simak
2015-01-01
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other NR and there is evidence that ERα function may be recapitulated by other NRs in ERα-negative breast cancer. In order to examine the inter-relationships between nuclear receptors, and to obtain evidence for previously unsuspected roles for any NRs, we undertook quantitative RT-PCR and bioinformatics analysis to examine their expression in breast cancer. While most NRs were expressed, bioinformatic analyses differentiated tumours into distinct prognostic groups that were validated by analyzing public microarray data sets. Although ERα and progesterone receptor were dominant in distinguishing prognostic groups, other NR strengthened these groups. Clustering analysis identified several family members with potential importance in breast cancer. Specifically, RORγ is identified as being co-expressed with ERα, whilst several NRs are preferentially expressed in ERα-negative disease, with TLX expression being prognostic in this subtype. Functional studies demonstrated the importance of TLX in regulating growth and invasion in ERα-negative breast cancer cells. PMID:26280373
Nuclear Receptors in Bone Physiology and Diseases
Youn, Min-Young; Inoue, Kazuki; Takada, Ichiro; Kouzmenko, Alexander; Kato, Shigeaki
2013-01-01
During the last decade, our view on the skeleton as a mere solid physical support structure has been transformed, as bone emerged as a dynamic, constantly remodeling tissue with systemic regulatory functions including those of an endocrine organ. Reflecting this remarkable functional complexity, distinct classes of humoral and intracellular regulatory factors have been shown to control vital processes in the bone. Among these regulators, nuclear receptors (NRs) play fundamental roles in bone development, growth, and maintenance. NRs are DNA-binding transcription factors that act as intracellular transducers of the respective ligand signaling pathways through modulation of expression of specific sets of cognate target genes. Aberrant NR signaling caused by receptor or ligand deficiency may profoundly affect bone health and compromise skeletal functions. Ligand dependency of NR action underlies a major strategy of therapeutic intervention to correct aberrant NR signaling, and significant efforts have been made to design novel synthetic NR ligands with enhanced beneficial properties and reduced potential negative side effects. As an example, estrogen deficiency causes bone loss and leads to development of osteoporosis, the most prevalent skeletal disorder in postmenopausal women. Since administration of natural estrogens for the treatment of osteoporosis often associates with undesirable side effects, several synthetic estrogen receptor ligands have been developed with higher therapeutic efficacy and specificity. This review presents current progress in our understanding of the roles of various nuclear receptor-mediated signaling pathways in bone physiology and disease, and in development of advanced NR ligands for treatment of common skeletal disorders. PMID:23589826
Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors
Mills, Ian G.; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E.
2005-01-01
Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription. PMID:16027218
Zhang, Li; Jin, Yaru; Han, Zhihua; Liu, Hongling; Shi, Laihao; Hua, Xiaoxue; Doering, Jon A; Tang, Song; Giesy, John P; Yu, Hongxia
2018-03-01
One of the most abundant polybrominated diphenyl ethers (PBDEs) is 2,2',4,4',5-pentabromodiphenyl ether (BDE-99), which persists and potentially bioaccumulates in aquatic wildlife. Previous studies in mammals have shown that BDE-99 affects development and disrupts certain endocrine functions through signaling pathways mediated by nuclear receptors. However, fewer studies have investigated the potential of BDE-99 to interact with nuclear receptors in aquatic vertebrates such as fish. In the present study, interactions between BDE-99 and nuclear receptors were investigated by in silico and in vivo approaches. This PBDE was able to dock into the ligand-binding domain of zebrafish aryl hydrocarbon receptor 2 (AhR2) and pregnane X receptor (PXR). It had a significant effect on the transcriptional profiles of genes associated with AhR or PXR. Based on the developed cytoscape of all zebrafish genes, it was also inferred that AhR and PXR could interact via cross-talk. In addition, both the in silico and in vivo approaches found that BDE-99 affected peroxisome proliferator-activated receptor alpha (PPARα), glucocorticoid receptor, and thyroid receptor. Collectively, our results demonstrate for the first time detailed in silico evidence that BDE-99 can bind to and interact with zebrafish AhR and PXR. These findings can be used to elaborate the molecular mechanism of BDE-99 and guide more objective environmental risk assessments. Environ Toxicol Chem 2018;37:780-787. © 2017 SETAC. © 2017 SETAC.
Roehrborn, C G; Lange, J L; George, F W; Wilson, J D
1987-01-01
To provide insight into the factors that control growth of the penis we measured the amount and intracellular distribution of specific high affinity androgen receptor in foreskins obtained at circumcision from 49 males varying in age from newborn to 59 yr. Total (cytosolic plus nuclear extract) androgen receptor decreased from approximately 40 fmol/g tissue weight in newborn foreskins to approximately 25 fmol/g by 1 yr of age. The amount of receptor rose in childhood to approximately 180 fmol/g in the late teenage years and fell thereafter to approximately 20-40 fmol/g in men older than 40 yr. The amount of receptor in the nuclear fraction increased at the time of puberty and subsequently decreased in parallel with the decline in total receptor level. These changes in androgen-receptor amount are similar when expressed per milligram DNA or per milligram protein. Images PMID:3491838
Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V
1999-01-01
The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965
Structural basis for corepressor assembly by the orphan nuclear receptor TLX
Zhou, X. Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten
2015-01-01
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. PMID:25691470
Structural basis for corepressor assembly by the orphan nuclear receptor TLX
Zhi, Xiaoyong; Zhou, X. Edward; He, Yuanzheng; ...
2015-02-15
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conservedmore » ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression.« less
Hwang, Dae-Sik; Lee, Bo-Young; Kim, Hui-Su; Lee, Min Chul; Kyung, Do-Hyun; Om, Ae-Son; Rhee, Jae-Sung; Lee, Jae-Seong
2014-11-18
Nuclear receptors (NRs) are a large superfamily of proteins defined by a DNA-binding domain (DBD) and a ligand-binding domain (LBD). They function as transcriptional regulators to control expression of genes involved in development, homeostasis, and metabolism. The number of NRs differs from species to species, because of gene duplications and/or lineage-specific gene losses during metazoan evolution. Many NRs in arthropods interact with the ecdysteroid hormone and are involved in ecdysone-mediated signaling in arthropods. The nuclear receptor superfamily complement has been reported in several arthropods, including crustaceans, but not in copepods. We identified the entire NR repertoire of the copepod Tigriopus japonicus, which is an important marine model species for ecotoxicology and environmental genomics. Using whole genome and transcriptome sequences, we identified a total of 31 nuclear receptors in the genome of T. japonicus. Nomenclature of the nuclear receptors was determined based on the sequence similarities of the DNA-binding domain (DBD) and ligand-binding domain (LBD). The 7 subfamilies of NRs separate into five major clades (subfamilies NR1, NR2, NR3, NR4, and NR5/6). Although the repertoire of NR members in, T. japonicus was similar to that reported for other arthropods, there was an expansion of the NR1 subfamily in Tigriopus japonicus. The twelve unique nuclear receptors identified in T. japonicus are members of NR1L. This expansion may be a unique lineage-specific feature of crustaceans. Interestingly, E78 and HR83, which are present in other arthropods, were absent from the genomes of T. japonicus and two congeneric copepod species (T. japonicus and Tigriopus californicus), suggesting copepod lineage-specific gene loss. We identified all NR receptors present in the copepod, T. japonicus. Knowledge of the copepod nuclear receptor repertoire will contribute to a better understanding of copepod- and crustacean-specific NR evolution.
Rac-mediated Stimulation of Phospholipase Cγ2 Amplifies B Cell Receptor-induced Calcium Signaling*♦
Walliser, Claudia; Tron, Kyrylo; Clauss, Karen; Gutman, Orit; Kobitski, Andrei Yu.; Retlich, Michael; Schade, Anja; Röcker, Carlheinz; Henis, Yoav I.; Nienhaus, G. Ulrich; Gierschik, Peter
2015-01-01
The Rho GTPase Rac is crucially involved in controlling multiple B cell functions, including those regulated by the B cell receptor (BCR) through increased cytosolic Ca2+. The underlying molecular mechanisms and their relevance to the functions of intact B cells have thus far remained unknown. We have previously shown that the activity of phospholipase Cγ2 (PLCγ2), a key constituent of the BCR signalosome, is stimulated by activated Rac through direct protein-protein interaction. Here, we use a Rac-resistant mutant of PLCγ2 to functionally reconstitute cultured PLCγ2-deficient DT40 B cells and to examine the effects of the Rac-PLCγ2 interaction on BCR-mediated changes of intracellular Ca2+ and regulation of Ca2+-regulated and nuclear-factor-of-activated-T-cell-regulated gene transcription at the level of single, intact B cells. The results show that the functional Rac-PLCγ2 interaction causes marked increases in the following: (i) sensitivity of B cells to BCR ligation; (ii) BCR-mediated Ca2+ release from intracellular stores; (iii) Ca2+ entry from the extracellular compartment; and (iv) nuclear translocation of the Ca2+-regulated nuclear factor of activated T cells. Hence, Rac-mediated stimulation of PLCγ2 activity serves to amplify B cell receptor-induced Ca2+ signaling. PMID:25903139
Use Of Transgenic Mice In UDP-Glucuronosyltransferase (UGT) Studies
Ou, Zhimin; Huang, Min; Zhao, Lizi; Xie, Wen
2009-01-01
Transgenic mouse models are useful to understand the function and regulation of drug metabolizing enzymes in vivo. This article is intended to describe the general strategies and to discuss specific examples on how to use transgenic, gene knockout, and humanized mice to study the function as well as genetic and pharmacological regulation of UDP-glucuronosyltransferases (UGTs). The physiological and pharmacological implications of transcription factor-mediated UGT regulation will also be discussed. The UGT-regulating transcription factors to be discussed in this article include nuclear hormone receptors (NRs), aryl hydrocarbon receptor (AhR), and nuclear factor erythroid 2-related factor 2 (Nrf2). PMID:20070245
Chang, Ji Suk; Huypens, Peter; Zhang, Yubin; Black, Chelsea; Kralli, Anastasia; Gettys, Thomas W
2010-06-04
Peroxisome proliferator-activated receptor gamma co-activator-1alpha (PGC-1alpha) plays a central role in the regulation of cellular energy metabolism and metabolic adaptation to environmental and nutritional stimuli. We recently described a novel, biologically active splice variant of PGC-1alpha (NT-PGC-1alpha, amino acids 1-270) that retains the ability to interact with and transactivate nuclear hormone receptors through its N-terminal transactivation domain. Whereas PGC-1alpha is an unstable nuclear protein sensitive to ubiquitin-mediated targeting to the proteasome, NT-PGC-1alpha is relatively stable and predominantly cytoplasmic, suggesting that its ability to interact with and activate nuclear receptors and transcription factors is dependent upon regulated access to the nucleus. We provide evidence that NT-PGC-1alpha interacts with the nuclear exportin, CRM1, through a specific leucine-rich domain (nuclear export sequence) that regulates its export to the cytoplasm. The nuclear export of NT-PGC-1alpha is inhibited by protein kinase A-dependent phosphorylation of Ser-194, Ser-241, and Thr-256 on NT-PGC-1alpha, which effectively increases its nuclear concentration. Using site-directed mutagenesis to prevent or mimic phosphorylation at these sites, we show that the transcriptional activity of NT-PGC-1alpha is regulated in part through regulation of its subcellular localization. These findings suggest that the function of NT-PGC-1alpha as a transcriptional co-activator is regulated by protein kinase A-dependent inhibition of CRM1-mediated export from the nucleus.
Steroid receptors and their ligands: Effects on male gamete functions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aquila, Saveria; De Amicis, Francesca, E-mail: francesca.deamicis@unical.it
In recent years a new picture of human sperm biology is emerging. It is now widely recognized that sperm contain nuclear encoded mRNA, mitochondrial encoded RNA and different transcription factors including steroid receptors, while in the past sperm were considered incapable of transcription and translation. One of the main targets of steroid hormones and their receptors is reproductive function. Expression studies on Progesterone Receptor, estrogen receptor, androgen receptor and their specific ligands, demonstrate the presence of these systems in mature spermatozoa as surface but also as nuclear conventional receptors, suggesting that both systemic and local steroid hormones, through sperm receptors,more » may influence male reproduction. However, the relationship between the signaling events modulated by steroid hormones and sperm fertilization potential as well as the possible involvement of the specific receptors are still controversial issues. The main line of this review highlights the current research in human sperm biology examining new molecular systems of response to the hormones as well as specific regulatory pathways controlling sperm cell fate and biological functions. Most significant studies regarding the identification of steroid receptors are reported and the mechanistic insights relative to signaling pathways, together with the change in sperm metabolism energy influenced by steroid hormones are discussed.The reviewed evidences suggest important effects of Progesterone, Estrogen and Testosterone and their receptors on spermatozoa and implicate the involvement of both systemic and local steroid action in the regulation of male fertility potential. - Highlights: • One of the main targets of steroid hormones and their receptors is reproductive function. • Pg/PR co-work to stimulate enzymatic activities to sustain a capacitation process. • E2/ERs regulate sperm motility, capacitation and acrosome reaction and act as survival factors. • Androgens/AR mediate sperm death which is a novel field of investigation in sperm biology.« less
Reynolds, Merrick S; Hancock, Chad R; Ray, Jason D; Kener, Kyle B; Draney, Carrie; Garland, Kevin; Hardman, Jeremy; Bikman, Benjamin T; Tessem, Jeffery S
2016-07-01
β-Cell insulin secretion is dependent on proper mitochondrial function. Various studies have clearly shown that the Nr4a family of orphan nuclear receptors is essential for fuel utilization and mitochondrial function in liver, muscle, and adipose. Previously, we have demonstrated that overexpression of Nr4a1 or Nr4a3 is sufficient to induce proliferation of pancreatic β-cells. In this study, we examined whether Nr4a expression impacts pancreatic β-cell mitochondrial function. Here, we show that β-cell mitochondrial respiration is dependent on the nuclear receptors Nr4a1 and Nr4a3. Mitochondrial respiration in permeabilized cells was significantly decreased in β-cells lacking Nr4a1 or Nr4a3. Furthermore, respiration rates of intact cells deficient for Nr4a1 or Nr4a3 in the presence of 16 mM glucose resulted in decreased glucose mediated oxygen consumption. Consistent with this reduction in respiration, a significant decrease in glucose-stimulated insulin secretion rates is observed with deletion of Nr4a1 or Nr4a3. Interestingly, the changes in respiration and insulin secretion occur without a reduction in mitochondrial content, suggesting decreased mitochondrial function. We establish that knockdown of Nr4a1 and Nr4a3 results in decreased expression of the mitochondrial dehydrogenase subunits Idh3g and Sdhb. We demonstrate that loss of Nr4a1 and Nr4a3 impedes production of ATP and ultimately inhibits glucose-stimulated insulin secretion. These data demonstrate for the first time that the orphan nuclear receptors Nr4a1 and Nr4a3 are critical for β-cell mitochondrial function and insulin secretion. Copyright © 2016 the American Physiological Society.
Retinoid Pathway and Cancer Therapeutics
Bushue, Nathan; Wan, Yu-Jui Yvonne
2010-01-01
The retinoids are a class of compounds that are structurally related to vitamin A. Retinoic acid, which is the active metabolite of retinol, regulates a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids exert their effects through a variety of binding proteins including cellular retinol binding protein (CRBP), retinol-binding proteins (RBP), cellular retinoic acid-binding protein (CRABP), and nuclear receptors i.e. retinoic acid receptor (RAR) and retinoid × receptor (RXR). Because of the pleiotropic effects of retinoids, understanding the function of these binding proteins and nuclear receptors assists us in developing compounds that have specific effects. This review summarizes our current understanding of how retinoids are processed and act with the emphasis on the application of retinoids in cancer treatment and prevention. PMID:20654663
The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.
Magna, Melinda; Pisetsky, David S
2016-05-01
The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.
Molecular Determinants of Magnolol Targeting Both RXRα and PPARγ
Chen, Lili; Chen, Jing; Hu, Lihong; Jiang, Hualiang; Shen, Xu
2011-01-01
Nuclear receptors retinoic X receptor α (RXRα) and peroxisome proliferator activated receptor γ (PPARγ) function potently in metabolic diseases, and are both important targets for anti-diabetic drugs. Coactivation of RXRα and PPARγ is believed to synergize their effects on glucose and lipid metabolism. Here we identify the natural product magnolol as a dual agonist targeting both RXRα and PPARγ. Magnolol was previously reported to enhance adipocyte differentiation and glucose uptake, ameliorate blood glucose level and prevent development of diabetic nephropathy. Although magnolol can bind and activate both of these two nuclear receptors, the transactivation assays indicate that magnolol exhibits biased agonism on the transcription of PPAR-response element (PPRE) mediated by RXRα:PPARγ heterodimer, instead of RXR-response element (RXRE) mediated by RXRα:RXRα homodimer. To further elucidate the molecular basis for magnolol agonism, we determine both the co-crystal structures of RXRα and PPARγ ligand-binding domains (LBDs) with magnolol. Structural analyses reveal that magnolol adopts its two 5-allyl-2-hydroxyphenyl moieties occupying the acidic and hydrophobic cavities of RXRα L-shaped ligand-binding pocket, respectively. While, two magnolol molecules cooperatively accommodate into PPARγ Y-shaped ligand-binding pocket. Based on these two complex structures, the key interactions for magnolol activating RXRα and PPARγ are determined. As the first report on the dual agonist targeting RXRα and PPARγ with receptor-ligand complex structures, our results are thus expected to help inspect the potential pharmacological mechanism for magnolol functions, and supply useful hits for nuclear receptor multi-target ligand design. PMID:22140563
[GPCRs heterodimerization: a new way towards the discovery of function for the orphan receptors?].
Levoye, Angélique; Jockers, Ralf
2007-01-01
G protein-coupled receptors (GPCRs), also called seven transmembrane domain (7TM) proteins, represent the largest family of cell surface receptors. GPCRs control a variety of physiological processes, are involved in multiple diseases and are major drug targets. Despite a vast effort of academic and industrial research, more than one hundred receptors remain orphans. These orphan GPCRs offer a great potential for drug discovery, as almost 60% of currently prescribed drugs target GPCRs. Deorphenization strategies have concentrated mainly on the identification of the natural ligands of these proteins. Recent advances have shown that orphan GPCRs, similar to orphan nuclear receptors, can regulate the function of non-orphan receptors by heterodimerization. These findings not only help to better understand the extraordinary diversity of GPCRs, but also open new perspectives for the identification of the function of these orphan receptors that hold great therapeutic potential.
Savic, Daniel; Ramaker, Ryne C; Roberts, Brian S; Dean, Emma C; Burwell, Todd C; Meadows, Sarah K; Cooper, Sara J; Garabedian, Michael J; Gertz, Jason; Myers, Richard M
2016-07-11
The liver X receptors (LXRs, NR1H2 and NR1H3) and peroxisome proliferator-activated receptor gamma (PPARG, NR1C3) nuclear receptor transcription factors (TFs) are master regulators of energy homeostasis. Intriguingly, recent studies suggest that these metabolic regulators also impact tumor cell proliferation. However, a comprehensive temporal molecular characterization of the LXR and PPARG gene regulatory responses in tumor cells is still lacking. To better define the underlying molecular processes governing the genetic control of cellular growth in response to extracellular metabolic signals, we performed a comprehensive, genome-wide characterization of the temporal regulatory cascades mediated by LXR and PPARG signaling in HT29 colorectal cancer cells. For this analysis, we applied a multi-tiered approach that incorporated cellular phenotypic assays, gene expression profiles, chromatin state dynamics, and nuclear receptor binding patterns. Our results illustrate that the activation of both nuclear receptors inhibited cell proliferation and further decreased glutathione levels, consistent with increased cellular oxidative stress. Despite a common metabolic reprogramming, the gene regulatory network programs initiated by these nuclear receptors were widely distinct. PPARG generated a rapid and short-term response while maintaining a gene activator role. By contrast, LXR signaling was prolonged, with initial, predominantly activating functions that transitioned to repressive gene regulatory activities at late time points. Through the use of a multi-tiered strategy that integrated various genomic datasets, our data illustrate that distinct gene regulatory programs elicit common phenotypic effects, highlighting the complexity of the genome. These results further provide a detailed molecular map of metabolic reprogramming in cancer cells through LXR and PPARG activation. As ligand-inducible TFs, these nuclear receptors can potentially serve as attractive therapeutic targets for the treatment of various cancers.
Retinoids induce integrin-independent lymphocyte adhesion through RAR-α nuclear receptor activity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whelan, Jarrett T.; Wang, Lei; Chen, Jianming
2014-11-28
Highlights: • Transcription and translation are required for retinoid-induced lymphocyte adhesion. • RAR activation is sufficient to induced lymphocyte cell adhesion. • Vitamin D derivatives inhibit RAR-prompted lymphocyte adhesion. • Adhesion occurs through a novel binding site within ADAM disintegrin domains. • RARα is a key nuclear receptor for retinoid-dependent lymphocyte cell adhesion. - Abstract: Oxidative metabolites of vitamin A, in particular all-trans-retinoic acid (atRA), have emerged as key factors in immunity by specifying the localization of immune cells to the gut. Although it is appreciated that isomers of retinoic acid activate the retinoic acid receptor (RAR) and retinoid Xmore » receptor (RXR) family of nuclear receptors to elicit cellular changes, the molecular details of retinoic acid action remain poorly defined in immune processes. Here we employ a battery of agonists and antagonists to delineate the specific nuclear receptors utilized by retinoids to evoke lymphocyte cell adhesion to ADAM (adisintegrin and metalloprotease) protein family members. We report that RAR agonism is sufficient to promote immune cell adhesion in both immortal and primary immune cells. Interestingly, adhesion occurs independent of integrin function, and mutant studies demonstrate that atRA-induced adhesion to ADAM members required a distinct binding interface(s) as compared to integrin recognition. Anti-inflammatory corticosteroids as well as 1,25-(OH){sub 2}D{sub 3}, a vitamin D metabolite that prompts immune cell trafficking to the skin, potently inhibited the observed adhesion. Finally, our data establish that induced adhesion was specifically attributable to the RAR-α receptor isotype. The current study provides novel molecular resolution as to which nuclear receptors transduce retinoid exposure into immune cell adhesion.« less
Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail
2017-01-01
Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724
Smith, Aaron G; Muscat, George E O
2005-10-01
Skeletal muscle is a major mass peripheral tissue that accounts for approximately 40% of the total body mass and a major player in energy balance. It accounts for >30% of energy expenditure, is the primary tissue of insulin stimulated glucose uptake, disposal, and storage. Furthermore, it influences metabolism via modulation of circulating and stored lipid (and cholesterol) flux. Lipid catabolism supplies up to 70% of the energy requirements for resting muscle. However, initial aerobic exercise utilizes stored muscle glycogen but as exercise continues, glucose and stored muscle triglycerides become important energy substrates. Endurance exercise increasingly depends on fatty acid oxidation (and lipid mobilization from other tissues). This underscores the importance of lipid and glucose utilization as an energy source in muscle. Consequently skeletal muscle has a significant role in insulin sensitivity, the blood lipid profile, and obesity. Moreover, caloric excess, obesity and physical inactivity lead to skeletal muscle insulin resistance, a risk factor for the development of type II diabetes. In this context skeletal muscle is an important therapeutic target in the battle against cardiovascular disease, the worlds most serious public health threat. Major risk factors for cardiovascular disease include dyslipidemia, hypertension, obesity, sedentary lifestyle, and diabetes. These risk factors are directly influenced by diet, metabolism and physical activity. Metabolism is largely regulated by nuclear hormone receptors which function as hormone regulated transcription factors that bind DNA and mediate the patho-physiological regulation of gene expression. Metabolism and activity, which directly influence cardiovascular disease risk factors, are primarily driven by skeletal muscle. Recently, many nuclear receptors expressed in skeletal muscle have been shown to improve glucose tolerance, insulin resistance, and dyslipidemia. Skeletal muscle and nuclear receptors are rapidly emerging as critical targets in the battle against cardiovascular disease risk factors. Understanding the function of nuclear receptors in skeletal muscle has enormous pharmacological utility for the treatment of cardiovascular disease. This review focuses on the molecular regulation of metabolism by nuclear receptors in skeletal muscle in the context of dyslipidemia and cardiovascular disease.
Nuclear receptors and pathogenesis of pancreatic cancer
Polvani, Simone; Tarocchi, Mirko; Tempesti, Sara; Galli, Andrea
2014-01-01
Pancreatic ductal adenocarcinoma (PDAC) is a devastating disease with a median overall survival time of 5 mo and the five years survival less than 5%, a rate essentially unchanged over the course of the years. A well defined progression model of accumulation of genetic alterations ranging from single point mutations to gross chromosomal abnormalities has been introduced to describe the origin of this disease. However, due to the its subtle nature and concurring events PDAC cure remains elusive. Nuclear receptors (NR) are members of a large superfamily of evolutionarily conserved ligand-regulated DNA-binding transcription factors functionally involved in important cellular functions ranging from regulation of metabolism, to growth and development. Given the nature of their ligands, NR are very tempting drug targets and their pharmacological modulation has been widely exploited for the treatment of metabolic and inflammatory diseases. There are now clear evidences that both classical ligand-activated and orphan NR are involved in the pathogenesis of PDAC from its very early stages; nonetheless many aspects of their role are not fully understood. The purpose of this review is to highlight the striking connections that link peroxisome proliferator activated receptors, retinoic acid receptors, retinoid X receptor, androgen receptor, estrogen receptors and the orphan NR Nur, chicken ovalbumin upstream promoter transcription factor II and the liver receptor homologue-1 receptor to PDAC development, connections that could lead to the identification of novel therapies for this disease. PMID:25232244
Insulin-like growth factor binding protein-3 (IGFBP-3): Novel ligands mediate unexpected functions.
Baxter, Robert C
2013-08-01
In addition to its important role in the regulation of somatic growth by acting as the major circulating transport protein for the insulin-like growth factors (IGFs), IGF binding protein-3 (IGFBP-3) has a variety of intracellular ligands that point to its function within major signaling pathways. The discovery of its interaction with the retinoid X receptor has led to the elucidation of roles in regulating the function of several nuclear hormone receptors including retinoic acid receptor-α, Nur77 and vitamin D receptor. Its interaction with the nuclear hormone receptor peroxisome proliferator-activated receptor-γ is believed to be involved in regulating adipocyte differentiation, which is also modulated by IGFBP-3 through an interaction with TGFβ/Smad signaling. IGFBP-3 can induce apoptosis alone or in conjunction with other agents, and in different systems can activate caspases -8 and -9. At least two unrelated proteins (LRP1 and TMEM219) have been designated as receptors for IGFBP-3, the latter with a demonstrated role in inducing caspase-8-dependent apoptosis. In contrast, IGFBP-3 also has demonstrated roles in survival-related functions, including the repair of DNA double-strand breaks through interaction with the epidermal growth factor receptor and DNA-dependent protein kinase, and the induction of autophagy through interaction with GRP78. The ability of IGFBP-3 to modulate the balance between pro-apoptotic and pro-survival sphingolipids by regulating sphingosine kinase 1 and sphingomyelinases may be integral to its role at the crossroads between cell death and survival in response to a variety of stimuli. The pleiotropic nature of IGFBP-3 activity supports the idea that IGFBP-3 itself, or pathways with which it interacts, should be investigated as targets of therapy for a variety of diseases.
A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects.
Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L; Busby, Scott A; Griffin, Patrick R; Pathak, Manish C; Ortlund, Eric A; Moore, David D
2011-05-25
Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine (DLPC)) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver-specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signalling pathway that regulates bile acid metabolism and glucose homeostasis.
Nayebosadri, Arman; Ji, Julie Y
2013-08-01
The lamina serves to maintain the nuclear structure and stiffness while acting as a scaffold for heterochromatin and many transcriptional proteins. Its role in endothelial mechanotransduction, specifically how nuclear mechanics impact gene regulation under shear stress, is not fully understood. In this study, we successfully silenced lamin A/C in bovine aortic endothelial cells to determine its role in both glucocorticoid receptor (GR) nuclear translocation and glucocorticoid response element (GRE) transcriptional activation in response to dexamethasone and shear stress. Nuclear translocation of GR, an anti-inflammatory nuclear receptor, in response to dexamethasone or shear stress (5, 10, and 25 dyn/cm(2)) was observed via time-lapse cell imaging and quantified using a Bayesian image analysis algorithm. Transcriptional activity of the GRE promoter was assessed using a dual-luciferase reporter plasmid. We found no dependence on nuclear lamina for GR translocation from the cytoplasm into the nucleus. However, the absence of lamin A/C led to significantly increased expression of luciferase under dexamethasone and shear stress induction as well as changes in histone protein function. PCR results for NF-κB inhibitor alpha (NF-κBIA) and dual specificity phosphatase 1 (DUSP1) genes further supported our luciferase data with increased expression in the absence of lamin. Our results suggest that absence of lamin A/C does not hinder passage of GR into the nucleus, but nuclear lamina is important to properly regulate GRE transcription. Nuclear lamina, rather than histone deacetylase (HDAC), is a more significant mediator of shear stress-induced transcriptional activity, while dexamethasone-initiated transcription is more HDAC dependent. Our findings provide more insights into the molecular pathways involved in nuclear mechanotransduction.
Nayebosadri, Arman
2013-01-01
The lamina serves to maintain the nuclear structure and stiffness while acting as a scaffold for heterochromatin and many transcriptional proteins. Its role in endothelial mechanotransduction, specifically how nuclear mechanics impact gene regulation under shear stress, is not fully understood. In this study, we successfully silenced lamin A/C in bovine aortic endothelial cells to determine its role in both glucocorticoid receptor (GR) nuclear translocation and glucocorticoid response element (GRE) transcriptional activation in response to dexamethasone and shear stress. Nuclear translocation of GR, an anti-inflammatory nuclear receptor, in response to dexamethasone or shear stress (5, 10, and 25 dyn/cm2) was observed via time-lapse cell imaging and quantified using a Bayesian image analysis algorithm. Transcriptional activity of the GRE promoter was assessed using a dual-luciferase reporter plasmid. We found no dependence on nuclear lamina for GR translocation from the cytoplasm into the nucleus. However, the absence of lamin A/C led to significantly increased expression of luciferase under dexamethasone and shear stress induction as well as changes in histone protein function. PCR results for NF-κB inhibitor alpha (NF-κBIA) and dual specificity phosphatase 1 (DUSP1) genes further supported our luciferase data with increased expression in the absence of lamin. Our results suggest that absence of lamin A/C does not hinder passage of GR into the nucleus, but nuclear lamina is important to properly regulate GRE transcription. Nuclear lamina, rather than histone deacetylase (HDAC), is a more significant mediator of shear stress-induced transcriptional activity, while dexamethasone-initiated transcription is more HDAC dependent. Our findings provide more insights into the molecular pathways involved in nuclear mechanotransduction. PMID:23703529
Bain, Peter A; Kumar, Anu
2018-05-01
The widespread use of hydraulic fracturing (HF) in oil and gas extraction operations has led to concern over environmental risks posed by chemicals used in HF fluids. Here we employed a suite of stable luciferase reporter gene assays to investigate the potential for selected HF chemicals or geogenics to activate or antagonise nuclear receptor signalling. We screened three biocides (bronopol [BP], glutaraldehyde [GA], and tetrakis(hydroxymethyl)phosphonium sulfate [THPS]), a surfactant (2-butoxyethanol), a friction reducer (polyacrylamide), and a coal seam geogenic (o-cresol) for their potential to act as agonists or antagonists of the estrogen receptor, androgen receptor, progesterone receptor (PR), glucocorticoid receptor or peroxisome proliferator-activated receptor gamma (PPARγ). None of the chemicals induced luciferase activity in any of assays used in the study. In antagonistic mode, BP, GA and THPS caused reductions in luciferase activity in the reporter assays at higher concentrations (50-100 μM), while at low concentrations (2-10 μM) GA and THPS enhanced luciferase activity in some assays relative to controls. None of the other tested chemicals exhibited antagonism in the selected assays. In most cases, altered receptor signalling only occurred at concentrations exhibiting cytotoxicity. However, PPARγ activity, and to a lesser extent PR activity, were inhibited by THPS at sub-cytotoxic concentrations. The majority of binary combinations tested exhibited significantly less-than-additive cytotoxicity, and none of the combinations exhibited synergistic cytotoxicity. In summary, the results of the present study indicate that the selected chemicals are not likely to function as direct agonists of the nuclear receptors tested, and only one chemical, THPS was an apparent partial antagonist of two nuclear receptors. Copyright © 2017. Published by Elsevier Ltd.
Douglas, Steven D.; Leeman, Susan E.
2010-01-01
The G-protein coupled receptor (GPCR), Neurokinin-1 Receptor (NK1R), and its preferred ligand, substance P (SP), are reviewed in relationship to the immune system and selected infections. NK1R and substance P are ubiquitous throughout the animal kingdom. This important pathway has unique functions in numerous cells and tissues. The interaction of SP with its preferred receptor, NK1R, leads to the activation of nuclear factor-kappa-b (NF-κb) and proinflammatory cytokines. NK1R has two isoforms, both a full-length and a truncated form. These isoforms have different functional significances and differ in cell signaling capability. The proinflammatory signals modulated by substance P are important in bacterial, viral, fungal, and parasitic diseases, as well as in immune system function. The SP-NK1R system is a major Class 1, rhodopsin-like GPCR ligand-receptor interaction. PMID:21091716
Giner, Xavier C; Cotnoir-White, David; Mader, Sylvie; Lévesque, Daniel
2017-01-01
Retinoid X receptors (RXR) play a role as master regulators due to their capacity to form heterodimers with other nuclear receptors. Accordingly, retinoid signaling is involved in multiple biological processes, including development, cell differentiation, metabolism and cell death. However, the role and functions of RXR in different heterodimer complexes remain unsolved, mainly because most RXR drugs (called rexinoids) are not selective to specific heterodimer complexes. This also strongly limits the use of rexinoids for specific therapeutic approaches. In order to better characterize rexinoids at specific nuclear receptor complexes, we have developed and optimized luciferase protein complementation-based Bioluminescence Resonance Energy Transfer (BRET) assays, which can directly measure recruitment of a co-activator motif fused to yellow fluorescent protein (YFP) by specific nuclear receptor dimers. To validate the assays, we compared rexinoid modulation of co-activator recruitment by RXR homodimer, and heterodimers Nur77/RXR and Nurr1/RXR. Results reveal that some rexinoids display selective co-activator recruitment activities with homo- or hetero-dimer complexes. In particular, SR11237 (BMS649) has increased potency for recruitment of co-activator motif and transcriptional activity with the Nur77/RXR heterodimer compared to other complexes. This technology should prove useful to identify new compounds with specificity for individual dimeric species formed by nuclear receptors. PMID:26148973
Structural basis for corepressor assembly by the orphan nuclear receptor TLX.
Zhi, Xiaoyong; Zhou, X Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten; Xu, H Eric
2015-02-15
The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX-Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. © 2015 Zhi et al.; Published by Cold Spring Harbor Laboratory Press.
Redfern, Andrew D.; Colley, Shane M.; Beveridge, Dianne J.; Ikeda, Naoya; Epis, Michael R.; Li, Xia; Foulds, Charles E.; Stuart, Lisa M.; Barker, Andrew; Russell, Victoria J.; Ramsay, Kerry; Kobelke, Simon J.; Li, Xiaotao; Hatchell, Esme C.; Payne, Christine; Giles, Keith M.; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B.; O’Malley, Bert W.; Leedman, Peter J.
2013-01-01
The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing. PMID:23550157
Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J
2013-04-16
The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.
The NR3B subgroup: an ovERRview
Tremblay, Annie M.; Giguère, Vincent
2007-01-01
Members of the NR3B group of the nuclear receptor superfamily, known as the estrogen-related receptors (ERRs), were the first orphan receptors to be identified two decades ago. Despite the fact that a natural ligand has yet to be associated with the ERRs, considerable knowledge about their mode of action and biological functions has emerged through extensive biochemical, genetic and functional genomics studies. This review describes our current understanding of how the ERRs work as transcription factors and as such, how they control diverse developmental and physiological programs. PMID:18174917
Allosteric Pathways in the PPARγ-RXRα nuclear receptor complex
NASA Astrophysics Data System (ADS)
Ricci, Clarisse G.; Silveira, Rodrigo L.; Rivalta, Ivan; Batista, Victor S.; Skaf, Munir S.
2016-01-01
Understanding the nature of allostery in DNA-nuclear receptor (NR) complexes is of fundamental importance for drug development since NRs regulate the transcription of a myriad of genes in humans and other metazoans. Here, we investigate allostery in the peroxisome proliferator-activated/retinoid X receptor heterodimer. This important NR complex is a target for antidiabetic drugs since it binds to DNA and functions as a transcription factor essential for insulin sensitization and lipid metabolism. We find evidence of interdependent motions of Ω-loops and PPARγ-DNA binding domain with contacts susceptible to conformational changes and mutations, critical for regulating transcriptional functions in response to sequence-dependent DNA dynamics. Statistical network analysis of the correlated motions, observed in molecular dynamics simulations, shows preferential allosteric pathways with convergence centers comprised of polar amino acid residues. These findings are particularly relevant for the design of allosteric modulators of ligand-dependent transcription factors.
Guo, Xinyue; Li, Weihong; Ma, Minghui; Lu, Xin; Zhang, Haiyan
2017-11-01
The extracellular matrix (ECM) microenvironment is involved in the regulation of hepatocyte phenotype and function. Recently, the cell-derived extracellular matrix has been proposed to represent the bioactive and biocompatible materials of the native ECM. Here, we show that the endothelial cell-derived matrix (EC matrix) promotes the metabolic maturation of human adipose stem cell-derived hepatocyte-like cells (hASC-HLCs) through the activation of the transcription factor forkhead box protein A2 (FOXA2) and the nuclear receptors hepatocyte nuclear factor 4 alpha (HNF4α) and pregnane X receptor (PXR). Reducing the fibronectin content in the EC matrix or silencing the expression of α5 integrin in the hASC-HLCs inhibited the effect of the EC matrix on Src phosphorylation and hepatocyte maturation. The inhibition of Src phosphorylation using the inhibitor PP2 or silencing the expression of Src in hASC-HLCs also attenuated the up-regulation of the metabolic function of hASC-HLCs in a nuclear receptor-dependent manner. These data elucidate integrin-Src signalling linking the extrinsic EC matrix signals and metabolic functional maturation of hepatocyte. This study provides a model for studying the interaction between hepatocytes and non-parenchymal cell-derived matrix. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Liver receptor homolog-1 is a critical determinant of methyl-pool metabolism
USDA-ARS?s Scientific Manuscript database
Balance of labile methyl groups (choline, methionine, betaine, and folate) is important for normal liver function. Quantitatively, a significant use of labile methyl groups is in the production of phosphatidylcholines (PCs), which are ligands for the nuclear liver receptor homolog-1 (LRH-1). We stud...
The nuclear receptor PPARγ individually responds to serotonin- and fatty acid-metabolites
Waku, Tsuyoshi; Shiraki, Takuma; Oyama, Takuji; Maebara, Kanako; Nakamori, Rinna; Morikawa, Kosuke
2010-01-01
The nuclear receptor, peroxisome proliferator-activated receptor γ (PPARγ), recognizes various synthetic and endogenous ligands by the ligand-binding domain. Fatty-acid metabolites reportedly activate PPARγ through conformational changes of the Ω loop. Here, we report that serotonin metabolites act as endogenous agonists for PPARγ to regulate macrophage function and adipogenesis by directly binding to helix H12. A cyclooxygenase inhibitor, indomethacin, is a mimetic agonist of these metabolites. Crystallographic analyses revealed that an indole acetate functions as a common moiety for the recognition by the sub-pocket near helix H12. Intriguingly, a serotonin metabolite and a fatty-acid metabolite each bind to distinct sub-pockets, and the PPARγ antagonist, T0070907, blocked the fatty-acid agonism, but not that of the serotonin metabolites. Mutational analyses on receptor-mediated transcription and coactivator binding revealed that each metabolite individually uses coregulator and/or heterodimer interfaces in a ligand-type-specific manner. Furthermore, the inhibition of the serotonin metabolism reduced the expression of the endogenous PPARγ-target gene. Collectively, these results suggest a novel agonism, in which PPARγ functions as a multiple sensor in response to distinct metabolites. PMID:20717101
Weiss, Roy E; Gehin, Martine; Xu, Jianming; Sadow, Peter M; O'Malley, Bert W; Chambon, Pierre; Refetoff, Samuel
2002-04-01
Steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)-2 are homologous nuclear receptor coactivators. We have investigated their possible redundancy as thyroid hormone (TH) coactivators by measuring thyroid function in compound SRC-1 and TIF-2 knock out (KO) mice. Whereas SRC-1 KO (SRC-1(-/-)) mice are resistant to TH and SRC-1(+/-) are not, we now demonstrate that TIF-2 KO (TIF-2(-/-)) mice have normal thyroid function. Yet double heterozygous, SRC-1(+/-)/TIF-2(+/-) mice manifested resistance to TH of a similar degree as that in mice completely deficient in SRC-1. KO of both SRC-1 and TIF-2 resulted in marked increases of serum TH and thyrotropin concentrations. This work demonstrates gene dosage effect in nuclear coactivators manifesting as haploinsufficiency and functional redundancy of SRC-1 and TIF-2.
Molenda-Figueira, Heather A.; Williams, Casey A.; Griffin, Andreana L.; Rutledge, Eric M.; Blaustein, Jeffrey D.; Tetel, Marc J.
2008-01-01
The ovarian hormones, estradiol (E) and progesterone (P) facilitate the expression of sexual behavior in female rats. E and P mediate many of these behavioral effects by binding to their respective intracellular receptors in specific brain regions. Nuclear receptor coactivators, including Steroid Receptor Coactivator-1 (SRC-1) and CREB Binding Protein (CBP), dramatically enhance ligand-dependent steroid receptor transcriptional activity in vitro. Previously, our lab has shown that SRC-1 and CBP modulate estrogen receptor (ER)-mediated induction of progestin receptor (PR) gene expression in the ventromedial nucleus of the hypothalamus (VMN) and hormone-dependent sexual receptivity in female rats. Female sexual behaviors can be activated by high doses of E alone in ovariectomized rats, and thus are believed to be ER-dependent. However, the full repertoire of female sexual behavior, in particular, proceptive behaviors such as hopping, darting and ear wiggling, are considered to be PR-dependent. In the present experiments, the function of SRC-1 and CBP in distinct ER- (Exp. 1) and PR- (Exp. 2) dependent aspects of female sexual behavior was investigated. In Exp. 1, infusion of antisense oligodeoxynucleotides to SRC-1 and CBP mRNA into the VMN decreased lordosis intensity in rats treated with E alone, suggesting that these coactivators modulate ER-mediated female sexual behavior. In Exp. 2, antisense to SRC-1 and CBP mRNA around the time of P administration reduced PR-dependent ear wiggling and hopping and darting. Taken together, these data suggest that SRC-1 and CBP modulate ER and PR action in brain and influence distinct aspects of hormone-dependent sexual behaviors. These findings support our previous studies and provide further evidence that SRC-1 and CBP function together to regulate ovarian hormone action in behaviorally-relevant brain regions. PMID:16769066
Targeting Nuclear Receptors with Marine Natural Products
Yang, Chunyan; Li, Qianrong; Li, Yong
2014-01-01
Nuclear receptors (NRs) are important pharmaceutical targets because they are key regulators of many metabolic and inflammatory diseases, including diabetes, dyslipidemia, cirrhosis, and fibrosis. As ligands play a pivotal role in modulating nuclear receptor activity, the discovery of novel ligands for nuclear receptors represents an interesting and promising therapeutic approach. The search for novel NR agonists and antagonists with enhanced selectivities prompted the exploration of the extraordinary chemical diversity associated with natural products. Recent studies involving nuclear receptors have disclosed a number of natural products as nuclear receptor ligands, serving to re-emphasize the translational possibilities of natural products in drug discovery. In this review, the natural ligands of nuclear receptors will be described with an emphasis on their mechanisms of action and their therapeutic potentials, as well as on strategies to determine potential marine natural products as nuclear receptor modulators. PMID:24473166
Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F
1995-04-01
The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.
[Nutrigenomics--bioactive dietary components].
Gętek, Monika; Czech, Natalia; Fizia, Katarzyna; Białek-Dratwa, Agnieszka; Muc-Wierzgoń, Małgorzata; Kokot, Teresa; Nowakowska-Zajdel, Ewa
2013-04-05
Nutrigenomics analyzes relations between diet and genes, and identifies mechanisms in which food and nutrition affect health and lifestyles and noncommunicable diseases (R. Chadwick, 2004). Bioactive dietary components are signal molecules that carry information from the external environment and affect in terms of quantity and quality in the process of gene expression. The biological effect of bioactive dietary components depends on various of physiological processes that can occur within a few genes. Polymorphism of genes can change their function and physiological response of the body for nutrients. Bioactive dietary components work on at least two levels of the expression of genes as factors regulating chromatin structure and as factors directly regulate the activity of nuclear receptors. The processes of synthesis and DNA repair are regulated by some of vitamins, macro-and micro-elements. They provide, among others, cofactors of enzymes that catalyze the replication of DNA methylation and its repair. DNA methylation profile may change under the influence of diet, single nucleotide polymorphisms and environmental factors. Bioactive dietary components may directly affect the process of gene expression by acting as ligands for nuclear receptors. Sensitive to dietary group of nuclear receptors are sensory receptors. This group includes, among others receptor PPAR (peroxisome proliferator activated), responsible for energy metabolism and receptors LXR (liver X receptor), FXR (farnesoid X receptor) and RXR, which is responsible for the metabolism of cholesterol.
Membrane estrogen receptors - is it an alternative way of estrogen action?
Soltysik, K; Czekaj, P
2013-04-01
The functions of estrogens are relatively well known, however the molecular mechanism of their action is not clear. The classical pathway of estrogen action is dependent on ERα and ERβ which act as transcription factors. The effects of this pathway occur within hours or days. In addition, so-called, non-classical mechanism of steroid action dependent on membrane estrogen receptors (mER) was described. In this mechanism the effects of estrogen action are observed in a much shorter time. Here we review the structure and cellular localization of mER, molecular basis of non-classical mER action, physiological role of mER as well as implications of mER action for cancer biology. Finally, some concerns about the new estrogen receptor - GPER and candidates for estrogen receptors - ER-X and ERx, are briefly discussed. It seems that mER is a complex containing signal proteins (signalosome), as IGF receptor, EGF receptor, Ras protein, adaptor protein Shc, non-receptor kinase c-Src and PI-3K, what rationalizes production of second messengers. Some features of membrane receptors are almost identical if compared to nuclear receptors. Probably, membrane and nuclear estrogen receptors are not separate units, but rather the components of a complex mechanism in which they both cooperate with each other. We conclude that the image of the estrogen receptor as a simple transcription factor is a far-reaching simplification. A better understanding of the mechanisms of estrogen action will help us to design more effective drugs affecting signal pathways depending on both membrane and nuclear receptors.
The emerging roles of orphan nuclear receptors in prostate cancer.
Wu, Dinglan; Cheung, Alyson; Wang, Yuliang; Yu, Shan; Chan, Franky L
2016-08-01
Orphan nuclear receptors are members of the nuclear receptor (NR) superfamily and are so named because their endogenous physiological ligands are either unknown or may not exist. Because of their important regulatory roles in many key physiological processes, dysregulation of signalings controlled by these receptors is associated with many diseases including cancer. Over years, studies of orphan NRs have become an area of great interest because their specific physiological and pathological roles have not been well-defined, and some of them are promising drug targets for diseases. The recently identified synthetic small molecule ligands, acting as agonists or antagonists, to these orphan NRs not only help to understand better their functional roles but also highlight that the signalings mediated by these ligand-independent NRs in diseases could be therapeutically intervened. This review is a summary of the recent advances in elucidating the emerging functional roles of orphan NRs in cancers, especially prostate cancer. In particular, some orphan NRs, RORγ, TR2, TR4, COUP-IFII, ERRα, DAX1 and SHP, exhibit crosstalk or interference with androgen receptor (AR) signaling in either normal or malignant prostatic cells, highlighting their involvement in prostate cancer progression as androgen and AR signaling pathway play critical roles in this process. We also propose that a better understanding of the mechanism of actions of these orphan NRs in prostate gland or prostate cancer could help to evaluate their potential value as therapeutic targets for prostate cancer. Copyright © 2016 Elsevier B.V. All rights reserved.
Antidiabetic actions of a phosphatidylcholine ligand for nuclear receptor LRH-1
Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L.; Busby, Scott A.; Griffin, Patrick R.; Pathak, Manish C.; Ortlund, Eric A.; Moore, David D.
2011-01-01
Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (NR5A2) regulates bile acid biosynthesis1,2. Structural studies have identified phospholipids as potential LRH-1 ligands3–5, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine, DLPC) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signaling pathway that regulates bile acid metabolism and glucose homeostasis. PMID:21614002
2002-01-01
the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N
Sierralta, W D; Thole, H H
1996-05-01
The unmasking of estradiol receptor in paraffin sections of Bouin's-fixed uterine tissue from ovariectomized gilts was attained with microwave treatment. Immunocytochemistry of the receptor was performed using a polyclonal or five monoclonal antibodies, two of which are commercially available, reacting with different domains of the protein and an amplified-peroxidase system for detection. With five of the antibodies, a predominance of nuclear staining was observed in cells of endometrial glands, while one monoclonal antibody (13H2), reacting with the receptor's domain E, showed a preference for the cytoplasmic receptor. In stroma, all antibodies detected more receptor in nuclei than in cytoplasm. In epithelium, the commercially available antibody H222, our monoclonals 13H2 and HT65, and the polyclonal antibody 402 demonstrated more receptor in cytoplasmic than in nuclear areas. In myometrium, the nuclei from longitudinal and ring muscles were definitely stained with the antibodies. We conclude that the accessibilities of the antibody epitopes of the receptor differ according to the functional uterine cell type.
Guo, Dongsheng; Sarkar, Joy; Ahmed, Mohamed R; Viswakarma, Navin; Jia, Yuzhi; Yu, Songtao; Sambasiva Rao, M; Reddy, Janardan K
2006-08-25
The constitutive androstane receptor (CAR) regulates transcription of phenobarbital-inducible genes that encode xenobiotic-metabolizing enzymes in liver. CAR is localized to the hepatocyte cytoplasm but to be functional, it translocates into the nucleus in the presence of phenobarbital-like CAR ligands. We now demonstrate that adenovirally driven EGFP-CAR, as expected, translocates into the nucleus of normal wild-type hepatocytes following phenobarbital treatment under both in vivo and in vitro conditions. Using this approach we investigated the role of transcription coactivators PBP and PRIP in the translocation of EGFP-CAR into the nucleus of PBP and PRIP liver conditional null mouse hepatocytes. We show that coactivator PBP is essential for nuclear translocation of CAR but not PRIP. Adenoviral expression of both PBP and EGFP-CAR restored phenobarbital-mediated nuclear translocation of exogenously expressed CAR in PBP null livers in vivo and in PBP null primary hepatocytes in vitro. CAR translocation into the nucleus of PRIP null livers resulted in the induction of CAR target genes such as CYP2B10, necessary for the conversion of acetaminophen to its hepatotoxic intermediate metabolite, N-acetyl-p-benzoquinone imine. As a consequence, PRIP-deficiency in liver did not protect from acetaminophen-induced hepatic necrosis, unlike that exerted by PBP deficiency. These results establish that transcription coactivator PBP plays a pivotal role in nuclear localization of CAR, that it is likely that PBP either enhances nuclear import or nuclear retention of CAR in hepatocytes, and that PRIP is redundant for CAR function.
Yuk, Jae-Min; Kim, Tae Sung; Kim, Soo Yeon; Lee, Hye-Mi; Han, Jeongsu; Dufour, Catherine Rosa; Kim, Jin Kyung; Jin, Hyo Sun; Yang, Chul-Su; Park, Ki-Sun; Lee, Chul-Ho; Kim, Jin-Man; Kweon, Gi Ryang; Choi, Hueng-Sik; Vanacker, Jean-Marc; Moore, David D; Giguère, Vincent; Jo, Eun-Kyeong
2015-07-21
The orphan nuclear receptor estrogen-related receptor α (ERRα; NR3B1) is a key metabolic regulator, but its function in regulating inflammation remains largely unknown. Here, we demonstrate that ERRα negatively regulates Toll-like receptor (TLR)-induced inflammation by promoting Tnfaip3 transcription and fine-tuning of metabolic reprogramming in macrophages. ERRα-deficient (Esrra(-/-)) mice showed increased susceptibility to endotoxin-induced septic shock, leading to more severe pro-inflammatory responses than control mice. ERRα regulated macrophage inflammatory responses by directly binding the promoter region of Tnfaip3, a deubiquitinating enzyme in TLR signaling. In addition, Esrra(-/-) macrophages showed an increased glycolysis, but impaired mitochondrial respiratory function and biogenesis. Further, ERRα was required for the regulation of NF-κB signaling by controlling p65 acetylation via maintenance of NAD(+) levels and sirtuin 1 activation. These findings unravel a previously unappreciated role for ERRα as a negative regulator of TLR-induced inflammatory responses through inducing Tnfaip3 transcription and controlling the metabolic reprogramming. Copyright © 2015 Elsevier Inc. All rights reserved.
Bajenova, Olga; Stolper, Eugenia; Gapon, Svetlana; Sundina, Natalia; Zimmer, Regis; Thomas, Peter
2003-11-15
Elevated concentrations of carcinoembryonic antigen (CEA) in the blood are associated with the development of hepatic metastases from colorectal cancers. Clearance of circulating CEA occurs through endocytosis by liver macrophages, Kupffer cells. Previously we identified heterogeneous nuclear ribonucleoproteins M4 (hnRNP M4) as a receptor (CEAR) for CEA. HnRNP M4 has two isoform proteins (p80, p76), the full-length hnRNP M4 (CEARL) and a truncated form (CEARS) with a deletion of 39 amino acids between RNA binding domains 1 and 2, generated by alternative splicing. The present study was undertaken to clarify any isoform-specific differences in terms of their function as CEA receptor and localization. We develop anti-CEAR isoform-specific antibodies and show that both CEAR splicing isoforms are expressed on the surface of Kupffer cells and can function as CEA receptor. Alternatively, in P388D1 macrophages CEARS protein has nuclear and CEARL has cytoplasmic localization. In MIP101 colon cancer and HeLa cells the CEARS protein is localized to the nucleus and CEARL to the cytoplasm. These findings imply that different functions are assigned to CEAR isoforms depending on the cell type. The search of 39 amino acids deleted region against the Prosite data base revealed the presence of N-myristylation signal PGGPGMITIP that may be involved in protein targeting to the plasma membrane. Overall, this report demonstrates that the cellular distribution, level of expression, and relative amount of CEARL and CEARS isoforms determine specificity for CEA binding and the expression of alternative spliced forms of CEAR is regulated in a tissue-specific manner.
Atypical nuclear localization of VIP receptors in glioma cell lines and patients
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barbarin, Alice; Séité, Paule; Godet, Julie
Highlights: • The VIP receptor VPAC1 contains a putative NLS signal. • VPAC1 is predominantly nuclear in GBM cell lines but not VPAC2. • Non-nuclear VPAC1/2 protein expression is correlated with glioma grade. • Nuclear VPAC1 is observed in 50% of stage IV glioma (GBM). - Abstract: An increasing number of G protein-coupled receptors, like receptors for vasoactive intestinal peptide (VIP), are found in cell nucleus. As VIP receptors are involved in the regulation of glioma cell proliferation and migration, we investigated the expression and the nuclear localization of the VIP receptors VPAC1 and VPAC2 in this cancer. First, bymore » applying Western blot and immunofluorescence detection in three human glioblastoma (GBM) cell lines, we observed a strong nuclear staining for the VPAC1 receptor and a weak nuclear VPAC2 receptor staining. Second, immunohistochemical staining of VPAC1 and VPAC2 on tissue microarrays (TMA) showed that the two receptors were expressed in normal brain and glioma tissues. Expression in the non-nuclear compartment of the two receptors significantly increased with the grade of the tumors. Analysis of nuclear staining revealed a significant increase of VPAC1 staining with glioma grade, with up to 50% of GBM displaying strong VPAC1 nuclear staining, whereas nuclear VPAC2 staining remained marginal. The increase in VPAC receptor expression with glioma grades and the enhanced nuclear localization of the VPAC1 receptors in GBM might be of importance for glioma progression.« less
Desclozeaux, Marion; Krylova, Irina N.; Horn, Florence; Fletterick, Robert J.; Ingraham, Holly A.
2002-01-01
Steroidogenic factor 1 (SF-1) is an orphan nuclear receptor with no known ligand. We showed previously that phosphorylation at serine 203 located N′-terminal to the ligand binding domain (LBD) enhanced cofactor recruitment, analogous to the ligand-mediated recruitment in ligand-dependent receptors. In this study, results of biochemical analyses and an LBD helix assembly assay suggest that the SF-1 LBD adopts an active conformation, with helices 1 and 12 packed against the predicted alpha-helical bundle, in the apparent absence of ligand. Fine mapping of the previously defined proximal activation function in SF-1 showed that the activation function mapped fully to helix 1 of the LBD. Limited proteolyses demonstrate that phosphorylation of S203 in the hinge region mimics the stabilizing effects of ligand on the LBD. Moreover, similar effects were observed in an SF-1/thyroid hormone LBD chimera receptor, illustrating that the S203 phosphorylation effects are transferable to a heterologous ligand-dependent receptor. Our collective data suggest that the hinge together with helix 1 is an individualized specific motif, which is tightly associated with its cognate LBD. For SF-1, we find that this intramolecular association and hence receptor activity are further enhanced by mitogen-activated protein kinase phosphorylation, thus mimicking many of the ligand-induced changes observed for ligand-dependent receptors. PMID:12242296
Saas, Philippe; Varin, Alexis; Perruche, Sylvain; Ceroi, Adam
2017-01-01
There are more and more data concerning the role of cellular metabolism in innate immune cells, such as macrophages or conventional dendritic cells. However, few data are available currently concerning plasmacytoid dendritic cells (PDC), another type of innate immune cells. These cells are the main type I interferon (IFN) producing cells, but they also secrete other pro-inflammatory cytokines (e.g., tumor necrosis factor or interleukin [IL]-6) or immunomodulatory factors (e.g., IL-10 or transforming growth factor-β). Through these functions, PDC participate in antimicrobial responses or maintenance of immune tolerance, and have been implicated in the pathophysiology of several autoimmune diseases, as well as in tumor immune escape mechanisms. Recent data support the idea that the glycolytic pathway (or glycolysis), as well as lipid metabolism (including both cholesterol and fatty acid metabolism) may impact some innate immune functions of PDC or may be involved in these functions after Toll-like receptor (TLR) 7/9 triggering. The kinetics of glycolysis after TLR7/9 triggering may differ between human and murine PDC. In mouse PDC, metabolism changes promoted by TLR7/9 activation may depend on an autocrine/paracrine loop, implicating type I IFN and its receptor IFNAR. This could explain a delayed glycolysis in mouse PDC. Moreover, PDC functions can be modulated by the metabolism of cholesterol and fatty acids. This may occur via the production of lipid ligands that activate nuclear receptors (e.g., liver X receptor [LXR]) in PDC or through limiting intracellular cholesterol pool size (by statin or LXR agonist treatment) in these cells. Finally, lipid-activated nuclear receptors (i.e., LXR or peroxisome proliferator activated receptor) may also directly interact with pro-inflammatory transcription factors, such as NF-κB. Here, we discuss how glycolysis and lipid metabolism may modulate PDC functions and how this may be harnessed in pathological situations where PDC play a detrimental role.
Saas, Philippe; Varin, Alexis; Perruche, Sylvain; Ceroi, Adam
2017-01-01
There are more and more data concerning the role of cellular metabolism in innate immune cells, such as macrophages or conventional dendritic cells. However, few data are available currently concerning plasmacytoid dendritic cells (PDC), another type of innate immune cells. These cells are the main type I interferon (IFN) producing cells, but they also secrete other pro-inflammatory cytokines (e.g., tumor necrosis factor or interleukin [IL]-6) or immunomodulatory factors (e.g., IL-10 or transforming growth factor-β). Through these functions, PDC participate in antimicrobial responses or maintenance of immune tolerance, and have been implicated in the pathophysiology of several autoimmune diseases, as well as in tumor immune escape mechanisms. Recent data support the idea that the glycolytic pathway (or glycolysis), as well as lipid metabolism (including both cholesterol and fatty acid metabolism) may impact some innate immune functions of PDC or may be involved in these functions after Toll-like receptor (TLR) 7/9 triggering. The kinetics of glycolysis after TLR7/9 triggering may differ between human and murine PDC. In mouse PDC, metabolism changes promoted by TLR7/9 activation may depend on an autocrine/paracrine loop, implicating type I IFN and its receptor IFNAR. This could explain a delayed glycolysis in mouse PDC. Moreover, PDC functions can be modulated by the metabolism of cholesterol and fatty acids. This may occur via the production of lipid ligands that activate nuclear receptors (e.g., liver X receptor [LXR]) in PDC or through limiting intracellular cholesterol pool size (by statin or LXR agonist treatment) in these cells. Finally, lipid-activated nuclear receptors (i.e., LXR or peroxisome proliferator activated receptor) may also directly interact with pro-inflammatory transcription factors, such as NF-κB. Here, we discuss how glycolysis and lipid metabolism may modulate PDC functions and how this may be harnessed in pathological situations where PDC play a detrimental role. PMID:28580131
Small-Molecule Hormones: Molecular Mechanisms of Action
Budzińska, Monika
2013-01-01
Small-molecule hormones play crucial roles in the development and in the maintenance of an adult mammalian organism. On the molecular level, they regulate a plethora of biological pathways. Part of their actions depends on their transcription-regulating properties, exerted by highly specific nuclear receptors which are hormone-dependent transcription factors. Nuclear hormone receptors interact with coactivators, corepressors, basal transcription factors, and other transcription factors in order to modulate the activity of target genes in a manner that is dependent on tissue, age and developmental and pathophysiological states. The biological effect of this mechanism becomes apparent not earlier than 30–60 minutes after hormonal stimulus. In addition, small-molecule hormones modify the function of the cell by a number of nongenomic mechanisms, involving interaction with proteins localized in the plasma membrane, in the cytoplasm, as well as with proteins localized in other cellular membranes and in nonnuclear cellular compartments. The identity of such proteins is still under investigation; however, it seems that extranuclear fractions of nuclear hormone receptors commonly serve this function. A direct interaction of small-molecule hormones with membrane phospholipids and with mRNA is also postulated. In these mechanisms, the reaction to hormonal stimulus appears within seconds or minutes. PMID:23533406
The orphan nuclear receptor DAX-1 acts as a novel transcriptional corepressor of PPAR{gamma}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Gwang Sik; Lee, Gha Young; Nedumaran, Balachandar
2008-05-30
DAX-1 is an atypical nuclear receptor (NR) which functions primarily as a transcriptional corepressor of other NRs via heterodimerization. Peroxisome proliferator-activated receptor (PPAR) {gamma} is a ligand-dependent NR which performs a key function in adipogenesis. In this study, we evaluated a novel cross-talk mechanism between DAX-1 and PPAR{gamma}. Transient transfection assays demonstrated that DAX-1 inhibits the transactivity of PPAR{gamma} in a dose-dependent manner. DAX-1 directly competed with the PPAR{gamma} coactivator (PGC)-1{alpha} for binding to PPAR{gamma}. Endogenous levels of DAX-1 were significantly lower in differentiated 3T3-L1 adipocytes as compared to preadipocytes. Using a retroviral expression system, we demonstrated that DAX-1 overexpressionmore » downregulates the expression of PPAR{gamma} target genes, resulting in an attenuation of adipogenesis in 3T3-L1 cells. Our results suggest that DAX-1 acts as a corepressor of PPAR{gamma} and performs a potential function in the regulation of PPAR{gamma}-mediated cellular differentiation.« less
The role of bile acids in metabolic regulation.
Vítek, Libor; Haluzík, Martin
2016-03-01
Bile acids (BA), long believed to only have lipid-digestive functions, have emerged as novel metabolic modulators. They have important endocrine effects through multiple cytoplasmic as well as nuclear receptors in various organs and tissues. BA affect multiple functions to control energy homeostasis, as well as glucose and lipid metabolism, predominantly by activating the nuclear farnesoid X receptor and the cytoplasmic G protein-coupled BA receptor TGR5 in a variety of tissues. However, BA also are aimed at many other cellular targets in a wide array of organs and cell compartments. Their role in the pathogenesis of diabetes, obesity and other 'diseases of civilization' becomes even more clear. They also interact with the gut microbiome, with important clinical implications, further extending the complexity of their biological functions. Therefore, it is not surprising that BA metabolism is substantially modulated by bariatric surgery, a phenomenon contributing favorably to the therapeutic effects of these surgical procedures. Based on these data, several therapeutic approaches to ameliorate obesity and diabetes have been proposed to affect the cellular targets of BA. © 2016 Society for Endocrinology.
Guo, Lei; Chen, Chaoyu; Liang, Qiaoling; Karim, Md. Zunayet; Gorska, Magdalena M.; Alam, Rafeul
2012-01-01
MEK1 phosphorylates ERK1/2 and regulates T cell generation, differentiation and function. MEK1 has recently been shown to translocate to the nucleus. Its nuclear function is largely unknown. By studying human CD4 T cells we demonstrate that a low level of MEK1 is present in the nucleus of CD4 T cells under basal conditions. T cell activation further increases the nuclear translocation of MEK1. MEK1 interacts with the nuclear receptor co-repressor SMRT. MEK1 reduces the nuclear level of SMRT in an activation-dependent manner. MEK1 is recruited to the promoter of c-Fos upon TCR stimulation. Conversely, SMRT is bound to the c-Fos promoter under basal conditions and is removed upon TCR stimulation. We examined the role of SMRT in regulation of T cell function. siRNA-mediated knockdown of SMRT results in a biphasic effect on cytokine production. The production of the cytokines—IL2, IL4, IL10 and IFNγ increases in the early phase (8 hr) and then decreases in the late phase (48 hr). The late phase decrease is associated with inhibition of T cell proliferation. The late phase inhibition of T cell activation is, in part, mediated by IL10 that is produced in the early phase, and in part, by β-catenin signaling. Thus, we have identified a novel nuclear function of MEK1. MEK1 triggers a complex pattern of early T cell activation followed by a late inhibition through its interaction with SMRT. This biphasic dual effect likely reflects a homeostatic regulation of T cell function by MEK1. PMID:23225884
Chen, Liming; Bao, Yifan; Piekos, Stephanie C; Zhu, Kexin; Zhang, Lirong; Zhong, Xiao-Bo
2018-07-01
Cytochrome P450 (P450) enzymes are responsible for metabolizing drugs. Expression of P450s can directly affect drug metabolism, resulting in various outcomes in therapeutic efficacy and adverse effects. Several nuclear receptors are transcription factors that can regulate expression of P450s at both basal and drug-induced levels. Some long noncoding RNAs (lncRNAs) near a transcription factor are found to participate in the regulatory functions of the transcription factors. The aim of this study is to determine whether there is a transcriptional regulatory network containing nuclear receptors and lncRNAs controlling both basal and drug-induced expression of P450s in HepaRG cells. Small interfering RNAs or small hairpin RNAs were applied to knock down four nuclear receptors [hepatocyte nuclear factor 1 α (HNF1 α ), hepatocyte nuclear factor 4 α (HNF4 α ), pregnane X receptor (PXR), and constitutive androstane receptor (CAR)] as well as two lncRNAs [HNF1 α antisense RNA 1 (HNF1 α -AS1) and HNF4 α antisense RNA 1 (HNF4 α -AS1)] in HepaRG cells with or without treatment of phenobarbital or rifampicin. Expression of eight P450 enzymes was examined in both basal and drug-induced levels. CAR and PXR mainly regulated expression of specific P450s. HNF1 α and HNF4 α affected expression of a wide range of P450s as well as other transcription factors. HNF1 α and HNF4 α controlled the expression of their neighborhood lncRNAs, HNF1 α -AS1 and HNF4 α -AS1, respectively. HNF1 α -AS1 and HNF4 α -AS1 was also involved in the regulation of P450s and transcription factors in diverse manners. Altogether, our study concludes that a transcription regulatory network containing the nuclear receptors and lncRNAs controls both basal and drug-induced expression of P450s in HepaRG cells. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.
NR and High-Throughput Screening: Putting the Pieces Together Chemicals
Nuclear receptors (NR) are one of the most abundant classes of transcriptional regulators in animals and function as ligand-activated transcription factors. They provide a direct link between signaling molecules and transcriptional responses that impact diverse functions includin...
Treuter, E; Johansson, L; Thomsen, J S; Wärnmark, A; Leers, J; Pelto-Huikko, M; Sjöberg, M; Wright, A P; Spyrou, G; Gustafsson, J A
1999-03-05
Transcriptional activation by nuclear receptors (NRs) involves the concerted action of coactivators, chromatin components, and the basal transcription machinery. Crucial NR coactivators, which target primarily the conserved ligand-regulated activation (AF-2) domain, include p160 family members, such as TIF2, as well as p160-associated coactivators, such as CBP/p300. Because these coactivators possess intrinsic histone acetyltransferase activity, they are believed to function mainly by regulating chromatin-dependent transcriptional activation. Recent evidence suggests the existence of an additional NR coactivator complex, referred to as the thyroid hormone receptor-associated protein (TRAP) complex, which may function more directly as a bridging complex to the basal transcription machinery. TRAP220, the 220-kDa NR-binding subunit of the complex, has been identified in independent studies using both biochemical and genetic approaches. In light of the functional differences identified between p160 and TRAP coactivator complexes in NR activation, we have attempted to compare interaction and functional characteristics of TIF 2 and TRAP220. Our findings imply that competition between the NR-binding subunits of distinct coactivator complexes may act as a putative regulatory step in establishing either a sequential activation cascade or the formation of independent coactivator complexes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko
2008-04-11
Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less
Melatonin membrane receptors in peripheral tissues: Distribution and functions
Slominski, Radomir M.; Reiter, Russel J.; Schlabritz-Loutsevitch, Natalia; Ostrom, Rennolds S.; Slominski, Andrzej T.
2012-01-01
Many of melatonin’s actions are mediated through interaction with the G-protein coupled membrane bound melatonin receptors type 1 and type 2 (MT1 and MT2, respectively) or, indirectly with nuclear orphan receptors from the RORα/RZR family. Melatonin also binds to the quinone reductase II enzyme, previously defined the MT3 receptor. Melatonin receptors are widely distributed in the body; herein we summarize their expression and actions in non-neural tissues. Several controversies still exist regarding, for example, whether melatonin binds the RORα/RZR family. Studies of the peripheral distribution of melatonin receptors are important since they are attractive targets for immunomodulation, regulation of endocrine, reproductive and cardiovascular functions, modulation of skin pigmentation, hair growth, cancerogenesis, and aging. Melatonin receptor agonists and antagonists have an exciting future since they could define multiple mechanisms by which melatonin modulates the complexity of such a wide variety of physiological and pathological processes. PMID:22245784
Markov, Gabriel V; Girard, Jean; Laudet, Vincent; Leblanc, Catherine
2018-06-15
Hormonally active phytochemicals (HAPs) are signaling molecules produced by plants that alter hormonal signaling in animals, due to consumption or environmental exposure. To date, HAPs have been investigated mainly in terrestrial ecosystems. To gain a full understanding of the origin and evolution of plant-animal interactions, it is necessary also to study these interactions in the marine environment, where the major photosynthetic lineages are very distant from the terrestrial plants. Here we focus on chemicals from red and brown macroalgae and point out their potential role as modulators of the endocrine system of aquatic animals through nuclear hormone receptors. We show that, regarding steroids and oxylipins, there are already some candidates available for further functional investigations of ligand-receptor interactions. Furthermore, several carotenoids, produced by cyanobacteria provide candidates that could be investigated with respect to their presence in macroalgae. Finally, regarding halogenated compounds, it is not clear yet which molecules could bridge the gap to explain the transition from lipid sensing to thyroid hormone high affinity binding among nuclear receptors. Copyright © 2018 Elsevier Inc. All rights reserved.
Regulation of hepatic energy metabolism by the nuclear receptor PXR.
Hakkola, Jukka; Rysä, Jaana; Hukkanen, Janne
2016-09-01
The pregnane X receptor (PXR) is a nuclear receptor that is traditionally thought to be specialized for sensing xenobiotic exposure. In concurrence with this feature PXR was originally identified to regulate drug-metabolizing enzymes and transporters. During the last ten years it has become clear that PXR harbors broader functions. Evidence obtained both in experimental animals and humans indicate that ligand-activated PXR regulates hepatic glucose and lipid metabolism and affects whole body metabolic homeostasis. Currently, the consequences of PXR activation on overall metabolic health are not yet fully understood and varying results on the effect of PXR activation or knockout on metabolic disorders and weight gain have been published in mouse models. Rifampicin and St. John's wort, the prototypical human PXR agonists, impair glucose tolerance in healthy volunteers. Chronic exposure to PXR agonists could potentially represent a risk factor for diabetes and metabolic syndrome. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. Copyright © 2016 Elsevier B.V. All rights reserved.
Prossnitz, Eric R; Barton, Matthias
2009-09-01
GPR30, now named GPER1 (G protein-coupled estrogen receptor1) or GPER here, was first identified as an orphan 7-transmembrane G protein-coupled receptor by multiple laboratories using either homology cloning or differential expression and subsequently shown to be required for estrogen-mediated signaling in certain cancer cells. The actions of estrogen are extensive in the body and are thought to be mediated predominantly by classical nuclear estrogen receptors that act as transcription factors/regulators. Nevertheless, certain aspects of estrogen function remain incompatible with the generally accepted mechanisms of classical estrogen receptor action. Many recent studies have revealed that GPER contributes to some of the actions of estrogen, including rapid signaling events and rapid transcriptional activation. With the introduction of GPER-selective ligands and GPER knockout mice, the functions of GPER are becoming more clearly defined. In many cases, there appears to be a complex interplay between the two receptor systems, suggesting that estrogen-mediated physiological responses may be mediated by either receptor or a combination of both receptor types, with important medical implications.
Bonnelye, Edith; Aubin, Jane E
2013-02-01
Estrogen receptor-related receptor alpha (ERRα) is an orphan nuclear receptor with sequence homology to the estrogen receptors, ERα/β, but it does not bind estrogen. ERRα not only plays a functional role in osteoblasts but also in osteoclasts and chondrocytes. In addition, the ERRs, including ERRα, can be activated by coactivators such as peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC1α and β) and are implicated in adipogenesis, fatty acid oxidation, and oxidative stress defense, suggesting that ERRα-through its activity in bone resorption and adipogenesis--may regulate the insulin and leptin pathways and contribute to aging-related changes in bone and cartilage. In this review, we discuss data on ERRα and its cellular and molecular modes of action, which have broad implications for considering the potential role of this orphan receptor in cartilage and bone endocrine function, on whole-organism physiology, and in the bone aging process. Copyright © 2013 American Society for Bone and Mineral Research.
Heat stress-induced nuclear transport mediated by Hikeshi confers nuclear function of Hsp70s.
Imamoto, Naoko
2018-06-01
The prime feature of eukaryotic cells is the separation of the intracellular space into two compartments, the nucleus and the cytoplasm. Active nuclear transport is crucial for the maintenance of this separation. In this report, we focus on a nuclear transport receptor named Hikeshi, which mediates the heat stress-induced nuclear import of 70-kDa heat shock proteins (Hsp70s), and discuss how the same protein can function differently depending on the cellular compartment in which it is localized. Hsp70 is a molecular chaperone that is predominantly localized in the cytoplasm under normal conditions but is known to accumulate in the nucleus under conditions of heat stress. Although the reported function of Hsp70 is mostly attributed to its molecular function in the cytoplasm, the functions of Hsp70 may extend beyond molecular chaperone activity in the nucleus. Copyright © 2018 The Author. Published by Elsevier Ltd.. All rights reserved.
Jessen, Heather M.; Kolodkin, Mira H.; Bychowski, Meaghan E.; Auger, Catherine J.; Auger, Anthony P.
2010-01-01
Nuclear receptor function on DNA is regulated by the balanced recruitment of coregulatory complexes. Recruited proteins that increase gene expression are called coactivators, and those that decrease gene expression are called corepressors. Little is known about the role of corepressors, such as nuclear receptor corepressor (NCoR), on the organization of behavior. We used real-time PCR to show that NCoR mRNA levels are sexually dimorphic, that females express higher levels of NCoR mRNA within the developing amygdala and hypothalamus, and that NCoR mRNA levels are reduced by estradiol treatment. To investigate the functional role of NCoR on juvenile social behavior, we infused small interfering RNA targeted against NCoR within the developing rat amygdala and assessed the enduring impact on juvenile social play behavior, sociability, and anxiety-like behavior. As expected, control males exhibited higher levels of juvenile social play than control females. Reducing NCoR expression during development further increased juvenile play in males only. Interestingly, decreased NCoR expression within the developing amygdala had lasting effects on increasing juvenile anxiety-like behavior in males and females. These data suggest that the corepressor NCoR functions to blunt sex differences in juvenile play behavior, a sexually dimorphic and hormone-dependent behavior, and appears critical for appropriate anxiety-like behavior in juvenile males and females. PMID:20051490
Jessen, Heather M; Kolodkin, Mira H; Bychowski, Meaghan E; Auger, Catherine J; Auger, Anthony P
2010-03-01
Nuclear receptor function on DNA is regulated by the balanced recruitment of coregulatory complexes. Recruited proteins that increase gene expression are called coactivators, and those that decrease gene expression are called corepressors. Little is known about the role of corepressors, such as nuclear receptor corepressor (NCoR), on the organization of behavior. We used real-time PCR to show that NCoR mRNA levels are sexually dimorphic, that females express higher levels of NCoR mRNA within the developing amygdala and hypothalamus, and that NCoR mRNA levels are reduced by estradiol treatment. To investigate the functional role of NCoR on juvenile social behavior, we infused small interfering RNA targeted against NCoR within the developing rat amygdala and assessed the enduring impact on juvenile social play behavior, sociability, and anxiety-like behavior. As expected, control males exhibited higher levels of juvenile social play than control females. Reducing NCoR expression during development further increased juvenile play in males only. Interestingly, decreased NCoR expression within the developing amygdala had lasting effects on increasing juvenile anxiety-like behavior in males and females. These data suggest that the corepressor NCoR functions to blunt sex differences in juvenile play behavior, a sexually dimorphic and hormone-dependent behavior, and appears critical for appropriate anxiety-like behavior in juvenile males and females.
L-tyrosine and L-DOPA as hormone-like regulators of melanocytes functions
Slominski, Andrzej; Zmijewski, Michal; Pawelek, John
2011-01-01
Summary Evidence reveals that L-tyrosine and L-DOPA, besides serving as substrates and intermediates of melanogenesis, are also bioregulatory agents acting not only as inducers and positive regulators of melanogenesis but also as regulators of other cellular functions. These can be mediated through action on specific receptors or through non-receptor mediated mechanisms. The substrate induced (L-tyrosine and/or L-DOPA) melanogenic pathway would autoregulate itself as well as it would regulate the melanocyte functions through activity of its structural or regulatory proteins and through intermediates of melanogenesis and melanin itself. Dissection of regulatory and autoregulatory elements of this process may elucidate how substrate induced autoregulatory pathways have evolved from prokaryotic or simple eukaryotic organisms to complex systems in vertebrates. This could substantiate older theory proposing that receptors for amino-acid derived hormones arose from the receptors for those amino acids, and that nuclear receptors evolved from primitive intracellular receptors binding nutritional factors or metabolic intermediates. PMID:21834848
Fritah, Asmaà; Steel, Jennifer H; Nichol, Donna; Parker, Nadeene; Williams, Sharron; Price, Anthony; Strauss, Leena; Ryder, Timothy A; Mobberley, Margaret A; Poutanen, Matti; Parker, Malcolm; White, Roger
2010-06-01
Receptor-interacting protein 140 (RIP140) is a ligand-dependent cofactor for nuclear receptors that regulate networks of genes involved in cellular processes, including metabolism. An important role for RIP140 in metabolic control has been identified in RIP140 null mice, whose phenotypes include derepression of genes involved in energy mobilization or catabolism in adipocytes and a switch to more oxidative fibres in skeletal muscle. We hypothesized that ubiquitous expression of RIP140 would suppress metabolic processes, leading to defects in development or cellular function. The primary effect of exogenous expression of RIP140 mRNA (real-time PCR) and protein (western blotting) in transgenic mice is impaired postnatal heart function. There was rapid onset of cardiac hypertrophy and ventricular fibrosis, detected microscopically, in male RIP140 transgenic mice from 4 weeks of age, resulting in 25% mortality by 5 months. RIP140 exogenous expression in the heart leads to decreased mitochondria state III and state IV membrane potential and oxygen consumption. Quantitative PCR showed more than 50% reduced expression of genes involved in mitochondrial activity and fatty acid metabolism, including mitochondrial transcription factor A, cytochrome oxidase VIIa, cytochrome XII, CD36, medium-chain acyl dehydrogenase, and fatty acid transport protein, many of which are known targets for nuclear receptors, including peroxisome proliferator-activated receptors PPARalpha and PPARdelta and oestrogen-related receptors ERRalpha and ERRgamma. This study demonstrates that RIP140 is an important cofactor in postnatal cardiac function and that inhibition of the action of RIP140 may provide a model system to investigate specific interventions designed to prevent or delay the onset of cardiac disease.
Becnel, Lauren B; Darlington, Yolanda F; Ochsner, Scott A; Easton-Marks, Jeremy R; Watkins, Christopher M; McOwiti, Apollo; Kankanamge, Wasula H; Wise, Michael W; DeHart, Michael; Margolis, Ronald N; McKenna, Neil J
2015-01-01
Signaling pathways involving nuclear receptors (NRs), their ligands and coregulators, regulate tissue-specific transcriptomes in diverse processes, including development, metabolism, reproduction, the immune response and neuronal function, as well as in their associated pathologies. The Nuclear Receptor Signaling Atlas (NURSA) is a Consortium focused around a Hub website (www.nursa.org) that annotates and integrates diverse 'omics datasets originating from the published literature and NURSA-funded Data Source Projects (NDSPs). These datasets are then exposed to the scientific community on an Open Access basis through user-friendly data browsing and search interfaces. Here, we describe the redesign of the Hub, version 3.0, to deploy "Web 2.0" technologies and add richer, more diverse content. The Molecule Pages, which aggregate information relevant to NR signaling pathways from myriad external databases, have been enhanced to include resources for basic scientists, such as post-translational modification sites and targeting miRNAs, and for clinicians, such as clinical trials. A portal to NURSA's Open Access, PubMed-indexed journal Nuclear Receptor Signaling has been added to facilitate manuscript submissions. Datasets and information on reagents generated by NDSPs are available, as is information concerning periodic new NDSP funding solicitations. Finally, the new website integrates the Transcriptomine analysis tool, which allows for mining of millions of richly annotated public transcriptomic data points in the field, providing an environment for dataset re-use and citation, bench data validation and hypothesis generation. We anticipate that this new release of the NURSA database will have tangible, long term benefits for both basic and clinical research in this field.
Lu, Huijie; Cui, Yong; Jiang, Liwen; Ge, Wei
2017-07-01
Estrogens signal through both nuclear and membrane receptors with most reported effects being mediated via the nuclear estrogen receptors (nERs). Although much work has been reported on nERs in the zebrafish, there is a lack of direct genetic evidence for their functional roles and importance in reproduction. To address this issue, we undertook this study to disrupt all three nERs in the zebrafish, namely esr1 (ERα), esr2a (ERβII), and esr2b (ERβI), by the genome-editing technology clustered regularly interspaced short palindromic repeats and its associated nuclease (CRISPR/Cas9). Using this loss-of-function genetic approach, we successfully created three mutant zebrafish lines with each nER knocked out. In addition, we also generated all possible double and triple knockouts of the three nERs. The phenotypes of these mutants in reproduction were analyzed in all single, double, and triple nER knockouts in both females and males. Surprisingly, all three single nER mutant fish lines display normal reproductive development and function in both females and males, suggesting functional redundancy among these nERs. Further analysis of double and triple knockouts showed that nERs, especially Esr2a and Esr2b, were essential for female reproduction, and loss of these two nERs led to an arrest of folliculogenesis at previtellogenic stage II followed by sex reversal from female to male. In addition, the current study also revealed a unique role for Esr2a in follicle cell proliferation and transdifferentiation, follicle growth, and chorion formation. Taken together, this study provides the most comprehensive genetic analysis for differential functions of esr1, esr2a, and esr2b in fish reproduction. Copyright © 2017 Endocrine Society.
Krzysik-Walker, Susan M.; González-Mariscal, Isabel; Scheibye-Knudsen, Morten; Indig, Fred E.
2013-01-01
The orphan nuclear receptor estrogen-related receptor alpha (ERRα) directs the transcription of nuclear genes involved in energy homeostasis control and the regulation of mitochondrial mass and function. A crucial role for controlling ERRα-mediated target gene expression has been ascribed to the biarylpyrazole compound 1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-1-piperidinyl-1H-pyrazole-3-carboxamide (AM251) through direct binding to and destabilization of ERRα protein. Here, we provide evidence that structurally related AM251 analogs also have negative impacts on ERRα protein levels in a cell-type-dependent manner while having no deleterious actions on ERRγ. We show that these off-target cellular effects of AM251 are mediated by proteasomal degradation of nuclear ERRα. Cell treatment with the nuclear export inhibitor leptomycin B did not prevent AM251-induced destabilization of ERRα protein, whereas proteasome inhibition with MG132 stabilized and maintained its DNA-binding function, indicative of ERRα being a target of nuclear proteasomal complexes. NativePAGE analysis revealed that ERRα formed a ∼220-kDa multiprotein nuclear complex that was devoid of ERRγ and the coregulator peroxisome proliferator-activated receptor γ coactivator-1. AM251 induced SUMO-2,3 incorporation in ERRα in conjunction with increased protein kinase C activity, whose activation by phorbol ester also promoted ERRα protein loss. Down-regulation of ERRα by AM251 or small interfering RNA led to increased mitochondria biogenesis while negatively impacting mitochondrial membrane potential. These results reveal a novel molecular mechanism by which AM251 and related compounds alter mitochondrial physiology through destabilization of ERRα. PMID:23066093
Park, Sunghee; Yoon, Sangyeon; Zhao, Yuechao; Park, Seong-Eun; Liao, Lan; Xu, Jianming; Lydon, John P.; DeMayo, Francesco J.; O'Malley, Bert W.; Bagchi, Milan K.
2012-01-01
Although the effectiveness of nuclear hormone-receptor complexes is known to depend on coregulator partner proteins, relatively little is known about the roles of coregulators in uterine development and early stages of pregnancy and implantation. Because conventional genetic deletion of the coregulator, repressor of estrogen receptor activity (REA), was embryonic lethal, we here study REA conditional knockout mice generated by cre-loxP recombination, in which REA function was abrogated only in progesterone receptor-expressing tissues, to define the roles of REA in postembryonic stages and in a tissue-specific manner. We find that REA has gene dose-dependent activity impacting uterine development and fertility. Conditional homozygous mutant (REAd/d) mice developed to adulthood and showed normal ovarian function, but females were infertile with severely compromised uterine development and function characterized by cell cycle arrest, apoptosis, and altered adenogenesis (endometrial gland morphogenesis), resulting in failure of implantation and decidualization. By contrast, mice heterozygous for REA (REAf/d) had a very different phenotype, with estradiol treatment resulting in hyperstimulated, large uteri showing increased proliferation of luminal epithelial cells, and enhanced fluid imbibition associated with altered regulation of aquaporins. These REAf/d female mice showed a subfertility phenotype with reduced numbers and sizes of litters. These findings highlight that uterine development and regulation of estrogen receptor activities show a bimodal dependence on the gene dosage of REA. Optimal uterine development and functional activities require the normal gene dosage of REA, with partial or complete deletion resulting in hyperresponsiveness or underresponsiveness to hormone and subfertility or infertility, respectively. PMID:22585830
Yang, Fan; Yu, Xiao; Liu, Chuan; Qu, Chang-Xiu; Gong, Zheng; Liu, Hong-Da; Li, Fa-Hui; Wang, Hong-Mei; He, Dong-Fang; Yi, Fan; Song, Chen; Tian, Chang-Lin; Xiao, Kun-Hong; Wang, Jiang-Yun; Sun, Jin-Peng
2015-01-01
Specific arrestin conformations are coupled to distinct downstream effectors, which underlie the functions of many G-protein-coupled receptors (GPCRs). Here, using unnatural amino acid incorporation and fluorine-19 nuclear magnetic resonance (19F-NMR) spectroscopy, we demonstrate that distinct receptor phospho-barcodes are translated to specific β-arrestin-1 conformations and direct selective signalling. With its phosphate-binding concave surface, β-arrestin-1 ‘reads' the message in the receptor phospho-C-tails and distinct phospho-interaction patterns are revealed by 19F-NMR. Whereas all functional phosphopeptides interact with a common phosphate binding site and induce the movements of finger and middle loops, different phospho-interaction patterns induce distinct structural states of β-arrestin-1 that are coupled to distinct arrestin functions. Only clathrin recognizes and stabilizes GRK2-specific β-arrestin-1 conformations. The identified receptor-phospho-selective mechanism for arrestin conformation and the spacing of the multiple phosphate-binding sites in the arrestin enable arrestin to recognize plethora phosphorylation states of numerous GPCRs, contributing to the functional diversity of receptors. PMID:26347956
Hainan, Lan; Huilin, Liu; Khan, Mahamad; Xin, Zheng; YuJiang, Yang; Hui, Zhang; Naiquan, Yao
2018-06-08
Traditional views suggest that growth hormone and the growth hormone receptor (GH/GHR complex) exert their functions only on the plasma membrane. This paradigm, however, has been challenged by recent new findings that the GH/GHR complex could translocate into cell nuclei where they could still exhibit important physiological functions. We also reported the nuclear localization of porcine GH/GHR and their potential functions in porcine hepatocytes. However, the basic path of pGH/GHR's nuclear translocation remains unclear. Combining previous research results and our current findings, we proposed two basic routes of pGH/GHR's nuclear transportation as follows: 1) after pGH binding to GHR, pGH/GHR enters into the cytoplasm though clathrin- or caveolin-mediated endocytosis, then the pGH/GHR complex enters into early endosomes (Rab5-positive), and the endosome carries the GH/GHR complex to the endoplasmic reticulum (ER). After endosome docking on the ER, the endosome starts fission, and the pGH/GHR complex enters into the ER lumen. Then the pGH/GHR complex transports into the cytoplasm, possibly by the ERAD pathway. Subsequently, the pGH/GHR complex interacts with IMPα/β, which, in turn, mediates GH/GHR nuclear localization; 2) pGH binds with the GHR on the cell membrane and, subsequently, pGH/GHR internalizes into the cell and enters into the endosome (this endosome may belong to a class of endosomes called envelope-associated endosomes (NAE)). Then, the endosome carries the pGH/GHR to the nuclear membrane. After docking on the nuclear membrane, the pGH/GHR complex fuses with the nuclear membrane and then enters into the cell nucleus. Copyright © 2018 Elsevier Inc. All rights reserved.
Nuclear Receptors in Neurodegenerative Diseases
Skerrett, Rebecca; Malm, Tarja; Landreth, Gary
2014-01-01
Nuclear receptors have generated substantial interest in the past decade as potential therapeutic targets for the treatment of neurodegenerative disorders. Despite years of effort, effective treatments for progressive neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease and ALS remain elusive, making non-classical drug targets such as nuclear receptors an attractive alternative. A substantial literature in mouse models of disease and several clinical trials have investigated the role of nuclear receptors in various neurodegenerative disorders, most prominently AD. These studies have met with mixed results, yet the majority of studies in mouse models report positive outcomes. The mechanisms by which nuclear receptor agonists affect disease pathology remain unclear. Deciphering the complex signaling underlying nuclear receptor action in neurodegenerative diseases is essential for understanding this variability in preclinical studies, and for the successful translation of nuclear receptor agonists into clinical therapies. PMID:24874548
Khurana, Simran; Chakraborty, Sharmistha; Zhao, Xuan; Liu, Yu; Guan, Dongyin; Lam, Minh; Huang, Wei; Yang, Sichun; Kao, Hung-Ying
2012-01-01
α-Actinins (ACTNs) are a family of proteins cross-linking actin filaments that maintain cytoskeletal organization and cell motility. Recently, it has also become clear that ACTN4 can function in the nucleus. In this report, we found that ACTN4 (full length) and its spliced isoform ACTN4 (Iso) possess an unusual LXXLL nuclear receptor interacting motif. Both ACTN4 (full length) and ACTN4 (Iso) potentiate basal transcription activity and directly interact with estrogen receptor α, although ACTN4 (Iso) binds ERα more strongly. We have also found that both ACTN4 (full length) and ACTN4 (Iso) interact with the ligand-independent and the ligand-dependent activation domains of estrogen receptor α. Although ACTN4 (Iso) interacts efficiently with transcriptional co-activators such as p300/CBP-associated factor (PCAF) and steroid receptor co-activator 1 (SRC-1), the full length ACTN4 protein either does not or does so weakly. More importantly, the flanking sequences of the LXXLL motif are important not only for interacting with nuclear receptors but also for the association with co-activators. Taken together, we have identified a novel extended LXXLL motif that is critical for interactions with both receptors and co-activators. This motif functions more efficiently in a spliced isoform of ACTN4 than it does in the full-length protein. PMID:22908231
Kargl, Julia; Brown, Andrew J; Andersen, Liisa; Dorn, Georg; Schicho, Rudolf; Waldhoer, Maria; Heinemann, Akos
2013-07-01
The G protein-coupled receptor 55 (GPR55) is a lysophosphatidylinositol (LPI) receptor that is also responsive to certain cannabinoids. Although GPR55 has been implicated in several (patho)physiologic functions, its role remains enigmatic owing mainly to the lack of selective GPR55 antagonists. Here we show that the compound CID16020046 ((4-[4-(3-hydroxyphenyl)-3-(4-methylphenyl)-6-oxo-1H,4H,5H,6H-pyrrolo[3,4-c]pyrazol-5-yl] benzoic acid) is a selective GPR55 antagonist. In yeast cells expressing human GPR55, CID16020046 antagonized agonist-induced receptor activation. In human embryonic kidney (HEK293) cells stably expressing human GPR55, the compound behaved as an antagonist on LPI-mediated Ca²⁺ release and extracellular signal-regulated kinases activation, but not in HEK293 cells expressing cannabinoid receptor 1 or 2 (CB₁ or CB₂). CID16020046 concentration dependently inhibited LPI-induced activation of nuclear factor of activated T-cells (NFAT), nuclear factor κ of activated B cells (NF-κB) and serum response element, translocation of NFAT and NF-κB, and GPR55 internalization. It reduced LPI-induced wound healing in primary human lung microvascular endothelial cells and reversed LPI-inhibited platelet aggregation, suggesting a novel role for GPR55 in platelet and endothelial cell function. CID16020046 is therefore a valuable tool to study GPR55-mediated mechanisms in primary cells and tissues.
Pérez-Schindler, Joaquín; Summermatter, Serge; Salatino, Silvia; Zorzato, Francesco; Beer, Markus; Balwierz, Piotr J.; van Nimwegen, Erik; Feige, Jérôme N.; Auwerx, Johan
2012-01-01
Skeletal muscle exhibits a high plasticity and accordingly can quickly adapt to different physiological and pathological stimuli by changing its phenotype largely through diverse epigenetic mechanisms. The nuclear receptor corepressor 1 (NCoR1) has the ability to mediate gene repression; however, its role in regulating biological programs in skeletal muscle is still poorly understood. We therefore studied the mechanistic and functional aspects of NCoR1 function in this tissue. NCoR1 muscle-specific knockout mice exhibited a 7.2% higher peak oxygen consumption (VO2peak), a 11% reduction in maximal isometric force, and increased ex vivo fatigue resistance during maximal stimulation. Interestingly, global gene expression analysis revealed a high overlap between the effects of NCoR1 deletion and peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) overexpression on oxidative metabolism in muscle. Importantly, PPARβ/δ and estrogen-related receptor α (ERRα) were identified as common targets of NCoR1 and PGC-1α with opposing effects on the transcriptional activity of these nuclear receptors. In fact, the repressive effect of NCoR1 on oxidative phosphorylation gene expression specifically antagonizes PGC-1α-mediated coactivation of ERRα. We therefore delineated the molecular mechanism by which a transcriptional network controlled by corepressor and coactivator proteins determines the metabolic properties of skeletal muscle, thus representing a potential therapeutic target for metabolic diseases. PMID:23028049
Beiting, Daniel P; Hidano, Shinya; Baggs, Julie E; Geskes, Jeanne M; Fang, Qun; Wherry, E John; Hunter, Christopher A; Roos, David S; Cherry, Sara
2015-07-01
The protozoan parasite, Toxoplasma, like many intracellular pathogens, suppresses interferon gamma (IFN-γ)-induced signal transducer and activator of transcription 1 (STAT1) activity. We exploited this well-defined host-pathogen interaction as the basis for a high-throughput screen, identifying nine transcription factors that enhance STAT1 function in the nucleus, including the orphan nuclear hormone receptor TLX. Expression profiling revealed that upon IFN-γ treatment TLX enhances the output of a subset of IFN-γ target genes, which we found is dependent on TLX binding at those loci. Moreover, infection of TLX deficient mice with the intracellular parasite Toxoplasma results in impaired production of the STAT1-dependent cytokine interleukin-12 by dendritic cells and increased parasite burden in the brain during chronic infection. These results demonstrate a previously unrecognized role for this orphan nuclear hormone receptor in regulating STAT1 signaling and host defense and reveal that STAT1 activity can be modulated in a context-specific manner by such "modifiers."
Liver X receptor alpha regulates fatty acid synthase expression in chicken.
Demeure, O; Duby, C; Desert, C; Assaf, S; Hazard, D; Guillou, H; Lagarrigue, S
2009-12-01
Liver X receptor alpha (LXRalpha), also referred to as nuclear receptor subfamily 1, group H, member 3 is a member of the nuclear hormone receptor superfamily, and has recently been shown to act as a master transcription factor governing hepatic lipogenesis in mammals. Liver X receptor alpha directly regulates both the expression of other lipogenic transcription factors and the expression of lipogenic enzymes, thereby enhancing hepatic fatty acid synthesis (FASN). In birds, like in humans, fatty acid synthesis primarily occurs in the liver. Whether LXRalpha is involved in hepatic regulation of lipogenic genes remained to be investigated in this species. Here we show that fatty acid synthase and the expression of other lipogenic genes (sterol regulatory element binding protein 1 and steroyl coenzyme A desaturase 1) are induced in chicken hepatoma cells in response to a pharmacological liver X receptor agonist, T0901317. A detailed analysis of the chicken FASN promoter revealed a functional liver X response element. These data define the chicken FASN gene as a direct target of LXRalpha and further expand the role of LXRalpha as a regulator of lipid metabolism in this species.
Innate scavenger receptor-A regulates adaptive T helper cell responses to pathogen infection
Xu, Zhipeng; Xu, Lei; Li, Wei; Jin, Xin; Song, Xian; Chen, Xiaojun; Zhu, Jifeng; Zhou, Sha; Li, Yong; Zhang, Weiwei; Dong, Xiaoxiao; Yang, Xiaowei; Liu, Feng; Bai, Hui; Chen, Qi; Su, Chuan
2017-01-01
The pattern recognition receptor (PRR) scavenger receptor class A (SR-A) has an important function in the pathogenesis of non-infectious diseases and in innate immune responses to pathogen infections. However, little is known about the role of SR-A in the host adaptive immune responses to pathogen infection. Here we show with mouse models of helminth Schistosoma japonicum infection and heat-inactivated Mycobacterium tuberculosis stimulation that SR-A is regulated by pathogens and suppresses IRF5 nuclear translocation by direct interaction. Reduced abundance of nuclear IRF5 shifts macrophage polarization from M1 towards M2, which subsequently switches T-helper responses from type 1 to type 2. Our study identifies a role for SR-A as an innate PRR in regulating adaptive immune responses. PMID:28695899
Jakobsson, Tomas; Osman, Waffa; Gustafsson, Jan-Åke; Zilliacus, Johanna; Wärnmark, Anette
2007-01-01
Similarities in physiological roles of LXR (liver X receptors) and co-repressor RIP140 (receptor-interacting protein 140) in regulating energy homoeostasis and lipid and glucose metabolism suggest that the effects of LXR could at least partly be mediated by recruitment of the co-repressor RIP140. In the present study, we have elucidated the molecular basis for regulation of LXR transcriptional activity by RIP140. LXR is evenly localized in the nucleus and neither the N-terminal domain nor the LBD (ligand-binding domain) is necessary for nuclear localization. Both LXR subtypes, LXRα and LXRβ, interact with RIP140 and co-localize in diffuse large nuclear domains. Interaction and co-localization are dependent on the LBD of the receptor. The C-terminal domain of RIP140 is sufficient for full repressive effect. None of the C-terminal NR (nuclear receptor)-boxes is required for the co-repressor activity, whereas the NR-box-like motif as well as additional elements in the C-terminal region are required for full repressive function. The C-terminal NR-box-like motif is necessary for interaction with LXRβ, whereas additional elements are needed for strong interaction with LXRα. In conclusion, our results suggest that co-repression of LXR activity by RIP140 involves an atypical binding mode of RIP140 and a repression element in the RIP140 C-terminus. PMID:17391100
Gaines, Peter; Tien, Chiung W.; Olins, Ada L.; Olins, Donald E.; Shultz, Leonard D.; Carney, Lisa; Berliner, Nancy
2008-01-01
Objective The capacity of neutrophils to eradicate bacterial infections is dependent on normal development and the activation of functional responses, which include chemotaxis and the generation of oxygen radicals during the respiratory burst. A unique feature of the neutrophil is its highly lobulated nucleus, which is thought to facilitate chemotaxis but may also play a role in other critical neutrophil functions. Nuclear lobulation is dependent on the expression of the inner nuclear envelope protein, the lamin B receptor (LBR), mutations of which cause hypolobulated neutrophil nuclei in human Pelger-Huët anomaly (PHA) and the "ichthyosis" (ic) phenotype in mice. In this study we have investigated roles for LBR in mediating neutrophil development and the activation of multiple neutrophil functions, including chemotaxis and the respiratory burst. Materials and Methods A progenitor EML cell line was generated from an ic/ic mouse, and derived cells that lacked LBR expression were induced to mature neutrophils and then examined for abnormal morphology and functional responses. Results Neutrophils derived from EML-ic/ic cells exhibited nuclear hypolobulation identical to that observed in ichthyosis mice. The ic/ic neutrophils also displayed abnormal chemotaxis, supporting the notion that nuclear segmentation augments neutrophil extravasation. Furthermore, promyelocytic forms of ic/ic cells displayed decreased proliferative responses and produced a deficient respiratory burst upon terminal maturation. Conclusions Our studies of promyelocytes that lack LBR expression have identified roles for LBR in regulating not only the morphologic maturation of the neutrophil nucleus but also proliferative and functional responses that are critical to innate immunity. PMID:18550262
Zhao, Yichao; Xu, Longwei; Ding, Song; Lin, Nan; Ji, Qingqi; Gao, Lingchen; Su, Yuanyuan; He, Ben; Pu, Jun
2017-04-01
Diabetic cardiomyopathy is a major complication that significantly contributes to morbidity and mortality in diabetics with few therapies. Moreover, antidiabetic drugs reported inconsistent or even adverse cardiovascular effects, suggesting that it is important to exploit novel therapeutic targets against diabetic cardiomyopathy. Here, we observed that the nuclear melatonin receptor, the retinoic acid-related orphan receptor-α (RORα), was downregulated in diabetic hearts. By utilizing a mouse line with RORα disruption, we demonstrated that RORα deficiency led to significantly augmented diastolic dysfunction and cardiac remodeling induced by diabetes. Microscopic and molecular analyses further indicated that the detrimental effects of RORα deficiency were associated with aggravated myocardial apoptosis, autophagy dysfunction, and oxidative stress by disrupting antioxidant gene expression. By contrast, restoration of cardiac RORα levels in transgenic mice significantly improved cardiac functional and structural parameters at 8 weeks after diabetes induction. Consistent with genetic manipulation, pharmacological activation of RORα by melatonin and SR1078 (a synthetic agonist) showed beneficial effects against diabetic cardiomyopathy, while the RORα inhibitor SR3335 significantly exacerbated cardiac impairments in diabetic mice. Collectively, these findings suggest that cardiac-targeted manipulation of nuclear melatonin receptor RORα may hold promise for delaying diabetic cardiomyopathy development. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Fan, WuQiang; Yanase, Toshihiko; Nishi, Yoshihiro; Chiba, Seiichi; Okabe, Taijiro; Nomura, Masatoshi; Yoshimatsu, Hironobu; Kato, Shigeaki; Takayanagi, Ryoichi; Nawata, Hajime
2008-12-01
Hypogonadism is associated with increased fat mass and dysregulation of metabolic homeostasis in men. Our previous study revealed that androgen receptor (AR)-null male mice (ARL-/Y) develop late-onset obesity and are leptin-resistant. The present study evaluated how hypothalamic AR contributes to central leptin-signal transducer and activator of transcription 3 (STAT3) signaling. We evaluated leptin action in wild-type and ARL-/Y mice, the anatomic co-relationship between AR and leptin signaling in the hypothalamus, and the effects of AR on leptin-mediated STAT3 transactivation and nuclear translocation. AR deletion in male mice results in a weaker leptin-induced suppression of food intake and body weight drop even before the onset of overt obesity. In wild-type male but not female mice, AR was highly expressed in various hypothalamic nuclei that also expressed the long-form leptin receptor (OBRB) and co-resided with OBRB directly in the arcuate neurons. In vitro, AR significantly enhanced STAT3-mediated transcription of leptin target genes including POMC and SOCS3. This effect relied on the AR N-terminal activation function-1 (AF-1) domain and was specific to AR in that none of the other sex steroid hormone receptors tested showed similar effects. AR enhanced the low concentrations of leptin-induced STAT3 nuclear translocation in vitro, and ARL-/Y mice receiving leptin had impaired STAT3 nuclear localization in the arcuate neurons. These findings indicate that AR in the hypothalamus functions as a regulator of central leptin-OBRB-STAT3 signaling and has a physiological role in energy homeostasis and metabolic regulation in male mice.
Protein disulfide isomerase regulates renal AT1 receptor function and blood pressure in rats.
Wang, Xitao; Asghar, Mohammad
2017-08-01
The role and mechanism of renal protein disulfide isomerase (PDI) in blood pressure regulation has not been tested before. Here, we test this possibility in Sprague-Dawley rats. Rats were treated with PDI inhibitor bacitracin (100 mg·kg -1 ip·day -1 for 14 days), and then blood pressure and renal angiotensin II type 1 (AT 1 ) receptor function were determined in anesthetized rats. Renal AT 1 receptor function was determined as the ability of candesartan (an AT 1 receptor blocker) to increase diuresis and natriuresis. A second set of vehicle- and bacitracin-treated rats was used to determine biochemical parameters. Systolic blood pressure as well as diastolic blood pressure increased in bacitracin-treated compared with vehicle-treated rats. Compared with vehicle, bacitracin-treated rats showed increased diuresis and natriuresis in response to candesartan (10-µg iv bolus dose) suggesting higher AT 1 receptor function in these rats. These were associated with higher renin activities in the plasma and renal tissues. Furthermore, urinary 8-isoprostane and kidney injury molecule-1 levels were higher and urinary antioxidant capacity was lower in bacitracin-treated rats. Renal protein carbonyl and nitrotyrosine levels also were higher in bacitracin- compared with vehicle-treated rats, suggesting oxidative stress burden in bacitracin-treated rats. Moreover, PDI activity decreased and its protein levels increased in renal tissues of bacitracin-treated rats. Also, nuclear levels of Nrf2 transcription factor, which regulates redox homeostasis, were decreased in bacitracin-treated rats. Furthermore, tissue levels of Keap1, an Nrf2 inhibitory molecule, and tyrosine 216-phosphorylated GSK3β protein, an Nrf2 nuclear export protein, were increased in bacitracin-treated rats. These results suggest that renal PDI by regulating Keap1-Nrf2 pathway acts as an antioxidant, maintaining redox balance, renal AT 1 receptor function, and blood pressure in rats. Copyright © 2017 the American Physiological Society.
Nuclear localization of coactivator RAC3 is mediated by a bipartite NLS and importin {alpha}3
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeung, Percy Luk; Zhang, Aihua; Chen, J. Don
2006-09-15
The nuclear receptor coactivator RAC3 (also known as SRC-3/ACTR/AIB1/p/CIP/TRAM-1) belongs to the p160 coactivator family, which are involved in several physiological processes and diseases. Here we have investigated how RAC3 is translocated into the nucleus and show that it is mediated through a bipartite NLS and importin {alpha}3. This bipartite NLS is located within the conserved bHLH domain, and its mutation abolished nuclear localization. The NLS is also sufficient to cause nuclear import of EGFP, and the activity requires basic amino acids within the NLS. RAC3 binds strongly to importin {alpha}3, which also depends on the basic amino acids. Functionally,more » RAC3 cytoplasmic mutant loses its ability to enhance transcription, suggesting that nuclear localization is essential for coactivator function. Together, these results reveal a previous unknown mechanism for nuclear translocation of p160 coactivators and a critical function of the conserved bHLH within the coactivator.« less
Benoit, Thibaut; Valera, Marie-Cecile; Fontaine, Coralie; Buscato, Melissa; Lenfant, Francoise; Raymond-Letron, Isabelle; Tremollieres, Florence; Soulie, Michel; Foidart, Jean-Michel; Game, Xavier; Arnal, Jean-Francois
2017-11-01
The genitourinary syndrome of menopause has a negative impact on quality of life of postmenopausal women. The treatment of vulvovaginal atrophy includes administration of estrogens. However, oral estrogen treatment is controversial because of its potential risks on venous thrombosis and breast cancer. Estetrol (E4) is a natural estrogen synthesized exclusively during pregnancy by the human fetal liver and initially considered as a weak estrogen. However, E4 was recently evaluated in phase 1 to 2 clinical studies and found to act as an oral contraceptive in combination with a progestin, without increasing the level of coagulation factors. We recently showed that E4 stimulates uterine epithelial proliferation through nuclear estrogen receptor (ER) α, but failed to elicit endothelial responses. Herein, we first evaluated the morphological and functional impacts of E4 on the vagina of ovariectomized mice, and we determined the molecular mechanism mediating these effects. Vaginal epithelial proliferation and lubrication after stimulation were found to increase after E4 chronic treatment. Using a combination of pharmacological and genetic approaches, we demonstrated that these E4 effects on the vagina are mediated by nuclear ERα activation. Altogether, we demonstrate that the selective activation of nuclear ERα is both necessary and sufficient to elicit functional and structural effects on the vagina, and therefore E4 appears promising as a therapeutic option to improve vulvovaginal atrophy. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Becnel, Lauren B.; Darlington, Yolanda F.; Ochsner, Scott A.; Easton-Marks, Jeremy R.; Watkins, Christopher M.; McOwiti, Apollo; Kankanamge, Wasula H.; Wise, Michael W.; DeHart, Michael; Margolis, Ronald N.; McKenna, Neil J.
2015-01-01
Signaling pathways involving nuclear receptors (NRs), their ligands and coregulators, regulate tissue-specific transcriptomes in diverse processes, including development, metabolism, reproduction, the immune response and neuronal function, as well as in their associated pathologies. The Nuclear Receptor Signaling Atlas (NURSA) is a Consortium focused around a Hub website (www.nursa.org) that annotates and integrates diverse ‘omics datasets originating from the published literature and NURSA-funded Data Source Projects (NDSPs). These datasets are then exposed to the scientific community on an Open Access basis through user-friendly data browsing and search interfaces. Here, we describe the redesign of the Hub, version 3.0, to deploy “Web 2.0” technologies and add richer, more diverse content. The Molecule Pages, which aggregate information relevant to NR signaling pathways from myriad external databases, have been enhanced to include resources for basic scientists, such as post-translational modification sites and targeting miRNAs, and for clinicians, such as clinical trials. A portal to NURSA’s Open Access, PubMed-indexed journal Nuclear Receptor Signaling has been added to facilitate manuscript submissions. Datasets and information on reagents generated by NDSPs are available, as is information concerning periodic new NDSP funding solicitations. Finally, the new website integrates the Transcriptomine analysis tool, which allows for mining of millions of richly annotated public transcriptomic data points in the field, providing an environment for dataset re-use and citation, bench data validation and hypothesis generation. We anticipate that this new release of the NURSA database will have tangible, long term benefits for both basic and clinical research in this field. PMID:26325041
Quantification of transcription factor-DNA binding affinity in a living cell
Belikov, Sergey; Berg, Otto G.; Wrange, Örjan
2016-01-01
The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626
Noncoding RNAs and the control of signalling via nuclear receptor regulation in health and disease.
Cathcart, Paul; Lucchesi, Walter; Ottaviani, Silvia; De Giorgio, Alex; Krell, Jonathan; Stebbing, Justin; Castellano, Leandro
2015-08-01
Nuclear receptors belong to a superfamily of proteins that play central roles in human biology, orchestrating a large variety of biological functions in both health and disease. Understanding the interactions and regulatory pathways of NRs will allow development of potential therapeutic interventions for a multitude of disease processes. Non-coding RNAs have recently been discovered to have significant interactions with NR signalling pathways via a variety of biological connections. This review summarises the known interactions between ncRNAs and the NR superfamily in health, embryogenesis and a plethora of human diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Negative Effects of SRD5A1 on Nuclear Activity of Progesterone Receptor Isoform B in JEG3 Cells.
Miao, Zhuo; Sun, Min; Jiang, Feng; Yao, Yuanqing; Li, Yi
2016-02-01
Progesterone withdrawal signals labor in mammals. Elevated intracellular metabolism contributes to progesterone functional withdrawal through unknown mechanism, which is thought to act via progesterone receptor (PR). This study aims to investigate molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. We investigated the role of 5α-reductase type I (SRD5A1) in enzymatic catalysis of progesterone and loss of PR function in a human trophoblast choriocarcinoma cell line JEG3. The PR isoform B (PR-B) was robustly expressed in JEG3 cells. The SRD5A1 small-interfering RNA knockdown led to significant increase in PR-B nuclear import, ectopic, whereas SRD5A1 overexpression resulted in remarkable inhibition of nuclear PR-B in P4-treated cells. Repression of SRD5A1 activated PR-B responsive gene, whereas overexpression of SRD5A1 possessed an inhibitory effect. JEG3 cell line is a valuable tool to study mechanisms responsible for loss of PR function and screening of drugs for preterm birth treatment. Our study aims to investigate the molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. © The Author(s) 2015.
Chen, Tao; Laurenzana, Elizabeth M.; Coslo, Denise M.; Chen, Fengming; Omiecinski, Curtis J.
2014-01-01
The CAR (constitutive androstane receptor; NR1I3) is a critical xenobiotic sensor that regulates xenobiotic metabolism, drug clearance, energy and lipid homoeostasis, cell proliferation and development. Although constitutively active, in hepatocytes CAR is normally held quiescent through a tethering mechanism in the cytosol, anchored to a protein complex that includes several components, including heat-shock protein 90. Release and subsequent nuclear translocation of CAR is triggered through either direct binding to ligand activators such as CITCO {6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime} or through indirect chemical activation, such as with PB (phenobarbital). In the present study, we demonstrate that proteasomal inhibition markedly disrupts CAR function, repressing CAR nuclear trafficking, disrupting CAR’s interaction with nuclear co-activators and inhibiting induction of CAR target gene responses in human primary hepatocytes following treatment with either PB or CITCO. Paradoxically, these effects occur following accumulation of ubiquitinated hCAR (human CAR). Furthermore, a non-proteolytic function was indicated by its interaction with a SUG1 (suppressor for Gal1), a subunit of the 26S proteasome. Taken together, these data demonstrate that the proteasome complex functions at multiple levels to regulate the functional biology of hCAR activity. PMID:24224465
Li, Xiang; Anderson, Marie; Collin, Delphine; Muegge, Ingo; Wan, John; Brennan, Debra; Kugler, Stanley; Terenzio, Donna; Kennedy, Charles; Lin, Siqi; Labadia, Mark E; Cook, Brian; Hughes, Robert; Farrow, Neil A
2017-07-14
The nuclear receptor retinoid acid receptor-related orphan receptor γt (RORγt) is a master regulator of the Th17/IL-17 pathway that plays crucial roles in the pathogenesis of autoimmunity. RORγt has recently emerged as a highly promising target for treatment of a number of autoimmune diseases. Through high-throughput screening, we previously identified several classes of inverse agonists for RORγt. Here, we report the crystal structures for the ligand-binding domain of RORγt in both apo and ligand-bound states. We show that apo RORγt adopts an active conformation capable of recruiting coactivator peptides and present a detailed analysis of the structural determinants that stabilize helix 12 (H12) of RORγt in the active state in the absence of a ligand. The structures of ligand-bound RORγt reveal that binding of the inverse agonists disrupts critical interactions that stabilize H12. This destabilizing effect is supported by ab initio calculations and experimentally by a normalized crystallographic B-factor analysis. Of note, the H12 destabilization in the active state shifts the conformational equilibrium of RORγt toward an inactive state, which underlies the molecular mechanism of action for the inverse agonists reported here. Our findings highlight that nuclear receptor structure and function are dictated by a dynamic conformational equilibrium and that subtle changes in ligand structures can shift this equilibrium in opposite directions, leading to a functional switch from agonists to inverse agonists. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes.
Stoney, Patrick N; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J; McCaffery, Peter
2016-03-01
Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)-synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA-responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1-expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. © 2015 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biswas, Arunima; Pasquel, Danielle; Tyagi, Rakesh Kumar
2011-03-18
Research highlights: {yields} Pregnane X receptor (PXR), a major regulatory protein, is modified by acetylation. {yields} PXR undergoes dynamic deacetylation upon ligand-mediated activation. {yields} SIRT1 partially mediates PXR deacetylation. {yields} PXR deacetylation per se induces lipogenesis mimicking ligand-mediated activation. -- Abstract: Pregnane X receptor (PXR), like other members of its class of nuclear receptors, undergoes post-translational modification [PTM] (e.g., phosphorylation). However, it is unknown if acetylation (a major and common form of protein PTM) is observed on PXR and, if it is, whether it is of functional consequence. PXR has recently emerged as an important regulatory protein with multiple ligand-dependentmore » functions. In the present work we show that PXR is indeed acetylated in vivo. SIRT1 (Sirtuin 1), a NAD-dependent class III histone deacetylase and a member of the sirtuin family of proteins, partially mediates deacetylation of PXR. Most importantly, the acetylation status of PXR regulates its selective function independent of ligand activation.« less
Integrative and systemic approaches for evaluating PPARβ/δ (PPARD) function
Giordano Attianese, Greta MP
2015-01-01
The peroxisome proliferator-activated receptors (PPARs) are a group of nuclear receptors that function as transcription factors regulating the expression of genes involved in cellular differentiation, development, metabolism and also tumorigenesis. Three PPAR isotypes (α, β/δ and γ) have been identified, among which PPARβ/δ is the most difficult to functionally examine due to its tissue-specific diversity in cell fate determination, energy metabolism and housekeeping activities. PPARβ/δ acts both in a ligand-dependent and -independent manner. The specific type of regulation, activation or repression, is determined by many factors, among which the type of ligand, the presence/absence of PPARβ/δ-interacting corepressor or coactivator complexes and PPARβ/δ protein post-translational modifications play major roles. Recently, new global approaches to the study of nuclear receptors have made it possible to evaluate their molecular activity in a more systemic fashion, rather than deeply digging into a single pathway/function. This systemic approach is ideally suited for studying PPARβ/δ, due to its ubiquitous expression in various organs and its overlapping and tissue-specific transcriptomic signatures. The aim of the present review is to present in detail the diversity of PPARβ/δ function, focusing on the different information gained at the systemic level, and describing the global and unbiased approaches that combine a systems view with molecular understanding. PMID:25945080
Gwathmey, TanYa M; Shaltout, Hossam A; Rose, James C; Diz, Debra I; Chappell, Mark C
2011-03-01
We examined the impact of fetal programming on the functional responses of renal angiotensin receptors. Fetal sheep were exposed in utero to betamethasone (BMX; 0.17 mg/kg) or control (CON) at 80 to 81 days gestation with full-term delivery. Renal nuclear and plasma membrane fractions were isolated from sheep age 1.0 to 1.5 years for receptor binding and fluorescence detection of reactive oxygen species (ROS) or nitric oxide (NO). Mean arterial blood pressure and blood pressure variability were significantly higher in the BMX-exposed adult offspring versus CON sheep. The proportion of nuclear AT(1) receptors sensitive to losartan was 2-fold higher (67 ± 6% vs 27 ± 9%; P<0.01) in BMX compared with CON. In contrast, the proportion of AT(2) sites was only one third that of controls (BMX, 25 ± 11% vs CON, 78 ± 4%; P<0.01), with a similar reduction in sites sensitive to the Ang-(1-7) antagonist D-Ala7-Ang-(1-7) with BMX exposure. Functional studies revealed that Ang II stimulated ROS to a greater extent in BMX than in CON sheep (16 ± 3% vs 6 ± 4%; P<0.05); however, NO production to Ang II was attenuated in BMX (26 ± 7% vs 82 ± 14%; P<0.05). BMX exposure was also associated with a reduction in the Ang-(1-7) NO response (75 ± 8% vs 131 ± 26%; P<0.05). We conclude that altered expression of angiotensin receptor subtypes may be one mechanism whereby functional changes in NO- and ROS-dependent signaling pathways may favor the sustained increase in blood pressure evident in fetal programming.
Identification of Gene Markers for Activation of the Nuclear Receptor Pregnane X Receptor
Many environmentally-relevant chemicals and drugs activate the nuclear receptor pregnane X receptor (PXR). Activation of PXR in the mouse liver can lead to increases in liver weight in part through increased hepatocyte replication similar to chemicals that activate other nuclear ...
FKBP51 and FKBP52 in Signaling and Disease
Storer, Cheryl L.; Dickey, Chad A.; Galigniana, Mario D.; Rein, Theo; Cox, Marc B.
2011-01-01
FKBP51 and FKBP52 are diverse regulators of steroid hormone receptor signaling including regulation of receptor maturation, hormone binding, and nuclear translocation. Although structurally similar, they are functionally divergent, which is largely attributed to differences in the FK1 domain and the proline-rich loop. FKBP51 and FKBP52 have emerged as likely contributors to a variety of hormone-dependent diseases including stress-related diseases, immune function, reproductive functions and a variety of cancers. In addition, recent studies have implicated FKBP51 and FKBP52 in Alzheimer’s disease and other protein aggregation disorders. This review summarizes our current understanding of FKBP51 and FKBP52 interactions within the receptor-chaperone complex, their contributions to health and disease, and their potential as therapeutic targets for the treatment of these diseases. PMID:21889356
Vitamin D receptor (VDR) promoter targeting through a novel chromatin remodeling complex.
Kato, Shigeaki; Fujiki, Ryoji; Kitagawa, Hirochika
2004-05-01
We have purified nuclear complexes for Vitamin D receptor (VDR), and identified one of them as a novel ATP-dependent chromatine remodeling containing Williams syndrome transcription factor (WSTF), that is supposed to be responsible for Williams syndrome. This complex (WSTF including nucleosome assembly complex (WINAC)) exhibited an ATP-dependent chromatin remodeling activity in vitro. Transient expression assays revealed that WINAC potentiates ligand-induced function of VDR in gene activation and repression. Thus, this study describes a molecular basis of the VDR function on chromosomal DNA through chromatine remodeling.
2013-07-01
epithelial cells; MDA-MB-231 metastatic breast cancer cells) with systematic alterations in the expression of lamins A, B1, B2, C, and lamin B receptor...LBR). We then evaluated the effect of altered lamin expression on nuclear stiffness in these cell lines. While increased expression of lamin A...caused stiffer, less deformable nuclei, reduction of lamins A/C expression by shRNA reduced nuclear stiffness. The effect of alterations in other lamins
Pierce, Jacqueline B; van der Merwe, George; Mangroo, Dev
2014-02-01
The two main signal transduction mechanisms that allow eukaryotes to sense and respond to changes in glucose availability in the environment are the cyclic AMP (cAMP)/protein kinase A (PKA) and AMP-activated protein kinase (AMPK)/Snf1 kinase-dependent pathways. Previous studies have shown that the nuclear tRNA export process is inhibited in Saccharomyces cerevisiae deprived of glucose. However, the signal transduction pathway involved and the mechanism by which glucose availability regulates nuclear-cytoplasmic tRNA trafficking are not understood. Here, we show that inhibition of nuclear tRNA export is caused by a block in nuclear reimport of the tRNA export receptors during glucose deprivation. Cytoplasmic accumulation of the tRNA export receptors during glucose deprivation is not caused by activation of Snf1p. Evidence obtained suggests that PKA is part of the mechanism that regulates nuclear reimport of the tRNA export receptors in response to glucose availability. This mechanism does not appear to involve phosphorylation of the nuclear tRNA export receptors by PKA. The block in nuclear reimport of the tRNA export receptors appears to be caused by activation of an unidentified mechanism when PKA is turned off during glucose deprivation. Taken together, the data suggest that PKA facilitates return of the tRNA export receptors to the nucleus by inhibiting an unidentified activity that facilitates cytoplasmic accumulation of the tRNA export receptors when glucose in the environment is limiting. A PKA-independent mechanism was also found to regulate nuclear tRNA export in response to glucose availability. This mechanism, however, does not regulate nuclear reimport of the tRNA export receptors.
Pierce, Jacqueline B.; van der Merwe, George
2014-01-01
The two main signal transduction mechanisms that allow eukaryotes to sense and respond to changes in glucose availability in the environment are the cyclic AMP (cAMP)/protein kinase A (PKA) and AMP-activated protein kinase (AMPK)/Snf1 kinase-dependent pathways. Previous studies have shown that the nuclear tRNA export process is inhibited in Saccharomyces cerevisiae deprived of glucose. However, the signal transduction pathway involved and the mechanism by which glucose availability regulates nuclear-cytoplasmic tRNA trafficking are not understood. Here, we show that inhibition of nuclear tRNA export is caused by a block in nuclear reimport of the tRNA export receptors during glucose deprivation. Cytoplasmic accumulation of the tRNA export receptors during glucose deprivation is not caused by activation of Snf1p. Evidence obtained suggests that PKA is part of the mechanism that regulates nuclear reimport of the tRNA export receptors in response to glucose availability. This mechanism does not appear to involve phosphorylation of the nuclear tRNA export receptors by PKA. The block in nuclear reimport of the tRNA export receptors appears to be caused by activation of an unidentified mechanism when PKA is turned off during glucose deprivation. Taken together, the data suggest that PKA facilitates return of the tRNA export receptors to the nucleus by inhibiting an unidentified activity that facilitates cytoplasmic accumulation of the tRNA export receptors when glucose in the environment is limiting. A PKA-independent mechanism was also found to regulate nuclear tRNA export in response to glucose availability. This mechanism, however, does not regulate nuclear reimport of the tRNA export receptors. PMID:24297441
Nuclear Receptors, Mitochondria, and Lipid Metabolism
Alaynick, William A.
2009-01-01
Lipid metabolism is a continuum from emulsification and uptake of lipids in the intestine to cellular uptake and transport to compartments such as mitochondria. Whether fats are shuttled into lipid droplets in adipose tissue or oxidized in mitochondria and peroxisomes depends on metabolic substrate availability, energy balance and endocrine signaling of the organism. Several members of the nuclear hormone receptor superfamily are lipid-sensing factors that affect all aspects of lipid metabolism. The physiologic actions of glandular hormones (e.g. thyroid, mineralocorticoid and glucocorticoid), vitamins (e.g. vitamins A and D) and reproductive hormones (e.g. progesterone, estrogen and testosterone) and their cognate receptors are well established. The peroxisome proliferator activated receptors (PPARs) and Liver X receptors (LXRs), acting in concert with PPARγ Coactivator 1α (PGC-1α), have been shown to regulate insulin sensitivity and lipid handling. These receptors are the focus of intense pharmacologic studies to expand the armamentarium of small molecule ligands to treat diabetes and the metabolic syndrome (hypertension, insulin resistance, hyperglycemia, dyslipidemia, and obesity). Recently, additional partners of PGC-1α have moved to the forefront of metabolic research, the Estrogen-related Receptors (ERRs). Although no endogenous ligands for these receptors have been identified, phenotypic analyses of knockout mouse models demonstrate an important role for these molecules in substrate sensing and handling as well as mitochondrial function. PMID:18375192
Does bilirubin prevent hepatic steatosis through activation of the PPARα nuclear receptor?
Hinds, Terry D; Adeosun, Samuel O; Alamodi, Abdulhadi A; Stec, David E
2016-10-01
Several large population studies have demonstrated a negative correlation between serum bilirubin levels and the development of obesity, hepatic steatosis, and cardiovascular disease. Despite the strong correlative data demonstrating the protective role of bilirubin, the mechanism by which bilirubin can protect against these pathologies remains unknown. Bilirubin has long been known as a powerful antioxidant and also has anti-inflammatory actions, each of which may contribute to the protection afforded by increased levels. We have recently described a novel function of bilirubin as a ligand for the peroxisome proliferator-activated receptor-alpha (PPARα), which we show specifically binds to the nuclear receptor. Bilirubin may function as a selective PPAR modulator (SPPARM) to control lipid accumulation and blood glucose. However, it is not known to what degree bilirubin activation of PPARα is responsible for the protection afforded to reduce hepatic steatosis. We hypothesize that bilirubin, acting as a novel SPPARM, increases hepatic fatty acid metabolism through a PPARα-dependent mechanism which reduces hepatic lipid accumulation and protects against hepatic steatosis and non-alcoholic fatty liver disease (NAFLD). Copyright © 2016 Elsevier Ltd. All rights reserved.
Selectivity Mechanism of the Nuclear Pore Complex Characterized by Single Cargo Tracking
Lowe, Alan R.; Siegel, Jake J.; Kalab, Petr; Siu, Merek; Weis, Karsten; Liphardt, Jan T.
2010-01-01
The Nuclear Pore Complex (NPC) mediates all exchange between the cytoplasm and the nucleus. Small molecules can passively diffuse through the NPC, while larger cargos require transport receptors to translocate1. How the NPC facilitates the translocation of transport receptor/cargo complexes remains unclear. Here, we track single protein-functionalized Quantum Dot (QD) cargos as they translocate the NPC. Import proceeds by successive sub-steps comprising cargo capture, filtering and translocation, and release into the nucleus. The majority of QDs are rejected at one of these steps and return to the cytoplasm including very large cargos that abort at a size-selective barrier. Cargo movement in the central channel is subdiffusive and cargos that can bind more transport receptors diffuse more freely. Without Ran, cargos still explore the entire NPC, but have a markedly reduced probability of exit into the nucleus, suggesting that NPC entry and exit steps are not equivalent and that the pore is functionally asymmetric to importing cargos. The overall selectivity of the NPC appears to arise from the cumulative action of multiple reversible sub-steps and a final irreversible exit step. PMID:20811366
Nuclear receptors in bile acid metabolism
Li, Tiangang; Chiang, John Y. L.
2013-01-01
Bile acids are signaling molecules that activate nuclear receptors, such as farnesoid X receptor, pregnane X receptor, constitutive androstane receptor, and vitamin D receptor, and play a critical role in the regulation of lipid, glucose, energy, and drug metabolism. These xenobiotic/endobiotic-sensing nuclear receptors regulate phase I oxidation, phase II conjugation, and phase III transport in bile acid and drug metabolism in the digestive system. Integration of bile acid metabolism with drug metabolism controls absorption, transport, and metabolism of nutrients and drugs to maintain metabolic homeostasis and also protects against liver injury, inflammation, and related metabolic diseases, such as nonalcoholic fatty liver disease, diabetes, and obesity. Bile-acid–based drugs targeting nuclear receptors are in clinical trials for treating cholestatic liver diseases and fatty liver disease. PMID:23330546
REV-ERB and ROR nuclear receptors as drug targets
Kojetin, Douglas J.; Burris, Thomas P.
2016-01-01
The nuclear receptors REV-ERB (consisting of REV-ERBα and REV-ERBβ) and retinoic acid receptor-related orphan receptors (RORs; consisting of RORα, RORβ and RORγ) are involved in many physiological processes, including regulation of metabolism, development and immunity as well as the circadian rhythm. The recent characterization of endogenous ligands for these former orphan nuclear receptors has stimulated the development of synthetic ligands and opened up the possibility of targeting these receptors to treat several diseases, including diabetes, atherosclerosis, autoimmunity and cancer. This Review focuses on the latest developments in ROR and REV-ERB pharmacology indicating that these nuclear receptors are druggable targets and that ligands targeting these receptors may be useful in the treatment of several disorders. PMID:24577401
Identification of an allosteric binding site for RORγt inhibition
Scheepstra, Marcel; Leysen, Seppe; van Almen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc
2015-01-01
RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors. PMID:26640126
Hwang, Ho Sik; Parfitt, Geraint J; Brown, Donald J; Jester, James V
2017-10-01
This paper reviews our current understanding of age-related meibomian gland dysfunction (MGD) and the role of the nuclear receptor, peroxisome proliferator-activated receptor gamma (PPARγ), in the regulation of meibomian gland function, meibocyte differentiation and lipid synthesis. The studies suggest that PPARγ is a master regulator of meibocyte differentiation and function, whose expression and nuclear signaling coupled with meibocyte renewal is altered during aging, potentially leading to atrophy of the meibomian gland as seen in clinical MGD. Study of meibomian gland stem cells also suggest that there is a limited number of precursor meibocytes that provide progeny to the acini, that may be susceptible to exhaustion as occurs during aging and other environmental factors. Further study of pathways regulating PPARγ expression and function as well as meibocyte stem cell maintenance may provide clues to establishing cellular and molecular mechanisms underlying MGD and the development of novel therapeutic strategies to treating this disease. Copyright © 2017 Elsevier Ltd. All rights reserved.
Balaguer, Patrick; Delfosse, Vanessa; Grimaldi, Marina; Bourguet, William
Endocrine-disrupting chemicals (EDCs) represent a broad class of exogenous substances that cause adverse effects in the endocrine system mainly by interacting with nuclear hormone receptors (NRs). Humans are generally exposed to low doses of pollutants, and current researches aim at deciphering the mechanisms accounting for the health impact of EDCs at environmental concentrations. Our correlative analysis of structural, interaction and cell-based data has revealed a variety of, sometimes unexpected, binding modes, reflecting a wide range of EDC affinities and specificities. Here, we present a few representative examples to illustrate various means by which EDCs achieve high-affinity binding to NRs. These examples include the binding of the mycoestrogen α-zearalanol to estrogen receptors, the covalent interaction of organotins with the retinoid X- and peroxisome proliferator-activated receptors, and the cooperative binding of two chemicals to the pregnane X receptor. We also discuss some hypotheses that could further explain low-concentration effects of EDCs with weaker affinity towards NRs. Copyright © 2017. Published by Elsevier Masson SAS.
Galigniana, Mario D; Echeverría, Pablo C; Erlejman, Alejandra G; Piwien-Pilipuk, Graciela
2010-01-01
In the absence of hormone, corticosteroid receptors such as GR (glucocorticoid receptor) and (mineralocorticoid receptor) are primarily located in the cytoplasm. Upon steroid-binding, they rapidly accumulate in the nucleus. Regardless of their primary location, these receptors and many other nuclear factors undergo a constant and dynamic nucleocytoplasmic shuttling. All members of the steroid receptor family are known to form large oligomeric structures with the heat-shock proteins of 90-kDa (hsp90) and 70-kDa (hsp70), the small acidic protein p23, and a tetratricopeptide repeat (TPR) -domain protein such as FK506-binding proteins (FKBPs), cyclophilins (CyPs) or the serine/threonine protein phosphatase 5 (PP5). It has always been stated that the dissociation of the chaperone heterocomplex (a process normally referred to as receptor "transformation") is the first step that permits the nuclear import of steroid receptors. However the experimental evidence is consistent with a model where the chaperone machinery is required for the retrotransport of the receptor through the cytoplasm and also facilitates the passage through the nuclear pore. Recent evidence indicates that the hsp90-based chaperone system also interacts with structures of the nuclear pore such as importin β and the integral nuclear pore glycoprotein Nup62 facilitating the passage of the untransformed receptor through the nuclear pore.
Gates, Julie; Lam, Geanette; Ortiz, José A; Losson, Régine; Thummel, Carl S
2004-01-01
Pulses of the steroid hormone ecdysone trigger the major developmental transitions in Drosophila, including molting and puparium formation. The ecdysone signal is transduced by the EcR/USP nuclear receptor heterodimer that binds to specific response elements in the genome and directly regulates target gene transcription. We describe a novel nuclear receptor interacting protein encoded by rigor mortis (rig) that is required for ecdysone responses during larval development. rig mutants display defects in molting, delayed larval development, larval lethality, duplicated mouth parts, and defects in puparium formation--phenotypes that resemble those seen in EcR, usp, E75A and betaFTZ-F1 mutants. Although the expression of these nuclear receptor genes is essentially normal in rig mutant larvae, the ecdysone-triggered switch in E74 isoform expression is defective. rig encodes a protein with multiple WD-40 repeats and an LXXLL motif, sequences that act as specific protein-protein interaction domains. Consistent with the presence of these elements and the lethal phenotypes of rig mutants, Rig protein interacts with several Drosophila nuclear receptors in GST pull-down experiments, including EcR, USP, DHR3, SVP and betaFTZ-F1. The ligand binding domain of betaFTZ-F1 is sufficient for this interaction, which can occur in an AF-2-independent manner. Antibody stains reveal that Rig protein is present in the brain and imaginal discs of second and third instar larvae, where it is restricted to the cytoplasm. In larval salivary gland and midgut cells, however, Rig shuttles between the cytoplasm and nucleus in a spatially and temporally regulated manner, at times that correlate with the major lethal phase of rig mutants and major switches in ecdysone-regulated gene expression. Taken together, these data indicate that rig exerts essential functions during larval development through gene-specific effects on ecdysone-regulated transcription, most likely as a cofactor for one or more nuclear receptors. Furthermore, the dynamic intracellular redistribution of Rig protein suggests that it may act to refine spatial and temporal responses to ecdysone during development.
Han, Kyuyong; Song, Haengseok; Moon, Irene; Augustin, Robert; Moley, Kelle; Rogers, Melissa; Lim, Hyunjung
2007-03-01
Various nuclear receptors form dimers to activate target genes via specific response elements located within promoters or enhancers. Retinoid X receptor (RXR) serves as a dimerization partner for many nuclear receptors including retinoic acid receptor (RAR) and peroxisome proliferator-activated receptor (PPAR). Dimers show differential preference towards directly repeated response elements with 1-5 nucleotide spacing, and direct repeat 1 (DR1) is a promiscuous element which recruits RAR/RXR, RXR/RXR, and PPAR/RXR in vitro. In the present investigation, we report identification of a novel RAR/RXR target gene which is regulated by DR1s in the promoter region. This gene, namely spermatocyte-specific marker (Ssm), recruits all the three combinations of nuclear receptors in vitro, but in vivo regulation is observed by trans-retinoic acid-activated RAR/RXR dimer. Indeed, chromatin immunoprecipitation experiment demonstrates binding of RARbeta and RXRalpha in the promoter region of the Ssm. Interestingly, expression of Ssm is almost exclusively observed in spermatocytes in the adult mouse testis, where RA signaling is known to regulate developmental program of male germ cells. The results show that Ssm is a RAR/RXR target gene uniquely using DR1 and exhibits stage-specific expression in the mouse testis with potential function in later stages of spermatogenesis. This finding exemplifies usage of DR1s as retinoic acid response element (RARE) under a specific in vivo context.
Bonnelye, Edith; Saltel, Frédéric; Chabadel, Anne; Zirngibl, Ralph A; Aubin, Jane E; Jurdic, Pierre
2010-01-01
The orphan nuclear receptor, estrogen receptor-related receptor α (ERRα) is expressed in osteoblasts and osteoclasts (OCs) and has been proposed to be a modulator of estrogen signaling. To determine the role of ERRα in OC biology, we knocked down ERRα activity by transient transfection of an siRNA directed against ERRα in the RAW264.7 monocyte–macrophage cell line that differentiates into OCs in the presence of receptor activator of nuclear factor κB-ligands and macrophage colony-stimulating factor. In parallel, stable RAW cell lines expressing a dominant-negative form of ERRα and green fluorescent protein (RAW-GFP-ERRαΔAF2) were used. Expression of OC markers was assessed by real-time PCR, and adhesion and transmigration tests were performed. Actin cytoskeletal organization was visualized using confocal microscopy. We found that RAW264.7 cells expressing siRNA directed against ERRα and RAW-GFP-ERRαΔAF2 OCs displayed abnormal spreading, and decreased osteopontin and β3 integrin subunit expression compared with the corresponding control cells. Decreased adhesion and the absence of podosome belts concomitant with abnormal localization of c-src were also observed in RAW-GFP-ERRαΔAF2-derived OCs. In addition, RAW-GFP-ERRαΔAF2-derived OCs failed to transmigrate through osteoblast cell layers. Our data show that the impairment of ERRα function does not alter OC precursor proliferation and differentiation but does alter the adhesion/spreading and migration capacities of mature OCs. PMID:20841427
Choi, Hyo-Kyoung; Choi, Kyung-Chul; Kang, Hee-Bum; Kim, Han-Cheon; Lee, Yoo-Hyun; Haam, Seungjoo; Park, Hyoung-Gi; Yoon, Ho-Geun
2008-05-01
Lis-homology (LisH) motifs are involved in protein dimerization, and the discovery of the conserved N-terminal LisH domain in transducin beta-like protein 1 and its receptor (TBL1 and TBLR1) led us to examine the role of this domain in transcriptional repression. Here we show that multiple beta-transducin (WD-40) repeat-containing proteins interact to form oligomers in solution and that oligomerization depends on the presence of the LisH domain in each protein. Repression of transcription, as assayed using Gal4 fusion proteins, also depended on the presence of the LisH domain, suggesting that oligomerization is a prerequisite for efficient transcriptional repression. Furthermore, we show that the LisH domain is responsible for the binding to the hypoacetylated histone H4 tail and for stable chromatin targeting by the nuclear receptor corepressor complex. Mutations in conserved residues in the LisH motif of TBL1 and TBLR1 block histone binding, oligomerization, and transcriptional repression, supporting the functional importance of the LisH motif in transcriptional repression. Our results indicate that another WD-40 protein, TBL3, also preferentially binds to the N-terminal domain of TBL1 and TBLR1, and forms oligomers with other WD-40 proteins. Finally, we observed that the WD-40 proteins RbAp46 and RbAp48 of the sin3A corepressor complex failed to dimerize. We also found the specific interaction UbcH/E2 with TBL1, but not RbAp46/48. Altogether, our results thus indicate that the presence of multiple LisH/WD-40 repeat containing proteins is exclusive to nuclear receptor corepressor/ silencing mediator for retinoic and thyroid receptor complexes compared with other class 1 histone deacetylase-containing corepessor complexes.
EphB4 localises to the nucleus of prostate cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mertens-Walker, Inga, E-mail: inga.mertenswalker@qut.edu.au; Australian Prostate Cancer Research Centre—Queensland, Translational Research Institute, 37 Kent Street, Woolloongabba 4102, QLD; Lisle, Jessica E.
2015-04-10
The EphB4 receptor tyrosine kinase is over-expressed in a variety of different epithelial cancers including prostate where it has been shown to be involved in survival, migration and angiogenesis. We report here that EphB4 also resides in the nucleus of prostate cancer cell lines. We used in silico methods to identify a bipartite nuclear localisation signal (NLS) in the extracellular domain and a monopartite NLS sequence in the intracellular kinase domain of EphB4. To determine whether both putative NLS sequences were functional, fragments of the EphB4 sequence containing each NLS were cloned to create EphB4NLS-GFP fusion proteins. Localisation of bothmore » NLS-GFP proteins to the nuclei of transfected cells was observed, demonstrating that EphB4 contains two functional NLS sequences. Mutation of the key amino residues in both NLS sequences resulted in diminished nuclear accumulation. As nuclear translocation is often dependent on importins we confirmed that EphB4 and importin-α can interact. To assess if nuclear EphB4 could be implicated in gene regulatory functions potential EphB4-binding genomic loci were identified using chromatin immunoprecipitation and Lef1 was confirmed as a potential target of EphB4-mediated gene regulation. These novel findings add further complexity to the biology of this important cancer-associated receptor. - Highlights: • The EphB4 protein can be found in the nucleus of prostate cancer cell lines. • EphB4 contains two functional nuclear localisation signals. • Chromatin immunoprecipitation has identified potential genome sequences to which EphB4 binds. • Lef1 is a confirmed target for EphB4-mediated gene regulation.« less
Miyazaki, Satsuki; Taniguchi, Hidenori; Moritoh, Yusuke; Tashiro, Fumi; Yamamoto, Tsunehiko; Yamato, Eiji; Ikegami, Hiroshi; Ozato, Keiko; Miyazaki, Jun-ichi
2010-11-01
Retinoid X receptors (RXRs) are members of the nuclear hormone receptor superfamily and are thought to be key regulators in differentiation, cellular growth, and gene expression. Although several experiments using pancreatic β-cell lines have shown that the ligands of nuclear hormone receptors modulate insulin secretion, it is not clear whether RXRs have any role in insulin secretion. To elucidate the function of RXRs in pancreatic β-cells, we generated a double-transgenic mouse in which a dominant-negative form of RXRβ was inducibly expressed in pancreatic β-cells using the Tet-On system. We also established a pancreatic β-cell line from an insulinoma caused by the β-cell-specific expression of simian virus 40 T antigen in the above transgenic mouse. In the transgenic mouse, expression of the dominant-negative RXR enhanced the insulin secretion with high glucose stimulation. In the pancreatic β-cell line, the suppression of RXRs also enhanced glucose-stimulated insulin secretion at a high glucose concentration, while 9-cis-retinoic acid, an RXR agonist, repressed it. High-density oligonucleotide microarray analysis showed that expression of the dominant-negative RXR affected the expression levels of a number of genes, some of which have been implicated in the function and/or differentiation of β-cells. These results suggest that endogenous RXR negatively regulates the glucose-stimulated insulin secretion. Given these findings, we propose that the modulation of endogenous RXR in β-cells may be a new therapeutic approach for improving impaired insulin secretion in type 2 diabetes.
Synthetic estrogen derivatives demonstrate the functionality of intracellular GPR30.
Revankar, Chetana M; Mitchell, Hugh D; Field, Angela S; Burai, Ritwik; Corona, Cesear; Ramesh, Chinnasamy; Sklar, Larry A; Arterburn, Jeffrey B; Prossnitz, Eric R
2007-08-17
Estrogen mediates its effects through multiple cellular receptors. In addition to the classical nuclear estrogen receptors (ERalpha and ERbeta), estrogen also signals through the seven-transmembrane G-protein-coupled receptor (GPCR) GPR30. Although estrogen is a cell-permeable ligand, it is often assumed that all GPCRs function solely as cell surface receptors. Our previous results showed that GPR30 appeared to be expressed predominantly in the endoplasmic reticulum. A critical question that arises is whether this localization represents the site of functional receptor. To address this question, we synthesized a collection of cell-permeable and cell-impermeable estrogen derivatives. We hypothesized that if functional GPR30 were expressed at the cell surface, both permeable and impermeable derivatives would show activity. However, if functional GPR30 were predominantly intracellular, like ERalpha, only the permeable ligands should show activity. Cell permeability was assessed using cells expressing ERalpha as a model intracellular estrogen-binding receptor. Our results reveal that despite exhibiting similar binding affinities for GPR30, only the cell-permeable ligands are capable of stimulating rapid calcium mobilization and phosphoinositide 3-kinase (PI3K) activation. We conclude that GPR30 expressed intracellularly is capable of initiating cellular signaling and that there is insufficient GPR30 expressed on the cell surface to initiate signaling in response to impermeable ligands in the cell lines examined. To our knowledge, this is the first definitive demonstration of a functional intracellular transmembrane estrogen receptor.
The Aryl hydrocarbon receptor (AhR) is a ligand-activated, transcription factor with a basic region/helix (bHLH) motif. hR has been sequenced and the functional domains defined and there is information on the formation of complexes with other peptides and interactions with DNA, a...
Wang, Ting; McDonald, Caitlin; Petrenko, Nataliya B.; Leblanc, Mathias; Wang, Tao; Giguere, Vincent; Evans, Ronald M.; Patel, Vickas V.
2015-01-01
Almost all cellular functions are powered by a continuous energy supply derived from cellular metabolism. However, it is little understood how cellular energy production is coordinated with diverse energy-consuming cellular functions. Here, using the cardiac muscle system, we demonstrate that nuclear receptors estrogen-related receptor α (ERRα) and ERRγ are essential transcriptional coordinators of cardiac energy production and consumption. On the one hand, ERRα and ERRγ together are vital for intact cardiomyocyte metabolism by directly controlling expression of genes important for mitochondrial functions and dynamics. On the other hand, ERRα and ERRγ influence major cardiomyocyte energy consumption functions through direct transcriptional regulation of key contraction, calcium homeostasis, and conduction genes. Mice lacking both ERRα and cardiac ERRγ develop severe bradycardia, lethal cardiomyopathy, and heart failure featuring metabolic, contractile, and conduction dysfunctions. These results illustrate that the ERR transcriptional pathway is essential to couple cellular energy metabolism with energy consumption processes in order to maintain normal cardiac function. PMID:25624346
Beiting, Daniel P.; Hidano, Shinya; Baggs, Julie E.; Geskes, Jeanne M.; Fang, Qun; Wherry, E. John; Hunter, Christopher A.; Roos, David S.; Cherry, Sara
2015-01-01
The protozoan parasite, Toxoplasma, like many intracellular pathogens, suppresses interferon gamma (IFN-γ)-induced signal transducer and activator of transcription 1 (STAT1) activity. We exploited this well-defined host–pathogen interaction as the basis for a high-throughput screen, identifying nine transcription factors that enhance STAT1 function in the nucleus, including the orphan nuclear hormone receptor TLX. Expression profiling revealed that upon IFN-γ treatment TLX enhances the output of a subset of IFN-γ target genes, which we found is dependent on TLX binding at those loci. Moreover, infection of TLX deficient mice with the intracellular parasite Toxoplasma results in impaired production of the STAT1-dependent cytokine interleukin-12 by dendritic cells and increased parasite burden in the brain during chronic infection. These results demonstrate a previously unrecognized role for this orphan nuclear hormone receptor in regulating STAT1 signaling and host defense and reveal that STAT1 activity can be modulated in a context-specific manner by such “modifiers.” PMID:26196739
Nuclear receptor TLX prevents retinal dystrophy and recruits the corepressor atrophin1.
Zhang, Chun-Li; Zou, Yuhua; Yu, Ruth T; Gage, Fred H; Evans, Ronald M
2006-05-15
During mammalian embryogenesis, precise coordination of progenitor cell proliferation and differentiation is essential for proper organ size and function. The involvement of TLX (NR2E1), an orphan nuclear receptor, has been implicated in ocular development, as Tlx-/- mice exhibit visual impairment. Using genetic and biochemical approaches, we show that TLX modulates retinal progenitor cell proliferation and cell cycle re-entry by directly regulating the expression of Pten and its target cyclin D1. Additionally, TLX finely tunes the progenitor differentiation program by modulating the phospholipase C and mitogen-activated protein kinase (MAPK) pathways and the expression of an array of cell type-specific transcriptional regulators. Consequently, Tlx-/- mice have a dramatic reduction in retina thickness and enhanced generation of S-cones, and develop severe early onset retinal dystrophy. Furthermore, TLX interacts with atrophin1 (Atn1), a corepressor that is involved in human neurodegenerative dentatorubral-pallidoluysian atrophy (DRPLA) and that is essential for development of multiple tissues. Together, these results reveal a molecular strategy by which an orphan nuclear receptor can precisely orchestrate tissue-specific proliferation and differentiation programs to prevent retinal malformation and degeneration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fujinaga, Ryutaro; Takeshita, Yukio; Yoshioka, Kazuhiro
2011-07-15
The stigmoid body (STB) is a cytoplasmic inclusion containing huntingtin-associated protein 1 (HAP1), and HAP1/STB formation is induced by transfection of the HAP1 gene into cultured cells. In the present study, we examined the intracellular colocalization of HAP1/STBs with steroid hormone receptors (SHRs), including the androgen receptor (AR), estrogen receptor, glucocorticoid receptor (GR), and mineralocorticoid receptor, in COS-7 cells cotransfected with HAP1 and each receptor. We found that C-terminal ligand-binding domains of all SHRs had potential for colocalization with HAP1/STBs, whereas only AR and GR were clearly colocalized with HAP1/STBs when each full-length SHR was coexpressed with HAP1. In addition,more » it appeared that HAP1/STBs did not disrupt GR and AR functions because the receptors on HAP1/STBs maintained nuclear translocation activity in response to their specific ligands. When the cells were treated with a proteasome inhibitor, GR and AR localized outside HAP1/STBs translocated into the nucleus, whereas the receptors colocalized with HAP1/STBs persisted in their colocalization even after treatment with their ligands. Therefore, HAP1/STBs may be involved in cytoplasmic modifications of the nuclear translocation of GR and AR in a ubiquitin-proteasome system.« less
Guillaume, Maeva; Montagner, Alexandra; Fontaine, Coralie; Lenfant, Françoise; Arnal, Jean-François; Gourdy, Pierre
2017-01-01
Estrogen receptor alpha (ERα) has been demonstrated to play a key role in reproduction but also to exert numerous functions in nonreproductive tissues. Accordingly, ERα is now recognized as a key regulator of energy homeostasis and glucose metabolism and mediates the protective effects of estrogens against obesity and type 2 diabetes. This chapter attempts to summarize our current understanding of the mechanisms of ERα activation and their involvement in the modulation of energy balance and glucose metabolism. We first focus on the experimental studies that constitute the basis of the understanding of ERα as a nuclear receptor and more specifically on the key roles played by its two activation functions (AFs). We depict the consequences of the selective inactivation of these AFs in mouse models, which further underline the prominent role of nuclear ERα in the prevention of obesity and diabetes, as on the reproductive tract and the vascular system. Besides these nuclear actions, a fraction of ERα is associated with the plasma membrane and activates nonnuclear signaling from this site. Such rapid effects, called membrane-initiated steroid signals (MISS), have been characterized in a variety of cell lines and in particular in endothelial cells. The development of selective pharmacological tools that specifically activate MISS as well as the generation of mice expressing an ERα protein impeded for membrane localization has just begun to unravel the physiological role of MISS in vivo and their contribution to ERα-mediated metabolic protection. Finally, we discuss novel perspectives for the design of tissue-selective ER modulators.
Zhu, Jun; Koken, Marcel H. M.; Quignon, Frédérique; Chelbi-Alix, Mounira K.; Degos, Laurent; Wang, Zhen Yi; Chen, Zhu; de Thé, Hugues
1997-01-01
Acute promyelocytic leukemia (APL) is associated with the t(15;17) translocation, which generates a PML/RARα fusion protein between PML, a growth suppressor localized on nuclear matrix-associated bodies, and RARα, a nuclear receptor for retinoic acid (RA). PML/RARα was proposed to block myeloid differentiation through inhibition of nuclear receptor response, as does a dominant negative RARα mutant. In addition, in APL cells, PML/RARα displaces PML and other nuclear body (NB) antigens onto nuclear microspeckles, likely resulting in the loss of PML and/or NB functions. RA leads to clinical remissions through induction of terminal differentiation, for which the respective contributions of RARα (or PML/RARα) activation, PML/RARα degradation, and restoration of NB antigens localization are poorly determined. Arsenic trioxide also leads to remissions in APL patients, presumably through induction of apoptosis. We demonstrate that in non-APL cells, arsenic recruits the nucleoplasmic form of several NB antigens onto NB, but induces the degradation of PML only, identifying a powerful tool to approach NB function. In APL cells, arsenic targets PML and PML/RARα onto NB and induces their degradation. Thus, RA and arsenic target RARα and PML, respectively, but both induce the degradation of the PML/RARα fusion protein, which should contribute to their therapeutic effects. The difference in the cellular events triggered by these two agents likely stems from RA-induced transcriptional activation and arsenic effects on NB proteins. PMID:9108090
Structure and signalling functions of C3 receptors on human B cells.
Frade, R
1990-03-01
CR1 (C3b receptor) and CR2 (C3d/EBV receptor) are two C3 receptors expressed on B lymphocytes. CR1 and CR2 have structural similarities and their cross-linking at the B cell surface by antibodies or specific ligands in multimeric forms induce B cell activation. However, activation of human B cells through cell surface interactions or by intracellular protein kinase C activators leads to phosphorylation of CR2 but not CR1. CR2 is phosphorylated on serine and tyrosine residues. Analysis of post-membrane events associated with CR2 revealed intracellular interactions of CR2 with p53, a plasma membrane anti-oncogene-encoded phosphoprotein, and with p120, a nuclear phosphoribonucleoprotein. These intracellular interactions probably represent important steps in the signalling functions of CR2.
The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.
Wang, Tao; Xiong, Jian-Qiong
2016-02-01
The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.
Plasticity of an ultrafast interaction between nucleoporins and nuclear transport receptors.
Milles, Sigrid; Mercadante, Davide; Aramburu, Iker Valle; Jensen, Malene Ringkjøbing; Banterle, Niccolò; Koehler, Christine; Tyagi, Swati; Clarke, Jane; Shammas, Sarah L; Blackledge, Martin; Gräter, Frauke; Lemke, Edward A
2015-10-22
The mechanisms by which intrinsically disordered proteins engage in rapid and highly selective binding is a subject of considerable interest and represents a central paradigm to nuclear pore complex (NPC) function, where nuclear transport receptors (NTRs) move through the NPC by binding disordered phenylalanine-glycine-rich nucleoporins (FG-Nups). Combining single-molecule fluorescence, molecular simulations, and nuclear magnetic resonance, we show that a rapidly fluctuating FG-Nup populates an ensemble of conformations that are prone to bind NTRs with near diffusion-limited on rates, as shown by stopped-flow kinetic measurements. This is achieved using multiple, minimalistic, low-affinity binding motifs that are in rapid exchange when engaging with the NTR, allowing the FG-Nup to maintain an unexpectedly high plasticity in its bound state. We propose that these exceptional physical characteristics enable a rapid and specific transport mechanism in the physiological context, a notion supported by single molecule in-cell assays on intact NPCs. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Plasticity of an Ultrafast Interaction between Nucleoporins and Nuclear Transport Receptors
Milles, Sigrid; Mercadante, Davide; Aramburu, Iker Valle; Jensen, Malene Ringkjøbing; Banterle, Niccolò; Koehler, Christine; Tyagi, Swati; Clarke, Jane; Shammas, Sarah L.; Blackledge, Martin; Gräter, Frauke; Lemke, Edward A.
2015-01-01
Summary The mechanisms by which intrinsically disordered proteins engage in rapid and highly selective binding is a subject of considerable interest and represents a central paradigm to nuclear pore complex (NPC) function, where nuclear transport receptors (NTRs) move through the NPC by binding disordered phenylalanine-glycine-rich nucleoporins (FG-Nups). Combining single-molecule fluorescence, molecular simulations, and nuclear magnetic resonance, we show that a rapidly fluctuating FG-Nup populates an ensemble of conformations that are prone to bind NTRs with near diffusion-limited on rates, as shown by stopped-flow kinetic measurements. This is achieved using multiple, minimalistic, low-affinity binding motifs that are in rapid exchange when engaging with the NTR, allowing the FG-Nup to maintain an unexpectedly high plasticity in its bound state. We propose that these exceptional physical characteristics enable a rapid and specific transport mechanism in the physiological context, a notion supported by single molecule in-cell assays on intact NPCs. PMID:26456112
Nuclear export receptor CRM1 recognizes diverse conformations in nuclear export signals.
Fung, Ho Yee Joyce; Fu, Szu-Chin; Chook, Yuh Min
2017-03-10
Nuclear export receptor CRM1 binds highly variable nuclear export signals (NESs) in hundreds of different cargoes. Previously we have shown that CRM1 binds NESs in both polypeptide orientations (Fung et al., 2015). Here, we show crystal structures of CRM1 bound to eight additional NESs which reveal diverse conformations that range from loop-like to all-helix, which occupy different extents of the invariant NES-binding groove. Analysis of all NES structures show 5-6 distinct backbone conformations where the only conserved secondary structural element is one turn of helix that binds the central portion of the CRM1 groove. All NESs also participate in main chain hydrogen bonding with human CRM1 Lys568 side chain, which acts as a specificity filter that prevents binding of non-NES peptides. The large conformational range of NES backbones explains the lack of a fixed pattern for its 3-5 hydrophobic anchor residues, which in turn explains the large array of peptide sequences that can function as NESs.
Retinoid-Related Orphan Receptor β and Transcriptional Control of Neuronal Differentiation.
Liu, Hong; Aramaki, Michihiko; Fu, Yulong; Forrest, Douglas
2017-01-01
The ability to generate neuronal diversity is central to the function of the nervous system. Here we discuss the key neurodevelopmental roles of retinoid-related orphan receptor β (RORβ) encoded by the Rorb (Nr1f2) gene. Recent studies have reported loss of function of the human RORB gene in cases of familial epilepsy and intellectual disability. Principal sites of expression of the Rorb gene in model species include sensory organs, the spinal cord, and brain regions that process sensory and circadian information. Genetic analyses in mice have indicated functions in circadian behavior, vision, and, at the cellular level, the differentiation of specific neuronal cell types. Studies in the retina and sensory areas of the cerebral cortex suggest that this orphan nuclear receptor acts at decisive steps in transcriptional hierarchies that determine neuronal diversity. 2017 Published by Elsevier Inc.
History of retinoic acid receptors.
Benbrook, Doris M; Chambon, Pierre; Rochette-Egly, Cécile; Asson-Batres, Mary Ann
2014-01-01
The discovery of retinoic acid receptors arose from research into how vitamins are essential for life. Early studies indicated that Vitamin A was metabolized into an active factor, retinoic acid (RA), which regulates RNA and protein expression in cells. Each step forward in our understanding of retinoic acid in human health was accomplished by the development and application of new technologies. Development cDNA cloning techniques and discovery of nuclear receptors for steroid hormones provided the basis for identification of two classes of retinoic acid receptors, RARs and RXRs, each of which has three isoforms, α, β and ɣ. DNA manipulation and crystallographic studies revealed that the receptors contain discrete functional domains responsible for binding to DNA, ligands and cofactors. Ligand binding was shown to induce conformational changes in the receptors that cause release of corepressors and recruitment of coactivators to create functional complexes that are bound to consensus promoter DNA sequences called retinoic acid response elements (RAREs) and that cause opening of chromatin and transcription of adjacent genes. Homologous recombination technology allowed the development of mice lacking expression of retinoic acid receptors, individually or in various combinations, which demonstrated that the receptors exhibit vital, but redundant, functions in fetal development and in vision, reproduction, and other functions required for maintenance of adult life. More recent advancements in sequencing and proteomic technologies reveal the complexity of retinoic acid receptor involvement in cellular function through regulation of gene expression and kinase activity. Future directions will require systems biology approaches to decipher how these integrated networks affect human stem cells, health, and disease.
The nuclear lamina regulates germline stem cell niche organization via modulation of EGFR signaling.
Chen, Haiyang; Chen, Xin; Zheng, Yixian
2013-07-03
Stem cell niche interactions have been studied extensively with regard to cell polarity and extracellular signaling. Less is known about the way in which signals and polarity cues integrate with intracellular structures to ensure appropriate niche organization and function. Here, we report that nuclear lamins function in the cyst stem cells (CySCs) of Drosophila testes to control the interaction of CySCs with the hub. This interaction is important for regulation of CySC differentiation and organization of the niche that supports the germline stem cells (GSCs). Lamin promotes nuclear retention of phosphorylated ERK in the CySC lineage by regulating the distribution of specific nucleoporins within the nuclear pores. Lamin-regulated nuclear epidermal growth factor (EGF) receptor signaling in the CySC lineage is essential for proliferation and differentiation of the GSCs and the transient amplifying germ cells. Thus, we have uncovered a role for the nuclear lamina in the integration of EGF signaling to regulate stem cell niche function. Copyright © 2013 Elsevier Inc. All rights reserved.
Reengineering ribosome export.
Lo, Kai-Yin; Johnson, Arlen W
2009-03-01
Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.
Lo, Kai-Yin
2009-01-01
Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820
Wirthmueller, Lennart; Zhang, Yan; Jones, Jonathan D G; Parker, Jane E
2007-12-04
Recognition of specific pathogen molecules inside the cell by nucleotide-binding domain and leucine-rich repeat (NB-LRR) receptors constitutes an important layer of innate immunity in plants. Receptor activation triggers host cellular reprogramming involving transcriptional potentiation of basal defenses and localized programmed cell death. The sites and modes of action of NB-LRR receptors are, however, poorly understood. Arabidopsis Toll/Interleukin-1 (TIR) type NB-LRR receptor RPS4 recognizes the bacterial type III effector AvrRps4. We show that epitope-tagged RPS4 expressed under its native regulatory sequences distributes between endomembranes and nuclei in healthy and AvrRps4-triggered tissues. RPS4 accumulation in the nucleus, mediated by a bipartite nuclear localization sequence (NLS) at its C terminus, is necessary for triggering immunity through authentic activation by AvrRps4 in Arabidopsis or as an effector-independent "deregulated" receptor in tobacco. A strikingly conserved feature of TIR-NB-LRR receptors is their recruitment of the nucleocytoplasmic basal-defense regulator EDS1 in resistance to diverse pathogens. We find that EDS1 is an indispensable component of RPS4 signaling and that it functions downstream of RPS4 activation but upstream of RPS4-mediated transcriptional reprogramming in the nucleus.
Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X
2017-10-01
The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.
MTA family of coregulators in nuclear receptor biology and pathology
Manavathi, Bramanandam; Singh, Kamini; Kumar, Rakesh
2007-01-01
Nuclear receptors (NRs) rely on coregulators (coactivators and corepressors) to modulate the transcription of target genes. By interacting with nucleosome remodeling complexes, NR coactivators potentiate transcription, whereas corepressors inhibit transcription of the target genes. Metastasis-associated proteins (MTA) represent an emerging family of novel NR coregulators. In general, MTA family members form independent nucleosome remodeling and deacetylation (NuRD) complexes and repress the transcription of different genes by recruiting histone deacetylases onto their target genes. However, MTA1 also acts as a coactivator in a promoter-context dependent manner. Recent findings that repression of estrogen receptor transactivation functions by MTA1, MTA1s, and MTA2 and regulation of MTA3 by estrogen signaling have indicated the significance of these proteins in NR signaling. Here, we highlight the action of MTA proteins on NR signaling and their roles in pathophysiological conditions. PMID:18174918
Recent advance in the design of small molecular modulators of estrogen-related receptors.
Lu, Xiaoyun; Peng, Lijie; Lv, Man; ding, Ke
2012-01-01
The estrogen-related receptors (ERRs), comprising ERRα, ERRβ and ERRγ, are the members of the nuclear receptor superfamily, which have been functionally implicated in estrogen signal pathway in various patterns. However, no natural ligand of ERRs has been identified to data, so identification of the synthetic modulators (inverse agonist and agonist) of ERRs would be highly effective in the treatment of estrogen-related pathologies, such as diabetes, breast cancer and osteoporosis. This review summarizes the structures and biological functions of ERR subtypes, and the progress in designing the small molecular modulators of ERRs as well as the detailed description of available co-crystal structures of the LBD of ERRs in three distinct states: unligand, inverse agonist bound, and agonist bound.
Ret Receptor: Functional Consequences of Oncogenic Rearrangements.
1996-10-01
incorporation of the thymidine analog 5- bromodeoxyuridine (BrdU) and its subsequent detection by immunostaining (33). Following nuclear ...other LexA- fussions to test for Ret/ptc2 specific interaction. Seventeen of the library plasmids yielded co-transformants which were 3- galactosidase...cellsexpressing the EGFR/Ret chimera and M. Pierotti for the Ret/ptc2 events in papillary thyroid carcinoma (28). In a nuclear micro- clone. injection assay the
Prostanoids and their receptors that modulate dendritic cell-mediated immunity.
Gualde, Norbert; Harizi, Hedi
2004-08-01
Dendritic cells (DC) are essential for the initiation of immune responses by capturing, processing and presenting antigens to T cells. In addition to their important role as professional APC, they are able to produce immunosuppressive and pro-inflammatory prostanoids from arachidonic acid (AA) by the action of cyclooxygenase (COX) enzymes. In an autocrine and paracrine fashion, the secreted lipid mediators subsequently modulate the maturation, cytokine production, Th-cell polarizing ability, chemokine receptor expression, migration, and apoptosis of these extremely versatile APC. The biological actions of prostanoids, including their effects on APC-mediated immunity and acute inflammatory responses, are exerted by G protein-coupled receptors on plasma membrane. Some COX metabolites act as anti-inflammatory lipid mediators by binding to nuclear receptors and modulating DC functions. Although the role of cytokines in DC function has been studied extensively, the effects of prostanoids on DC biology have only recently become the focus of investigation. This review summarizes the current knowledge about the role of prostanoids and their receptors in modulating DC function and the subsequent immune responses.
Nuclear receptor TLX inhibits TGF-β signaling in glioblastoma.
Johansson, Erik; Zhai, Qiwei; Zeng, Zhao-Jun; Yoshida, Takeshi; Funa, Keiko
2016-05-01
TLX (also called NR2E1) is an orphan nuclear receptor that maintains stemness of neuronal stem cells. TLX is highly expressed in the most malignant form of glioma, glioblastoma multiforme (GBM), and is important for the proliferation and maintenance of the stem/progenitor cells of the tumor. Transforming Growth Factor-β (TGF-β) is a cytokine regulating many different cellular processes such as differentiation, migration, adhesion, cell death and proliferation. TGF-β has an important function in cancer where it can work as either a tumor suppressor or oncogene, depending on the cancer type and stage of tumor development. Since glioblastoma often have dysfunctional TGF-β signaling we wanted to find out if there is any interaction between TLX and TGF-β in glioblastoma cells. We demonstrate that knockdown of TLX enhances the canonical TGF-β signaling response in glioblastoma cell lines. TLX physically interacts with and stabilizes Smurf1, which can ubiquitinate and target TGF-β receptor II for degradation, whereas knockdown of TLX leads to stabilization of TGF-β receptor II, increased nuclear translocation of Smad2/3 and enhanced expression of TGF-β target genes. The interaction between TLX and TGF-β may play an important role in the regulation of proliferation and tumor-initiating properties of glioblastoma cells. Copyright © 2016. Published by Elsevier Inc.
Targeting nuclear receptors for the treatment of fatty liver disease.
Tanaka, Naoki; Aoyama, Toshifumi; Kimura, Shioko; Gonzalez, Frank J
2017-11-01
Ligand-activated nuclear receptors, including peroxisome proliferator-activated receptor alpha (PPARα), pregnane X receptor, and constitutive androstane receptor, were first identified as key regulators of the responses against chemical toxicants. However, numerous studies using mouse disease models and human samples have revealed critical roles for these receptors and others, such as PPARβ/δ, PPARγ, farnesoid X receptor (FXR), and liver X receptor (LXR), in maintaining nutrient/energy homeostasis in part through modulation of the gut-liver-adipose axis. Recently, disorders associated with disrupted nutrient/energy homeostasis, e.g., obesity, metabolic syndrome, and non-alcoholic fatty liver disease (NAFLD), are increasing worldwide. Notably, in NAFLD, a progressive subtype exists, designated as non-alcoholic steatohepatitis (NASH) that is characterized by typical histological features resembling alcoholic steatohepatitis (ASH), and NASH/ASH are recognized as major causes of hepatitis virus-unrelated liver cirrhosis and hepatocellular carcinoma. Since hepatic steatosis is basically caused by an imbalance between fat/energy influx and utilization, abnormal signaling of these nuclear receptors contribute to the pathogenesis of fatty liver disease. Standard therapeutic interventions have not been fully established for fatty liver disease, but some new agents that activate or inhibit nuclear receptor signaling have shown promise as possible therapeutic targets. In this review, we summarize recent findings on the roles of nuclear receptors in fatty liver disease and discuss future perspectives to develop promising pharmacological strategies targeting nuclear receptors for NAFLD/NASH. Copyright © 2017 Elsevier Inc. All rights reserved.
Lin, Jhih-Rong; Liu, Zhonghao; Hu, Jianjun
2014-10-01
The binding affinity between a nuclear localization signal (NLS) and its import receptor is closely related to corresponding nuclear import activity. PTM-based modulation of the NLS binding affinity to the import receptor is one of the most understood mechanisms to regulate nuclear import of proteins. However, identification of such regulation mechanisms is challenging due to the difficulty of assessing the impact of PTM on corresponding nuclear import activities. In this study we proposed NIpredict, an effective algorithm to predict nuclear import activity given its NLS, in which molecular interaction energy components (MIECs) were used to characterize the NLS-import receptor interaction, and the support vector regression machine (SVR) was used to learn the relationship between the characterized NLS-import receptor interaction and the corresponding nuclear import activity. Our experiments showed that nuclear import activity change due to NLS change could be accurately predicted by the NIpredict algorithm. Based on NIpredict, we developed a systematic framework to identify potential PTM-based nuclear import regulations for human and yeast nuclear proteins. Application of this approach has identified the potential nuclear import regulation mechanisms by phosphorylation of two nuclear proteins including SF1 and ORC6. © 2014 Wiley Periodicals, Inc.
Hrycay, E G; Bandiera, S M
2009-12-01
The present review focuses on the expression, function and regulation of mouse cytochrome P450 (Cyp) enzymes. Information compiled for mouse Cyp enzymes is compared with data collected for human CYP enzymes. To date, approximately 40 pairs of orthologous mouse-human CYP genes have been identified that encode enzymes performing similar metabolic functions. Recent knowledge concerning the tissue expression of mouse Cyp enzymes from families 1 to 51 is summarized. The catalytic activities of microsomal, mitochondrial and recombinant mouse Cyp enzymes are discussed and their involvement in the metabolism of exogenous and endogenous compounds is highlighted. The role of nuclear receptors, such as the aryl hydrocarbon receptor, constitutive androstane receptor and pregnane X receptor, in regulating the expression of mouse Cyp enzymes is examined. Targeted disruption of selected Cyp genes has generated numerous Cyp null mouse lines used to decipher the role of Cyp enzymes in metabolic, toxicological and biological processes. In conclusion, the laboratory mouse is an indispensable model for exploring human CYP-mediated activities.
Genomic integration of ERRγ-HNF1β regulates renal bioenergetics and prevents chronic kidney disease.
Zhao, Juanjuan; Lupino, Katherine; Wilkins, Benjamin J; Qiu, Chengxiang; Liu, Jian; Omura, Yasuhiro; Allred, Amanda L; McDonald, Caitlin; Susztak, Katalin; Barish, Grant D; Pei, Liming
2018-05-22
Mitochondrial dysfunction is increasingly recognized as a critical determinant of both hereditary and acquired kidney diseases. However, it remains poorly understood how mitochondrial metabolism is regulated to support normal kidney function and how its dysregulation contributes to kidney disease. Here, we show that the nuclear receptor estrogen-related receptor gamma (ERRγ) and hepatocyte nuclear factor 1 beta (HNF1β) link renal mitochondrial and reabsorptive functions through coordinated epigenomic programs. ERRγ directly regulates mitochondrial metabolism but cooperatively controls renal reabsorption via convergent binding with HNF1β. Deletion of ERRγ in renal epithelial cells (RECs), in which it is highly and specifically expressed, results in severe renal energetic and reabsorptive dysfunction and progressive renal failure that recapitulates phenotypes of animals and patients with HNF1β loss-of-function gene mutations. Moreover, ERRγ expression positively correlates with renal function and is decreased in patients with chronic kidney disease (CKD). REC-ERRγ KO mice share highly overlapping renal transcriptional signatures with human patients with CKD. Together these findings reveal a role for ERRγ in directing independent and HNF1β-integrated programs for energy production and use essential for normal renal function and the prevention of kidney disease.
Yamada, Kana; Noguchi, Chisato; Kamitori, Kazuyo; Dong, Youyi; Hirata, Yuko; Hossain, Mohammad A; Tsukamoto, Ikuko; Tokuda, Masaaki; Yamaguchi, Fuminori
2012-02-01
Oxidative stress modulates the osteoclast differentiation via redox systems, and thioredoxin 1 (Trx) promotes the osteoclast formation by regulating the activity of transcription factors. The function of Trx is known to be regulated by its binding partner, thioredoxin-interacting protein (TXNIP). We previously reported that the expression of TXNIP gene is strongly induced by a rare sugar D-allose. In this study, we tested the hypothesis that D-allose could inhibit the osteoclast differentiation by regulating the Trx function. We used a murine Raw264 cell line that differentiates to the osteoclast by the receptor activator of nuclear factor-κB ligand (RANKL) treatment. The effect of sugars was evaluated by tartrate-resistant acid phosphatase staining. The expression and localization of TXNIP and Trx protein were examined by Western blotting and immunohistochemisty. The activity of the nuclear factor-κB, nuclear factor of activated T cells, and activator protein 1 transcription factors was measured by the luciferase reporter assay. The addition of D-allose (25 mmol/L) inhibited the osteoclast differentiation down to 9.53% ± 1.27% of a receptor activator of nuclear factor-κB ligand-only treatment. During the osteoclast differentiation, a significant increase of TNXIP was observed by D-allose treatment. The immunohistochemical analysis showed that both Trx and TXNIP existed in the nucleus in preosteoclasts and osteoclasts. Overexpression of TXNIP by plasmid transfection also inhibited the osteoclast formation, indicating the functional importance of TXNIP for the osteoclast differentiation. Transcriptional activity of the activator protein 1, nuclear factor-κB, and nuclear factor of activated T cells, known to be modulated by Trx, were inhibited by D-allose. In conclusion, our data indicate that D-allose is a strong inhibitor of the osteoclast differentiation, and this effect could be caused by TXNIP induction and a resulting inhibition of the Trx function. Copyright © 2012 Elsevier Inc. All rights reserved.
Phosphorylation of G Protein-Coupled Receptors: From the Barcode Hypothesis to the Flute Model.
Yang, Zhao; Yang, Fan; Zhang, Daolai; Liu, Zhixin; Lin, Amy; Liu, Chuan; Xiao, Peng; Yu, Xiao; Sun, Jin-Peng
2017-09-01
Seven transmembrane G protein-coupled receptors (GPCRs) are often phosphorylated at the C terminus and on intracellular loops in response to various extracellular stimuli. Phosphorylation of GPCRs by GPCR kinases and certain other kinases can promote the recruitment of arrestin molecules. The arrestins critically regulate GPCR functions not only by mediating receptor desensitization and internalization, but also by redirecting signaling to G protein-independent pathways via interactions with numerous downstream effector molecules. Accumulating evidence over the past decade has given rise to the phospho-barcode hypothesis, which states that ligand-specific phosphorylation patterns of a receptor direct its distinct functional outcomes. Our recent work using unnatural amino acid incorporation and fluorine-19 nuclear magnetic resonance ( 19 F-NMR) spectroscopy led to the flute model, which provides preliminary insight into the receptor phospho-coding mechanism, by which receptor phosphorylation patterns are recognized by an array of phosphate-binding pockets on arrestin and are translated into distinct conformations. These selective conformations are recognized by various effector molecules downstream of arrestin. The phospho-barcoding mechanism enables arrestin to recognize a wide range of phosphorylation patterns of GPCRs, contributing to their diverse functions. Copyright © 2017 by The Author(s).
The Orphan Nuclear Receptor TR4 Is a Vitamin A-activated Nuclear Receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, X. Edward; Suino-Powell, Kelly M.; Xu, Yong
2015-11-30
Testicular receptors 2 and 4 (TR2/4) constitute a subgroup of orphan nuclear receptors that play important roles in spermatogenesis, lipid and lipoprotein regulation, and the development of the central nervous system. Currently, little is known about the structural features and the ligand regulation of these receptors. Here we report the crystal structure of the ligand-free TR4 ligand binding domain, which reveals an autorepressed conformation. The ligand binding pocket of TR4 is filled by the C-terminal half of helix 10, and the cofactor binding site is occupied by the AF-2 helix, thus preventing ligand-independent activation of the receptor. However, TR4 exhibitsmore » constitutive transcriptional activity on multiple promoters, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, or ligand binding substantially reduce the transcriptional activity of this receptor. Importantly, both retinol and retinoic acid are able to promote TR4 to recruit coactivators and to activate a TR4-regulated reporter. These findings demonstrate that TR4 is a ligand-regulated nuclear receptor and suggest that retinoids might have a much wider regulatory role via activation of orphan receptors such as TR4.« less
Evolution of the nuclear receptor gene superfamily.
Laudet, V; Hänni, C; Coll, J; Catzeflis, F; Stéhelin, D
1992-01-01
Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplication from a common ancestor or if their different domains came from different independent sources. To test these possibilities we have constructed and compared the phylogenetic trees derived from two different domains of 30 nuclear receptor genes. The tree built from the DNA binding C domain clearly shows a common progeny of all nuclear receptors, which can be grouped into three subfamilies: (i) thyroid hormone and retinoic acid receptors, (ii) orphan receptors and (iii) steroid hormone receptors. The tree constructed from the central part of the E domain which is implicated in transcriptional regulation and dimerization shows the same distribution in three subfamilies but two groups of receptors are in a different position from that in the C domain tree: (i) the Drosophila knirps family genes have acquired very different E domains during evolution, and (ii) the vitamin D and ecdysone receptors, as well as the FTZ-F1 and the NGF1B genes, seem to have DNA binding and hormone binding domains belonging to different classes. These data suggest a complex evolutionary history for nuclear receptor genes in which gene duplication events and swapping between domains of different origins took place. PMID:1312460
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oumeddour, Abdelkader; CNRS, UMR 6293, GReD, F-63171 Aubiere; INSERM, UMR 1103, GReD, F-63171 Aubiere
Highlights: • Part of the neonatal effect of DES on testis needs the presence of Lxrα/β. • Some DES-induced pathways are blocked in Lxr-deficient mice. • Lxr-deficient mice analysis defines DES-target genes protected by Lxr. - Abstract: Liver X receptors LXRα (NR1H3) and LXRβ (NR1H2) are transcription factors belonging to the nuclear receptor superfamily, activated by specific oxysterols, oxidized derivatives of cholesterol. These receptors are involved in the regulation of testis physiology. Lxr-deficient mice pointed to the physiological roles of these nuclear receptors in steroid synthesis, lipid homeostasis and germ cell apoptosis and proliferation. Diethylstilbestrol (DES) is a synthetic estrogenmore » considered as an endocrine disruptor that affects the functions of the testis. Various lines of evidences have made a clear link between estrogens, their nuclear receptors ERα (NR3A1) and ERβ (NR3A2), and Lxrα/β. As LXR activity could also be regulated by the nuclear receptor small heterodimer partner (SHP, NR0A2) and DES could act through SHP, we wondered whether LXR could be targeted by estrogen-like endocrine disruptors such as DES. For that purpose, wild-type and Lxr-deficient mice were daily treated with 0.75 μg DES from days 1 to 5 after birth. The effects of DES were investigated at 10 or 45 days of age. We demonstrated that DES induced a decrease of the body mass at 10 days only in the Lxr-deficient mice suggesting a protective effect of Lxr. We defined three categories of DES-target genes in testis: those whose accumulation is independent of Lxr; those whose accumulation is enhanced by the lack of both Lxrα/β; those whose accumulation is repressed by the absence of Lxrα/β. Lipid accumulation is also modified by neonatal DES injection. Lxr-deficient mice present different lipid profiles, demonstrating that DES could have its effects in part due to Lxrα/β. Altogether, our study shows that both nuclear receptors Lxrα and Lxrβ are not only basally important for testicular physiology but could also have a preventive effect against estrogen-like endocrine disruptors.« less
Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni
2017-08-01
Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.
Peroxisome proliferator-activated receptors for hypertension
Usuda, Daisuke; Kanda, Tsugiyasu
2014-01-01
Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors belonging to the nuclear receptor superfamily, which is composed of four members encoded by distinct genes (α, β, γ, and δ). The genes undergo transactivation or transrepression under specific mechanisms that lead to the induction or repression of target gene expression. As is the case with other nuclear receptors, all four PPAR isoforms contain five or six structural regions in four functional domains; namely, A/B, C, D, and E/F. PPARs have many functions, particularly functions involving control of vascular tone, inflammation, and energy homeostasis, and are, therefore, important targets for hypertension, obesity, obesity-induced inflammation, and metabolic syndrome in general. Hence, PPARs also represent drug targets, and PPARα and PPARγ agonists are used clinically in the treatment of dyslipidemia and type 2 diabetes mellitus, respectively. Because of their pleiotropic effects, they have been identified as active in a number of diseases and are targets for the development of a broad range of therapies for a variety of diseases. It is likely that the range of PPARγ agonist therapeutic actions will result in novel approaches to lifestyle and other diseases. The combination of PPARs with reagents or with other cardiovascular drugs, such as diuretics and angiotensin II receptor blockers, should be studied. This article provides a review of PPAR isoform characteristics, a discussion of progress in our understanding of the biological actions of PPARs, and a summary of PPAR agonist development for patient management. We also include a summary of the experimental and clinical evidence obtained from animal studies and clinical trials conducted to evaluate the usefulness and effectiveness of PPAR agonists in the treatment of lifestyle-related diseases. PMID:25228953
Garattini, Enrico; Bolis, Marco; Gianni', Maurizio; Paroni, Gabriela; Fratelli, Maddalena; Terao, Mineko
2016-07-05
Breast-cancer is heterogeneous and consists of various groups with different biological characteristics. Innovative pharmacological approaches accounting for this heterogeneity are needed. The forty eight human Nuclear-Hormone-Receptors are ligand-dependent transcription-factors and are classified into Endocrine-Receptors, Adopted-Orphan-Receptors (Lipid-sensors and Enigmatic-Orphans) and Orphan-receptors. Nuclear-Receptors represent ideal targets for the design/synthesis of pharmacological ligands. We provide an overview of the literature available on the expression and potential role played by Lipid-sensors, Enigmatic-Orphans and Orphan-Receptors in breast-cancer. The data are complemented by an analysis of the expression levels of each selected Nuclear-Receptor in the PAM50 breast-cancer groups, following re-elaboration of the data publicly available. The major aim is to support the idea that some of the Nuclear-Receptors represent largely unexploited therapeutic-targets in breast-cancer treatment/chemo-prevention. On the basis of our analysis, we conclude that the Lipid-Sensors, NR1C3, NR1H2 and NR1H3 are likely to be onco-suppressors in breast-cancer. The Enigmatic-Orphans, NR1F1 NR2A1 and NR3B3 as well as the Orphan-Receptors, NR0B1, NR0B2, NR1D1, NR2F1, NR2F2 and NR4A3 exert a similar action. These Nuclear-Receptors represent candidates for the development of therapeutic strategies aimed at increasing their expression or activating them in tumor cells. The group of Nuclear-Receptors endowed with potential oncogenic properties consists of the Lipid-Sensors, NR1C2 and NR1I2, the Enigmatic-Orphans, NR1F3, NR3B1 and NR5A2, as well as the Orphan-Receptors, NR2E1, NR2E3 and NR6A1. These oncogenic Nuclear-Receptors should be targeted with selective antagonists, reverse-agonists or agents/strategies capable of reducing their expression in breast-cancer cells.
Molecular characterization of human thyroid hormone receptor β isoform 4.
Moriyama, Kenji; Yamamoto, Hiroyuki; Futawaka, Kumi; Atake, Asami; Kasahara, Masato; Tagami, Tetsuya
2016-01-01
Thyroid hormone exerts a pleiotropic effect on development, differentiation, and metabolism through thyroid hormone receptor (TR). A novel thyroid hormone receptor β isoform (TRβ4) was cloned using PCR from a human pituitary cDNA library as a template. We report here the characterization of TRβ4 from a molecular basis. Temporal expression of TRβ4 during the fetal period is abundant in the brain and kidney, comparable with the adult pattern. Western blot analysis revealed that TRs are ubiquitination labile proteins, while TRβ1 is potentially stable. TRβ1, peroxisome proliferator-activated receptors (PPAR), and vitamin D receptor (VDR), which belong to class II transcription factors that function via the formation of heterodimeric complexes with retinoid X receptor (RXR), were suppressed by TRβ4 in a dose-dependent manner. Thus, TRβ4 exhibits ligand-independent transcriptional silencing, possibly as a substitute for dimerized RXR. In this study, TRβ1 and TRβ4 transcripts were detected in several cell lines. Quantitative RT-PCR assay showed that the expression of TRβ4 in human embryonic carcinoma cells of the testis was suppressed by sex hormone in a reciprocal manner to TRβ1. In contrast, TRβ4 was expressed under a high dose of triiodothyronine (T3) in a reciprocal manner to TRβ1. Finally, in transiently transfected NIH-3T3 cells, green fluorescence protein (GFP)-tagged TRβ4 was mostly nuclear in both the absence and the presence of T3. By mutating defined regions of both TRβs, we found that both TRβ1 and TRβ4 had altered nuclear/cytoplasmic distribution as compared with wild-type, and different to T3 and the nuclear receptor corepressor (NCoR). Thus, site-specific DNA binding is not essential for maintaining TRβs within the nucleus.
Kremoser, Claus; Albers, Michael; Burris, Thomas P; Deuschle, Ulrich; Koegl, Manfred
2007-10-01
Drugs that target nuclear receptors are clinically, as well as commercially, successful. Their widespread use, however, is limited by an inherent propensity of nuclear receptors to trigger beneficial, as well as adverse, pharmacological effects upon drug activation. Hence, selective drugs that display reduced adverse effects, such as the selective estrogen receptor modulator (SERM) Raloxifene, have been developed by guidance through classical cell culture assays and animal trials. Full agonist and selective modulator nuclear receptor drugs, in general, differ by their ability to recruit certain cofactors to the receptor protein. Hence, systematic cofactor profiling is advancing into an approach for the rationally guided identification of selective NR modulators (SNuRMs) with improved therapeutic ratio.
Nuclear receptor TLX inhibits TGF-β signaling in glioblastoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johansson, Erik; Zhai, Qiwei; Zeng, Zhao-jun
TLX (also called NR2E1) is an orphan nuclear receptor that maintains stemness of neuronal stem cells. TLX is highly expressed in the most malignant form of glioma, glioblastoma multiforme (GBM), and is important for the proliferation and maintenance of the stem/progenitor cells of the tumor. Transforming Growth Factor-β (TGF-β) is a cytokine regulating many different cellular processes such as differentiation, migration, adhesion, cell death and proliferation. TGF-β has an important function in cancer where it can work as either a tumor suppressor or oncogene, depending on the cancer type and stage of tumor development. Since glioblastoma often have dysfunctional TGF-βmore » signaling we wanted to find out if there is any interaction between TLX and TGF-β in glioblastoma cells. We demonstrate that knockdown of TLX enhances the canonical TGF-β signaling response in glioblastoma cell lines. TLX physically interacts with and stabilizes Smurf1, which can ubiquitinate and target TGF-β receptor II for degradation, whereas knockdown of TLX leads to stabilization of TGF-β receptor II, increased nuclear translocation of Smad2/3 and enhanced expression of TGF-β target genes. The interaction between TLX and TGF-β may play an important role in the regulation of proliferation and tumor-initiating properties of glioblastoma cells. - Highlights: • TLX knockdown enhances TGF-β dependent Smad signaling in glioblastoma cells • TLX knockdown increases the protein level of TGF-β receptor II. • TLX stabilizes and retains Smurf1 in the cytoplasm. • TLX enhances Smurf1-dependent ubiquitination and degradation of TGF-β receptor II.« less
Non-IgE mediated mast cell activation.
Redegeld, Frank A; Yu, Yingxin; Kumari, Sangeeta; Charles, Nicolas; Blank, Ulrich
2018-03-01
Mast cells (MCs) are innate immune cells that are scattered in tissues throughout the organism being particularly abundant at sites exposed to the environment such as the skin and mucosal surfaces. Generally known for their role in IgE-mediated allergies, they have also important functions in the maintenance of tissue integrity by constantly sensing their microenvironment for signals by inflammatory triggers that can comprise infectious agents, toxins, hormones, alarmins, metabolic states, etc. When triggered their main function is to release a whole set of inflammatory mediators, cytokines, chemokines, and lipid products. This allows them to organize the ensuing innate immune and inflammatory response in tight coordination with resident tissue cells, other rapidly recruited immune effector cells as well as the endocrine and exocrine systems of the body. To complete these tasks, MCs are endowed with a large repertoire of receptors allowing them to respond to multiple stimuli or directly interact with other cells. Here we review some of the receptors expressed on MCs (ie, receptors for Immunoglobulins, pattern recognition receptors, nuclear receptors, receptors for alarmins, and a variety of other receptors) and discuss their functional implication in the immune and inflammatory response focusing on non-IgE-mediated activation mechanisms. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
G protein-coupled receptor 30 in tumor development.
Wang, Dengfeng; Hu, Lina; Zhang, Guonan; Zhang, Lin; Chen, Chen
2010-08-01
Estrogen plays several important physiological and pathological functions in not only reproductive system but many other systems as well. Its transcriptional activation has been traditionally described as being mediated by classic nuclear estrogen receptors (ERs). It is however established recently that a novel functional estrogen transmembrane receptor, G protein-coupled receptor 30 (GPR30), modulates both rapid non-genomic events and genomic transcriptional events of estrogen. It has been demonstrated that GPR30 promotes the progress of estrogen-related tumors through mitogen-activated protein kinase (MAPK) signaling pathways. Effects mediated by GPR30 are maintained when classic ERs are absent or blocked. In addition, GPR30 is involved in drug resistance, which is often occurring during cancer treatments. All these new findings strongly imply that GPR30 may be an important therapeutic target for estrogen-related tumors. Simultaneously blocking both GPR30 and classic ERs may be a better strategy for the treatment of estrogen-related tumors.
Goto, Tsuyoshi; Kim, Young-Il; Takahashi, Nobuyuki; Kawada, Teruo
2013-01-01
Obesity causes excess fat accumulation in various tissues, most notoriously in the adipose tissue, along with other insulin-responsive organs such as skeletal muscle and the liver, which predisposes an individual to the development of metabolic abnormalities. The molecular mechanisms underlying obesity-induced metabolic abnormalities have not been completely elucidated; however, in recent years, the search for therapies to prevent the development of obesity and obesity-associated metabolic disorders has increased. It is known that several nuclear receptors, when activated by specific ligands, regulate carbohydrate and lipid metabolism at the transcriptional level. The expression of lipid metabolism-related enzymes is directly regulated by the activity of various nuclear receptors via their interaction with specific response elements in promoters of those genes. Many natural compounds act as ligands of nuclear receptors and regulate carbohydrate and lipid metabolism by regulating the activities of these nuclear receptors. In this review, we describe our current knowledge of obesity, the role of lipid-sensing nuclear receptors in energy metabolism, and several examples of food factors that act as agonists or antagonists of nuclear receptors, which may be useful for the management of obesity and the accompanying energy metabolism abnormalities. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nuclear export of RNA: Different sizes, shapes and functions.
Williams, Tobias; Ngo, Linh H; Wickramasinghe, Vihandha O
2018-03-01
Export of protein-coding and non-coding RNA molecules from the nucleus to the cytoplasm is critical for gene expression. This necessitates the continuous transport of RNA species of different size, shape and function through nuclear pore complexes via export receptors and adaptor proteins. Here, we provide an overview of the major RNA export pathways in humans, highlighting the similarities and differences between each. Its importance is underscored by the growing appreciation that deregulation of RNA export pathways is associated with human diseases like cancer. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Jinmei; Wang Xuefeng; Xi Zhiqin
2006-10-06
Purpose: TRAP220 (thyroid hormone receptor-associated protein) functions as a coactivator for nuclear receptors and stimulates transcription by recruiting the TRAP mediator complex to hormone responsive promoter regions. Thus, TRAP220 enhances the function of thyroid/steroid hormone receptors such as thyroid hormone and oestrogen receptors. This study investigated the expression of TRAP220 mRNA and protein level in epileptic brains comparing with human control. Methods: We examined the expression of TRAP220 mRNA and protein levels in temporal lobes from patients with chronic pharmacoresistant epilepsy who have undergone surgery. Results: Expression of TRAP220 mRNA and protein was shown to be decreased significantly in themore » temporal cortex of the patients with epilepsy. Conclusions: Our work showed that a decrease in TRAP220 mRNA and protein levels may be involved in the pathophysiology of epilepsy and may be associated with impairment of the brain caused by frequent seizures.« less
Ali, Ferhana Y; Hall, Matthew G; Desvergne, Béatrice; Warner, Timothy D; Mitchell, Jane A
2009-11-01
Peroxisome proliferator-activated receptor beta/delta (PPARbeta/delta) is a nuclear receptor found in platelets. PPARbeta/delta agonists acutely inhibit platelet function within a few minutes of addition. As platelets are anucleated, the effects of PPARbeta/delta agonists on platelets must be nongenomic. Currently, the particular role of PPARbeta/delta receptors and their intracellular signaling pathways in platelets are not known. We have used mice lacking PPARbeta/delta (PPARbeta/delta(-/-)) to show the effects of the PPARbeta/delta agonist GW501516 on platelet adhesion and cAMP levels are mediated specifically by PPARbeta/delta, however GW501516 had no PPARbeta/delta-specific effect on platelet aggregation. Studies in human platelets showed that PKCalpha, which can mediate platelet activation, was bound and repressed by PPARbeta/delta after platelets were treated with GW501516. These data provide evidence of a novel mechanism by which PPAR receptors influence platelet activity and thereby thrombotic risk.
Bernardo, Travis J.; Dubrovsky, Edward B.
2012-01-01
Juvenile hormone (JH) has been implicated in many developmental processes in holometabolous insects, but its mechanism of signaling remains controversial. We previously found that in Drosophila Schneider 2 cells, the nuclear receptor FTZ-F1 is required for activation of the E75A gene by JH. Here, we utilized insect two-hybrid assays to show that FTZ-F1 interacts with two JH receptor candidates, the bHLH-PAS paralogs MET and GCE, in a JH-dependent manner. These interactions are severely reduced when helix 12 of the FTZ-F1 activation function 2 (AF2) is removed, implicating AF2 as an interacting site. Through homology modeling, we found that MET and GCE possess a C-terminal α-helix featuring a conserved motif LIXXL that represents a novel nuclear receptor (NR) box. Docking simulations supported by two-hybrid experiments revealed that FTZ-F1·MET and FTZ-F1·GCE heterodimer formation involves a typical NR box-AF2 interaction but does not require the canonical charge clamp residues of FTZ-F1 and relies primarily on hydrophobic contacts, including a unique interaction with helix 4. Moreover, we identified paralog-specific features, including a secondary interaction site found only in MET. Our findings suggest that a novel NR box enables MET and GCE to interact JH-dependently with the AF2 of FTZ-F1. PMID:22249180
The estrogen-related receptors and the adipocyte.
Carnesecchi, Julie; Vanacker, Jean-Marc
2013-08-01
The estrogen-related receptors (ERRα, β, and γ) are orphan members of the nuclear receptor superfamily. ERRα and γ are highly expressed in tissues displaying elevated energy demands and are involved in several aspects of energetic metabolism, which they regulate mostly in association with members of the PGC-1 coactivator family. These activities have mostly been documented in the liver, heart, or skeletal muscle. ERRα and γ are also highly expressed in adipocytes. Their precise roles in this cell type are less documented, although published data indicate that they contribute to cell differentiation as well as functionality. This review describes these activities.
Kiss, Mate; Czimmerer, Zsolt; Nagy, Gergely; Bieniasz-Krzywiec, Pawel; Ehling, Manuel; Pap, Attila; Poliska, Szilard; Boto, Pal; Tzerpos, Petros; Horvath, Attila; Kolostyak, Zsuzsanna; Daniel, Bence; Szatmari, Istvan; Mazzone, Massimiliano; Nagy, Laszlo
2017-01-01
Retinoid X receptor (RXR) regulates several key functions in myeloid cells, including inflammatory responses, phagocytosis, chemokine secretion, and proangiogenic activity. Its importance, however, in tumor-associated myeloid cells is unknown. In this study, we demonstrate that deletion of RXR in myeloid cells enhances lung metastasis formation while not affecting primary tumor growth. We show that RXR deficiency leads to transcriptomic changes in the lung myeloid compartment characterized by increased expression of prometastatic genes, including important determinants of premetastatic niche formation. Accordingly, RXR-deficient myeloid cells are more efficient in promoting cancer cell migration and invasion. Our results suggest that the repressive activity of RXR on prometastatic genes is mediated primarily through direct DNA binding of the receptor along with nuclear receptor corepressor (NCoR) and silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) corepressors and is largely unresponsive to ligand activation. In addition, we found that expression and transcriptional activity of RXRα is down-modulated in peripheral blood mononuclear cells of patients with lung cancer, particularly in advanced and metastatic disease. Overall, our results identify RXR as a regulator in the myeloid cell-assisted metastatic process and establish lipid-sensing nuclear receptors in the microenvironmental regulation of tumor progression. PMID:28923935
Alenghat, Theresa; Yu, Jiujiu; Lazar, Mitchell A
2006-01-01
Unliganded thyroid hormone receptor (TR) actively represses transcription via the nuclear receptor corepressor (N-CoR)/histone deacetylase 3 (HDAC3) complex. Although transcriptional activation by liganded receptors involves chromatin remodeling, the role of ATP-dependent remodeling in receptor-mediated repression is unknown. Here we report that SNF2H, the mammalian ISWI chromatin remodeling ATPase, is critical for repression of a genomically integrated, TR-regulated reporter gene. N-CoR and HDAC3 are both required for recruitment of SNF2H to the repressed gene. SNF2H does not interact directly with the N-CoR/HDAC3 complex, but binds to unacetylated histone H4 tails, suggesting that deacetylase activity of the corepressor complex is critical to SNF2H function. Indeed, HDAC3 as well as SNF2H are required for nucleosomal organization on the TR target gene. Consistent with these findings, reduction of SNF2H induces expression of an endogenous TR-regulated gene, dio1, in liver cells. Thus, although not apparent from studies of transiently transfected reporter genes, gene repression by TR involves the targeting of chromatin remodeling factors to repressed genes by the HDAC activity of nuclear receptor corepressors. PMID:16917504
Lee, Sangho; Privalsky, Martin L.
2009-01-01
Nuclear receptors are ligand-regulated transcription factors that regulate key aspects of metazoan development, differentiation, and homeostasis. Nuclear receptors recognize target genes by binding to specific DNA recognition sequences, denoted hormone response elements (HREs). Many nuclear receptors can recognize HREs as either homodimers or heterodimers. Retinoid X receptors (RXRs), in particular, serve as important heterodimer partners for many other nuclear receptors, including thyroid hormone receptors (TRs), and RXR/TR heterodimers have been proposed to be the primary mediators of target gene regulation by T3 hormone. Here, we report that the retinoic acid receptors (RARs), a distinct class of nuclear receptors, are also efficient heterodimer partners for TRs. These RAR/TR heterodimers form with similar affinities as RXR/TR heterodimers on an assortment of consensus and natural HREs, and preferentially assemble with the RAR partner 5′ of the TR moiety. The corepressor and coactivator recruitment properties of these RAR/TR heterodimers and their transcriptional activities in vivo are distinct from those observed with the corresponding RXR heterodimers. Our studies indicate that RXRs are not unique in their ability to partner with TRs, and that RARs can also serve as robust heterodimer partners and combinatorial regulators of T3-modulated gene expression. PMID:15650024
Cheng, Behling; Al-Shammari, Fatema H; Ghader, Isra'a A; Sequeira, Fatima; Thakkar, Jitendra; Mathew, Thazhumpal C
2017-07-01
Adrenal gland reportedly expresses many nuclear receptors that are known to heterodimerize with retinoid-X-receptor (RXR) for functions, but the information regarding the glandular RXR is not adequate. Studies of rat adrenal homogenate by Western blotting revealed three RXR proteins: RXRα (55kDa), RXRβ (47kDa) and RXR (56kDa). RXRγ was not detectable. After fractionation, RXRα was almost exclusively localized in the nuclear fraction. In comparison, substantial portions of RXRβ and RXR were found in both nuclear and post-nuclear particle fractions, suggesting genomic and non-genomic functions. Cells immunostained for RXRα were primarily localized in zona fasciculata (ZF) and medulla, although some stained cells were found in zona glomerulosa (ZG) and zona reticularis (ZR). In contrast, cells immunostained for RXRβ were concentrated principally in ZG, although some stained cells were seen in ZR, ZF, and medulla (in descending order, qualitatively). Analysis of adrenal lipid extracts by LC/MS did not detect 9-cis-retinoic acid (a potent RXR-ligand) but identified all-trans retinoic acid. Since C20 and C22 polyunsaturated fatty acids (PUFAs) can also activate RXR, subcellular availabilities of unesterified fatty acids were investigated by GC/MS. As results, arachidonic acid (C20:4), adrenic acid (C22:4), docosapentaenoic acid (C22:5), and cervonic acid (C22:6) were detected in the lipids extracted from each subcellular fraction. Thus, the RXR-agonizing PUFAs are available in all the main subcellular compartments considerably. The present findings not only shed light on the adrenal network of RXRs but also provide baseline information for further investigations of RXR heterodimers in the regulation of adrenal steroidogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Smet-Nocca, Caroline; Page, Adeline; Cantrelle, François-Xavier; Nikolakaki, Eleni; Landrieu, Isabelle; Giannakouros, Thomas
2018-04-01
Lamin B Receptor (LBR) is an integral protein of the interphase inner nuclear membrane that is implicated in chromatin anchorage to the nuclear envelope. Phosphorylation of a stretch of arginine-serine (RS) dipeptides in the amino-terminal nucleoplasmic domain of LBR regulates the interactions of the receptor with other nuclear proteins, DNA and RNA and thus modulates tethering of heterochromatin to the nuclear envelope. While phosphorylation has been extensively studied, very little is known about other post-translational modifications of the protein. There is only one report on the O-β-linked N-acetyl-glucosaminylation (O-GlcNAcylation) of a serine residue downstream of the RS domain of rat LBR. In the present study we identify additional O-GlcNAcylation sites by using as substrates of O-β-N-acetylglucosaminyltransferase (OGT) a set of peptides containing the entire LBR RS domain or parts of it as well as flanking sequences. The in vitro activity of OGT was assessed by tandem mass spectrometry and NMR spectroscopy. Furthermore, we provide evidence that O-GlcNAcylation hampers DNA binding while it marginally affects RS domain phosphorylation mediated by SRPK1, Akt2 and cdk1 kinases. Our methodology providing a quantitative description of O-GlcNAc patterns based on a combination of mass spectrometry and high resolution NMR spectroscopy on short peptide substrates allows subsequent functional analyses. Hence, our approach is of general interest to a wide audience of biologists aiming at deciphering the functional role of O-GlcNAc glycosylation and its crosstalk with phosphorylation. Copyright © 2018 Elsevier B.V. All rights reserved.
Clinical validation of nuclear factor kappa B expression in invasive breast cancer.
Agrawal, Anil Kumar; Pielka, Ewa; Lipinski, Artur; Jelen, Michal; Kielan, Wojciech; Agrawal, Siddarth
2018-01-01
Breast cancer is the most commonly diagnosed cancer in Polish women. The expression of transcription nuclear factor kappa B, a key inducer of inflammatory response promoting carcinogenesis and cancer progression in breast cancer, is not well-established. We assessed the nuclear factor kappa B expression in a total of 119 invasive breast carcinomas and 25 healthy control samples and correlated this expression pattern with several clinical and pathologic parameters including histologic type and grade, tumor size, lymph node status, estrogen receptor status, and progesterone receptor status. The data used for the analysis were derived from medical records. An immunohistochemical analysis of nuclear factor kappa B, estrogen receptor, and progesterone receptor was carried out and evaluation of stainings was performed. The expression of nuclear factor kappa B was significantly higher than that in the corresponding healthy control samples. No statistical difference was demonstrated in nuclear factor kappa B expression in relation to age, menopausal status, lymph node status, tumor size and location, grade and histologic type of tumor, and hormonal status (estrogen receptor and progesterone receptor). Nuclear factor kappa B is significantly overexpressed in invasive breast cancer tissues. Although nuclear factor kappa B status does not correlate with clinicopathological findings, it might provide important additional information on prognosis and become a promising object for targeted therapy.
Occhipinti, Laura; Chang, Yiming; Altvater, Martin; Menet, Anna M.; Kemmler, Stefan; Panse, Vikram G.
2013-01-01
Multiple export receptors passage bound pre-ribosomes through nuclear pore complexes (NPCs) by transiently interacting with the Phe-Gly (FG) meshwork of their transport channels. Here, we reveal how the non-FG interacting yeast mRNA export factor Gly-Leu-FG lethal 2 (Gle2) functions in the export of the large pre-ribosomal subunit (pre-60S). Structure-guided studies uncovered conserved platforms used by Gle2 to export pre-60S: an uncharacterized basic patch required to bind pre-60S, and a second surface that makes non-FG contacts with the nucleoporin Nup116. A basic patch mutant of Gle2 is able to function in mRNA export, but not pre-60S export. Thus, Gle2 provides a distinct interaction platform to transport pre-60S to the cytoplasm. Notably, Gle2’s interaction platforms become crucial for pre-60S export when FG-interacting receptors are either not recruited to pre-60S or are impaired. We propose that large complex cargos rely on non-FG as well as FG-interactions for their efficient translocation through the nuclear pore complex channel. PMID:23907389
Beard, Richard S; Reynolds, Jason J; Bearden, Shawn E
2012-01-01
Elevated plasma homocysteine (Hcy) is an independent risk factor for vascular disease and stroke in part by causing generalized endothelial dysfunction. A receptor that is sensitive to Hcy and its intracellular signaling systems has not been identified. β-catenin is a pleiotropic regulator of transcription and cell function. Using a brain microvascular endothelial cell line (bEnd.3), we tested the hypothesis that Hcy causes receptor-dependent nuclear translocation of β-catenin. Hcy increased phosphorylation of Y731 on vascular endothelial cadherin (VE-cadherin), a site involved in coupling β-catenin to VE-cadherin. This was blocked by inhibition of either metabotropic glutamate receptor 5 (mGluR5) or ionotropic glutamate receptor (NMDAr) and by shRNA knockdown of mGluR5. Expression of these receptors was confirmed by flow cytometry, immunohistochemistry, and western blotting. Directed pharmacology with specific agonists elucidated a signaling cascade where Hcy activates mGluR5 which activates NMDAr with subsequent PKC activation and uncoupling of the VE-cadherin/β-catenin complex. Moreover, Hcy caused a shift in localization of β-catenin from membrane-bound VE-cadherin to the cell nucleus, where it bound DNA, including a regulatory region of the gene for claudin-5, leading to reduced expression of claudin-5. Nuclear localization, DNA binding of β-catenin, and reduced claudin-5 expression were blocked by inhibition of mGluR5. Knockdown of mGluR5 expression with shRNA also rescued claudin-5 expression from the effects of Hcy treatment. These data uniquely identify mGluR5 as a master switch that drives β-catenin nuclear localization in vascular endothelium and regulates cell-cell coupling in response to elevated Hcy levels. These studies dissect a pharmacological opportunity for developing new therapeutic strategies in HHcy. Copyright © 2012 Elsevier Inc. All rights reserved.
Structural and Functional Impacts of ER Coactivator Sequential Recruitment.
Yi, Ping; Wang, Zhao; Feng, Qin; Chou, Chao-Kai; Pintilie, Grigore D; Shen, Hong; Foulds, Charles E; Fan, Guizhen; Serysheva, Irina; Ludtke, Steven J; Schmid, Michael F; Hung, Mien-Chie; Chiu, Wah; O'Malley, Bert W
2017-09-07
Nuclear receptors recruit multiple coactivators sequentially to activate transcription. This "ordered" recruitment allows different coactivator activities to engage the nuclear receptor complex at different steps of transcription. Estrogen receptor (ER) recruits steroid receptor coactivator-3 (SRC-3) primary coactivator and secondary coactivators, p300/CBP and CARM1. CARM1 recruitment lags behind the binding of SRC-3 and p300 to ER. Combining cryo-electron microscopy (cryo-EM) structure analysis and biochemical approaches, we demonstrate that there is a close crosstalk between early- and late-recruited coactivators. The sequential recruitment of CARM1 not only adds a protein arginine methyltransferase activity to the ER-coactivator complex, it also alters the structural organization of the pre-existing ERE/ERα/SRC-3/p300 complex. It induces a p300 conformational change and significantly increases p300 HAT activity on histone H3K18 residues, which, in turn, promotes CARM1 methylation activity on H3R17 residues to enhance transcriptional activity. This study reveals a structural role for a coactivator sequential recruitment and biochemical process in ER-mediated transcription. Copyright © 2017 Elsevier Inc. All rights reserved.
Activation of RXR–PPAR heterodimers by organotin environmental endocrine disruptors
le Maire, Albane; Grimaldi, Marina; Roecklin, Dominique; Dagnino, Sonia; Vivat-Hannah, Valérie; Balaguer, Patrick; Bourguet, William
2009-01-01
The nuclear receptor retinoid X receptor-α (RXR-α)–peroxisome proliferator-activated receptor-γ (PPAR-γ) heterodimer was recently reported to have a crucial function in mediating the deleterious effects of organotin compounds, which are ubiquitous environmental contaminants. However, because organotins are unrelated to known RXR-α and PPAR-γ ligands, the mechanism by which these compounds bind to and activate the RXR-α–PPAR-γ heterodimer at nanomolar concentrations has remained elusive. Here, we show that tributyltin (TBT) activates all three RXR–PPAR-α, -γ, -δ heterodimers, primarily through its interaction with RXR. In addition, the 1.9 Å resolution structure of the RXR-α ligand-binding domain in complex with TBT shows a covalent bond between the tin atom and residue Cys 432 of helix H11. This interaction largely accounts for the high binding affinity of TBT, which only partly occupies the RXR-α ligand-binding pocket. Our data allow an understanding of the binding and activation properties of the various organotins and suggest a mechanism by which these tin compounds could affect other nuclear receptor signalling pathways. PMID:19270714
Nuclear DAMP complex-mediated RAGE-dependent macrophage cell death
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Ruochan; Department of Infectious Diseases and State Key Lab of Viral Hepatitis, Xiangya Hospital, Central South University, Changsha, Hunan 410008; Fu, Sha
High mobility group box 1 (HMGB1), histone, and DNA are essential nuclear components involved in the regulation of chromosome structure and function. In addition to their nuclear function, these molecules act as damage-associated molecular patterns (DAMPs) alone or together when released extracellularly. The synergistic effect of these nuclear DNA-HMGB1-histone complexes as DAMP complexes (nDCs) on immune cells remains largely unexplored. Here, we demonstrate that nDCs limit survival of macrophages (e.g., RAW264.7 and peritoneal macrophages) but not cancer cells (e.g., HCT116, HepG2 and Hepa1-6). nDCs promote production of inflammatory tumor necrosis factor α (TNFα) release, triggering reactive oxygen species-dependent apoptosis andmore » necrosis. Moreover, the receptor for advanced glycation end products (RAGE), but not toll-like receptor (TLR)-4 and TLR-2, was required for Akt-dependent TNFα release and subsequent cell death following treatment with nDCs. Genetic depletion of RAGE by RNAi, antioxidant N-Acetyl-L-cysteine, and TNFα neutralizing antibody significantly attenuated nDC-induced cell death. These findings provide evidence supporting novel signaling mechanisms linking nDCs and inflammation in macrophage cell death. - Highlights: • Nuclear DAMP complexes (nDCs) selectively induce cell death in macrophages, but not cancer cells. • TNFα-mediated oxidative stress is required for nDC-induced death. • RAGE-mediated Akt activation is required for nDC-induced TNFα release. • Blocking RAGE and TNFα inhibits nDC-induced macrophage cell death.« less
Queisser, Gillian; Wiegert, Simon; Bading, Hilmar
2011-01-01
Neuronal morphology plays an essential role in signal processing in the brain. Individual neurons can undergo use-dependent changes in their shape and connectivity, which affects how intracellular processes are regulated and how signals are transferred from one cell to another in a neuronal network. Calcium is one of the most important intracellular second messengers regulating cellular morphologies and functions. In neurons, intracellular calcium levels are controlled by ion channels in the plasma membrane such as NMDA receptors (NMDARs), voltage-gated calcium channels (VGCCs) and certain α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) as well as by calcium exchange pathways between the cytosol and internal calcium stores including the endoplasmic reticulum and mitochondria. Synaptic activity and the subsequent opening of ligand and/or voltage-gated calcium channels can initiate cytosolic calcium transients which propagate towards the cell soma and enter the nucleus via its nuclear pore complexes (NPCs) embedded in the nuclear envelope. We recently described the discovery that in hippocampal neurons the morphology of the nucleus affects the calcium dynamics within the nucleus. Here we propose that nuclear infoldings determine whether a nucleus functions as an integrator or detector of oscillating calcium signals. We outline possible ties between nuclear mophology and transcriptional activity and discuss the importance of extending the approach to whole cell calcium signal modeling in order to understand synapse-to-nucleus communication in healthy and dysfunctional neurons.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ewan, Kenneth B.R.; Oketch-Rabah, Hellen A.; Ravani, Shraddha A.
2005-03-03
Transforming growth factor {beta}1 (TGF{beta}1) is a potent inhibitor of mammary epithelial proliferation. In human breast, estrogen receptor {alpha} (ER{alpha}) cells rarely co-localize with markers of proliferation, but their increased frequency correlates with breast cancer risk. To determine whether TGF{beta}1 is necessary for the quiescence of ER{alpha}-positive population, we examined mouse mammary epithelial gland at estrus. Approximately 35% of cells showed TGF{beta}1 activation, which co-localized with nuclear receptor-phosphorylated Smad 2/3, indicating that TGF{beta} signaling is autocrine. Furthermore, nuclear Smad co-localized with nuclear ER{alpha}. To test whether TGF{beta} was functional, we examined genetically engineered mice with different levels of TGF{beta}1. ER{alpha}more » co-localization with markers of proliferation (i.e. Ki-67 or BrdU) at estrus was significantly increased in the mammary glands of Tgf{beta}1 C57/bl/129SV heterozygote mice. This relationship was maintained following pregnancy, but was absent at puberty. Conversely, mammary epithelial expression of constitutively active TGF{beta}1 via the MMTV promoter suppressed proliferation of ER{alpha} positive cells. Thus, TGF{beta}1 activation functionally restrains ER{alpha} positive cells from proliferating in adult mammary gland. Accordingly, we propose that TGF{beta}1 dysregulation may promote proliferation of ER{alpha} positive cells associated with breast cancer risk in humans.« less
Madeo, Antonio; Maggiolini, Marcello
2010-07-15
Fibroblasts are the principal cellular component of connective tissue and are associated with cancer cells at all stages of tumor progression. Structural and functional contributions of fibroblasts to the growth, survival, and invasive capacity of cancer cells are beginning to emerge. In breast carcinoma, approximately 80% of stromal fibroblasts termed cancer-associated fibroblasts (CAF) are thought to manifest an activated phenotype that promotes cancer cell proliferation tumor growth at metastatic sites similar to the primary tumor. In this report, we show that CAFs respond to physiologic concentrations of 17beta-estradiol (E2) by rapidly inducing extracellular signal-regulated kinase phosphorylation and immediate early gene expression, including c-fos and connective tissue growth factor, and cyclin D1. Notably, the E2 response is mediated by the alternate estrogen receptor GPR30, which interfaces with the epidermal growth factor receptor (EGFR) signaling pathway. In particular, E2 stimulates a physical interaction between GPR30 and phosphorylated EGFR, recruiting them to the cyclin D1 gene promoter. Nuclear localization induced by E2 was confirmed by cellular immunofluorescence methods. GPR30 was required for CAF proliferation and migration induced by E2. Our results provide important new mechanistic insights into how CAFs are stimulated by estrogen through a GPR30-mediated nuclear signaling pathway. More generally, they define estrogenic GPR30 signaling as a functionally important component of the tumor microenvironment. (c)2010 AACR.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tao Yongguang; Song Xing; Deng Xiyun
Epstein-Barr virus (EBV)-encoded latent membrane protein 1 (LMP1) is considered to be the major oncogenic protein of EBV-encoded proteins and has always been the core of the oncogenic mechanism of EBV. Advanced studies on nuclear translocation of the epidermal growth factor receptor (EGFR) family have greatly improved our knowledge of the biological function of cell surface receptors. In this study, we used the Tet-on LMP1 HNE2 cell line as a cell model, which is a dual-stable LMP1-integrated nasopharyngeal carcinoma (NPC) cell line and the expression of LMP1 which could be regulated by the Tet system. We found that LMP1 couldmore » regulate the nuclear accumulation of EGFR in a dose-dependent manner quantitatively and qualitatively. We also demonstrated that the nuclear localization sequence of EGFR played some roles in the location of the protein within the nucleus under LMP1 regulation and EGFR in the nucleus could bind to the promoters of cyclinD1 and cyclinE, respectively. We further demonstrated that EGFR is involved in the acceleration of the G1/S phase transition by LMP1 through binding to cyclinD1 and cyclinE directly. These findings provided a novel view that the acceleration of LMP1 on the G1/S transition via the nuclear accumulation of EGFR was critical in the process of nasopharyngeal carcinoma.« less
Larder, Rachel; Karali, Dimitra; Nelson, Nancy; Brown, Pamela
2006-12-01
GnRH binds its cognate G protein-coupled GnRH receptor (GnRHR) located on pituitary gonadotropes and drives expression of gonadotropin hormones. There are two gonadotropin hormones, comprised of a common alpha- and hormone-specific beta-subunit, which are required for gonadal function. Recently we identified that Fanconi anemia a (Fanca), a DNA damage repair gene, is differentially expressed within the LbetaT2 gonadotrope cell line in response to stimulation with GnRH. FANCA is mutated in more than 60% of cases of Fanconi anemia (FA), a rare genetically heterogeneous autosomal recessive disorder characterized by bone marrow failure, endocrine tissue cancer susceptibility, and infertility. Here we show that induction of FANCA protein is mediated by the GnRHR and that the protein constitutively adopts a nucleocytoplasmic intracellular distribution pattern. Using inhibitors to block nuclear import and export and a GnRHR antagonist, we demonstrated that GnRH induces nuclear accumulation of FANCA and green fluorescent protein (GFP)-FANCA before exporting back to the cytoplasm using the nuclear export receptor CRM1. Using FANCA point mutations that locate GFP-FANCA to the cytoplasm (H1110P) or functionally uncouple GFP-FANCA (Q1128E) from the wild-type nucleocytoplasmic distribution pattern, we demonstrated that wild-type FANCA was required for GnRH-induced activation of gonadotrope cell markers. Cotransfection of H1110P and Q1128E blocked GnRH activation of the alphaGsu and GnRHR but not the beta-subunit gene promoters. We conclude that nucleocytoplasmic shuttling of FANCA is required for GnRH transduction of the alphaGSU and GnRHR gene promoters and propose that FANCA functions as a GnRH-induced signal transducer.
Larder, Rachel; Karali, Dimitra; Nelson, Nancy; Brown, Pamela
2007-01-01
GnRH binds its cognate G protein-coupled GnRH receptor (GnRHR) located on pituitary gonadotropes and drives expression of gonadotropin hormones. There are two gonadotropin hormones, comprised of a common α- and hormone-specific β-subunit, which are required for gonadal function. Recently we identified that Fanconi anemia a (Fanca), a DNA damage repair gene, is differentially expressed within the LβT2 gonadotrope cell line in response to stimulation with GnRH. FANCA is mutated in more than 60% of cases of Fanconi anemia (FA), a rare genetically heterogeneous autosomal recessive disorder characterized by bone marrow failure, endocrine tissue cancer susceptibility, and infertility. Here we show that induction of FANCA protein is mediated by the GnRHR and that the protein constitutively adopts a nucleocytoplasmic intracellular distribution pattern. Using inhibitors to block nuclear import and export and a GnRHR antagonist, we demonstrated that GnRH induces nuclear accumulation of FANCA and green fluorescent protein (GFP)-FANCA before exporting back to the cytoplasm using the nuclear export receptor CRM1. Using FANCA point mutations that locate GFP-FANCA to the cytoplasm (H1110P) or functionally uncouple GFP-FANCA (Q1128E) from the wild-type nucleocytoplasmic distribution pattern, we demonstrated that wild-type FANCA was required for GnRH-induced activation of gonadotrope cell markers. Cotransfection of H1110P and Q1128E blocked GnRH activation of the αGsu and GnRHR but not the β-subunit gene promoters. We conclude that nucleocytoplasmic shuttling of FANCA is required for GnRH transduction of the αGSU and GnRHR gene promoters and propose that FANCA functions as a GnRH-induced signal transducer. PMID:16946016
Carvalho, Claudine M; Santos, Anésia A; Pires, Silvana R; Rocha, Carolina S; Saraiva, Daniela I; Machado, João Paulo B; Mattos, Eliciane C; Fietto, Luciano G; Fontes, Elizabeth P B
2008-12-01
The NSP-interacting kinase (NIK) receptor-mediated defense pathway has been identified recently as a virulence target of the geminivirus nuclear shuttle protein (NSP). However, the NIK1-NSP interaction does not fit into the elicitor-receptor model of resistance, and hence the molecular mechanism that links this antiviral response to receptor activation remains obscure. Here, we identified a ribosomal protein, rpL10A, as a specific partner and substrate of NIK1 that functions as an immediate downstream effector of NIK1-mediated response. Phosphorylation of cytosolic rpL10A by NIK1 redirects the protein to the nucleus where it may act to modulate viral infection. While ectopic expression of normal NIK1 or a hyperactive NIK1 mutant promotes the accumulation of phosphorylated rpL10A within the nuclei, an inactive NIK1 mutant fails to redirect the protein to the nuclei of co-transfected cells. Likewise, a mutant rpL10A defective for NIK1 phosphorylation is not redirected to the nucleus. Furthermore, loss of rpL10A function enhances susceptibility to geminivirus infection, resembling the phenotype of nik1 null alleles. We also provide evidence that geminivirus infection directly interferes with NIK1-mediated nuclear relocalization of rpL10A as a counterdefensive measure. However, the NIK1-mediated defense signaling neither activates RNA silencing nor promotes a hypersensitive response but inhibits plant growth and development. Although the virulence function of the particular geminivirus NSP studied here overcomes this layer of defense in Arabidopsis, the NIK1-mediated signaling response may be involved in restricting the host range of other viruses.
Tarallo, Roberta; Giurato, Giorgio; Bruno, Giuseppina; Ravo, Maria; Rizzo, Francesca; Salvati, Annamaria; Ricciardi, Luca; Marchese, Giovanna; Cordella, Angela; Rocco, Teresa; Gigantino, Valerio; Pierri, Biancamaria; Cimmino, Giovanni; Milanesi, Luciano; Ambrosino, Concetta; Nyman, Tuula A; Nassa, Giovanni; Weisz, Alessandro
2017-10-06
The RNA-binding protein Argonaute 2 (AGO2) is a key effector of RNA-silencing pathways It exerts a pivotal role in microRNA maturation and activity and can modulate chromatin remodeling, transcriptional gene regulation and RNA splicing. Estrogen receptor beta (ERβ) is endowed with oncosuppressive activities, antagonizing hormone-induced carcinogenesis and inhibiting growth and oncogenic functions in luminal-like breast cancers (BCs), where its expression correlates with a better prognosis of the disease. Applying interaction proteomics coupled to mass spectrometry to characterize nuclear factors cooperating with ERβ in gene regulation, we identify AGO2 as a novel partner of ERβ in human BC cells. ERβ-AGO2 association was confirmed in vitro and in vivo in both the nucleus and cytoplasm and is shown to be RNA-mediated. ChIP-Seq demonstrates AGO2 association with a large number of ERβ binding sites, and total and nascent RNA-Seq in ERβ + vs ERβ - cells, and before and after AGO2 knock-down in ERβ + cells, reveals a widespread involvement of this factor in ERβ-mediated regulation of gene transcription rate and RNA splicing. Moreover, isolation and sequencing by RIP-Seq of ERβ-associated long and small RNAs in the cytoplasm suggests involvement of the nuclear receptor in RISC loading, indicating that it may also be able to directly control mRNA translation efficiency and stability. These results demonstrate that AGO2 can act as a pleiotropic functional partner of ERβ, indicating that both factors are endowed with multiple roles in the control of key cellular functions.
Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P; Brown, Andrew J; Heinemann, Akos; Waldhoer, Maria
2012-12-28
The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors.
Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P.; Brown, Andrew J.; Heinemann, Akos; Waldhoer, Maria
2012-01-01
The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors. PMID:23161546
Expression and potential role of the peptide orexin-A in prostate cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valiante, Salvatore; Liguori, Giovanna; Tafuri, Simona
The peptides orexin-A and orexin-B and their G protein-coupled OX1 and OX2 receptors are involved in multiple physiological processes in the central nervous system and peripheral organs. Altered expression or signaling dysregulation of orexins and their receptors have been associated with a wide range of human diseases including narcolepsy, obesity, drug addiction, and cancer. Although orexin-A, its precursor molecule prepro-orexin and OX1 receptor have been detected in the human normal and hyperplastic prostate tissues, their expression and function in the prostate cancer (PCa) remains to be addressed. Here, we demonstrate for the first time the immunohistochemical localization of orexin-A inmore » human PCa specimens, and the expression of prepro-orexin and OX1 receptor at both protein and mRNA levels in these tissues. Orexin-A administration to the human androgen-dependent prostate carcinoma cells LNCaP up-regulates OX1 receptor expression resulting in a decrease of cell survival. Noteworthy, nanomolar concentrations of the peptide counteract the testosterone-induced nuclear translocation of the androgen receptor in the cells: the orexin-A action is prevented by the addition of the OX1 receptor antagonist SB-408124 to the test system. These findings indicate that orexin-A/OX1 receptor interaction interferes with the activity of the androgen receptor which regulates PCa onset and progression, thus suggesting that orexin-A and its receptor might represent novel therapeutic targets to challenge this aggressive cancer. - Highlights: • Orexin-A and OX1 receptor are present in human cancer prostate tissues. • Orexin-A up-regulates OX1 receptor expression in LNCaP cells. • Orexin-A inhibits testosterone-induced nuclear translocation of androgen receptor.« less
Nuclear receptor TLX prevents retinal dystrophy and recruits the corepressor atrophin1
Zhang, Chun-Li; Zou, Yuhua; Yu, Ruth T.; Gage, Fred H.; Evans, Ronald M.
2006-01-01
During mammalian embryogenesis, precise coordination of progenitor cell proliferation and differentiation is essential for proper organ size and function. The involvement of TLX (NR2E1), an orphan nuclear receptor, has been implicated in ocular development, as Tlx−/− mice exhibit visual impairment. Using genetic and biochemical approaches, we show that TLX modulates retinal progenitor cell proliferation and cell cycle re-entry by directly regulating the expression of Pten and its target cyclin D1. Additionally, TLX finely tunes the progenitor differentiation program by modulating the phospholipase C and mitogen-activated protein kinase (MAPK) pathways and the expression of an array of cell type-specific transcriptional regulators. Consequently, Tlx−/− mice have a dramatic reduction in retina thickness and enhanced generation of S-cones, and develop severe early onset retinal dystrophy. Furthermore, TLX interacts with atrophin1 (Atn1), a corepressor that is involved in human neurodegenerative dentatorubral-pallidoluysian atrophy (DRPLA) and that is essential for development of multiple tissues. Together, these results reveal a molecular strategy by which an orphan nuclear receptor can precisely orchestrate tissue-specific proliferation and differentiation programs to prevent retinal malformation and degeneration. PMID:16702404
Structure and Dynamics of the Liver Receptor Homolog 1-PGC1α Complex.
Mays, Suzanne G; Okafor, C Denise; Tuntland, Micheal L; Whitby, Richard J; Dharmarajan, Venkatasubramanian; Stec, Józef; Griffin, Patrick R; Ortlund, Eric A
2017-07-01
Peroxisome proliferator-activated gamma coactivator 1- α (PGC1 α ) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1 α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1 α is known to bind and activate LRH-1, mechanisms through which PGC1 α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1-PGC1 α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1 α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), in coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1-PGC1 α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1 α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1 α but promoted allosteric signaling from the helix 6/ β -sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1-PGC1 α interaction and may illuminate strategies for selective therapeutic targeting of PGC1 α -dependent LRH-1 signaling pathways. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Kim, Dong-Gyu; Yoo, Jae Cheal; Kim, Eunju; Lee, Young-Sun; Yarishkin, Oleg V; Lee, Da Yong; Lee, Kun Ho; Hong, Seong-Geun; Hwang, Eun Mi; Park, Jae-Yong
2014-06-01
Mitochondrial trans-2-enoyl-CoA reductase (MECR) is involved in mitochondrial synthesis of fatty acids and is highly expressed in mitochondria. MECR is also known as nuclear receptor binding factor-1, which was originally reported with yeast two-hybrid screening as a binding protein of the nuclear hormone receptor peroxisome proliferator-activated receptor α (PPARα). However, MECR and PPARα are localized at different compartment, mitochondria, and the nucleus, respectively. Therefore, the presence of a cytosolic or nuclear isoform of MECR is necessary for functional interaction between MECR and PPARα. To identify the expression pattern of MECR and the cytosolic form of MECR (cMECR), we performed reverse transcription polymerase chain reaction (RT-PCR) with various tissue samples from Sprague-Dawley rats. To confirm the interaction between cMECR and PPARα, we performed several binding assays such as yeast two-hybrid, coimmunoprecipitation, and bimolecular fluorescence complementation. To observe subcellular localization of these proteins, immunocytochemistry was performed. A luciferase assay was used to measure PPARα activity. We provide evidence of an alternatively spliced variant of the rat MECR gene that yields cMECR. The cMECR lacks the N-terminal 76 amino acids of MECR and shows uniform distribution in the cytoplasm and nucleus of HeLa cells. cMECR directly bound PPARα in the nucleus and increased PPARα-dependent luciferase activity in HeLa cells. We found the cytosolic form of MECR (cMECR) was expressed in the cytosolic and/or nuclear region, directly binds with PPARα, and enhances PPARα activity.
Zhang, Hao; Liao, Lan; Kuang, Shao-Qing; Xu, Jianming
2003-04-01
Transcriptional activities of nuclear receptors are modulated by coactivators and corepressors. The amplified in breast cancer-3 protein (AIB3, also known as ASC-2, RAP250, PRIP, TRBP, and NCR) is a newly identified nuclear receptor coactivator that is amplified and overexpressed in breast cancers. This study aims to investigate the spatial expression of AIB3 mRNA and protein in various murine tissues. Quantitative measurements revealed that the concentrations of AIB3 mRNA differ substantially in different tissues in a descending order from the following: testis, brain, thymus, white fat, pituitary, ovary, adrenal gland, lung, uterus, kidney, heart, skeletal muscle, liver, and virgin mammary gland. The AIB3 mRNA level in the testis is 165-fold higher than that in the virgin mammary gland. Specific antiserum was generated and used to map the distribution of AIB3 protein by immunohistochemistry. Although AIB3 protein was detected in many tissues, the AIB3 immunoreactivities varied significantly from cell type to cell type. High levels of AIB3 immunoreactivity were observed in hormone target cells including the testicular Sertoli cells, follicular granulosa cells, and epithelial cells of the prostate, uterus, mammary gland, and kidney tubules. Medium and low levels of AIB3 immunoreactivities were also detected in a variety of other cell types. These results demonstrate that AIB3 mRNA and protein are preferentially expressed in specific cell types, suggesting that AIB3 may support the function of nuclear receptors in a cell type-specific manner.
Cross-species extrapolation of an adverse outcome pathway for ecdysone receptor activation
Different invertebrate nuclear receptors serve as targets for a variety of environmental contaminants. One of these is the ecdysteroid receptor (EcR). Due to the important role of this nuclear receptor in regulating development and reproduction in invertebrates, particularly duri...
Cross-species extrapolation of an adverse outcome pathway for ecdysteroid receptor activation
Different invertebrate nuclear receptors serve as targets for a variety of environmental contaminants. One of these is the ecdysteroid receptor (EcR). Due to the important role of this nuclear receptor in regulating development and reproduction in invertebrates, particularly duri...
García, Ana V; Blanvillain-Baufumé, Servane; Huibers, Robin P; Wiermer, Marcel; Li, Guangyong; Gobbato, Enrico; Rietz, Steffen; Parker, Jane E
2010-07-01
An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR) receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor)-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1). In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES)) or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR)) in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.
Blumberg, Bruce; Kang, Heonjoong; Bolado, Jack; Chen, Hongwu; Craig, A. Grey; Moreno, Tanya A.; Umesono, Kazuhiko; Perlmann, Thomas; De Robertis, Eddy M.; Evans, Ronald M.
1998-01-01
Nuclear receptors are ligand-modulated transcription factors that respond to steroids, retinoids, and thyroid hormones to control development and body physiology. Orphan nuclear receptors, which lack identified ligands, provide a unique, and largely untapped, resource to discover new principles of physiologic homeostasis. We describe the isolation and characterization of the vertebrate orphan receptor, BXR, which heterodimerizes with RXR and binds high-affinity DNA sites composed of a variant thyroid hormone response element. A bioactivity-guided screen of embryonic extracts revealed that BXR is activatable by low-molecular-weight molecules with spectral patterns distinct from known nuclear receptor ligands. Mass spectrometry and 1H NMR analysis identified alkyl esters of amino and hydroxy benzoic acids as potent, stereoselective activators. In vitro cofactor association studies, along with competable binding of radiolabeled compounds, establish these molecules as bona fide ligands. Benzoates comprise a new molecular class of nuclear receptor ligand and their activity suggests that BXR may control a previously unsuspected vertebrate signaling pathway. PMID:9573044
Barry, William E; Thummel, Carl S
2016-01-01
Although mutations in HNF4A were identified as the cause of Maturity Onset Diabetes of the Young 1 (MODY1) two decades ago, the mechanisms by which this nuclear receptor regulates glucose homeostasis remain unclear. Here we report that loss of Drosophila HNF4 recapitulates hallmark symptoms of MODY1, including adult-onset hyperglycemia, glucose intolerance and impaired glucose-stimulated insulin secretion (GSIS). These defects are linked to a role for dHNF4 in promoting mitochondrial function as well as the expression of Hex-C, a homolog of the MODY2 gene Glucokinase. dHNF4 is required in the fat body and insulin-producing cells to maintain glucose homeostasis by supporting a developmental switch toward oxidative phosphorylation and GSIS at the transition to adulthood. These findings establish an animal model for MODY1 and define a developmental reprogramming of metabolism to support the energetic needs of the mature animal. DOI: http://dx.doi.org/10.7554/eLife.11183.001 PMID:27185732
Long non-coding RNAs as regulators of the endocrine system
Knoll, Marko; Lodish, Harvey F.; Sun, Lei
2015-01-01
Long non-coding RNAs (lncRNAs) are a large and diverse group of RNAs that are often lineage-specific and that regulate multiple biological functions. Many are nuclear and are essential parts of ribonucleoprotein complexes that modify chromatin segments and establish active or repressive chromatin states; others are cytosolic and regulate the stability of mRNA or act as microRNA sponges. This Review summarizes the current knowledge of lncRNAs as regulators of the endocrine system, with a focus on the identification and mode of action of several endocrine-important lncRNAs. We highlight lncRNAs that have a role in the development and function of pancreatic β cells, white and brown adipose tissue, and other endocrine organs, and discuss the involvement of these molecules in endocrine dysfunction (for example, diabetes mellitus). We also address the associations of lncRNAs with nuclear receptors involved in major hormonal signalling pathways, such as estrogen and androgen receptors, and the relevance of these associations in certain endocrine cancers. PMID:25560704
Long non-coding RNAs as regulators of the endocrine system.
Knoll, Marko; Lodish, Harvey F; Sun, Lei
2015-03-01
Long non-coding RNAs (lncRNAs) are a large and diverse group of RNAs that are often lineage-specific and that regulate multiple biological functions. Many are nuclear and are essential parts of ribonucleoprotein complexes that modify chromatin segments and establish active or repressive chromatin states; others are cytosolic and regulate the stability of mRNA or act as microRNA sponges. This Review summarizes the current knowledge of lncRNAs as regulators of the endocrine system, with a focus on the identification and mode of action of several endocrine-important lncRNAs. We highlight lncRNAs that have a role in the development and function of pancreatic β cells, white and brown adipose tissue, and other endocrine organs, and discuss the involvement of these molecules in endocrine dysfunction (for example, diabetes mellitus). We also address the associations of lncRNAs with nuclear receptors involved in major hormonal signalling pathways, such as estrogen and androgen receptors, and the relevance of these associations in certain endocrine cancers.
Bmal1 is a direct transcriptional target of the orphan nuclear receptor, NR2F1
USDA-ARS?s Scientific Manuscript database
Orphan nuclear receptor NR2F1 (also known as COUP-TFI, Chicken Ovalbumin Upstream Promoter Transcription Factor I) is a highly conserved member of the nuclear receptor superfamily. NR2F1 plays a critical role during embryonic development, particularly in the central and peripheral nervous systems a...
Markina-Iñarrairaegui, Ane; Etxebeste, Oier; Herrero-García, Erika; Araújo-Bazán, Lidia; Fernández-Martínez, Javier; Flores, Jairo A.; Osmani, Stephen A.; Espeso, Eduardo A.
2011-01-01
Nuclear transporters mediate bidirectional macromolecule traffic through the nuclear pore complex (NPC), thus participating in vital processes of eukaryotic cells. A systematic functional analysis in Aspergillus nidulans permitted the identification of 4 essential nuclear transport pathways of a hypothetical number of 14. The absence of phenotypes for most deletants indicates redundant roles for these nuclear receptors. Subcellular distribution studies of these carriers show three main distributions: nuclear, nucleocytoplasmic, and in association with the nuclear envelope. These locations are not specific to predicted roles as exportins or importins but indicate that bidirectional transport may occur coordinately in all nuclei of a syncytium. Coinciding with mitotic NPC rearrangements, transporters dynamically modified their localizations, suggesting supplementary roles to nucleocytoplasmic transport specifically during mitosis. Loss of transportin-SR and Mex/TAP from the nuclear envelope indicates absence of RNA transport during the partially open mitosis of Aspergillus, whereas nucleolar accumulation of Kap121 and Kap123 homologues suggests a role in nucleolar disassembly. This work provides new insight into the roles of nuclear transporters and opens an avenue for future studies of the molecular mechanisms of transport among nuclei within a common cytoplasm, using A. nidulans as a model organism. PMID:21880896
Structural dynamics of the cell nucleus
Wiegert, Simon; Bading, Hilmar
2011-01-01
Neuronal morphology plays an essential role in signal processing in the brain. Individual neurons can undergo use-dependent changes in their shape and connectivity, which affects how intracellular processes are regulated and how signals are transferred from one cell to another in a neuronal network. Calcium is one of the most important intracellular second messengers regulating cellular morphologies and functions. In neurons, intracellular calcium levels are controlled by ion channels in the plasma membrane such as NMDA receptors (NMDARs), voltage-gated calcium channels (VGCCs) and certain α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) as well as by calcium exchange pathways between the cytosol and internal calcium stores including the endoplasmic reticulum and mitochondria. Synaptic activity and the subsequent opening of ligand and/or voltage-gated calcium channels can initiate cytosolic calcium transients which propagate towards the cell soma and enter the nucleus via its nuclear pore complexes (NPCs) embedded in the nuclear envelope. We recently described the discovery that in hippocampal neurons the morphology of the nucleus affects the calcium dynamics within the nucleus. Here we propose that nuclear infoldings determine whether a nucleus functions as an integrator or detector of oscillating calcium signals. We outline possible ties between nuclear mophology and transcriptional activity and discuss the importance of extending the approach to whole cell calcium signal modeling in order to understand synapse-to-nucleus communication in healthy and dysfunctional neurons. PMID:21738832
Zeiner, M; Gehring, U
1995-01-01
In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784
The constitutive androstane receptor (CAR) and pregnane X receptor (PXR) are key nuclear receptors involved in the regulation of cellular responses. to exposure to many xenobiotics and various physiological processes. Phenobarbital (PB) is a non genotoxic i...
2015-01-01
Estrogens are critical mediators of multiple and diverse physiologic effects throughout the body in both sexes, including the reproductive, cardiovascular, endocrine, nervous, and immune systems. As such, alterations in estrogen function play important roles in many diseases and pathophysiological conditions (including cancer), exemplified by the lower prevalence of many diseases in premenopausal women. Estrogens mediate their effects through multiple cellular receptors, including the nuclear receptor family (ERα and ERβ) and the G protein–coupled receptor (GPCR) family (GPR30/G protein–coupled estrogen receptor [GPER]). Although both receptor families can initiate rapid cell signaling and transcriptional regulation, the nuclear receptors are traditionally associated with regulating gene expression, whereas GPCRs are recognized as mediating rapid cellular signaling. Estrogen-activated pathways are not only the target of multiple therapeutic agents (e.g., tamoxifen, fulvestrant, raloxifene, and aromatase inhibitors) but are also affected by a plethora of phyto- and xeno-estrogens (e.g., genistein, coumestrol, bisphenol A, dichlorodiphenyltrichloroethane). Because of the existence of multiple estrogen receptors with overlapping ligand specificities, expression patterns, and signaling pathways, the roles of the individual receptors with respect to the diverse array of endogenous and exogenous ligands have been challenging to ascertain. The identification of GPER-selective ligands however has led to a much greater understanding of the roles of this receptor in normal physiology and disease as well as its interactions with the classic estrogen receptors ERα and ERβ and their signaling pathways. In this review, we describe the history and characterization of GPER over the past 15 years focusing on the pharmacology of steroidal and nonsteroidal compounds that have been employed to unravel the biology of this most recently recognized estrogen receptor. PMID:26023144
Prossnitz, Eric R; Arterburn, Jeffrey B
2015-07-01
Estrogens are critical mediators of multiple and diverse physiologic effects throughout the body in both sexes, including the reproductive, cardiovascular, endocrine, nervous, and immune systems. As such, alterations in estrogen function play important roles in many diseases and pathophysiological conditions (including cancer), exemplified by the lower prevalence of many diseases in premenopausal women. Estrogens mediate their effects through multiple cellular receptors, including the nuclear receptor family (ERα and ERβ) and the G protein-coupled receptor (GPCR) family (GPR30/G protein-coupled estrogen receptor [GPER]). Although both receptor families can initiate rapid cell signaling and transcriptional regulation, the nuclear receptors are traditionally associated with regulating gene expression, whereas GPCRs are recognized as mediating rapid cellular signaling. Estrogen-activated pathways are not only the target of multiple therapeutic agents (e.g., tamoxifen, fulvestrant, raloxifene, and aromatase inhibitors) but are also affected by a plethora of phyto- and xeno-estrogens (e.g., genistein, coumestrol, bisphenol A, dichlorodiphenyltrichloroethane). Because of the existence of multiple estrogen receptors with overlapping ligand specificities, expression patterns, and signaling pathways, the roles of the individual receptors with respect to the diverse array of endogenous and exogenous ligands have been challenging to ascertain. The identification of GPER-selective ligands however has led to a much greater understanding of the roles of this receptor in normal physiology and disease as well as its interactions with the classic estrogen receptors ERα and ERβ and their signaling pathways. In this review, we describe the history and characterization of GPER over the past 15 years focusing on the pharmacology of steroidal and nonsteroidal compounds that have been employed to unravel the biology of this most recently recognized estrogen receptor. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.
Rethinking Nuclear Receptors as Potential Therapeutic Targets for Retinal Diseases.
Choudhary, Mayur; Malek, Goldis
2016-12-01
Collectively, retinal diseases, including age-related macular degeneration, retinitis pigmentosa, and diabetic retinopathy, result in severe vision impairment worldwide. The absence and/or limited availability of successful drug therapies for these blinding disorders necessitates further understanding their pathobiology and identifying new targetable signaling pathways. Nuclear receptors are transcription regulators of many key aspects of human physiology, as well as pathophysiology, with reported roles in development, aging, and disease. Some of the pathways regulated by nuclear receptors include, but are not limited to, angiogenesis, inflammation, and lipid metabolic dysregulation, mechanisms also important in the initiation and development of several retinal diseases. Herein, we present an overview of the biology of three diseases affecting the posterior eye, summarize a growing body of evidence that suggests direct or indirect involvement of nuclear receptors in disease progression, and discuss the therapeutic potential of targeting nuclear receptors for treatment.
Rethinking Nuclear Receptors as Potential Therapeutic Targets for Retinal Diseases
Choudhary, Mayur; Malek, Goldis
2017-01-01
Collectively, retinal diseases, including age-related macular degeneration, retinitis pigmentosa, and diabetic retinopathy, result in severe vision impairment worldwide. The absence and/or limited availability of successful drug therapies for these blinding disorders necessitates further understanding their pathobiology and identifying new targetable signaling pathways. Nuclear receptors are transcription regulators of many key aspects of human physiology, as well as pathophysiology, with reported roles in development, aging, and disease. Some of the pathways regulated by nuclear receptors include, but are not limited to, angiogenesis, inflammation, and lipid metabolic dysregulation, mechanisms also important in the initiation and development of several retinal diseases. Herein, we present an overview of the biology of three diseases affecting the posterior eye, summarize a growing body of evidence that suggests direct or indirect involvement of nuclear receptors in disease progression, and discuss the therapeutic potential of targeting nuclear receptors for treatment. PMID:27455994
Dubrovsky, Edward B.; Dubrovskaya, Veronica A.; Bernardo, Travis; Otte, Valerie; DiFilippo, Robert; Bryan, Heather
2011-01-01
Juvenile hormone (JH) regulates a wide variety of biological activities in holometabolous insects, ranging from vitellogenesis and caste determination in adults to the timing of metamorphosis in larvae. The mechanism of JH signaling in such a diverse array of processes remains either unknown or contentious. We previously found that the nuclear receptor gene E75A is activated in S2 cells as a primary response to JH. Here, by expressing an intracellular form of JH esterase, we demonstrate that JH must enter the cell in order to activate E75A. To find intracellular receptors involved in the JH response, we performed an RNAi screen against nuclear receptor genes expressed in this cell line and identified the orphan receptor FTZ-F1. Removal of FTZ-F1 prevents JH activation of E75A, whereas overexpression enhances activation, implicating FTZ-F1 as a critical component of the JH response. FTZ-F1 is bound in vivo to multiple enhancers upstream of E75A, suggesting that it participates in direct JH-mediated gene activation. To better define the role of FTZ-F1 in JH signaling, we investigated interactions with candidate JH receptors and found that the bHLH-PAS proteins MET and GCE both interact with FTZ-F1 and can activate transcription through the FTZ-F1 response element. Removal of endogenous GCE, but not MET, prevents JH activation of E75A. We propose that FTZ-F1 functions as a competence factor by loading JH signaling components to the promoter, thus facilitating the direct regulation of E75A gene expression by JH. PMID:21832074
Zhang, Li; Paine, Catherine
2010-01-01
Nuclear orphan receptors 4A (NR4A) are early responsive genes that belong to the superfamily of hormone receptors and comprise NR4A1, NR4A2 and NR4A3. They have been associated to transcriptional activation of multiple genes involved in inflammation, apoptosis and cell cycle control. Here, we establish a link between NR4As and adenosine, a paradoxical inflammatory molecule that can contribute to persistence of inflammation or mediate inflammatory shutdown. Transcriptomics screening of the human mast cell-line HMC-1 revealed a sharp induction of transcriptionally active NR4A2 and NR4A3 by the adenosine analogue NECA. The concomitant treatment of NECA and the adenosine receptor A2A (A2AAR) selective antagonist SCH-58261 exaggerated this effect, suggesting that upregulation of these factors in mast cells is mediated by other AR subtypes (A2B and A3) and that A2AAR activation counteracts NR4A2 and NR4A3 induction. In agreement with this, A2AAR-silencing amplified NR4A induction by NECA. Interestingly, a similar A2AAR modulatory effect was observed on ERK1/2 phosphorylation because A2AAR blockage exacerbated NECA-mediated phosphorylation of ERK1/2. In addition, PKC or MEK1/2 inhibition prevented ERK1/2 phosphorylation and antagonized AR-mediated induction of NR4A2 and NR4A3, suggesting the involvement of these kinases in AR to NR4A signaling. Finally, we observed that selective A2AAR activation with CGS-21680 blocked PMA-induced ERK1/2 phosphorylation and modulated the overexpression of functional nuclear orphan receptors 4A. Taken together, these results establish a novel PKC/ERK/nuclear orphan receptors 4A axis for adenosinergic signaling in mast cells, which can be modulated by A2AAR activation, not only in the context of adenosine but of other mast cell activating stimuli as well. PMID:21234122
[The function of ERα in male reproductive system].
Dong, Yu-Hang; Wei, Jin-Hua; Li, Zhen
2014-12-01
Estrogen receptors (ERs), including two sub-types ERα and ERβ, belong to the steroid hormone superfamily of nuclear receptors. ERα distributes in the male reproductive system and plays a crucial role in the regulation of male reproduction through estrogen-dependent and -independent ways. In this article, we mainly reviewed the molecular structure, mode of action and location of ERα in the male reproductive system, and explored the mechanism of ERα in regulating the male reproductive system by analyzing different animal models of disrupted ERα.
The nuclear receptor family member peroxisome proliferator-activated receptor α (PPARα) is activated by therapeutic hypolipidemic drugs and environmentally-relevant chemicals to regulate genes involved in lipid transport and catabolism. Chronic activation of PPARα in rodents inc...
Nakao, Shu; Wakabayashi, Shigeo; Nakamura, Tomoe Y
2015-01-01
In cardiomyocytes, intracellular calcium (Ca2+) transients are elicited by electrical and receptor stimulations, leading to muscle contraction and gene expression, respectively. Although such elevations of Ca2+levels ([Ca2+]) also occur in the nucleus, the precise mechanism of nuclear [Ca2+] regulation during different kinds of stimuli, and its relationship with cytoplasmic [Ca2+] regulation are not fully understood. To address these issues, we used a new region-specific fluorescent protein-based Ca2+ indicator, GECO, together with the conventional probe Fluo-4 AM. We confirmed that nuclear Ca2+ transients were elicited by both electrical and receptor stimulations in neonatal mouse ventricular myocytes. Kinetic analysis revealed that electrical stimulation-elicited nuclear Ca2+ transients are slower than cytoplasmic Ca2+ transients, and chelating cytoplasmic Ca2+ abolished nuclear Ca2+ transients, suggesting that nuclear Ca2+ are mainly derived from the cytoplasm during electrical stimulation. On the other hand, receptor stimulation such as with insulin-like growth factor-1 (IGF-1) preferentially increased nuclear [Ca2+] compared to cytoplasmic [Ca2+]. Experiments using inhibitors revealed that electrical and receptor stimulation-elicited Ca2+ transients were mainly mediated by ryanodine receptors and inositol 1,4,5-trisphosphate receptors (IP3Rs), respectively, suggesting different mechanisms for the two signals. Furthermore, IGF-1-elicited nuclear Ca2+ transient amplitude was significantly lower in myocytes lacking neuronal Ca2+ sensor-1 (NCS-1), a Ca2+ binding protein implicated in IP3R-mediated pathway in the heart. Moreover, IGF-1 strengthened the interaction between NCS-1 and IP3R. These results suggest a novel mechanism for receptor stimulation-induced nuclear [Ca2+] regulation mediated by IP3R and NCS-1 that may further fine-tune cardiac Ca2+ signal regulation.
Retinoid X receptor α attenuates host antiviral response by suppressing type I interferon
Ma, Feng; Liu, Su-Yang; Razani, Bahram; Arora, Neda; Li, Bing; Kagechika, Hiroyuki; Tontonoz, Peter; Núñez, Vanessa; Ricote, Mercedes; Cheng, Genhong
2015-01-01
The retinoid X receptor α (RXRα), a key nuclear receptor in metabolic processes, is down-regulated during host antiviral response. However, the roles of RXRα in host antiviral response are unknown. Here we show that RXRα overexpression or ligand activation increases host susceptibility to viral infections in vitro and in vivo, while Rxra −/− or antagonist treatment reduces infection by the same viruses. Consistent with these functional studies, ligand activation of RXR inhibits the expression of antiviral genes including type I interferon (IFN) and Rxra −/− macrophages produce more IFNβ than WT macrophages in response to polyI:C stimulation. Further results indicate that ligand activation of RXR suppresses the nuclear translocation of β-catenin, a co-activator of IFNβ enhanceosome. Thus, our studies have uncovered a novel RXR-dependent innate immune regulatory pathway, suggesting that the downregulation of RXR expression or RXR antagonist treatment benefits host antiviral response, whereas RXR agonist treatment may increase the risk of viral infections. PMID:25417649
Proteomic profiling of human plasma exosomes identifies PPAR{gamma} as an exosome-associated protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Looze, Christopher; Yui, David; Leung, Lester
Exosomes are nanovesicles that are released from cells as a mechanism of cell-free intercellular communication. Only a limited number of proteins have been identified from the plasma exosome proteome. Here, we developed a multi-step fractionation scheme incorporating gel exclusion chromatography, rate zonal centrifugation through continuous sucrose gradients, and high-speed centrifugation to purify exosomes from human plasma. Exosome-associated proteins were separated by SDS-PAGE and 66 proteins were identified by LC-MS/MS, which included both cellular and extracellular proteins. Furthermore, we identified and characterized peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}), a nuclear receptor that regulates adipocyte differentiation and proliferation, as well as immune and inflammatorymore » cell functions, as a novel component of plasma-derived exosomes. Given the important role of exosomes as intercellular messengers, the discovery of PPAR{gamma} as a component of human plasma exosomes identifies a potential new pathway for the paracrine transfer of nuclear receptors.« less
Retinoic acid signaling pathways in development and diseases.
Das, Bhaskar C; Thapa, Pritam; Karki, Radha; Das, Sasmita; Mahapatra, Sweta; Liu, Ting-Chun; Torregroza, Ingrid; Wallace, Darren P; Kambhampati, Suman; Van Veldhuizen, Peter; Verma, Amit; Ray, Swapan K; Evans, Todd
2014-01-15
Retinoids comprise a group of compounds each composed of three basic parts: a trimethylated cyclohexene ring that is a bulky hydrophobic group, a conjugated tetraene side chain that functions as a linker unit, and a polar carbon-oxygen functional group. Biochemical conversion of carotenoid or other retinoids to retinoic acid (RA) is essential for normal regulation of a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids regulate various physiological outputs by binding to nuclear receptors called retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which themselves are DNA-binding transcriptional regulators. The functional response of RA and their receptors are modulated by a host of coactivators and corepressors. Retinoids are essential in the development and function of several organ systems; however, deregulated retinoid signaling can contribute to serious diseases. Several natural and synthetic retinoids are in clinical use or undergoing trials for treating specific diseases including cancer. In this review, we provide a broad overview on the importance of retinoids in development and various diseases, highlighting various retinoids in the drug discovery process, ranging all the way from retinoid chemistry to clinical uses and imaging. Copyright © 2013 Elsevier Ltd. All rights reserved.
Saito, Shoko; Cigdem, Sadik; Okuwaki, Mitsuru; Nagata, Kyosuke
2016-07-01
Nuclear-cytoplasmic transport through nuclear pore complexes is mediated by nuclear transport receptors. Previous reports have suggested that aberrant nuclear-cytoplasmic transport due to mutations or overexpression of nuclear pore complexes and nuclear transport receptors is closely linked to diseases. Nup214, a component of nuclear pore complexes, has been found as chimeric fusion proteins in leukemia. Among various Nup214 fusion proteins, SET-Nup214 and DEK-Nup214 have been shown to be engaged in tumorigenesis, but their oncogenic mechanisms remain unclear. In this study, we examined the functions of the Nup214 fusion proteins by focusing on their effects on nuclear-cytoplasmic transport. We found that SET-Nup214 and DEK-Nup214 interact with exportin-1 (XPO1)/CRM1 and nuclear RNA export factor 1 (NXF1)/TAP, which mediate leucine-rich nuclear export signal (NES)-dependent protein export and mRNA export, respectively. SET-Nup214 and DEK-Nup214 decreased the XPO1-mediated nuclear export of NES proteins such as cyclin B and proteins involved in the NF-κB signaling pathway by tethering XPO1 onto nuclear dots where Nup214 fusion proteins are localized. We also demonstrated that SET-Nup214 and DEK-Nup214 expression inhibited NF-κB-mediated transcription by abnormal tethering of the complex containing p65 and its inhibitor, IκB, in the nucleus. These results suggest that SET-Nup214 and DEK-Nup214 perturb the regulation of gene expression through alteration of the nuclear-cytoplasmic transport system. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
The nuclear receptor tailless is required for neurogenesis in the adult subventricular zone
Liu, Hai-Kun; Belz, Thorsten; Bock, Dagmar; Takacs, Andrea; Wu, Hui; Lichter, Peter; Chai, Minqiang; Schütz, Günther
2008-01-01
The tailless (Tlx) gene encodes an orphan nuclear receptor that is expressed by neural stem/progenitor cells in the adult brain of the subventricular zone (SVZ) and the dentate gyrus (DG). The function of Tlx in neural stem cells of the adult SVZ remains largely unknown. We show here that in the SVZ of the adult brain Tlx is exclusively expressed in astrocyte-like B cells. An inducible mutation of the Tlx gene in the adult brain leads to complete loss of SVZ neurogenesis. Furthermore, analysis indicates that Tlx is required for the transition from radial glial cells to astrocyte-like neural stem cells. These findings demonstrate the crucial role of Tlx in the generation and maintenance of NSCs in the adult SVZ in vivo. PMID:18794344
Mapping the Dynamics of the Glucocorticoid Receptor within the Nuclear Landscape.
Stortz, Martin; Presman, Diego M; Bruno, Luciana; Annibale, Paolo; Dansey, Maria V; Burton, Gerardo; Gratton, Enrico; Pecci, Adali; Levi, Valeria
2017-07-24
The distribution of the transcription machinery among different sub-nuclear domains raises the question on how the architecture of the nucleus modulates the transcriptional response. Here, we used fluorescence fluctuation analyses to quantitatively explore the organization of the glucocorticoid receptor (GR) in the interphase nucleus of living cells. We found that this ligand-activated transcription factor diffuses within the nucleus and dynamically interacts with bodies enriched in the coregulator NCoA-2, DNA-dependent foci and chromatin targets. The distribution of the receptor among the nuclear compartments depends on NCoA-2 and the conformation of the receptor as assessed with synthetic ligands and GR mutants with impaired transcriptional abilities. Our results suggest that the partition of the receptor in different nuclear reservoirs ultimately regulates the concentration of receptor available for the interaction with specific targets, and thus has an impact on transcription regulation.
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function. PMID:29138803
McInnes, C; Hoyt, D W; Harkins, R N; Pagila, R N; Debanne, M T; O'Connor-McCourt, M; Sykes, B D
1996-12-13
The study of human transforming growth factor-alpha (TGF-alpha) in complex with the epidermal growth factor (EGF) receptor extracellular domain has been undertaken in order to generate information on the interactions of these molecules. Analysis of 1H NMR transferred nuclear Overhauser enhancement data for titration of the ligand with the receptor has yielded specific data on the residues of the growth factor involved in contact with the larger protein. Significant increases and decreases in nuclear Overhauser enhancement cross-peak intensity occur upon complexation, and interpretation of these changes indicates that residues of the A- and C-loops of TGF-alpha form the major binding interface, while the B-loop provides a structural scaffold for this site. These results corroborate the conclusions from NMR relaxation studies (Hoyt, D. W., Harkins, R. N., Debanne, M. T., O'Connor-McCourt, M., and Sykes, B. D. (1994) Biochemistry 33, 15283-15292), which suggest that the C-terminal residues of the polypeptide are immobilized upon receptor binding, while the N terminus of the molecule retains considerable flexibility, and are consistent with structure-function studies of the TGF-alpha/EGF system indicating a multidomain binding model. These results give a visualization, for the first time, of native TGF-alpha in complex with the EGF receptor and generate a picture of the ligand-binding site based upon the intact molecule. This will undoubtedly be of utility in the structure-based design of TGF-alpha/EGF agonists and/or antagonists.
Vincent, Kathleen; Wang, Shu Fan; Laferrière, André; Kumar, Naresh; Coderre, Terence J
2017-04-01
Metabotropic glutamate receptor 5 (mGluR5) is an excitatory G-protein-coupled receptor (GPCR) present in the spinal cord dorsal horn (SCDH) where it has a well-established role in pain. In addition to its traditional location on the cytoplasmic membrane, recent evidence shows that these receptors are present intracellularly on the nuclear membrane in the spinal cord dorsal horn and are implicated in neuropathic pain. Nuclear mGluR5 is a functional receptor that binds glutamate entering the cell through the neuronal glutamate transporter (GT) EAAT3 and activates transcription factor c-fos, whereas plasma membrane mGluR5 is responsible for c-jun activation. Here, we extend these findings to a model of inflammatory pain using complete Freund's adjuvant (CFA) and show that nuclear mGluR5 is also upregulated in the spinal cord dorsal horn following inflammation. We also show that pretreatment with an excitatory amino acid transporter (EAAT) inhibitor attenuates pain and decreases Fos, but not Jun, expression in complete Freund's adjuvant rats. In contrast, selective glial glutamate transporter inhibitors are pronociceptive and increase spinal glutamate concentrations. Additionally, we found that permeable mGluR5 antagonists are more effective at attenuating pain and Fos expression than nonpermeable group I mGluR antagonists. Taken together, these results suggest that under inflammatory conditions, intracellular mGluR5 is actively involved in the relay of nociceptive information in the spinal cord.
Peoples, R J; Cisco, M J; Kaplan, P; Francke, U
1998-01-01
We have identified a novel gene (WBSCR9) within the common Williams-Beuren syndrome (WBS) deletion by interspecies sequence conservation. The WBSCR9 gene encodes a roughly 7-kb transcript with an open reading frame of 1483 amino acids and a predicted protein product size of 170.8 kDa. WBSCR9 is comprised of at least 20 exons extending over 60 kb. The transcript is expressed ubiquitously throughout development and is subject to alternative splicing. Functional motifs identified by sequence homology searches include a bromodomain; a PHD, or C4HC3, finger; several putative nuclear localization signals; four nuclear receptor binding motifs; a polyglutamate stretch and two PEST sequences. Bromodomains, PHD motifs and nuclear receptor binding motifs are cardinal features of proteins that are involved in chromatin remodeling and modulation of transcription. Haploinsufficiency for WBSCR9 gene products may contribute to the complex phenotype of WBS by interacting with tissue-specific regulatory factors during development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Ying-Ying; Kong, De-Xin; Qin, Tao
2010-01-08
It is well known that oxygen rise greatly facilitated biological evolution. However, the underlying mechanisms remain elusive. Recently, Raymond and Segre revealed that molecular oxygen allows 1000 more metabolic reactions than can occur in anoxic conditions. From the novel metabolites produced in aerobic metabolism, we serendipitously found that some of the metabolites are signaling molecules that target nuclear receptors. Since nuclear signaling systems are indispensable to superior organisms, we speculated that aerobic metabolism may facilitate biological evolution through promoting the establishment of nuclear signaling systems. This hypothesis is validated by the observation that most (97.5%) nuclear receptor ligands are producedmore » by aerobic metabolism, which is further explained in terms of the chemical criteria (appropriate volume and rather high hydrophobicity) of nuclear receptor ligands that aerobic metabolites are more ready than anaerobic counterparts to satisfy these criteria.« less
BACKGROUND: The nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha) regulates responses to chemical or physical stress in part by altering expression of genes involved in proteome maintenance. Many of these genes are also transcriptionally regulated by h...
Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M
1998-05-01
We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.
Rogers, Jason V; Rose, Mark D
2014-12-02
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide-sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p's functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. Copyright © 2015 Rogers and Rose.
Rogers, Jason V.; Rose, Mark D.
2014-01-01
During mating in the budding yeast Saccharomyces cerevisiae, two haploid nuclei fuse via two sequential membrane fusion steps. SNAREs (i.e., soluble N-ethylmaleimide–sensitive factor attachment protein receptors) and Prm3p mediate outer nuclear membrane fusion, but the inner membrane fusogen remains unknown. Kar5p is a highly conserved transmembrane protein that localizes adjacent to the spindle pole body (SPB), mediates nuclear envelope fusion, and recruits Prm3p adjacent to the SPB. To separate Kar5p’s functions, we tested localization, Prm3p recruitment, and nuclear fusion efficiency in various kar5 mutants. All domains and the conserved cysteine residues were essential for nuclear fusion. Several kar5 mutant proteins localized properly but did not mediate Prm3p recruitment; other kar5 mutant proteins localized and recruited Prm3p but were nevertheless defective for nuclear fusion, demonstrating additional functions beyond Prm3p recruitment. We identified one Kar5p domain required for SPB localization, which is dependent on the half-bridge protein Mps3p. Electron microscopy revealed a kar5 mutant that arrests with expanded nuclear envelope bridges, suggesting that Kar5p is required after outer nuclear envelope fusion. Finally, a split-GFP assay demonstrated that Kar5p localizes to both the inner and outer nuclear envelope. These insights suggest a mechanism by which Kar5p mediates inner nuclear membrane fusion. PMID:25467943
White, J O; Moore, P A; Elder, M G; Lim, L
1981-01-01
The neonatal administration of testosterone propionate to Wistar rats resulted in anovulatory adults in persistent vaginal oestrus. Clomiphene citrate had a similar effect. In both groups of adults, hyperplasia of the uterine epithelium and occasional metaplasia was observed. The uterine nuclear and cytosol oestrogen and progestin receptors of these anovulatory rats were found to have affinities for their respective ligands similar to those of normal females. The nuclear oestrogen receptor comprised occupied and unoccupied components, as in normal females. The content of the nuclear oestrogen receptor was comparable with that of females in the late dioestrous or pro-oestrous phase. This content was higher in the clomiphene-treated group. Despite the relatively high nuclear oestrogen receptor content the content of progestin receptors, a putative index of the oestrogenic response, was lower in the treated rats than in normal adult females throughout the cycle. Administration of oestradiol to both treatment groups resulted in depletion of cytosol oestrogen receptor content 1 h later, which, however, was not reflected by an increase in the content of nuclear oestrogen receptors. There was no measurable increase in progesterone receptor content in treated rats after daily administration of oestrogen (5 microgram/rat) for 3 days. These changes in sex-hormone-receptor interactions involving an impairment of the normal oestrogenic response may be associated with the abnormal differentiation of the uterus in these sterile, anovulatory animals. Images Fig. 1. Fig. 2. PMID:7316994
Mechanism regulating nuclear calcium signaling.
Malviya, Anant N; Klein, Christian
2006-01-01
Although the outer nuclear membrane is continuous with the endoplasmic reticulum, it is possible to isolate nuclei both intact and free from endoplasmic reticulum contaminants. The outer and the inner nuclear membranes can be purified free from cross-contamination. Evidence in support of autonomous regulation of nuclear calcium signaling relies upon the investigations with isolated nuclei. Mechanisms for generating calcium signaling in the nucleus have been identified. Two calcium transporting systems, an ATP-dependant nuclear Ca(2+)-ATPase and an IP4-mediated inositol 1,3,4,5-tetrakisphosphate receptor, are located on the outer nuclear membrane. Thus, ATP and IP4, depending on external free calcium concentrations, are responsible for filling the nuclear envelope calcium pool. The inositol 1,4,5-trisphosphate receptor is located on the inner nuclear membrane with its ligand binding domain facing toward the nucleoplasm. Likewise, the ryanodine receptor is located on the inner nuclear membrane and its ligand cADP-ribose is generated within the nucleus. A 120 kDa protein fragment of nuclear PLC-gamma1 is stimulated in vivo by epidermal growth factor nuclear signaling coincident with the time course of nuclear membrane epidermal growth factor receptor activation. Stimulated 120 kDa protein fragment interacts with PIKE, a nuclear GTPase, and together they form a complex with PI[3]kinase serving as a module for nuclear PI[3]K stimulation. Thus, the nucleus has its own IP(3) generating system.
Borton, Anna Henry; Benson, Bryan L; Neilson, Lee E; Saunders, Ashley; Alaiti, M Amer; Huang, Alex Y; Jain, Mukesh K; Proweller, Aaron; Ramirez-Bergeron, Diana L
2018-06-01
Limb ischemia resulting from peripheral vascular disease is a common cause of morbidity. Vessel occlusion limits blood flow, creating a hypoxic environment that damages distal tissue, requiring therapeutic revascularization. Hypoxia-inducible factors (HIFs) are key transcriptional regulators of hypoxic vascular responses, including angiogenesis and arteriogenesis. Despite vascular smooth muscle cells' (VSMCs') importance in vessel integrity, little is known about their functional responses to hypoxia in peripheral vascular disease. This study investigated the role of VSMC HIF in mediating peripheral ischemic responses. We used Arnt SMKO mice with smooth muscle-specific deletion of aryl hydrocarbon receptor nuclear translocator (ARNT, HIF-1β), required for HIF transcriptional activity, in a femoral artery ligation model of peripheral vascular disease. Arnt SMKO mice exhibit impaired perfusion recovery despite normal collateral vessel dilation and angiogenic capillary responses. Decreased blood flow manifests in extensive tissue damage and hypoxia in ligated limbs of Arnt SMKO mice. Furthermore, loss of aryl hydrocarbon receptor nuclear translocator changes the proliferation, migration, and transcriptional profile of cultured VSMCs. Arnt SMKO mice display disrupted VSMC morphologic features and wrapping around arterioles and increased vascular permeability linked to decreased local blood flow. Our data demonstrate that traditional vascular remodeling responses are insufficient to provide robust peripheral tissue reperfusion in Arnt SMKO mice. In all, this study highlights HIF responses to hypoxia in arteriole VSMCs critical for the phenotypic and functional stability of vessels that aid in the recovery of blood flow in ischemic peripheral tissues. © 2018 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.
Papi, Alessio; Storci, Gianluca; Guarnieri, Tiziana; De Carolis, Sabrina; Bertoni, Sara; Avenia, Nicola; Sanguinetti, Alessandro; Sidoni, Angelo; Santini, Donatella; Ceccarelli, Claudio; Taffurelli, Mario; Orlandi, Marina; Bonafé, Massimiliano
2013-01-01
Aims Cancer stem cell biology is tightly connected to the regulation of the pro-inflammatory cytokine network. The concept of cancer stem cells “inflammatory addiction” leads to envisage the potential role of anti-inflammatory molecules as new anti-cancer targets. Here we report on the relationship between nuclear receptors activity and the modulation of the pro-inflammatory phenotype in breast cancer stem cells. Methods Breast cancer stem cells were expanded as mammospheres from normal and tumor human breast tissues and from tumorigenic (MCF7) and non tumorigenic (MCF10) human breast cell lines. Mammospheres were exposed to the supernatant of breast tumor and normal mammary gland tissue fibroblasts. Results In mammospheres exposed to the breast tumor fibroblasts supernatant, autocrine tumor necrosis factor-α signalling engenders the functional interplay between peroxisome proliferator activated receptor-α and hypoxia inducible factor-1α (PPARα/HIF1α). The two proteins promote mammospheres formation and enhance each other expression via miRNA130b/miRNA17-5p-dependent mechanism which is antagonized by PPARγ. Further, the PPARα/HIF1α interplay regulates the expression of the pro-inflammatory cytokine interleukin-6, the hypoxia survival factor carbonic anhydrase IX and the plasma lipid carrier apolipoprotein E. Conclusion Our data demonstrate the importance of exploring the role of nuclear receptors (PPARα/PPARγ) in the regulation of pro-inflammatory pathways, with the aim to thwart breast cancer stem cells functioning. PMID:23372804
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prouillac, Caroline, E-mail: c.prouillac@vetagro-sup.fr; Koraichi, Farah; Videmann, Bernadette
2012-03-15
Zearalenone (ZEN) is a non-steroid estrogen mycotoxin produced by numerous strains of Fusarium which commonly contaminate cereals. After oral administration, ZEN is reduced via intestinal and hepatic metabolism to α- and β-zearalenol (αZEL and βZEL). These reduced metabolites possess estrogenic properties, αZEL showing the highest affinity for ERs. ZEN and reduced metabolites cause hormonal effects in animals, such as abnormalities in the development of the reproductive tract and mammary gland in female offspring, suggesting a fetal exposure to these contaminants. In our previous work, we have suggested the potential impact of ZEN on placental cells considering this organ as amore » potential target of xenobiotics. In this work, we first compared the in vitro effects of αZEL and βΖΕL on cell differentiation to their parental molecule on human trophoblast (BeWo cells). Secondly, we investigated their molecular mechanisms of action by investigating the expression of main differentiation biomarkers and the implication of nuclear receptor by docking prediction. Conversely to ZEN, reduced metabolites did not induce trophoblast differentiation. They also induced significant changes in ABC transporter expression by potential interaction with nuclear receptors (LXR, PXR, PR) that could modify the transport function of placental cells. Finally, the mechanism of ZEN differentiation induction seemed not to involve nuclear receptor commonly involved in the differentiation process (PPARγ). Our results demonstrated that in spite of structure similarities between ZEN, αZEL and βZEL, toxicological effects and toxicity mechanisms were significantly different for the three molecules. -- Highlights: ► ZEN and metabolites have differential effect on trophoblast differentiation. ► ZEN and metabolites have differential effect on ABC transporter expression. ► ZEN and metabolites effects involved nuclear receptors interaction.« less
In vitro and in vivo evidence for orphan nuclear receptor RORα function in bone metabolism
Meyer, Thomas; Kneissel, Michaela; Mariani, Jean; Fournier, Brigitte
2000-01-01
Bone is a major target site for steroid hormone action. Steroid hormones like cortisol, vitamin D, and estradiol are responsible for principal events associated with bone formation and resorption. Over the past decade, new members of the nuclear hormone gene family have been identified that lack known ligands. These orphan receptors can be used to uncover signaling molecules that regulate yet unidentified physiological networks. In the present study the function of retinoic acid receptor-related orphan receptor (ROR) α in bone metabolism has been examined. We showed that RORα and RORγ, but not RORβ, are expressed in mesenchymal stem cells derived from bone marrow. Interestingly, for RORα we observed an increased messenger signal expression between control cells and cells undergoing osteogenic differentiation. Furthermore, the direct activation of mouse bone sialoprotein by RORα, typically 7-fold, has been shown. In contrast, transient overexpression of RORα overrides the activation of the osteocalcin promoter by 1α,25-dihydroxyvitamin D3. In addition, we have investigated bone mass parameters and bone geometry in the mouse mutant staggerer (sg/sg), a mouse strain that carries a deletion within the RORα gene. Homozygote mutants have thin long bones compared with the heterozygote animals and wild-type littermates. More interestingly, the bones of the sg/sg animals are osteopenic as indicated by the comparison of bone mineral contents of sg/sg animals to the heterozygote and wild-type animals. We conclude that these in vitro and in vivo results suggest a function for RORα in bone biology. RORα most likely acts by direct modulation of a bone matrix component. PMID:10900268
Steiner-Mosonyi, Marta; Mangroo, Dev
2004-03-15
Nuclear tRNA export in Saccharomyces cerevisiae has been proposed to involve three pathways, designated Los1p-dependent, Los1p-independent nuclear aminoacylation-dependent, and Los1p- and nuclear aminoacylation-independent. Here, a comprehensive biochemical analysis was performed to identify tRNAs exported by the aminoacylation-dependent and -independent pathways of S. cerevisiae. Interestingly, the major tRNA species of at least 19 families were found in the aminoacylated form in the nucleus. tRNAs known to be exported by the export receptor Los1p were also aminoacylated in the nucleus of both wild-type and mutant Los1p strains. FISH (fluorescence in situ hybridization) analyses showed that tRNA(Tyr) co-localizes with the U18 small nucleolar RNA in the nucleolus of a tyrosyl-tRNA synthetase mutant strain defective in nuclear tRNA(Tyr) export because of a block in nuclear tRNA(Tyr) aminoacylation. tRNA(Tyr) was also found in the nucleolus of a utp8 mutant strain defective in nuclear tRNA export but not nuclear tRNA aminoacylation. These results strongly suggest that the nuclear aminoacylation-dependent pathway is principally responsible for tRNA export in S. cerevisiae and that Los1p is an export receptor of this pathway. It is also likely that in mammalian cells tRNAs are mainly exported from the nucleus by the nuclear aminoacylation-dependent pathway. In addition, the data are consistent with the idea that nuclear aminoacylation is used as a quality control mechanism for ensuring nuclear export of only mature and functional tRNAs, and that this quality assurance step occurs in the nucleolus.
Dissection of a nuclear localization signal.
Hodel, M R; Corbett, A H; Hodel, A E
2001-01-12
The regulated process of protein import into the nucleus of a eukaryotic cell is mediated by specific nuclear localization signals (NLSs) that are recognized by protein import receptors. This study seeks to decipher the energetic details of NLS recognition by the receptor importin alpha through quantitative analysis of variant NLSs. The relative importance of each residue in two monopartite NLS sequences was determined using an alanine scanning approach. These measurements yield an energetic definition of a monopartite NLS sequence where a required lysine residue is followed by two other basic residues in the sequence K(K/R)X(K/R). In addition, the energetic contributions of the second basic cluster in a bipartite NLS ( approximately 3 kcal/mol) as well as the energy of inhibition of the importin alpha importin beta-binding domain ( approximately 3 kcal/mol) were also measured. These data allow the generation of an energetic scale of nuclear localization sequences based on a peptide's affinity for the importin alpha-importin beta complex. On this scale, a functional NLS has a binding constant of approximately 10 nm, whereas a nonfunctional NLS has a 100-fold weaker affinity of 1 microm. Further correlation between the current in vitro data and in vivo function will provide the foundation for a comprehensive quantitative model of protein import.
The Expanding Complexity of Estrogen Receptor Signaling in the Cardiovascular System
Menazza, Sara; Murphy, Elizabeth
2016-01-01
Estrogen has important effects on cardiovascular function including regulation of vascular function, blood pressure, endothelial relaxation, the development of hypertrophy and cardioprotection. However, the mechanisms by which estrogen mediates these effects are still poorly understood. As detailed in this review, estrogen can regulate transcription by binding to two nuclear receptors, ERα and ERβ, which differentially regulate gene transcription. ERα and ERβ regulation of gene transcription is further modulated by tissue specific co-activators and co-repressors. Estrogen can bind to ERα and ERβ localized at the plasma membrane as well as GPER to initiate membrane delimited signaling, which enhances kinase signaling pathways that can have acute and long term effects. The kinase signaling pathways can also mediate transcriptional changes, and can synergize with the estrogen receptor to regulate cell function. This review will summarize the beneficial effects of estrogen in protecting the cardiovascular system through ER-dependent mechanisms with an emphasis on the role of the recently described ER-membrane signaling mechanisms. PMID:26838792
Orr, Christopher R.; Montie, Heather L.; Liu, Yuhong; Bolzoni, Elena; Jenkins, Shannon C.; Wilson, Elizabeth M.; Joseph, James D.; McDonnell, Donald P.; Merry, Diane E.
2010-01-01
Polyglutamine expansion within the androgen receptor (AR) causes spinal and bulbar muscular atrophy (SBMA) and is associated with misfolded and aggregated species of the mutant AR. We showed previously that nuclear localization of the mutant AR was necessary but not sufficient for SBMA. Here we show that an interdomain interaction of the AR that is central to its function within the nucleus is required for AR aggregation and toxicity. Ligands that prevent the interaction between the amino-terminal FXXLF motif and carboxyl-terminal AF-2 domain (N/C interaction) prevented toxicity and AR aggregation in an SBMA cell model and rescued primary SBMA motor neurons from 5α-dihydrotestosterone-induced toxicity. Moreover, genetic mutation of the FXXLF motif prevented AR aggregation and 5α-dihydrotestosterone toxicity. Finally, selective androgen receptor modulators, which prevent the N/C interaction, ameliorated AR aggregation and toxicity while maintaining AR function, highlighting a novel therapeutic strategy to prevent the SBMA phenotype while retaining AR transcriptional function. PMID:20826791
Design of selective nuclear receptor modulators: RAR and RXR as a case study.
de Lera, Angel R; Bourguet, William; Altucci, Lucia; Gronemeyer, Hinrich
2007-10-01
Retinoic acid receptors (RARs) and retinoid X receptors (RXRs) are members of the nuclear receptor superfamily whose effects on cell growth and survival can be modulated therapeutically by small-molecule ligands. Although compounds that target these receptors are powerful anticancer drugs, their use is limited by toxicity. An improved understanding of the structural biology of RXRs and RARs and recent advances in the chemical synthesis of modified retinoid and rexinoid ligands should enable the rational design of more selective agents that might overcome such problems. Here, we review structural data for RXRs and RARs, discuss strategies in the design of selective RXR and RAR modulators, and consider lessons that can be learned for the design of selective nuclear-receptor modulators in general.
NASA Astrophysics Data System (ADS)
Sakurai, Akihiro; Takeda, Kyoko; Ain, Kenneth; Ceccarelli, Paola; Nakai, Akira; Seino, Susumu; Bell, Graeme I.; Refetoff, Samuel; Degroot, Leslie J.
1989-11-01
The syndrome of generalized resistance to thyroid hormone is characterized by elevated circulating levels of thyroid hormone in the presence of an overall eumetabolic state and failure to respond normally to triiodothyronine. We have evaluated a family with inherited generalized resistance to thyroid hormone for abnormalities in the thyroid hormone nuclear receptors. A single guanine --> cytosine replacement in the codon for amino acid 340 resulted in a glycine --> arginine substitution in the hormone-binding domain of one of two alleles of the patient's thyroid hormone nuclear receptor β gene. In vitro translation products of this mutant human thyroid hormone nuclear receptor β gene did not bind triiodothyronine. Thus, generalized resistance to thyroid hormone can result from expression of an abnormal thyroid hormone nuclear receptor molecule.
Coleman, Jeffrey D.; Prabhu, K. Sandeep; Thompson, Jerry T.; Reddy, P. Sreenivasula; Peters, Jeffrey M.; Peterson, Blake R.; Reddy, C. Channa; Vanden Heuvel, John P.
2007-01-01
Liver insufficiency and damage is a major cause of death and disease worldwide and may result from exposure to environmental toxicants, specific combinations or dosages of pharmaceuticals and microbial metabolites. The generation of reactive intermediates, in particular 4-hydroxynonenal (4-HNE), is a common event in liver damage caused by a variety of hepatotoxic drugs and solvents. The peroxisome proliferator-activated receptors (PPARs) are nuclear receptors that are involved in the transcriptional regulation of lipid metabolism as well as other biological functions. Importantly, we have observed that the PPARβ/δ−/− mouse is more susceptible to chemically-induced hepatotoxicity than its wildtype counterpart, and our objective in this study was to elucidate the mechanism(s) by which PPARβ/δ confers protection to hepatocytes. We hypothesized that PPARβ/δ plays a protective role by responding to toxic lipids and altering gene expression accordingly. In support, oxidized-VLDL and constituents including 13-S-hydroxyoctadeca-dienoic acid (13(S)-HODE) and 4-HNE are PPARβ/δ ligands. A structure-activity relationship was established where 4-HNE and 4-hydroperoxynonenal (4-HpNE) enhanced the activity of the PPARβ/δ subtype while 4-hyroxy-hexenal (4-HHE), 4-oxo-2-Nonenal (4-ONE), and trans-4,5-epoxy-2(E)-decenal did not activate this receptor. Increasing PPARβ/δ activity with a synthetic agonist decreased sensitivity of hepatocytes to 4-HNE and other toxic agents, whereas inhibition of this receptor had the opposite result. Gene expression microarray analysis identified several important PPARβ/δ-regulated detoxification enzymes involved in 4-HNE metabolism that are regulated at the transcript level. This research established 4-HNE as an endogenous modulator of PPARβ/δ activity and raises the possibility that agonists of this nuclear receptor may be utilized to prevent or treat liver disease associated with oxidative damage. PMID:17382197
Kim, Kang Ho; Moore, David D
2017-01-01
The liver undergoes major changes in substrate utilization and metabolic output over the daily feeding and fasting cycle. These changes occur acutely in response to hormones such as insulin and glucagon, with rapid changes in signaling pathways mediated by protein phosphorylation and other post-translational modifications. They are also reflected in chronic alterations in gene expression in response to nutrient-sensitive transcription factors. Among these, the nuclear receptors farnesoid X receptor (FXR) and peroxisome proliferator activated receptor α (PPARα) provide an intriguing, coordinated response to maintain energy balance in the liver. FXR is activated in the fed state by bile acids returning to the liver, while PPARα is activated in the fasted state in response to the free fatty acids produced by adipocyte lipolysis or possibly other signals. Key Messages: Previous studies indicate that FXR and PPARα have opposing effects on each other's primary targets in key metabolic pathways including gluconeogenesis. Our more recent work shows that these 2 nuclear receptors coordinately regulate autophagy: FXR suppresses this pathway of nutrient and energy recovery, while PPARα activates it. Another recent study indicates that FXR activates the complement and coagulation pathway, while earlier studies identify this as a negative target of PPARα. Since secretion is a very energy- and nutrient-intensive process for hepatocytes, it is possible that FXR licenses it in the nutrient-rich fed state, while PPARα represses it to spare resources in the fasted state. Energy balance is a potential connection linking FXR and PPARα regulation of autophagy and secretion, 2 seemingly unrelated aspects of hepatocyte function. FXR and PPARα act coordinately to promote energy balance and homeostasis in the liver by regulating autophagy and potentially protein secretion. It is quite likely that their impact extends to additional pathways relevant to hepatic energy balance, and that these pathways will in turn interface with other well-known nutrient-responsive mechanisms of energy control. © 2017 S. Karger AG, Basel.
Chen, Wei; Zhang, Xiaoting; Birsoy, Kivanc; Roeder, Robert G
2010-06-01
As conventional transcriptional factors that are activated in diverse signaling pathways, nuclear receptors play important roles in many physiological processes that include energy homeostasis. The MED1 subunit of the Mediator coactivator complex plays a broad role in nuclear receptor-mediated transcription by anchoring the Mediator complex to diverse promoter-bound nuclear receptors. Given the significant role of skeletal muscle, in part through the action of nuclear receptors, in glucose and fatty acid metabolism, we generated skeletal muscle-specific Med1 knockout mice. Importantly, these mice show enhanced insulin sensitivity and improved glucose tolerance as well as resistance to high-fat diet-induced obesity. Furthermore, the white muscle of these mice exhibits increased mitochondrial density and expression of genes specific to type I and type IIA fibers, indicating a fast-to-slow fiber switch, as well as markedly increased expression of the brown adipose tissue-specific UCP-1 and Cidea genes that are involved in respiratory uncoupling. These dramatic results implicate MED1 as a powerful suppressor in skeletal muscle of genetic programs implicated in energy expenditure and raise the significant possibility of therapeutical approaches for metabolic syndromes and muscle diseases through modulation of MED1-nuclear receptor interactions.
Saloura, Vassiliki; Vougiouklakis, Theodore; Zewde, Makda; Deng, Xiaolan; Kiyotani, Kazuma; Park, Jae-Hyun; Matsuo, Yo; Lingen, Mark; Suzuki, Takehiro; Dohmae, Naoshi; Hamamoto, Ryuji; Nakamura, Yusuke
2017-01-01
While multiple post-translational modifications have been reported to regulate the function of epidermal growth factor receptor (EGFR), the effect of protein methylation on its function has not been well characterized. In this study, we show that WHSC1L1 mono-methylates lysine 721 in the tyrosine kinase domain of EGFR, and that this methylation leads to enhanced activation of its downstream ERK cascade without EGF stimulation. We also show that EGFR K721 mono-methylation not only affects the function of cytoplasmic EGFR, but also that of nuclear EGFR. WHSC1L1-mediated methylation of EGFR in the nucleus enhanced its interaction with PCNA in squamous cell carcinoma of the head and neck (SCCHN) cells and resulted in enhanced DNA synthesis and cell cycle progression. Overall, our study demonstrates the multifaceted oncogenic function of the protein lysine methyltransferase WHSC1L1 in SCCHN, which is mediated through direct non-histone methylation of the EGFR protein with effects both in its cytoplasmic and nuclear functions. PMID:28102297
Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J
1997-10-01
Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.
Nicolaides, Nicolas C; Roberts, Michael L; Kino, Tomoshige; Braatvedt, Geoffrey; Hurt, Darrell E; Katsantoni, Eleni; Sertedaki, Amalia; Chrousos, George P; Charmandari, Evangelia
2014-05-01
Primary generalized glucocorticoid resistance is a rare genetic disorder characterized by generalized, partial, target-tissue insensitivity to glucocorticoids. The molecular basis of the condition has been ascribed to inactivating mutations in the human glucocorticoid receptor (hGR) gene. The objective of the study was to present three new cases caused by a novel mutation in the hGR gene and to delineate the molecular mechanisms through which the mutant receptor impairs glucocorticoid signal transduction. The index case (father) and his two daughters presented with increased urinary free cortisol excretion and resistance of the hypothalamic-pituitary-adrenal axis to dexamethasone suppression in the absence of clinical manifestations suggestive of Cushing syndrome. All subjects harbored a novel, heterozygous, point mutation (T→G) at nucleotide position 1724 of the hGR gene, which resulted in substitution of valine by glycine at amino acid 575 of the receptor. Compared with the wild-type receptor, the hGRαV575G demonstrated a significant (33%) reduction in its ability to transactivate the mouse mammary tumor virus promoter in response to dexamethasone, a 50% decrease in its affinity for the ligand, and a 2.5-fold delay in nuclear translocation. Although it did not exert a dominant negative effect on the wild-type receptor and preserved its ability to bind to DNA, hGRαV575G displayed significantly enhanced (∼80%) ability to transrepress the nuclear factor-κΒ signaling pathway. Finally, the mutant receptor hGRαV575G demonstrated impaired interaction with the LXXLL motif of the glucocorticoid receptor-interacting protein 1 coactivator in vitro and in computer-based structural simulation via its defective activation function-2 (AF-2) domain. The natural mutant receptor hGRαV575G causes primary generalized glucocorticoid resistance by affecting multiple steps in the glucocorticoid signaling cascade, including the affinity for the ligand, the time required for nuclear translocation, and the interaction with the glucocorticoid-interacting protein-1 coactivator.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mays, Suzanne G.; Okafor, C. Denise; Tuntland, Micheal L.
Peroxisome proliferator-activated gamma coactivator 1-α (PGC1α) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1α is known to bind and activate LRH-1, mechanisms through which PGC1α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1–PGC1α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), inmore » coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1–PGC1α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1α but promoted allosteric signaling from the helix 6/β-sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1–PGC1α interaction and may illuminate strategies for selective therapeutic targeting of PGC1α-dependent LRH-1 signaling pathways.« less
Bengtson, C Peter; Kaiser, Martin; Obermayer, Joshua; Bading, Hilmar
2013-07-01
Both synaptic N-methyl-d-aspartate (NMDA) receptors and voltage-operated calcium channels (VOCCs) have been shown to be critical for nuclear calcium signals associated with transcriptional responses to bursts of synaptic input. However the direct contribution to nuclear calcium signals from calcium influx through NMDA receptors and VOCCs has been obscured by their concurrent roles in action potential generation and synaptic transmission. Here we compare calcium responses to synaptically induced bursts of action potentials with identical bursts devoid of any synaptic contribution generated using the pre-recorded burst as the voltage clamp command input to replay the burst in the presence of blockers of action potentials or ionotropic glutamate receptors. Synapse independent replays of bursts produced nuclear calcium responses with amplitudes around 70% of their original synaptically generated signals and were abolished by the L-type VOCC blocker, verapamil. These results identify a major direct source of nuclear calcium from local L-type VOCCs whose activation is boosted by NMDA receptor dependent depolarization. The residual component of synaptically induced nuclear calcium signals which was both VOCC independent and NMDA receptor dependent showed delayed kinetics consistent with a more distal source such as synaptic NMDA receptors or internal stores. The dual requirement of NMDA receptors and L-type VOCCs for synaptic activity-induced nuclear calcium dependent transcriptional responses most likely reflects a direct somatic calcium influx from VOCCs whose activation is amplified by synaptic NMDA receptor-mediated depolarization and whose calcium signal is boosted by a delayed input from distal calcium sources mostly likely entry through NMDA receptors and release from internal stores. This article is part of a Special Issue entitled: 12th European Symposium on Calcium. Copyright © 2013 Elsevier B.V. All rights reserved.
Szafran, Adam T.; Szwarc, Maria; Marcelli, Marco; Mancini, Michael A.
2008-01-01
Background Understanding how androgen receptor (AR) function is modulated by exposure to steroids, growth factors or small molecules can have important mechanistic implications for AR-related disease therapies (e.g., prostate cancer, androgen insensitivity syndrome, AIS), and in the analysis of environmental endocrine disruptors. Methodology/Principal Findings We report the development of a high throughput (HT) image-based assay that quantifies AR subcellular and subnuclear distribution, and transcriptional reporter gene activity on a cell-by-cell basis. Furthermore, simultaneous analysis of DNA content allowed determination of cell cycle position and permitted the analysis of cell cycle dependent changes in AR function in unsynchronized cell populations. Assay quality for EC50 coefficients of variation were 5–24%, with Z' values reaching 0.91. This was achieved by the selective analysis of cells expressing physiological levels of AR, important because minor over-expression resulted in elevated nuclear speckling and decreased transcriptional reporter gene activity. A small screen of AR-binding ligands, including known agonists, antagonists, and endocrine disruptors, demonstrated that nuclear translocation and nuclear “speckling” were linked with transcriptional output, and specific ligands were noted to differentially affect measurements for wild type versus mutant AR, suggesting differing mechanisms of action. HT imaging of patient-derived AIS mutations demonstrated a proof-of-principle personalized medicine approach to rapidly identify ligands capable of restoring multiple AR functions. Conclusions/Significance HT imaging-based multiplex screening will provide a rapid, systems-level analysis of compounds/RNAi that may differentially affect wild type AR or clinically relevant AR mutations. PMID:18978937
Absence of the neurogenesis-dependent nuclear receptor TLX induces inflammation in the hippocampus.
Kozareva, Danka A; Hueston, Cara M; Ó'Léime, Ciarán S; Crotty, Suzanne; Dockery, Peter; Cryan, John F; Nolan, Yvonne M
2017-08-20
The orphan nuclear receptor TLX (Nr2e1) is a key regulator of hippocampal neurogenesis. Impaired adult hippocampal neurogenesis has been reported in neurodegenerative and psychiatric conditions including dementia and stress-related depression. Neuroinflammation is also implicated in the neuropathology of these disorders, and has been shown to negatively affect hippocampal neurogenesis. To investigate a role for TLX in hippocampal neuroinflammation, we assessed microglial activation in the hippocampus of mice with a spontaneous deletion of TLX. Results from our study suggest that a lack of TLX is implicated in deregulation of microglial phenotype and that consequently, the survival and function of newborn cells in the hippocampus is impaired. TLX may be an important target in understanding inflammatory-associated impairments in neurogenesis. Copyright © 2017 Elsevier B.V. All rights reserved.
Novel mechanisms for DHEA action.
Prough, Russell A; Clark, Barbara J; Klinge, Carolyn M
2016-04-01
Dehydroepiandrosterone (3β-hydroxy-5-androsten-17-one, DHEA), secreted by the adrenal cortex, gastrointestinal tract, gonads, and brain, and its sulfated metabolite DHEA-S are the most abundant endogeneous circulating steroid hormones. DHEA actions are classically associated with age-related changes in cardiovascular tissues, female fertility, metabolism, and neuronal/CNS functions. Early work on DHEA action focused on the metabolism to more potent sex hormones, testosterone and estradiol, and the subsequent effect on the activation of the androgen and estrogen steroid receptors. However, it is now clear that DHEA and DHEA-S act directly as ligands for many hepatic nuclear receptors and G-protein-coupled receptors. In addition, it can function to mediate acute cell signaling pathways. This review summarizes the molecular mechanisms by which DHEA acts in cells and animal models with a focus on the 'novel' and physiological modes of DHEA action. © 2016 Society for Endocrinology.
Glucocorticoid receptor signaling in health and disease
Kadmiel, Mahita; Cidlowski, John A.
2013-01-01
Glucocorticoids are steroid hormones regulated in a circadian and stres-associated manner to maintain various metabolic and homeostatic functions that are necessary for life. Synthetic glucocorticoids are widely prescribed drugs for many conditions including asthma, chronic obstructive pulmonary disease (COPD), and inflammatory disorders of the eye. Research in the last few years has begun to unravel the profound complexity of glucocorticoid signaling and has contributed remarkably to improved therapeutic strategies. Glucocorticoids signal through the glucocorticoid receptor, a member of the superfamily of nuclear receptors, in both genomic and non-genomic ways in almost every tissue in the human body. In this review, we will provide an update on glucocorticoid receptor signaling and highlight the role of GR signaling in physiological and pathophysiological conditions in the major organ systems in the human body. PMID:23953592
Nuclear medicine and imaging research (quantitative studies in radiopharmaceutical science)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cooper, M.; Beck, R.N.
1992-06-01
This report describes three studies aimed at using radiolabeled pharmaceuticals to explore brain function and anatomy. The first section describes the chemical preparation of (F18)fluorinated benzamides (dopamine D-2 receptor tracers), (F18)fluorinated benzazepines (dopamine D-1 receptor tracers), and tissue distribution of (F18)-fluoxetine (serotonin reuptake site tracer). The second section relates pharmacological and behavioral studies of amphetamines. The third section reports on progress made with processing of brain images from CT, MRI and PET/SPECT with regards to brain metabolism of glucose during mental tasks.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sundar, Isaac K.; Hwang, Jae-Woong; Wu, Shaoping
Research highlights: {yields} Vitamin D deficiency is linked to accelerated decline in lung function. {yields} Levels of vitamin D receptor (VDR) are decreased in lungs of patients with COPD. {yields} VDR knock-out mouse showed increased lung inflammation and emphysema. {yields} This was associated with decline in lung function and increased MMPs. {yields} VDR knock-out mouse model is useful for studying the mechanisms of lung diseases. -- Abstract: Deficiency of vitamin D is associated with accelerated decline in lung function. Vitamin D is a ligand for nuclear hormone vitamin D receptor (VDR), and upon binding it modulates various cellular functions. Themore » level of VDR is reduced in lungs of patients with chronic obstructive pulmonary disease (COPD) which led us to hypothesize that deficiency of VDR leads to significant alterations in lung phenotype that are characteristics of COPD/emphysema associated with increased inflammatory response. We found that VDR knock-out (VDR{sup -/-}) mice had increased influx of inflammatory cells, phospho-acetylation of nuclear factor-kappaB (NF-{kappa}B) associated with increased proinflammatory mediators, and up-regulation of matrix metalloproteinases (MMPs) MMP-2, MMP-9, and MMP-12 in the lung. This was associated with emphysema and decline in lung function associated with lymphoid aggregates formation compared to WT mice. These findings suggest that deficiency of VDR in mouse lung can lead to an early onset of emphysema/COPD because of chronic inflammation, immune dysregulation, and lung destruction.« less
Sugatani, T; Alvarez, U M; Hruska, K A
2003-09-01
Recent studies have reported that activin A enhances osteoclastogenesis in cultures of mouse bone marrow cells stimulated with receptor activator of nuclear factor-kappaB ligand (RANKL) and macrophage colony-stimulating factor (M-CSF). However, the exact mechanisms by which activin A functions during osteoclastogenesis are not clear. RANKL stimulation of RANK/TRAF6 signaling increases nuclear factor-kappaB (NFkappaB) nuclear translocation and activates the Akt/PKB cell survival pathway. Here we report that activin A alone activates IkappaB-alpha, and stimulates nuclear translocation of NFkappaB and receptor activator of nuclear factor-kappaB (RANK) expression for osteoclastogenesis, but not Akt/PKB survival signal transduction including BAD and mammalian target of rapamycin (mTOR) for survival in osteoclast precursors in vitro. Activin A alone failed to activate Akt, BAD, and mTOR by immunoblotting, and it also failed to prevent apoptosis in osteoclast precursors. While activin A activated IkappaB-alpha and induced nuclear translocation of phosphorylated-NFkappaB, and it also enhanced RANK expression in osteoclast precursors. Moreover, activin A enhanced RANKL- and M-CSF-stimulated nuclear translocation of NFkappaB. Our data suggest that activin A enhances osteoclastogenesis treated with RANKL and M-CSF via stimulation of RANK, thereby increasing the RANKL stimulation. Activin A alone activated the NFkappaB pathway, but not survival in osteoclast precursors in vitro, but it is, thus, insufficient as a sole stimulus to osteoclastogenesis. Copyright 2003 Wiley-Liss, Inc.
ERRs and cancers: effects on metabolism and on proliferation and migration capacities.
Bianco, Stéphanie; Sailland, Juliette; Vanacker, Jean-Marc
2012-07-01
ERRs are orphan members of the nuclear receptor superfamily which, at least for ERRα and ERRγ display important roles in the control of various metabolic processes. On other hand, correlations have been found between the expression of ERRα and γ and diverse parameters of tumor progression in human cancers. Whereas it is tempting to speculate that ERR receptors act in tumors through the regulation of metabolism, recent data have suggested that they also may directly regulate tumor proliferation and progression independently of their effects on metabolism. The two aspects of tumoral functions of ERR receptors are the purpose of the present review. Copyright © 2011 Elsevier Ltd. All rights reserved.
Nomiyama, Takashi; Zhao, Yue; Gizard, Florence; Findeisen, Hannes M.; Heywood, Elizabeth B.; Jones, Karrie L.; Conneely, Orla M.; Bruemmer, Dennis
2009-01-01
Background The neuron-derived orphan receptor-1 (NOR1) belongs to the evolutionary highly conserved and most ancient NR4A subfamily of the nuclear hormone receptor superfamily. Members of this subfamily function as early response genes regulating key cellular processes including proliferation, differentiation, and survival. Although NOR1 has previously been demonstrated to be required for smooth muscle cell (SMC) proliferation in vitro, the role of this nuclear receptor for the proliferative response underlying neointima formation and target genes trans-activated by NOR1 remain to be defined. Methods and Results Using a model of guide wire-induced arterial injury, we demonstrate decreased neointima formation in NOR1-/- mice compared to wildtype mice. In vitro, NOR1-deficient SMC exhibit decreased proliferation due to a G1→S phase arrest of the cell cycle and increased apoptosis in response to serum deprivation. NOR1-deficiency alters phosphorylation of the retinoblastoma protein by preventing mitogen-induced cyclin D1 and D2 expression. Conversely, overexpression of NOR1 induces cyclin D1 expression and the transcriptional activity of the cyclin D1 promoter in transient reporter assays. Gel shift and chromatin immunoprecipitation assays identified a putative response element for NR4A receptors in the cyclin D1 promoter, to which NOR1 is recruited in response to mitogenic stimulation. Finally, we provide evidence that these observations are applicable in vivo by demonstrating decreased cyclin D1 expression during neointima formation in NOR1-deficient mice. Conclusions These experiments characterize cyclin D1 as a NOR1-regulated target gene in SMC and demonstrate that NOR1 deficiency decreases neointima formation in response to vascular injury. PMID:19153266
Schmidt, Azriel; Vogel, Robert; Rutledge, Su Jane; Opas, Evan E; Rodan, Gideon A; Friedman, Eitan
2005-03-01
Nuclear receptors are transcription factors that usually interact, in a ligand-dependent manner, with specific DNA sequences located within promoters of target genes. The nuclear receptors can also be controlled in a ligand-independent manner via the action of membrane receptors and cellular signaling pathways. 5-Tetradecyloxy-2-furancarboxylic acid (TOFA) was shown to stimulate transcription from the MMTV promoter via chimeric receptors that consist of the DNA binding domain of GR and the ligand binding regions of the PPARbeta or LXRbeta nuclear receptors (GR/PPARbeta and GR/LXRbeta). TOFA and hydroxycholesterols also modulate transcription from NF-kappaB- and AP-1-controlled reporter genes and induce neurite differentiation in PC12 cells. In CV-1 cells that express D(1) dopamine receptors, D(1) dopamine receptor stimulation was found to inhibit TOFA-stimulated transcription from the MMTV promoter that is under the control of chimeric GR/PPARbeta and GR/LXRbeta receptors. Treatment with the D(1) dopamine receptor antagonist, SCH23390, prevented dopamine-mediated suppression of transcription, and by itself increased transcription controlled by GR/LXRbeta. Furthermore, combined treatment of CV-1 cells with TOFA and SCH23390 increased transcription controlled by the GR/LXRbeta chimeric receptor synergistically. The significance of this in vitro synergy was demonstrated in vivo, by the observation that SCH23390 (but not haloperidol)-mediated catalepsy in rats was potentiated by TOFA, thus showing that an agent that mimics the in vitro activities of compounds that activate members of the LXR and PPAR receptor families can influence D1 dopamine receptor elicited responses.
2013-01-01
Background Co-Activator Arginine Methyltransferase 1(CARM1) is an Estrogen Receptor (ER) cofactor that remodels chromatin for gene regulation via methylation of Histone3. We investigated CARM1 levels and localization across breast cancer tumors in a cohort of patients of either European or African ancestry. Methods We analyzed CARM1 levels using tissue microarrays with over 800 histological samples from 549 female cancer patients from the US and Nigeria, Africa. We assessed associations between CARM1 expression localized to the nucleus and cytoplasm for 11 distinct variables, including; ER status, Progesterone Receptor status, molecular subtypes, ethnicity, HER2+ status, other clinical variables and survival. Results We found that levels of cytoplasmic CARM1 are distinct among tumor sub-types and increased levels are associated with ER-negative (ER-) status. Higher nuclear CARM1 levels are associated with HER2 receptor status. EGFR expression also correlates with localization of CARM1 into the cytoplasm. This suggests there are distinct functions of CARM1 among molecular tumor types. Our data reveals a basal-like subtype association with CARM1, possibly due to expression of Epidermal Growth Factor Receptor (EGFR). Lastly, increased cytoplasmic CARM1, relative to nuclear levels, appear to be associated with self-identified African ethnicity and this result is being further investigated using quantified genetic ancestry measures. Conclusions Although it is known to be an ER cofactor in breast cancer, CARM1 expression levels are independent of ER. CARM1 has distinct functions among molecular subtypes, as is indicative of its sub-cellular localization and it may function in subtype etiology. These sub-cellular localization patterns, indicate a novel role beyond its ER cofactor function in breast cancer. Differential localization among ethnic groups may be due to ancestry-specific polymorphisms which alter the gene product. PMID:23663560
Elevated copper impairs hepatic nuclear receptor function in Wilson's disease
USDA-ARS?s Scientific Manuscript database
Wilson's disease (WD) is an autosomal recessive disorder that results in accumulation of copper in the liver as a consequence of mutations in the gene encoding the copper-transporting P-type ATPase (ATP7B). WD is a chronic liver disorder, and individuals with the disease present with a variety of co...
The RanGTP Pathway: From Nucleo-Cytoplasmic Transport to Spindle Assembly and Beyond
Cavazza, Tommaso; Vernos, Isabelle
2016-01-01
The small GTPase Ran regulates the interaction of transport receptors with a number of cellular cargo proteins. The high affinity binding of the GTP-bound form of Ran to import receptors promotes cargo release, whereas its binding to export receptors stabilizes their interaction with the cargo. This basic mechanism linked to the asymmetric distribution of the two nucleotide-bound forms of Ran between the nucleus and the cytoplasm generates a switch like mechanism controlling nucleo-cytoplasmic transport. Since 1999, we have known that after nuclear envelope breakdown (NEBD) Ran and the above transport receptors also provide a local control over the activity of factors driving spindle assembly and regulating other aspects of cell division. The identification and functional characterization of RanGTP mitotic targets is providing novel insights into mechanisms essential for cell division. Here we review our current knowledge on the RanGTP system and its regulation and we focus on the recent advances made through the characterization of its mitotic targets. We then briefly review the novel functions of the pathway that were recently described. Altogether, the RanGTP system has moonlighting functions exerting a spatial control over protein interactions that drive specific functions depending on the cellular context. PMID:26793706
The orphan nuclear receptor Tlx regulates Pax2 and is essential for vision.
Yu, R T; Chiang, M Y; Tanabe, T; Kobayashi, M; Yasuda, K; Evans, R M; Umesono, K
2000-03-14
Although the development of the vertebrate eye is well described, the number of transcription factors known to be key to this process is still limited. The localized expression of the orphan nuclear receptor Tlx in the optic cup and discrete parts of the central nervous system suggested the possible role of Tlx in the formation or function of these structures. Analyses of Tlx targeted mice revealed that, in addition to the central nervous system cortical defects, lack of Tlx function results in progressive retinal and optic nerve degeneration with associated blindness. An extensive screen of Tlx-positive and Tlx-negative P19 neural precursors identified Pax2 as a candidate target gene. This identification is significant, because Pax2 is known to be involved in retinal development in both the human and the mouse eye. We find that Pax2 is a direct target and that the Tlx binding site in its promoter is conserved between mouse and human. These studies show that Tlx is a key component of retinal development and vision and an upstream regulator of the Pax2 signaling cascade.
The orphan nuclear receptor Tlx regulates Pax2 and is essential for vision
Yu, Ruth T.; Chiang, Ming-Yi; Tanabe, Teruyo; Kobayashi, Mime; Yasuda, Kunio; Evans, Ronald M.; Umesono, Kazuhiko
2000-01-01
Although the development of the vertebrate eye is well described, the number of transcription factors known to be key to this process is still limited. The localized expression of the orphan nuclear receptor Tlx in the optic cup and discrete parts of the central nervous system suggested the possible role of Tlx in the formation or function of these structures. Analyses of Tlx targeted mice revealed that, in addition to the central nervous system cortical defects, lack of Tlx function results in progressive retinal and optic nerve degeneration with associated blindness. An extensive screen of Tlx-positive and Tlx-negative P19 neural precursors identified Pax2 as a candidate target gene. This identification is significant, because Pax2 is known to be involved in retinal development in both the human and the mouse eye. We find that Pax2 is a direct target and that the Tlx binding site in its promoter is conserved between mouse and human. These studies show that Tlx is a key component of retinal development and vision and an upstream regulator of the Pax2 signaling cascade. PMID:10706625
Saito, Shoko; Yokokawa, Takafumi; Iizuka, Gemmei; Cigdem, Sadik; Okuwaki, Mitsuru; Nagata, Kyosuke
2017-05-20
Nup98 is a component of the nuclear pore complex. The nup98-fusion genes derived by chromosome translocations are involved in hematopoietic malignancies. Here, we investigated the functions of Nup98 isoforms and two unexamined Nup98-fusion proteins, Nup98-TopIIβ and Nup98-SETBP1. We first demonstrated that two Nup98 isoforms are expressed in various mouse tissues and similarly localized in the nucleus and the nuclear envelope. We also showed that Nup98-TopIIβ and Nup98-SETBP1 are localized in the nucleus and partially co-localized with full-length Nup98 and a nuclear export receptor XPO1. We demonstrated that Nup98-TopIIβ and Nup98-SETBP1 negatively regulate the XPO1-mediated protein export. Our results will contribute to the understanding of the molecular mechanism by which the Nup98-fusion proteins induce tumorigenesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Thermodynamic Paradigm for Solution Demixing Inspired by Nuclear Transport in Living Cells
NASA Astrophysics Data System (ADS)
Wang, Ching-Hao; Mehta, Pankaj; Elbaum, Michael
2017-04-01
Living cells display a remarkable capacity to compartmentalize their functional biochemistry. A particularly fascinating example is the cell nucleus. Exchange of macromolecules between the nucleus and the surrounding cytoplasm does not involve traversing a lipid bilayer membrane. Instead, large protein channels known as nuclear pores cross the nuclear envelope and regulate the passage of other proteins and RNA molecules. Beyond simply gating diffusion, the system of nuclear pores and associated transport receptors is able to generate substantial concentration gradients, at the energetic expense of guanosine triphosphate hydrolysis. In contrast to conventional approaches to demixing such as reverse osmosis and dialysis, the biological system operates continuously, without application of cyclic changes in pressure or solvent exchange. Abstracting the biological paradigm, we examine this transport system as a thermodynamic machine of solution demixing. Building on the construct of free energy transduction and biochemical kinetics, we find conditions for the stable operation and optimization of the concentration gradients as a function of dissipation in the form of entropy production.
Wagner, Kay-Dietrich; Vukolic, Ana; Baudouy, Delphine; Michiels, Jean-François
2016-01-01
Peroxisome proliferator-activated receptors are nuclear receptors which function as ligand-activated transcription factors. Among them, peroxisome proliferator-activated receptor beta/delta (PPARβ/δ) is highly expressed in the heart and thought to have cardioprotective functions due to its beneficial effects in metabolic syndrome. As we already showed that PPARβ/δ activation resulted in an enhanced cardiac angiogenesis and growth without impairment of heart function, we were interested to determine the effects of a specific activation of PPARβ/δ in the vasculature on cardiac performance under normal and in chronic ischemic heart disease conditions. We analyzed the effects of a specific PPARβ/δ overexpression in endothelial cells on the heart using an inducible conditional vascular-specific mouse model. We demonstrate that vessel-specific overexpression of PPARβ/δ induces rapid cardiac angiogenesis and growth with an increase in cardiomyocyte size. Upon myocardial infarction, vascular overexpression of PPARβ/δ, despite the enhanced cardiac vessel formation, does not protect against chronic ischemic injury. Our results suggest that the proper balance of PPARβ/δ activation in the different cardiac cell types is required to obtain beneficial effects on the outcome in chronic ischemic heart disease. PMID:27057154
Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.
1998-01-01
We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457
Idiopathic Hypogonadotropic Hypogonadism Caused by Inactivating Mutations in SRA1
Kotan, Leman Damla; Cooper, Charlton; Darcan, Şükran; Carr, Ian M.; Özen, Samim; Yan, Yi; Hamedani, Mohammad K.; Gürbüz, Fatih; Mengen, Eda; Turan, İhsan; Ulubay, Ayça; Akkuş, Gamze; Yüksel, Bilgin; Topaloğlu, A. Kemal; Leygue, Etienne
2016-01-01
Objective: What initiates the pubertal process in humans and other mammals is still unknown. We hypothesized that gene(s) taking roles in triggering human puberty may be identified by studying a cohort of idiopathic hypogonadotropic hypogonadism (IHH). Methods: A cohort of IHH cases was studied based on autozygosity mapping coupled with whole exome sequencing. Results: Our studies revealed three independent families in which IHH/delayed puberty is associated with inactivating SRA1 variants. SRA1 was the first gene to be identified to function through its protein as well as noncoding functional ribonucleic acid products. These products act as co-regulators of nuclear receptors including sex steroid receptors as well as SF-1 and LRH-1, the master regulators of steroidogenesis. Functional studies with a mutant SRA1 construct showed a reduced co-activation of ligand-dependent activity of the estrogen receptor alpha, as assessed by luciferase reporter assay in HeLa cells. Conclusion: Our findings strongly suggest that SRA1 gene function is required for initiation of puberty in humans. Furthermore, SRA1 with its alternative products and functionality may provide a potential explanation for the versatility and complexity of the pubertal process. PMID:27086651
Wiermer, Marcel; Cheng, Yu Ti; Imkampe, Julia; Li, Meilan; Wang, Dongmei; Lipka, Volker; Li, Xin
2012-06-01
In eukaryotic cells, transduction of external stimuli into the nucleus to induce transcription and export of mRNAs for translation in the cytoplasm is mediated by nuclear pore complexes (NPCs) composed of nucleoporin proteins (Nups). We previously reported that Arabidopsis MOS3, encoding the homolog of vertebrate Nup96, is required for plant immunity and constitutive resistance mediated by the de-regulated Toll interleukin 1 receptor/nucleotide-binding/leucine-rich repeat (TNL)-type R gene snc1. In vertebrates, Nup96 is a component of the conserved Nup107-160 nuclear pore sub-complex, and implicated in immunity-related mRNA export. Here, we used a reverse genetics approach to examine the requirement for additional subunits of the predicted Arabidopsis Nup107-160 complex in plant immunity. We show that, among eight putative complex members, beside MOS3, only plants with defects in Nup160 or Seh1 are impaired in basal resistance. Constitutive resistance in the snc1 mutant and immunity mediated by TNL-type R genes also depend on functional Nup160 and have a partial requirement for Seh1. Conversely, resistance conferred by coiled coil-type immune receptors operates largely independently of both genes, demonstrating specific contributions to plant defense signaling. Our functional analysis further revealed that defects in nup160 and seh1 result in nuclear accumulation of poly(A) mRNA, and, in the case of nup160, considerable depletion of EDS1, a key positive regulator of basal and TNL-triggered resistance. These findings suggest that Nup160 is required for nuclear mRNA export and full expression of EDS1-conditioned resistance pathways in Arabidopsis. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Bain, Peter A; Papanicolaou, Alexie; Kumar, Anupama
2015-01-01
Murray-Darling rainbowfish (Melanotaenia fluviatilis [Castelnau, 1878]; Atheriniformes: Melanotaeniidae) is a small-bodied teleost currently under development in Australasia as a test species for aquatic toxicological studies. To date, efforts towards the development of molecular biomarkers of contaminant exposure have been hindered by the lack of available sequence data. To address this, we sequenced messenger RNA from brain, liver and gonads of mature male and female fish and generated a high-quality draft transcriptome using a de novo assembly approach. 149,742 clusters of putative transcripts were obtained, encompassing 43,841 non-redundant protein-coding regions. Deduced amino acid sequences were annotated by functional inference based on similarity with sequences from manually curated protein sequence databases. The draft assembly contained protein-coding regions homologous to 95.7% of the complete cohort of predicted proteins from the taxonomically related species, Oryzias latipes (Japanese medaka). The mean length of rainbowfish protein-coding sequences relative to their medaka homologues was 92.1%, indicating that despite the limited number of tissues sampled a large proportion of the total expected number of protein-coding genes was captured in the study. Because of our interest in the effects of environmental contaminants on endocrine pathways, we manually curated subsets of coding regions for putative nuclear receptors and steroidogenic enzymes in the rainbowfish transcriptome, revealing 61 candidate nuclear receptors encompassing all known subfamilies, and 41 putative steroidogenic enzymes representing all major steroidogenic enzymes occurring in teleosts. The transcriptome presented here will be a valuable resource for researchers interested in biomarker development, protein structure and function, and contaminant-response genomics in Murray-Darling rainbowfish.
IRAK2 directs stimulus-dependent nuclear export of inflammatory mRNAs
Yu, Minjia; Qian, Wen; Wang, Han; Zhou, Gao; Chen, Xing; Yang, Hui; Hong, Lingzi; Zhao, Junjie; Qin, Luke; Fukuda, Koichi; Flotho, Annette; Gao, Ji; Dongre, Ashok; Carman, Julie A; Kang, Zizhen; Su, Bing; Kern, Timothy S; Smith, Jonathan D; Hamilton, Thomas A; Melchior, Frauke; Fox, Paul L
2017-01-01
Expression of inflammatory genes is determined in part by post-transcriptional regulation of mRNA metabolism but how stimulus- and transcript-dependent nuclear export influence is poorly understood. Here, we report a novel pathway in which LPS/TLR4 engagement promotes nuclear localization of IRAK2 to facilitate nuclear export of a specific subset of inflammation-related mRNAs for translation in murine macrophages. IRAK2 kinase activity is required for LPS-induced RanBP2-mediated IRAK2 sumoylation and subsequent nuclear translocation. Array analysis showed that an SRSF1-binding motif is enriched in mRNAs dependent on IRAK2 for nuclear export. Nuclear IRAK2 phosphorylates SRSF1 to reduce its binding to target mRNAs, which promotes the RNA binding of the nuclear export adaptor ALYREF and nuclear export receptor Nxf1 loading for the export of the mRNAs. In summary, LPS activates a nuclear function of IRAK2 that facilitates the assembly of nuclear export machinery to export selected inflammatory mRNAs to the cytoplasm for translation. PMID:28990926
IRAK2 directs stimulus-dependent nuclear export of inflammatory mRNAs.
Zhou, Hao; Bulek, Katarzyna; Li, Xiao; Herjan, Tomasz; Yu, Minjia; Qian, Wen; Wang, Han; Zhou, Gao; Chen, Xing; Yang, Hui; Hong, Lingzi; Zhao, Junjie; Qin, Luke; Fukuda, Koichi; Flotho, Annette; Gao, Ji; Dongre, Ashok; Carman, Julie A; Kang, Zizhen; Su, Bing; Kern, Timothy S; Smith, Jonathan D; Hamilton, Thomas A; Melchior, Frauke; Fox, Paul L; Li, Xiaoxia
2017-10-09
Expression of inflammatory genes is determined in part by post-transcriptional regulation of mRNA metabolism but how stimulus- and transcript-dependent nuclear export influence is poorly understood. Here, we report a novel pathway in which LPS/TLR4 engagement promotes nuclear localization of IRAK2 to facilitate nuclear export of a specific subset of inflammation-related mRNAs for translation in murine macrophages. IRAK2 kinase activity is required for LPS-induced RanBP2-mediated IRAK2 sumoylation and subsequent nuclear translocation. Array analysis showed that an SRSF1-binding motif is enriched in mRNAs dependent on IRAK2 for nuclear export. Nuclear IRAK2 phosphorylates SRSF1 to reduce its binding to target mRNAs, which promotes the RNA binding of the nuclear export adaptor ALYREF and nuclear export receptor Nxf1 loading for the export of the mRNAs. In summary, LPS activates a nuclear function of IRAK2 that facilitates the assembly of nuclear export machinery to export selected inflammatory mRNAs to the cytoplasm for translation.
Goto, Akira; Matsushita, Kazufumi; Gesellchen, Viola; Chamy, Laure El; Kuttenkeuler, David; Takeuchi, Osamu; Hoffmann, Jules A.; Akira, Shizuo; Boutros, Michael; Reichhart, Jean-Marc
2009-01-01
During a genome-wide RNAi screen, we isolated CG8580 as a gene involved in the innate immune response of Drosophila. CG8580, which we named Akirin, acts in parallel with the NF-κB transcription factor downstream of the Imd pathway and was required for defense against Gram-negative bacteria. Akirin is highly conserved and the human genome contains two homologues, one of which was able to rescue the loss of function phenotype in Drosophila cells. Akirins had a strict nuclear localization. Knockout of both Akirin homologues in mice revealed that one had an essential function downstream of Toll-like receptor, tumor necrosis factor and interleukin 1-β (IL-1β) signaling pathways leading to the production of IL-6. Thus, Akirin is a conserved nuclear factor required for innate immune responses. PMID:18066067
Strebovsky, Julia; Walker, Patrick; Lang, Roland; Dalpke, Alexander H
2011-03-01
Suppressor of cytokine signaling (SOCS) proteins are inhibitors of cytoplasmic Janus kinases (Jak) and signal transducer and activator of transcription (STAT) signaling pathways. Previously the authors surprisingly observed that SOCS1 translocated into the nucleus, which was because of the presence of a nuclear localization sequence. This report now hypothesizes that SOCS1 mediates specific functions within the nuclear compartment because it is instantly transported into the nucleus, as shown by photoactivation and live cell imaging in human HEK293 cells. The NFκB component p65 is identified as an interaction partner for SOCS1 but not for other members of the SOCS family. SOCS1 bound to p65 only within the nucleus. By means of its SOCS box domain, SOCS1 operated as a ubiquitin ligase, leading to polyubiquitination and proteasomal degradation of nuclear p65. Thus, SOCS1 limited prolonged p65 signaling and terminated expression of NFκB inducible genes. Using mutants that lack either nuclear translocation or a functional SOCS box, this report identifies genes that are regulated in a manner dependent on the nuclear availability of SOCS1. Data show that beyond its receptor-proximal function in Jak/STAT signaling, SOCS1 also regulates the duration of NFκB signaling within the cell nucleus, thus exerting a heretofore unrecognized function.
The VEGF-Receptor Inhibitor Axitinib Impairs Dendritic Cell Phenotype and Function
Daecke, Solveig Nora; Riethausen, Kati; Kotthoff, Philipp; Flores, Chrystel; Kurts, Christian; Brossart, Peter
2015-01-01
Inhibitors of VEGF receptor (VEGFR) signaling such as sorafenib and sunitinib that are currently used in the treatment of malignant diseases have been shown to affect immunological responses by inhibition of the function of antigen presenting cells and T lymphocytes. The VEGFR-inhibitor axitinib has recently been approved for second line therapy of metastatic renal cell carcinoma. While there is some evidence that axitinib might interfere with the activation of T cells, not much is known about the effects of axitinib on dendritic cell (DC) phenotype and function. We here show that the addition of axitinib during the final Toll-like receptor-4-induced maturation step of monocyte-derived human DCs results in a reduced DC activation characterized by impaired expression of activation markers and co-stimulatory molecules such as CD80, CD83 and CD86. We further found a decreased secretion of interleukin-12 which was accompanied by reduced nuclear expression of the transcription factor cRel. In addition, we found a dose-dependent reduced activation of p38 and STAT3 in axitinib-exposed DCs, whereas the expression was not affected. The dysfunction of axitinib-exposed DCs was further underlined by their impaired induction of allogeneic T cell proliferation in a mixed lymphocyte reaction assay and inhibition of DC migration. Our results demonstrate that axitinib significantly affects DC differentiation and function primarily via the inhibition of the nuclear factor kappa B signaling pathway leading to impaired T cell activation. This will be of importance for the design of future vaccination protocols and therapeutic approaches aiming at combining different treatment strategies, eg such as programmed death-1 inhibitors with axitinib. PMID:26042424
Mitochondrial Effects of PGC-1alpha Silencing in MPP+ Treated Human SH-SY5Y Neuroblastoma Cells
Ye, Qinyong; Chen, Chun; Si, Erwang; Cai, Yousheng; Wang, Juhua; Huang, Wanling; Li, Dongzhu; Wang, Yingqing; Chen, Xiaochun
2017-01-01
The dopaminergic neuron degeneration and loss that occurs in Parkinson’s disease (PD) has been tightly linked to mitochondrial dysfunction. Although the aged-related cause of the mitochondrial defect observed in PD patients remains unclear, nuclear genes are of potential importance to mitochondrial function. Human peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α) is a multi-functional transcription factor that tightly regulates mitochondrial biogenesis and oxidative capacity. The goal of the present study was to explore the potential pathogenic effects of interference by the PGC-1α gene on N-methyl-4-phenylpyridinium ion (MPP+)-induced SH-SY5Y cells. We utilized RNA interference (RNAi) technology to probe the pathogenic consequences of inhibiting PGC-1α in the SH-SY5Y cell line. Remarkably, a reduction in PGC-1α resulted in the reduction of mitochondrial membrane potential, intracellular ATP content and intracellular H2O2 generation, leading to the translocation of cytochrome c (cyt c) to the cytoplasm in the MPP+-induced PD cell model. The expression of related proteins in the signaling pathway (e.g., estrogen-related receptor α (ERRα), nuclear respiratory factor 1 (NRF-1), NRF-2 and Peroxisome proliferator-activated receptor γ (PPARγ)) also decreased. Our finding indicates that small interfering RNA (siRNA) interference targeting the PGC-1α gene could inhibit the function of mitochondria in several capacities and that the PGC-1α gene may modulate mitochondrial function by regulating the expression of ERRα, NRF-1, NRF-2 and PPARγ. Thus, PGC-1α can be considered a potential therapeutic target for PD. PMID:28611589
Park, Ji-Wan; Yoon, Hye-Jin; Kang, Woo Youl; Cho, Seungil; Seong, Sook Jin; Lee, Hae Won; Yoon, Young-Ran; Kim, Hyun-Ju
2018-02-01
GPR84, a member of the G protein-coupled receptor family, is found predominantly in immune cells, such as macrophages, and functions as a pivotal modulator of inflammatory responses. In this study, we investigated the role of GPR84 in receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast differentiation. Our microarray data showed that GPR84 was significantly downregulated in osteoclasts compared to in their precursors, macrophages. The overexpression of GPR84 in bone marrow-derived macrophages suppressed the formation of multinucleated osteoclasts without affecting precursor proliferation. In addition, GPR84 overexpression attenuated the induction of c-Fos and nuclear factor of activated T cells, cytoplasmic 1 (NFATc1), which are transcription factors that are critical for osteoclastogenesis. Furthermore, knockdown of GPR84 using a small hairpin RNA promoted RANKL-mediated osteoclast differentiation and gene expression of osteoclastogenic markers. Mechanistically, GPR84 overexpression blocked RANKL-stimulated phosphorylation of IκBα and three MAPKs, JNK, ERK, and p38. GPR84 also suppressed NF-κB transcriptional activity mediated by RANKL. Conversely, GPR84 knockdown enhanced RANKL-induced activation of IκBα and the three MAPKs. Collectively, our results revealed that GPR84 functions as a negative regulator of osteoclastogenesis, suggesting that it may be a potential therapeutic target for osteoclast-mediated bone-destructive diseases. © 2017 Wiley Periodicals, Inc.
Androgen Receptor Content of the Normal and Hyperplastic Canine Prostate
Shain, Sydney A.; Boesel, Robert W.
1978-01-01
A procedure was developed for measurement of androgen receptors in cytoplasmic extracts of prostates from intact dogs. The protocol utilized exchange saturation analysis at 15°C employing the synthetic androgen R1881 (17β-hydroxy-17α-methylestra-4,9,11-trien-3-one) as the ligand probe and quantitatively detected total cytoplasmic androgen receptor (Rc, androgen-free receptor, and RcA, androgen-occupied receptor) present at the initiation of the assay. This protocol was employed in conjunction with a tissue mince saturation analysis procedure (for quantitation of nuclear androgen receptor) to quantitate total androgen receptor content of normal and hyperplastic prostates obtained from young (2.5- or 4.6-yr old) and aged (12.5-yr old) purebred dogs of known birth date. The total cytoplasmic androgen receptor content (picomoles per prostate) of hyperplastic prostates was 4.6-fold greater than that of normal prostates. The total nuclear androgen receptor content of hyperplastic prostates (picomoles per prostate measured in crude nuclear preparations) was either 5.0- (4.6-yr-old dogs) or 7.8-fold (2.5-yr-old dogs) greater than that of normal prostates. However, androgen receptor content per cell was identical for hyperplastic and normal canine prostates, with the exception that nuclear androgen receptor was diminished in prostates from 2.5-yr-old dogs. The cell content per gram dry weight was identical for hyperplastic and normal canine prostates. We conclude that canine prostate hyperplasia is characterized by coordinate proliferation of androgen receptor-positive and androgen receptor-negative cells and is not a consequence of increased accumulation of 5α-dihydrotestosterone due to proliferation of androgen receptors per prostate cell. PMID:76635
Durrer, Stefan; Ehnes, Colin; Fuetsch, Michaela; Maerkel, Kirsten; Schlumpf, Margret; Lichtensteiger, Walter
2007-01-01
Background and objectives In previous studies, we found that the ultraviolet filter 4-methyl-benzylidene camphor (4-MBC) exhibits estrogenic activity, is a preferential estrogen receptor (ER)-β ligand, and interferes with development of female reproductive organs and brain of both sexes in rats. Here, we report effects on male development. Methods 4-MBC (0.7, 7, 24, 47 mg/kg/day) was administered in chow to the parent generation before mating, during gestation and lactation, and to offspring until adulthood. mRNA was determined in prostate lobes by real-time reverse transcription–polymerase chain reaction and protein was determined by Western blot analysis. Results 4-MBC delayed male puberty, decreased adult prostate weight, and slightly increased testis weight. Androgen receptor (AR), insulin-like growth factor-1 (IGF-1), ER-α, and ER-β expression in prostate were altered at mRNA and protein levels, with stronger effects in dorsolateral than ventral prostate. To assess sensitivity of target genes to estrogens, offspring were castrated on postnatal day 70, injected with 17β-estradiol (E2; 10 or 50 μg/kg, sc) or vehicle on postnatal day 84, and sacrificed 6 hr later. Acute repression of AR and IGF-1 mRNAs by E2, studied in ventral prostate, was reduced by 4-MBC exposure. This was accompanied by reduced co-repressor N-CoR (nuclear receptor co-repressor) protein in ventral and dorsolateral prostate, whereas steroid receptor coactivator-1 (SRC-1) protein levels were unaffected. Conclusions Our data indicate that 4-MBC affects development of male reproductive functions and organs, with a lowest observed adverse effect level of 0.7 mg/kg. Nuclear receptor coregulators were revealed as targets for endocrine disruptors, as shown for N-CoR in prostate and SRC-1 in uterus. This may have widespread effects on gene regulation. PMID:18174949
Norris, J S; Kohler, P O
1978-01-01
Two hamster cell lines have been isolated from androgen target tissue. The DDT1 cells derived from ductus deferens tissue exhibit a growth response to androgens, while the HVP cells derived from ventral prostate are androgen unresponsive. Both cell lines contain androgen receptors, that are similar when compared by kinetic methods, sedimentation velocity, chromatographic procedures or nuclear translocation ability. The forms of the high salt extracted nuclear receptors are indistinguishable chromatographically. Therefore, we postulate that the lesion preventing androgen induced growth in the HVP cell line is subseqent to nuclear translocation of the steroid receptor complex.
The emerging role of nuclear viral DNA sensors.
Diner, Benjamin A; Lum, Krystal K; Cristea, Ileana M
2015-10-30
Detecting pathogenic DNA by intracellular receptors termed "sensors" is critical toward galvanizing host immune responses and eliminating microbial infections. Emerging evidence has challenged the dogma that sensing of viral DNA occurs exclusively in sub-cellular compartments normally devoid of cellular DNA. The interferon-inducible protein IFI16 was shown to bind nuclear viral DNA and initiate immune signaling, culminating in antiviral cytokine secretion. Here, we review the newly characterized nucleus-originating immune signaling pathways, their links to other crucial host defenses, and unique mechanisms by which viruses suppress their functions. We frame these findings in the context of human pathologies associated with nuclear replicating DNA viruses. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
TLX: A master regulator for neural stem cell maintenance and neurogenesis.
Islam, Mohammed M; Zhang, Chun-Li
2015-02-01
The orphan nuclear receptor TLX, also known as NR2E1, is an essential regulator of neural stem cell (NSC) self-renewal, maintenance, and neurogenesis. In vertebrates, TLX is specifically localized to the neurogenic regions of the forebrain and retina throughout development and adulthood. TLX regulates the expression of genes involved in multiple pathways, such as the cell cycle, DNA replication, and cell adhesion. These roles are primarily performed through the transcriptional repression or activation of downstream target genes. Emerging evidence suggests that the misregulation of TLX might play a role in the onset and progression of human neurological disorders making this factor an ideal therapeutic target. Here, we review the current understanding of TLX function, expression, regulation, and activity significant to NSC maintenance, adult neurogenesis, and brain plasticity. This article is part of a Special Issue entitled: Nuclear receptors in animal development. Copyright © 2014 Elsevier B.V. All rights reserved.
Sasse, Sarah K; Gerber, Anthony N
2015-01-01
Nuclear receptors (NRs) are widely targeted to treat a range of human diseases. Feed-forward loops are an ancient mechanism through which single cell organisms organize transcriptional programming and modulate gene expression dynamics, but they have not been systematically studied as a regulatory paradigm for NR-mediated transcriptional responses. Here, we provide an overview of the basic properties of feed-forward loops as predicted by mathematical models and validated experimentally in single cell organisms. We review existing evidence implicating feed-forward loops as important in controlling clinically relevant transcriptional responses to estrogens, progestins, and glucocorticoids, among other NR ligands. We propose that feed-forward transcriptional circuits are a major mechanism through which NRs integrate signals, exert temporal control over gene regulation, and compartmentalize client transcriptomes into discrete subunits. Implications for the design and function of novel selective NR ligands are discussed. Copyright © 2014 Elsevier Inc. All rights reserved.
Glutamate receptors as seen by light: Spectroscopic studies of structure-function relationships
Mankiewicz, Kimberly A.; Jayaraman, Vasanthi
2010-01-01
Ionotropic glutamate receptors are major excitatory receptors in the central nervous system and also have far reaching influence in other areas of the body. Their modular nature has allowed for the isolation of the ligand binding domain and subsequent structural studies using a variety of spectroscopic techniques. This review will discuss the role of specific ligand:protein interactions in mediating activation in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) subtype of glutamate receptors as established by various spectroscopic investigations of the GluR2 and GluR4 subunits of this receptor. Specifically, this review will provide an introduction of the insight gained from X-ray crystallography and nuclear magnetic resonance (NMR) investigations and then go on to focus on studies utilizing vibrational spectroscopy and fluorescence resonance energy transfer (FRET) to study the behavior of the isolated ligand binding domain in solution and discuss the importance of specific ligand:protein interactions in the mechanism of receptor activation. PMID:17934637
Aleksic, Tamara; Gray, Nicki E; Wu, Xiaoning; Rieunier, Guillaume; Osher, Eliot; Mills, Jack; Verrill, Clare; Bryant, Richard J; Han, Cheng; Hutchinson, Kathryn; Lambert, Adam; Kumar, Rajeev; Hamdy, Freddie C; Weyer-Czernilofsky, Ulrike; Sanderson, Michael; Bogenrieder, Thomas; Taylor, Stephen; Macaulay, Valentine M
2018-05-07
Internalization of ligand-activated type 1 IGF receptor (IGF-1R) is followed by recycling to the plasma membrane, degradation or nuclear translocation. Nuclear IGF-1R reportedly associates with clinical response to IGF-1R inhibitory drugs, yet its role in the nucleus is poorly characterized. Here we investigated the significance of nuclear IGF-1R in clinical cancers and cell line models. In prostate cancers, IGF-1R was predominantly membrane-localized in benign glands, while malignant epithelium contained prominent internalized (nuclear/cytoplasmic) IGF-1R, and nuclear IGF-1R associated significantly with advanced tumor stage. Using ChIP-seq to assess global chromatin occupancy, we identified IGF-1R binding sites at or near transcription start sites of genes including JUN and FAM21, most sites coinciding with occupancy by RNA polymerase II (RNAPol2) and histone marks of active enhancers/promoters. IGF-1R was inducibly recruited to chromatin, directly binding DNA and interacting with RNAPol2 to upregulate expression of JUN and FAM21, shown to mediate tumor cell survival and IGF-induced migration. IGF-1 also enriched RNAPol2 on promoters containing IGF-1R binding sites. These functions were inhibited by IGF-1/2 neutralizing antibody xentuzumab (BI 836845), or by blocking receptor internalization. We detected nuclear IGF-1R on JUN and FAM21 promoters in fresh prostate cancers that contained abundant nuclear IGF-1R, with evidence of correlation between nuclear IGF-1R content and JUN expression in malignant prostatic epithelium. Taken together, these data reveal previously unrecognized molecular mechanisms through which IGFs promote tumorigenesis, with implications for therapeutic evaluation of anti-IGF drugs. Copyright ©2018, American Association for Cancer Research.
Expression and functional roles of G-protein-coupled estrogen receptor (GPER) in human eosinophils.
Tamaki, Mami; Konno, Yasunori; Kobayashi, Yoshiki; Takeda, Masahide; Itoga, Masamichi; Moritoki, Yuki; Oyamada, Hajime; Kayaba, Hiroyuki; Chihara, Junichi; Ueki, Shigeharu
2014-07-01
Sexual dimorphism in asthma links the estrogen and allergic immune responses. The function of estrogen was classically believed to be mediated through its nuclear receptors, i.e., estrogen receptors (ERs). However, recent studies established the important roles of G-protein-coupled estrogen receptor (GPER/GPR30) as a novel membrane receptor for estrogen. To date, the role of GPER in allergic inflammation is poorly understood. The purpose of this study was to examine whether GPER might affect the functions of eosinophils, which play an important role in the pathogenesis of asthma. Here, we demonstrated that GPER was expressed in purified human peripheral blood eosinophils both at the mRNA and protein levels. Although GPER agonist G-1 did not induce eosinophil chemotaxis or chemokinesis, preincubation with G-1 enhanced eotaxin (CCL11)-directed eosinophil chemotaxis. G-1 inhibited eosinophil spontaneous apoptosis and caspase-3 activities. The anti-apoptotic effect was not affected by the cAMP-phospodiesterase inhibitor rolipram or phosphoinositide 3-kinase inhibitors. In contrast to resting eosinophils, G-1 induced apoptosis and increased caspase-3 activities when eosinophils were co-stimulated with IL-5. No effect of G-1 was observed on eosinophil degranulation in terms of release of eosinophil-derived neurotoxin (EDN). The current study indicates the functional capacities of GPER on human eosinophils and also provides the previously unrecognized mechanisms of interaction between estrogen and allergic inflammation. Copyright © 2014 Elsevier B.V. All rights reserved.
Cheng, Qiuqiong; Inaba, Yuka; Lu, Peipei; Xu, Meishu; He, Jinhan; Zhao, Yueshui; Guo, Grace L.; Kuruba, Ramalinga; de la Vega, Rona; Evans, Rhobert W.; Li, Song
2015-01-01
The nuclear receptor farnesoid X receptor (FXR) (nuclear receptor subfamily 1, group H, member 4, or NR1H4) is highly expressed in the liver and intestine. Previous reports have suggested beneficial functions of FXR in the homeostasis of bile acids, lipids, and glucose, as well as in promoting liver regeneration and inhibiting carcinogenesis. To investigate the effect of chronic FXR activation in vivo, we generated transgenic mice that conditionally and tissue specifically express the activated form of FXR in the liver and intestine. Unexpectedly, the transgenic mice showed several intriguing phenotypes, including partial neonatal lethality, growth retardation, and spontaneous liver toxicity. The transgenic mice also displayed heightened sensitivity to a high-cholesterol diet-induced hepatotoxicity but resistance to the gallstone formation. The phenotypes were transgene specific, because they were abolished upon treatment with doxycycline to silence the transgene expression. The perinatal toxicity, which can be rescued by a maternal vitamin supplement, may have resulted from vitamin deficiency due to low biliary bile acid output as a consequence of inhibition of bile acid formation. Our results also suggested that the fibroblast growth factor-inducible immediate-early response protein 14 (Fn14), a member of the proinflammatory TNF family, is a FXR-responsive gene. However, the contribution of Fn14 induction in the perinatal toxic phenotype of the transgenic mice remains to be defined. Because FXR is being explored as a therapeutic target, our results suggested that a chronic activation of this nuclear receptor may have an unintended side effect especially during the perinatal stage. PMID:25719402
Steroid receptor coupling becomes nuclear.
Galigniana, Mario D
2012-06-22
In this issue of Chemistry & Biology, Grossman et al. report a study on aldosterone-dependent nuclear translocation of the mineralocorticoid receptor (MR). They analyze the dependency of MR retrotransport, DNA-binding, and transcriptional activity on Hsp90 and demonstrate that MR dimerization is a nuclear event. Copyright © 2012 Elsevier Ltd. All rights reserved.
Structural insights into FRS2α PTB domain recognition by neurotrophin receptor TrkB.
Zeng, Lei; Kuti, Miklos; Mujtaba, Shiraz; Zhou, Ming-Ming
2014-07-01
The fibroblast growth factor receptor (FGFR) substrate 2 (FRS2) family proteins function as scaffolding adapters for receptor tyrosine kinases (RTKs). The FRS2α proteins interact with RTKs through the phosphotyrosine-binding (PTB) domain and transfer signals from the activated receptors to downstream effector proteins. Here, we report the nuclear magnetic resonance structure of the FRS2α PTB domain bound to phosphorylated TrkB. The structure reveals that the FRS2α-PTB domain is comprised of two distinct but adjacent pockets for its mutually exclusive interaction with either nonphosphorylated juxtamembrane region of the FGFR, or tyrosine phosphorylated peptides TrkA and TrkB. The new structural insights suggest rational design of selective small molecules through targeting of the two conjunct pockets in the FRS2α PTB domain. © 2014 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rangwala, Shamina M.; Li, Xiaoyan; Lindsley, Loren
2007-05-25
Estrogen-related receptor {alpha} (ERR{alpha}) is an important mediator of mitochondrial biogenesis and function. To investigate the transcriptional network controlling these phenomena, we investigated mitochondrial gene expression in embryonic fibroblasts isolated from ERR{alpha} null mice. Peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) stimulated mitochondrial gene expression program in control cells, but not in the ERR{alpha} null cells. Interestingly, the induction of levels of mitochondrial oxidative stress protection genes in response to increased PGC-1{alpha} levels was dependent on ERR{alpha}. Furthermore, we found that the PGC-1{alpha}-mediated induction of estrogen-related receptor {gamma} and nuclear respiratory factor 2 (NRF-2), was dependent on the presence of ERR{alpha}.more » Basal levels of NRF-2 were decreased in the absence of ERR{alpha}. The absence of ERR{alpha} resulted in a decrease in citrate synthase enzyme activity in response to PGC-1{alpha} overexpression. Our results indicate an essential role for ERR{alpha} as a key regulator of oxidative metabolism.« less
Nuclear egress of TDP-43 and FUS occurs independently of Exportin-1/CRM1.
Ederle, Helena; Funk, Christina; Abou-Ajram, Claudia; Hutten, Saskia; Funk, Eva B E; Kehlenbach, Ralph H; Bailer, Susanne M; Dormann, Dorothee
2018-05-04
TDP-43 and FUS are nuclear proteins with multiple functions in mRNA processing. They play key roles in ALS (amyotrophic lateral sclerosis) and FTD (frontotemporal dementia), where they are partially lost from the nucleus and aggregate in the cytoplasm of neurons and glial cells. Defects in nucleocytoplasmic transport contribute to this pathology, hence nuclear import of both proteins has been studied in detail. However, their nuclear export routes remain poorly characterized and it is unclear whether aberrant nuclear export contributes to TDP-43 or FUS pathology. Here we show that predicted nuclear export signals in TDP-43 and FUS are non-functional and that both proteins are exported independently of the export receptor CRM1/Exportin-1. Silencing of Exportin-5 or the mRNA export factor Aly/REF, as well as mutations that abrogate RNA-binding do not impair export of TDP-43 and FUS. However, artificially enlarging TDP-43 or FUS impairs their nuclear egress, suggesting that they could leave the nucleus by passive diffusion. Finally, we found that inhibition of transcription causes accelerated nuclear egress of TDP-43, suggesting that newly synthesized RNA retains TDP-43 in the nucleus, limiting its egress into the cytoplasm. Our findings implicate reduced nuclear retention as a possible factor contributing to mislocalization of TDP-43 in ALS/FTD.
Role of co-regulators in metabolic and transcriptional actions of thyroid hormone.
Astapova, Inna
2016-04-01
Thyroid hormone (TH) controls a wide range of physiological processes through TH receptor (TR) isoforms. Classically, TRs are proposed to function as tri-iodothyronine (T3)-dependent transcription factors: on positively regulated target genes, unliganded TRs mediate transcriptional repression through recruitment of co-repressor complexes, while T3 binding leads to dismissal of co-repressors and recruitment of co-activators to activate transcription. Co-repressors and co-activators were proposed to play opposite roles in the regulation of negative T3 target genes and hypothalamic-pituitary-thyroid axis, but exact mechanisms of the negative regulation by TH have remained elusive. Important insights into the roles of co-repressors and co-activators in different physiological processes have been obtained using animal models with disrupted co-regulator function. At the same time, recent studies interrogating genome-wide TR binding have generated compelling new data regarding effects of T3, local chromatin structure, and specific response element configuration on TR recruitment and function leading to the proposal of new models of transcriptional regulation by TRs. This review discusses data obtained in various mouse models with manipulated function of nuclear receptor co-repressor (NCoR or NCOR1) and silencing mediator of retinoic acid receptor and thyroid hormone receptor (SMRT or NCOR2), and family of steroid receptor co-activators (SRCs also known as NCOAs) in the context of TH action, as well as insights into the function of co-regulators that may emerge from the genome-wide TR recruitment analysis. © 2016 Society for Endocrinology.
Dreier, Dominik; Latkolik, Simone; Rycek, Lukas; Schnürch, Michael; Dymáková, Andrea; Atanasov, Atanas G; Ladurner, Angela; Heiss, Elke H; Stuppner, Hermann; Schuster, Daniela; Mihovilovic, Marko D; Dirsch, Verena M
2017-10-20
The nuclear receptors peroxisome proliferator-activated receptor γ (PPARγ) and its hetero-dimerization partner retinoid X receptor α (RXRα) are considered as drug targets in the treatment of diseases like the metabolic syndrome and diabetes mellitus type 2. Effort has been made to develop new agonists for PPARγ to obtain ligands with more favorable properties than currently used drugs. Magnolol was previously described as dual agonist of PPARγ and RXRα. Here we show the structure-based rational design of a linked magnolol dimer within the ligand binding domain of PPARγ and its synthesis. Furthermore, we evaluated its binding properties and functionality as a PPARγ agonist in vitro with the purified PPARγ ligand binding domain (LBD) and in a cell-based nuclear receptor transactivation model in HEK293 cells. We determined the synthesized magnolol dimer to bind with much higher affinity to the purified PPARγ ligand binding domain than magnolol (K i values of 5.03 and 64.42 nM, respectively). Regarding their potency to transactivate a PPARγ-dependent luciferase gene both compounds were equally effective. This is likely due to the PPARγ specificity of the newly designed magnolol dimer and lack of RXRα-driven transactivation activity by this dimeric compound.
Pěnčíková, Kateřina; Brenerová, Petra; Svržková, Lucie; Hrubá, Eva; Pálková, Lenka; Vondráček, Jan; Lehmler, Hans-Joachim; Machala, Miroslav
2017-11-09
PCB 136 is an environmentally relevant chiral PCB congener, which has been found in vivo to be present in form of rotational isomers (atropisomers). Its atropselective biotransformation or neurotoxic effects linked with sensitization of ryanodine receptor suggest that it might interact also with other intracellular receptors in a stereospecific manner. However, possible atropselective effects of PCB 136 on nuclear receptor transactivation remain unknown. Therefore, in this study, atropselective effects of PCB 136 on nuclear receptors controlling endocrine signaling and/or expression of xenobiotic and steroid hormone catabolism were investigated. PCB136 atropisomers were found to exert differential effects on estrogen receptor (ER) activation; (+)-PCB 136 was estrogenic, while (-)-PCB 136 was antiestrogenic. In contrast, inhibition of androgen receptor (AR) activity was not stereospecific. Both PCB136 stereoisomers induced the constitutive androgen receptor (CAR)-dependent gene expression; however, no significant stereospecificity of PCB 136 atropisomers was observed. PCB136 was a partial inducer of the pregnane X receptor (PXR)-dependent gene expression. Here, (-)-PCB 136 was a significantly more potent inducer of PXR activity than (+)-PCB 136. Taken together, the present results indicate that at least two nuclear receptors participating in endocrine regulation or metabolism, ER and PXR, could be regulated in an atropselective manner by chiral PCB 136. The enantioselective enrichment of PCB atropisomers in animal and human tissues may thus have significant consequences for endocrine-disrupting effects of chiral ortho-substituted PCB congeners.
Evolving targets for lipid-modifying therapy
Do, Rose Q; Nicholls, Stephen J; Schwartz, Gregory G
2014-01-01
The pathogenesis and progression of atherosclerosis are integrally connected to the concentration and function of lipoproteins in various classes. This review examines existing and emerging approaches to modify low-density lipoprotein and lipoprotein (a), triglyceride-rich lipoproteins, and high-density lipoproteins, emphasizing approaches that have progressed to clinical evaluation. Targeting of nuclear receptors and phospholipases is also discussed. PMID:25172365
NUREBASE: database of nuclear hormone receptors.
Duarte, Jorge; Perrière, Guy; Laudet, Vincent; Robinson-Rechavi, Marc
2002-01-01
Nuclear hormone receptors are an abundant class of ligand activated transcriptional regulators, found in varying numbers in all animals. Based on our experience of managing the official nomenclature of nuclear receptors, we have developed NUREBASE, a database containing protein and DNA sequences, reviewed protein alignments and phylogenies, taxonomy and annotations for all nuclear receptors. The reviewed NUREBASE is completed by NUREBASE_DAILY, automatically updated every 24 h. Both databases are organized under a client/server architecture, with a client written in Java which runs on any platform. This client, named FamFetch, integrates a graphical interface allowing selection of families, and manipulation of phylogenies and alignments. NUREBASE sequence data is also accessible through a World Wide Web server, allowing complex queries. All information on accessing and installing NUREBASE may be found at http://www.ens-lyon.fr/LBMC/laudet/nurebase.html.
Becnel, Lauren B; Ochsner, Scott A; Darlington, Yolanda F; McOwiti, Apollo; Kankanamge, Wasula H; Dehart, Michael; Naumov, Alexey; McKenna, Neil J
2017-04-25
We previously developed a web tool, Transcriptomine, to explore expression profiling data sets involving small-molecule or genetic manipulations of nuclear receptor signaling pathways. We describe advances in biocuration, query interface design, and data visualization that enhance the discovery of uncharacterized biology in these pathways using this tool. Transcriptomine currently contains about 45 million data points encompassing more than 2000 experiments in a reference library of nearly 550 data sets retrieved from public archives and systematically curated. To make the underlying data points more accessible to bench biologists, we classified experimental small molecules and gene manipulations into signaling pathways and experimental tissues and cell lines into physiological systems and organs. Incorporation of these mappings into Transcriptomine enables the user to readily evaluate tissue-specific regulation of gene expression by nuclear receptor signaling pathways. Data points from animal and cell model experiments and from clinical data sets elucidate the roles of nuclear receptor pathways in gene expression events accompanying various normal and pathological cellular processes. In addition, data sets targeting non-nuclear receptor signaling pathways highlight transcriptional cross-talk between nuclear receptors and other signaling pathways. We demonstrate with specific examples how data points that exist in isolation in individual data sets validate each other when connected and made accessible to the user in a single interface. In summary, Transcriptomine allows bench biologists to routinely develop research hypotheses, validate experimental data, or model relationships between signaling pathways, genes, and tissues. Copyright © 2017, American Association for the Advancement of Science.
Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired. PMID:25961030
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Solution Structure and Molecular Interactions of Lamin B Receptor Tudor Domain*
Liokatis, Stamatis; Edlich, Christian; Soupsana, Katerina; Giannios, Ioannis; Panagiotidou, Parthena; Tripsianes, Konstantinos; Sattler, Michael; Georgatos, Spyros D.; Politou, Anastasia S.
2012-01-01
Lamin B receptor (LBR) is a polytopic protein of the nuclear envelope thought to connect the inner nuclear membrane with the underlying nuclear lamina and peripheral heterochromatin. To better understand the function of this protein, we have examined in detail its nucleoplasmic region, which is predicted to harbor a Tudor domain (LBR-TD). Structural analysis by multidimensional NMR spectroscopy establishes that LBR-TD indeed adopts a classical β-barrel Tudor fold in solution, which, however, features an incomplete aromatic cage. Removal of LBR-TD renders LBR more mobile at the plane of the nuclear envelope, but the isolated module does not bind to nuclear lamins, heterochromatin proteins (MeCP2), and nucleosomes, nor does it associate with methylated Arg/Lys residues through its aromatic cage. Instead, LBR-TD exhibits tight and stoichiometric binding to the “histone-fold” region of unassembled, free histone H3, suggesting an interesting role in histone assembly. Consistent with such a role, robust binding to native nucleosomes is observed when LBR-TD is extended toward its carboxyl terminus, to include an area rich in Ser-Arg residues. The Ser-Arg region, alone or in combination with LBR-TD, binds both unassembled and assembled H3/H4 histones, suggesting that the TD/RS interface may operate as a “histone chaperone-like platform.” PMID:22052904
Estruch, Sara B.; Buzón, Víctor; Carbó, Laia R.; Schorova, Lenka; Lüders, Jens; Estébanez-Perpiñá, Eva
2012-01-01
Nuclear orphan receptor TLX (NR2E1) functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs) of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H) screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1), a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9), a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain. PMID:22675500
Estruch, Sara B; Buzón, Víctor; Carbó, Laia R; Schorova, Lenka; Lüders, Jens; Estébanez-Perpiñá, Eva
2012-01-01
Nuclear orphan receptor TLX (NR2E1) functions primarily as a transcriptional repressor and its pivotal role in brain development, glioblastoma, mental retardation and retinopathologies make it an attractive drug target. TLX is expressed in the neural stem cells (NSCs) of the subventricular zone and the hippocampus subgranular zone, regions with persistent neurogenesis in the adult brain, and functions as an essential regulator of NSCs maintenance and self-renewal. Little is known about the TLX social network of interactors and only few TLX coregulators are described. To identify and characterize novel TLX-binders and possible coregulators, we performed yeast-two-hybrid (Y2H) screens of a human adult brain cDNA library using different TLX constructs as baits. Our screens identified multiple clones of Atrophin-1 (ATN1), a previously described TLX interactor. In addition, we identified an interaction with the oncoprotein and zinc finger transcription factor BCL11A (CTIP1/Evi9), a key player in the hematopoietic system and in major blood-related malignancies. This interaction was validated by expression and coimmunoprecipitation in human cells. BCL11A potentiated the transrepressive function of TLX in an in vitro reporter gene assay. Our work suggests that BCL11A is a novel TLX coregulator that might be involved in TLX-dependent gene regulation in the brain.
Krüppel-like factors are effectors of nuclear receptor signaling
Knoedler, Joseph R.; Denver, Robert J.
2015-01-01
Binding of steroid and thyroid hormones to their cognate nuclear receptors (NRs) impacts virtually every aspect of postembryonic development, physiology and behavior, and inappropriate signaling by NRs may contribute to disease. While NRs regulate genes by direct binding to hormone response elements in the genome, their actions may depend on the activity of other transcription factors (TFs) that may or may not bind DNA. The Krüppel-like family of transcription factors (KLF) is an evolutionarily conserved class of DNA-binding proteins that influence many aspects of development and physiology. Several members of this family have been shown to play diverse roles in NR signaling. For example, KLFs 1) act as accessory transcription factors for NR actions, 2) regulate expression of NR genes, and 3) as gene products of primary NR response genes function as key players in NR-dependent transcriptional networks. In mouse models, deletion of different KLFs leads to aberrant transcriptional and physiological responses to hormones, underscoring the importance of these proteins in the regulation of hormonal signaling. Understanding the functional relationships between NRs and KLFs will yield important insights into mechanisms of NR signaling. In this review we present a conceptual framework for understanding how KLFs participate in NR signaling, and we provide examples of how these proteins function to effect hormone action. PMID:24642391
Grb7 protein RA domain oligomerization.
Godamudunage, Malika P; Foster, Albert; Warren, Darius; Lyons, Barbara A
2017-08-01
The growth factor receptor bound protein 7 (Grb7) is an adaptor protein that is often coamplified with the erythroblastosis oncogene B 2 receptor in 20% to 30% of breast cancer patients. Grb7 overexpression has been linked to increased cell migration and cancer metastasis. The ras associating and pleckstrin homology domain region of Grb7 has been reported to interact with various other downstream signaling proteins such as four and half Lin11, Isl-1, Mec-3 (LIM) domains isoform 2 and filamin α. These interactions are believed to play a role in regulating Grb7-mediated cell migration function. The full-length Grb7 protein has been shown to dimerize, and the oligomeric state of the Grb7SH2 domain has been extensively studied; however, the oligomerization state of the ras associating and pleckstrin homology domains, and the importance of this oligomerization in Grb7 function, is yet to be fully known. In this study, we characterize the oligomeric state of the Grb7RA domain using size exclusion chromatography, nuclear magnetic resonance, nuclear relaxation studies, glutaraldehyde cross linking, and dynamic light scattering. We report the Grb7RA domain can exist in transient multimeric forms and, based upon modeling results, postulate the potential role of Grb7RA domain oligomerization in Grb7 function. Copyright © 2017 John Wiley & Sons, Ltd.
Souazé, Frédérique; Viardot-Foucault, Véronique; Roullet, Nicolas; Toy-Miou-Leong, Mireille; Gompel, Anne; Bruyneel, Erik; Comperat, Eva; Faux, Maree C; Mareel, Marc; Rostène, William; Fléjou, Jean-François; Gespach, Christian; Forgez, Patricia
2006-04-01
Alterations in the Wnt/APC (adenomatous polyposis coli) signalling pathway, resulting in beta-catenin/T cell factor (Tcf)-dependent transcriptional gene activation, are frequently detected in familial and sporadic colon cancers. The neuropeptide neurotensin (NT) is widely distributed in the gastrointestinal tract. Its proliferative and survival effects are mediated by a G-protein coupled receptor, the NT1 receptor. NT1 receptor is not expressed in normal colon epithelial cells, but is over expressed in a number of cancer cells and tissues suggesting a link to the outgrowth of human colon cancer. Our results demonstrate that the upregulation of NT1 receptor occurring in colon cancer is the result of Wnt/APC signalling pathway activation. We first established the functionality of the Tcf response element within the NT1 receptor promoter. Consequently, we observed the activation of NT1 receptor gene by agents causing beta-catenin cytosolic accumulation, as well as a strong decline of endogenous receptor when wt-APC was restored. At the cellular level, the re-establishment of wt-APC phenotype resulted in the impaired functionality of NT1 receptor, like the breakdown in NT-induced intracellular calcium mobilization and the loss of NT pro-invasive effect. We corroborated the Wnt/APC signalling pathway on the NT1 receptor promoter activation with human colon carcinogenesis, and showed that NT1 receptor gene activation was perfectly correlated with nuclear or cytoplasmic beta-catenin localization while NT1 receptor was absent when beta-catenin was localized at the cell-cell junction in early adenomas of patients with familial adenomatous polyposis, hereditary non-polyposis colorectal cancer and loss of heterozygosity tumours. In this report we establish a novel link in vitro between the Tcf/beta-catenin pathway and NT1 receptor promoter activation.
Bile Acids in the Treatment of Cardiometabolic Diseases.
Vítek, Libor
2017-11-01
Bile acids (BA), for decades considered only to have fat-emulsifying functions in the gut lumen, have recently emerged as novel cardio-metabolic modulators. They have real endocrine effects, acting via multiple intracellular receptors in various organs and tissues. BA affect energy homeostasis through the modulation of glucose and lipid metabolism, predominantly by activating the nuclear farnesoid X receptor (FXR), as well as the cytoplasmic membrane G protein-coupled BA receptor TGR5 in a variety of tissues; although numerous other intracellular targets of BA are also in play.The roles of BA in the pathogenesis of diabetes, obesity, metabolic syndrome, and cardiovascular diseases are seriously being considered, and BA and their derivatives seem to represent novel potential therapeutics to treat these diseases of civilization.
ERIC Educational Resources Information Center
Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil
2009-01-01
Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB[subscript 1]-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for alpha-type peroxisome proliferator-activated nuclear receptors, PPAR-alpha) when and where they are naturally released in the brain.…
Negative regulation of parathyroid hormone-related protein expression by steroid hormones
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kajitani, Takashi; Tamamori-Adachi, Mimi; Okinaga, Hiroko
Highlights: {yields} Steroid hormones repress expression of PTHrP in the cell lines where the corresponding nuclear receptors are expressed. {yields} Nuclear receptors are required for suppression of PTHrP expression by steroid hormones, except for androgen receptor. {yields} Androgen-induced suppression of PTHrP expression appears to be mediated by estrogen receptor. -- Abstract: Elevated parathyroid hormone-related protein (PTHrP) is responsible for humoral hypercalcemia of malignancy (HHM), which is of clinical significance in treatment of terminal patients with malignancies. Steroid hormones were known to cause suppression of PTHrP expression. However, detailed studies linking multiple steroid hormones to PTHrP expression are lacking. Here wemore » studied PTHrP expression in response to steroid hormones in four cell lines with excessive PTHrP production. Our study established that steroid hormones negatively regulate PTHrP expression. Vitamin D receptor, estrogen receptor {alpha}, glucocorticoid receptor, and progesterone receptor, were required for repression of PTHrP expression by the cognate ligands. A notable exception was the androgen receptor, which was dispensable for suppression of PTHrP expression in androgen-treated cells. We propose a pathway(s) involving nuclear receptors to suppress PTHrP expression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cooper, M.; Beck, R.N.
1992-06-01
This report describes three studies aimed at using radiolabeled pharmaceuticals to explore brain function and anatomy. The first section describes the chemical preparation of [F18]fluorinated benzamides (dopamine D-2 receptor tracers), [F18]fluorinated benzazepines (dopamine D-1 receptor tracers), and tissue distribution of [F18]-fluoxetine (serotonin reuptake site tracer). The second section relates pharmacological and behavioral studies of amphetamines. The third section reports on progress made with processing of brain images from CT, MRI and PET/SPECT with regards to brain metabolism of glucose during mental tasks.
Lapierre, Danielle M.; Tanabe, Natsuko; Pereverzev, Alexey; Spencer, Martha; Shugg, Ryan P. P.; Dixon, S. Jeffrey; Sims, Stephen M.
2010-01-01
Lysophosphatidic acid (LPA) is a bioactive phospholipid whose functions are mediated by multiple G protein-coupled receptors. We have shown that osteoblasts produce LPA, raising the possibility that it mediates intercellular signaling among osteoblasts and osteoclasts. Here we investigated the expression, signaling and function of LPA receptors in osteoclasts. Focal application of LPA elicited transient increases in cytosolic calcium concentration ([Ca2+]i), with 50% of osteoclasts responding at ∼400 nm LPA. LPA-induced elevation of [Ca2+]i was blocked by pertussis toxin or the LPA1/3 receptor antagonist VPC-32183. LPA caused sustained retraction of osteoclast lamellipodia and disrupted peripheral actin belts. Retraction was insensitive to VPC-32183 or pertussis toxin, indicating involvement of a distinct signaling pathway. In this regard, inhibition of Rho-associated kinase stimulated respreading after LPA-induced retraction. Real-time reverse transcription-PCR revealed transcripts encoding LPA1 and to a lesser extent LPA2, LPA4, and LPA5 receptor subtypes. LPA induced nuclear translocation of NFATc1 and enhanced osteoclast survival, effects that were blocked by VPC-32183 or by a specific peptide inhibitor of NFAT activation. LPA slightly reduced the resorptive activity of osteoclasts in vitro. Thus, LPA binds to at least two receptor subtypes on osteoclasts: LPA1, which couples through Gi/o to elevate [Ca2+]i, activate NFATc1, and promote survival, and a second receptor that likely couples through G12/13 and Rho to evoke and maintain retraction through reorganization of the actin cytoskeleton. These findings reveal a signaling axis in bone through which LPA, produced by osteoblasts, acts on multiple receptor subtypes to induce pleiotropic effects on osteoclast activity and function. PMID:20551326
2012-01-01
Background Progesterone (P4) may modulate oviductal functions to promote early embryo development in cattle. In addition to its nuclear receptor (PR), P4 may mediate its actions through P4 receptor membrane component 1 (PGRMC1) and its relative, PGRMC2. Two successive experiments were undertaken to characterise the expression of PR, PGRMC1 and PGRMC2 in the bovine oviduct during the post-ovulation period, and to relate their expression to the presence of an embryo, the proximity of the CL and to the region of the oviduct. Methods In the first experiment (Exp. I), whole oviduct sections were collected from Holstein cows at Day 1.5, Day 4 and Day 5 post-ovulation (n = 2 cows per stage). The expression of PR, PGRMC1 and PGRMC2 was studied in the ampulla and isthmus by RT-PCR, western-blot and immunohistochemistry. In Exp. II, oviduct epithelial cells were collected from cyclic and pregnant Charolais cows (n = 4 cows per status) at Day 3.5 post-ovulation and mRNA expression of PR, PGRMC1 and PGRMC2 was examined in the ampulla and isthmus by real-time quantitative PCR. Results In Exp. I, PR, PGRMC1 and PGRMC2 were expressed in all oviduct samples. PGRMC1 was mainly localised in the luminal epithelium whereas PR and PGRMC2 were localised in the epithelium as well as in the muscle and stroma layers of the oviduct. The expression was primarily nuclear for PR, primarily cytoplasmic for PGRMC1 and both nuclear and cytoplasmic for PGRMC2. In Exp. II, mRNA levels for PR, PGRMC1 and PGRMC2 were not affected by either the pregnancy status or the side relative to the CL. However, the expression of PR and PGRMC2 varied significantly with the region of the oviduct: PR was more highly expressed in the isthmus whereas PGRMC2 was more highly expressed in the ampulla. Conclusions This is the first evidence of PGRMC2 expression in the bovine oviduct. Our findings suggest that P4 regulates the functions of the bovine oviduct in a region-specific manner and through both classical and non classical pathways during the post-ovulation period. PMID:22958265
Blind, Raymond D.; Suzawa, Miyuki; Ingraham, Holly A.
2012-01-01
Phosphatidylinositol (4,5)-bisphosphate (PIP2) is best known as a plasma membrane-bound regulatory lipid. While PIP2 and phosphoinositide-modifying enzymes coexist in the nucleus, their roles in the nucleus remain unclear. Here we show that the nuclear inositol polyphosphate multikinase (IPMK), which functions both as an inositol- and a PI3-kinase, interacts with the nuclear receptor SF-1 (NR5A1) and phosphorylates its bound ligand, PIP2. IPMK failed to recognize SF-1/PIP2 after blocking or displacing PIP2 from SF-1’s large hydrophobic pocket. In contrast to IPMK, p110 catalytic subunits of type 1 PI3-kinases were inactive on SF-1/PIP2. These and other in vitro analyses demonstrated specificity of IPMK for the SF-1/PIP2 protein/lipid complex. Once generated, SF-1/PIP3 is readily dephosphorylated by the lipid phosphatase PTEN. Importantly, decreasing IPMK or increasing PTEN expression greatly reduced SF-1 transcriptional activity. This ability of lipid kinases and phosphatases to alter the activity and directly remodel a non-membrane protein/lipid complex such SF-1/PIP2, establishes a new pathway for promoting lipid-mediated signaling in the nucleus. PMID:22715467
ent-Steroids: novel tools for studies of signaling pathways.
Covey, Douglas F
2009-07-01
Membrane receptors are often modulated by steroids and it is necessary to distinguish the effects of steroids at these receptors from effects occurring at nuclear receptors. Additionally, it may also be mechanistically important to distinguish between direct effects caused by binding of steroids to membrane receptors and indirect effects on membrane receptor function caused by steroid perturbation of the membrane containing the receptor. In this regard, ent-steroids, the mirror images of naturally occurring steroids, are novel tools for distinguishing between these various actions of steroids. The review provides a background for understanding the different actions that can be expected of steroids and ent-steroids in biological systems, references for the preparation of ent-steroids, a short discussion about relevant forms of stereoisomerism and the requirements that need to be fulfilled for the interaction between two molecules to be enantioselective. The review then summarizes results of biophysical, biochemical and pharmacological studies published since 1992 in which ent-steroids have been used to investigate the actions of steroids in membranes and/or receptor-mediated signaling pathways.
ent-Steroids: Novel Tools for Studies of Signaling Pathways
Covey, Douglas F.
2008-01-01
Membrane receptors are often modulated by steroids and it is necessary to distinguish the effects of steroids at these receptors from effects occurring at nuclear receptors. Additionally, it may also be mechanistically important to distinguish between direct effects caused by binding of steroids to membrane receptors and indirect effects on membrane receptor function caused by steroid perturbation of the membrane containing the receptor. In this regard, ent-steroids, the mirror images of naturally occurring steroids, are novel tools for distinguishing between these various actions of steroids. The review provides a background for understanding the different actions that can be expected of steroids and ent-steroids in biological systems, references for the preparation of ent-steroids, a short discussion about relevant forms of stereoisomerism and the requirements that need to be fulfilled for the interaction between two molecules to be enantioselective. The review then summarizes results of biophysical, biochemical and pharmacological studies published since 1992 in which ent-steroids have been used to investigate the actions of steroids in membranes and/or receptor-mediated signaling pathways. PMID:19103212
A plurality of molecular targets: The receptor ecosystem for bisphenol-A (BPA).
MacKay, Harry; Abizaid, Alfonso
2018-05-01
Bisphenol-A (BPA) is a well-known endocrine disrupting compound (EDC), capable of affecting the normal function and development of the reproductive system, brain, adipose tissue, and more. In spite of these diverse and well characterized effects, there is often comparatively little known about the molecular mechanisms which bring them about. BPA has traditionally been regarded as a primarily estrogenic EDC, and this perspective is often what guides research into the effects of BPA. However, emerging data from in-vitro and in-silico models show that BPA binds with a significant number of hormone receptors, including a number of nuclear and membrane-bound estrogen receptors, androgen receptors, as well as the thyroid hormone receptor, glucocorticoid receptor, and PPARγ. With this increased diversity of receptor targets, it may be possible to explain some of the more puzzling aspects of BPA pharmacology, including its non-monotonic dose-response curve, as well as experimental results which disagree with estrogenic positive controls. This paper reviews the receptors for which BPA has a known interaction, and discusses the implications of taking these receptors into account when studying the disruptive effects of BPA on growth and development. Copyright © 2017 Elsevier Inc. All rights reserved.
Expression and Functional Pathway Analysis of Nuclear Receptor NR2F2 in Ovarian Cancer
Hawkins, Shannon M.; Loomans, Holli A.; Wan, Ying-Wooi; Ghosh-Choudhury, Triparna; Coffey, Donna; Xiao, Weimin; Liu, Zhandong; Sangi-Haghpeykar, Haleh
2013-01-01
Context: Recent evidence implicates the orphan nuclear receptor, nuclear receptor subfamily 2, group F, member 2 (NR2F2; chicken ovalbumin upstream promoter-transcription factor II) as both a master regulator of angiogenesis and an oncogene in prostate and other human cancers. Objective: The objective of the study was to determine whether NR2F2 plays a role in ovarian cancer and dissect its potential mechanisms of action. Design, Setting, and Patients: We examined NR2F2 expression in healthy ovary and ovarian cancers using quantitative PCR and immunohistochemistry. NR2F2 expression was targeted in established ovarian cancer cell lines to assess the impact of dysregulated NR2F2 expression in the epithelial compartment of ovarian cancers. Results: Our results indicate that NR2F2 is robustly expressed in the stroma of healthy ovary with little or no expression in epithelia lining the ovarian surface, clefts, or crypts. This pattern of NR2F2 expression was markedly disrupted in ovarian cancers, in which decreased levels of stromal expression and ectopic epithelial expression were frequently observed. Ovarian cancers with the most disrupted patterns of NR2F2 were associated with significantly shorter disease-free interval by Kaplan-Meier analysis. Targeting NR2F2 expression in established ovarian cancer cell lines enhanced apoptosis and increased proliferation. In addition, we found that NR2F2 regulates the expression of NEK2, RAI14, and multiple other genes involved in the cell cycle, suggesting potential pathways by which dysregulated expression of NR2F2 impacts ovarian cancer. Conclusions: These results uncover novel roles for NR2F2 in ovarian cancer and point to a unique scenario in which a single nuclear receptor plays potentially distinct roles in the stromal and epithelial compartments of the same tissue. PMID:23690307
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baek, Jong Min; Park, Sun-Hyang; Cheon, Yoon-Hee
Esculetin exerts various biological effects on anti-oxidation, anti-tumors, and anti-inflammation. However, the involvement of esculetin in the bone metabolism process, particularly osteoclast differentiation has not yet been investigated. In the present study, we first confirmed the inhibitory effect of esculetin on receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast formation. We then revealed the relationship between esculetin and the expression of osteoclast-specific molecules to elucidate its underlying mechanisms. Esculetin interfered with the expression of c-Fos and nuclear factor of activated T cell c1 (NFATc1) both at the mRNA and protein level with no involvement in osteoclast-associated early signaling pathways, suppressingmore » the expression of various transcription factors exclusively expressed in osteoclasts such as tartrate-resistant acid phosphatase (Trap), osteoclast-associated receptor (Oscar), dendritic cell-specific transmembrane protein (Dcstamp), osteoclast stimulatory transmembrane protein (Ocstamp), cathepsin K, αvβ3 integrin, and calcitonin receptor (Ctr). Additionally, esculetin inhibited the formation of filamentous actin (F-actin) ring-positive osteoclasts during osteoclast differentiation. However, the development of F-actin structures and subsequent bone resorbing activity of mature osteoclasts, which are observed in osteoclast/osteoblast co-culture systems were not affected by esculetin. Taken together, our results indicate for the first time that esculetin inhibits RANKL-mediated osteoclastogenesis via direct suppression of c-Fos and NFATc1 expression and exerts an inhibitory effect on actin ring formation during osteoclastogenesis. - Highlights: • We first investigated the effects of esculetin on osteoclast differentiation and function. • Our data demonstrate for the first time that esculetin can suppress osteoclastogenesis in vitro. • Esculetin acts as an inhibitor of c-Fos and NFATc1 activation. • Esculetin acts a negative regulator of actin ring formation during osteoclast differentiation. • Esculetin deserves new evaluation as a potential treatment target in various bone diseases.« less
Transcriptional activation of PPARalpha by phenobarbital in the absence of CAR and PXR.
Tamasi, Viola; Juvan, Peter; Beer, Markus; Rozman, Damjana; Meyer, Urs A
2009-01-01
The nuclear receptors CAR (constitutive androstane receptor) and PXR (pregnane X receptor) mediate the effects of phenobarbital on gene transcription. To investigate the relative contribution of these nuclear receptors to the expression of specific genes we studied the effect of phenobarbital in livers of wild type, CAR(-/-), PXR(-/-) and CAR/PXR(-/-) knockout mice. Spotted Steroltalk v1 cDNA arrays were applied containing probes for genes involved in drug metabolism, sterol biosynthesis, steroid synthesis/transport and heme synthesis. In the absence of CAR and PXR, phenobarbital unexpectedly induced mRNAs of several nuclear receptors, including PPARalpha and its target genes Cyp4a10 and Cyp4a14. Interestingly, in primary cultures of hepatocytes isolated from CAR/PXR(-/-) knockout mice, phenobarbital increased HNF-4alpha levels. In further experiments in these hepatocyte cultures we provide evidence that phenobarbital directly induces transcription of the PPARalpha gene via its HNF-4alpha response element, and indirectly by lack of inhibitory crosstalk of AMPK, CAR and PXR with HNF-4alpha. Our results provide further insight into CAR and PXR-independent effects of phenobarbital and the crosstalk between different nuclear receptor signaling pathways.
Zelko, Igor; Sueyoshi, Tatsuya; Kawamoto, Takeshi; Moore, Rick; Negishi, Masahiko
2001-01-01
In response to phenobarbital (PB) and other PB-type inducers, the nuclear receptor CAR translocates to the mouse liver nucleus (T. Kawamoto et al., Mol. Cell. Biol. 19:6318–6322, 1999). To define the translocation mechanism, fluorescent protein-tagged human CAR (hCAR) was expressed in the mouse livers using the in situ DNA injection and gene delivery systems. As in the wild-type hCAR, the truncated receptor lacking the C-terminal 10 residues (i.e., AF2 domain) translocated to the nucleus, indicating that the PB-inducible translocation is AF2 independent. Deletion of the 30 C-terminal residues abolished the receptor translocation, and subsequent site-directed mutagenesis delineated the PB-inducible translocation activity of the receptor to the peptide L313GLL316AEL319. Ala mutations of Leu313, Leu316, or Leu319 abrogated the translocation of CAR in the livers, while those of Leu312 or Leu315 did not affect the nuclear translocation. The leucine-rich peptide dictates the nuclear translocation of hCAR in response to various PB-type inducers and appears to be conserved in the mouse and rat receptors. PMID:11283262
Wu, Yifei; Chin, William W; Wang, Yong; Burris, Thomas P
2003-03-07
The activation function 2 (AF-2)-dependent recruitment of coactivator is essential for gene activation by nuclear receptors. We show that the peroxisome proliferator-activated receptor gamma (PPARgamma) (NR1C3) coactivator-1 (PGC-1) requires both the intact AF-2 domain of PPARgamma and the LXXLL domain of PGC-1 for ligand-dependent and ligand-independent interaction and coactivation. Although the AF-2 domain of PPARgamma is absolutely required for PGC-1-mediated coactivation, this coactivator displayed a unique lack of requirement for the charge clamp of the ligand-binding domain of the receptor that is thought to be essential for LXXLL motif recognition. The mutation of a single serine residue adjacent to the core LXXLL motif of PGC-1 led to restoration of the typical charge clamp requirement. Thus, the unique structural features of the PGC-1 LXXLL motif appear to mediate an atypical mode of interaction with PPARgamma. Unexpectedly, we discovered that various ligands display variability in terms of their requirement for the charge clamp of PPARgamma for coactivation by PGC-1. This ligand-selective variable requirement for the charge clamp was coactivator-specific. Thus, distinct structural determinants, which may be unique for a particular ligand, are utilized by the receptor to recognize the coactivator. Our data suggest that even subtle differences in ligand structure are perceived by the receptor and translated into a unique display of the coactivator-binding surface of the ligand-binding domain, allowing for differential recognition of coactivators that may underlie distinct pharmacological profiles observed for ligands of a particular nuclear receptor.
Huang, Xiong-fei; Zhao, Wei-yu; Huang, Wen-dong
2015-01-01
Farnesoid X receptor (FXR) is a member of the nuclear receptor family and a ligand-modulated transcription factor. In the liver, FXR has been considered a multi-functional cell protector and a tumor suppressor. FXR can suppress liver carcinogenesis via different mechanisms: 1) FXR maintains the normal liver metabolism of bile acids, glucose and lipids; 2) FXR promotes liver regeneration and repair after injury; 3) FXR protects liver cells from death and enhances cell survival; 4) FXR suppresses hepatic inflammation, thereby preventing inflammatory damage; and 5) FXR can directly increase the expression of some tumor-suppressor genes and repress the transcription of several oncogenes. However, inflammation and epigenetic silencing are known to decrease FXR expression during tumorigenesis. The reactivation of FXR function in the liver may be a potential therapeutic approach for patients with liver cancer. PMID:25500874
The impact of transcription on metabolism in prostate and breast cancers.
Poulose, Ninu; Mills, Ian G; Steele, Rebecca E
2018-05-14
Metabolic dysregulation is regarded as an important driver in cancer development and progression. The impact of transcriptional changes on metabolism have been intensively studied in hormone-dependent cancers, and in particular in prostate and breast cancer. These cancers have strong similarities in the function of important transcriptional drivers, such as the estrogen and androgen receptor, at the level of dietary risk and epidemiology, genetics and therapeutically. In this review we will focus on the function of these nuclear hormone receptors and their downstream impact on metabolism, with a particular focus on lipid metabolism. We go on to discuss how lipid metabolism remains dysregulated as the cancers progress. We conclude by discussing the opportunities that this presents for drug repurposing, imaging and the development and testing of new therapeutics and treatment combinations.
Once and for all, LXRα and LXRβ are gatekeepers of the endocrine system.
Maqdasy, Salwan; Trousson, Amalia; Tauveron, Igor; Volle, David H; Baron, Silvère; Lobaccaro, Jean-Marc A
2016-06-01
Liver X receptors (LXRs) α and β are nuclear receptors whose transcriptional activity is regulated by oxysterols, the oxidized forms of cholesterol. Described in the late 1990s as lipid sensors, both LXRs regulate cholesterol and fatty acid homeostasis. Over the years, deep phenotypic analyses of mouse models deficient for LXRα and/or LXRβ have pointed out various other physiological functions including glucose homeostasis, immunology, and neuroprotection. This review enlightens the "endocrine" functions of LXRs; they deeply impact plasma glucose directly and by modulating insulin signaling, renin-angiotensin-aldosterone axis, thyroid and pituitary hormone levels, and bone homeostasis. Besides, LXR signaling is also involved in adrenal physiology, steroid synthesis, and male and female reproduction. Hence, LXRs are definitely involved in the endocrine system and could thus be considered as endocrine receptors, even though oxysterols do not fully correspond to the definition of hormones. Finally, because they are ligand-regulated transcription factors, LXRs are potential pharmacological targets with promising beneficial metabolic effects. Copyright © 2016 Elsevier Ltd. All rights reserved.
Nuclear hormone receptor coregulator: role in hormone action, metabolism, growth, and development.
Mahajan, Muktar A; Samuels, Herbert H
2005-06-01
Nuclear hormone receptor coregulator (NRC) (also referred to as activating signal cointegrator-2, thyroid hormone receptor-binding protein, peroxisome proliferator activating receptor-interacting protein, and 250-kDa receptor associated protein) belongs to a growing class of nuclear cofactors widely known as coregulators or coactivators that are necessary for transcriptional activation of target genes. The NRC gene is also amplified and overexpressed in breast, colon, and lung cancers. NRC is a 2063-amino acid protein that harbors a potent N-terminal activation domain (AD1) and a second more centrally located activation domain (AD2) that is rich in Glu and Pro. Near AD2 is a receptor-interacting domain containing an LxxLL motif (LxxLL-1), which interacts with a wide variety of ligand-bound nuclear hormone receptors with high affinity. A second LxxLL motif (LxxLL-2) located in the C-terminal region of NRC is more restricted in its nuclear hormone receptor specificity. The intrinsic activation potential of NRC is regulated by a C-terminal serine, threonine, leucine-regulatory domain. The potential role of NRC as a cointegrator is suggested by its ability to enhance transcriptional activation of a wide variety of transcription factors and from its in vivo association with a number of known transcriptional regulators including CBP/p300. Recent studies in mice indicate that deletion of both NRC alleles leads to embryonic lethality resulting from general growth retardation coupled with developmental defects in the heart, liver, brain, and placenta. NRC(-/-) mouse embryo fibroblasts spontaneously undergo apoptosis, indicating the importance of NRC as a prosurvival and antiapoptotic gene. Studies with 129S6 NRC(+/-) mice indicate that NRC is a pleiotropic regulator that is involved in growth, development, reproduction, metabolism, and wound healing.
Brain nuclear receptors and body weight regulation
USDA-ARS?s Scientific Manuscript database
Neural pathways, especially those in the hypothalamus, integrate multiple nutritional, hormonal, and neural signals, resulting in the coordinated control of body weight balance and glucose homeostasis. Nuclear receptors (NRs) sense changing levels of nutrients and hormones, and therefore play essent...
Progesterone Receptors: Form and Function in Brain
Brinton, Roberta Diaz; Thompson, Richard F.; Foy, Michael R.; Baudry, Michel; Wang, JunMing; Finch, Caleb E; Morgan, Todd E.; Stanczyk, Frank Z.; Pike, Christian J.; Nilsen, Jon
2008-01-01
Emerging data indicate that progesterone has multiple non-reproductive functions in the central nervous system to regulate cognition, mood, inflammation, mitochondrial function, neurogenesis and regeneration, myelination and recovery from traumatic brain injury. Progesterone-regulated neural responses are mediated by an array of progesterone receptors (PR) that include the classic nuclear PRA and PRB receptors and splice variants of each, the seven transmembrane domain 7TMPRβ and the membrane-associated 25-Dx PR (PGRMC1). These PRs induce classic regulation of gene expression while also transducing signaling cascades that originate at the cell membrane and ultimately activate transcription factors. Remarkably, PRs are broadly expressed throughout the brain and can be detected in every neural cell type. The distribution of PRs beyond hypothalamic borders, suggests a much broader role of progesterone in regulating neural function. Despite the large body of evidence regarding progesterone regulation of reproductive behaviors and estrogen-inducible responses as well as effects of progesterone metabolite neurosteroids, much remains to be discovered regarding the functional outcomes resulting from activation of the complex array of PRs in brain by gonadally and / or glial derived progesterone. Moreover, the impact of clinically used progestogens and developing selective PR modulators for targeted outcomes in brain is a critical avenue of investigation as the non-reproductive functions of PRs have far-reaching implications for hormone therapy to maintain neurological health and function throughout menopausal aging. PMID:18374402
Giraudo, Maeva; Audant, Pascaline; Feyereisen, René; Le Goff, Gaëlle
2013-05-01
The fall armyworm Spodoptera frugiperda is a major polyphagous pest in agriculture and little is known on how this insect can adapt to the diverse and potentially toxic plant allelochemicals that they ingest or to insecticides. To investigate the involvement of nuclear receptors in the response of S. frugiperda to its chemical environment, we cloned SfHR96, a nuclear receptor orthologous to the mammalian xenobiotic receptors, pregnane X receptor (PXR) and constitutive androstane receptor (CAR). We also cloned ultraspiracle (USP), the ortholog of retinoid X receptor (RXR) that serves as partner of dimerization of PXR and CAR. Cloning of SfUSP revealed the presence of two isoforms, SfUSP-1 and SfUSP-2 in this species, that differ in their N-terminal region. The expression of these receptors as well as the ecdysone receptor was studied during specific steps of development in different tissues. SfHR96 was constitutively expressed in larval midgut, fat body and Malpighian tubules throughout the last two instars and pupal stage, as well as in Sf9 cells. EcR and SfUSP-2 showed peaks of expression before larval moults and during metamorphosis, whereas SfUSP-1 was mainly expressed in the pre-pupal stage. Receptor induction was followed after exposure of larvae or cells to 11 chemical compounds. SfHR96 was not inducible by the tested compounds. EcR was significantly induced by the 20-hydroxyecdysone agonist, methoxyfenozide, and SfUSP showed an increase expression when exposed to the juvenile hormone analog, methoprene. The cloning of these nuclear receptors is a first step in understanding the important capacities of adaptation of this insect pest. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hepatic circadian clock oscillators and nuclear receptors integrate microbiome-derived signals
Montagner, Alexandra; Korecka, Agata; Polizzi, Arnaud; Lippi, Yannick; Blum, Yuna; Canlet, Cécile; Tremblay-Franco, Marie; Gautier-Stein, Amandine; Burcelin, Rémy; Yen, Yi-Chun; Je, Hyunsoo Shawn; Maha, Al-Asmakh; Mithieux, Gilles; Arulampalam, Velmurugesan; Lagarrigue, Sandrine; Guillou, Hervé; Pettersson, Sven; Wahli, Walter
2016-01-01
The liver is a key organ of metabolic homeostasis with functions that oscillate in response to food intake. Although liver and gut microbiome crosstalk has been reported, microbiome-mediated effects on peripheral circadian clocks and their output genes are less well known. Here, we report that germ-free (GF) mice display altered daily oscillation of clock gene expression with a concomitant change in the expression of clock output regulators. Mice exposed to microbes typically exhibit characterized activities of nuclear receptors, some of which (PPARα, LXRβ) regulate specific liver gene expression networks, but these activities are profoundly changed in GF mice. These alterations in microbiome-sensitive gene expression patterns are associated with daily alterations in lipid, glucose, and xenobiotic metabolism, protein turnover, and redox balance, as revealed by hepatic metabolome analyses. Moreover, at the systemic level, daily changes in the abundance of biomarkers such as HDL cholesterol, free fatty acids, FGF21, bilirubin, and lactate depend on the microbiome. Altogether, our results indicate that the microbiome is required for integration of liver clock oscillations that tune output activators and their effectors, thereby regulating metabolic gene expression for optimal liver function. PMID:26879573
Comptour, Aurélie; Rouzaire, Marion; Belville, Corinne; Bouvier, Damien; Gallot, Denis; Blanchon, Loïc; Sapin, Vincent
2016-10-01
Animal models of vitamin A (retinol) deficiency have highlighted its crucial role in reproduction and placentation, whereas an excess of retinoids (structurally or functionally related entities) can cause toxic and teratogenic effects in the embryo and foetus, especially in the first trimester of human pregnancy. Knock-out experimental strategies-targeting retinoid nuclear receptors RARs and RXRs have confirmed that the effects of vitamin A are mediated by retinoic acid (especially all-trans retinoic acid) and that this vitamin is essential for the developmental process. All these data show that the vitamin A pathway and metabolism are as important for the well-being of the foetus, as they are for that of the adult. Accordingly, during this last decade, extensive research on retinoid metabolism has yielded detailed knowledge on all the actors in this pathway, spurring the development of antagonists and agonists for therapeutic and research applications. Natural and synthetic retinoids are currently used in clinical practice, most often on the skin for the treatment of acne, and as anti-oncogenic agents in acute promyelocytic leukaemia. However, because of the toxicity and teratogenicity of retinoids during pregnancy, their pharmacological use needs a sound knowledge of their metabolism, molecular aspects, placental transfer, and action.
Petta, Ioanna; Dejager, Lien; Ballegeer, Marlies; Lievens, Sam; Tavernier, Jan; Libert, Claude
2016-01-01
SUMMARY Glucocorticoids (GCs) have been widely used for decades as a first-line treatment for inflammatory and autoimmune diseases. However, their use is often hampered by the onset of adverse effects or resistance. GCs mediate their effects via binding to glucocorticoid receptor (GR), a transcription factor belonging to the family of nuclear receptors. An important aspect of GR's actions, including its anti-inflammatory capacity, involves its interactions with various proteins, such as transcription factors, cofactors, and modifying enzymes, which codetermine receptor functionality. In this review, we provide a state-of-the-art overview of the protein-protein interactions (PPIs) of GR that positively or negatively affect its anti-inflammatory properties, along with mechanistic insights, if known. Emphasis is placed on the interactions that affect its anti-inflammatory effects in the presence of inflammatory and microbial diseases. PMID:27169854
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cassell, Geoffrey D.; Weitzman, Matthew D.
2004-10-01
Adeno-associated virus (AAV) replicates in the nucleus of infected cells, and therefore multiple nuclear import events are required for productive infection. We analyzed nuclear import of the viral Rep proteins and characterized a nuclear localization signal (NLS) in the C-terminus. We demonstrate that basic residues in this region constitute an NLS that is transferable and mediates interaction with the nuclear import receptor importin {alpha} in vitro. Mutant Rep proteins are predominantly cytoplasmic and are severely compromised for interactions with importin {alpha}, but retain their enzymatic functions in vitro. Interestingly, mutations of the NLS had significantly less effect on importin {alpha}more » interaction and replication in the context of Rep78 than when incorporated into the Rep68 protein. Together, our results demonstrate that a bipartite NLS exists in the shared part of Rep68 and Rep78, and suggest that an alternate entry mechanism may also contribute to nuclear localization of the Rep78 protein.« less
Künzler, Markus; Gerstberger, Thomas; Stutz, Françoise; Bischoff, F. Ralf; Hurt, Ed
2000-01-01
The RanGTP-binding protein RanBP1, which is located in the cytoplasm, has been implicated in release of nuclear export complexes from the cytoplasmic side of the nuclear pore complex. Here we show that Yrb1 (the yeast homolog of RanBP1) shuttles between the nucleus and the cytoplasm. Nuclear import of Yrb1 is a facilitated process that requires a short basic sequence within the Ran-binding domain (RBD). By contrast, nuclear export of Yrb1 requires an intact RBD, which forms a ternary complex with the Xpo1 (Crm1) NES receptor in the presence of RanGTP. Nuclear export of Yrb1, however, is insensitive towards leptomycin B, suggesting a novel type of substrate recognition between Yrb1 and Xpo1. Taken together, these data suggest that ongoing nuclear import and export is an important feature of Yrb1 function in vivo. PMID:10825193
Aβ mediates Sigma receptor degradation via CaN/NFAT pathway
Fang, Min; Zhang, Pei; Zhao, Yanxin; Jin, Aiping; Liu, Xueyuan
2016-01-01
Sigma receptor is an endoplasmic reticulum protein and belongs to non-opioid receptor. Increasing evidence shows that Sigma receptor activation can significantly attenuate AD induced neurological dysfunction and the functional deficiency of Sigma receptor plays an important role in the Aβ induced neuronal loss. This study aimed to investigate the influence of extracellular accumulation of Aβ on the Sigma receptor expression. Our results showed the increase in extracellular Aβ had little influence on the mRNA expression of Sigma receptor, but gradually reduced its protein expression. Co-immunoprecipitation was employed to evaluate the interaction of Sigma receptor with other proteins. Results showed BIP could bind to Sigma receptor to affect the ubiquitination of Sigma receptor. Further investigation showed there was a NFAT binding site at the promoter of BIP. Then, Western blot assay was performed to detect NFAT expression. Results showed extracellular Aβ affected the nuclear translocation of NFAT and the CaN activity of NFAT also increased with the accumulation of extracellular Aβ. In this study, NFAT-BIP luciferase reporter gene system was constructed. Results showed NFAT was able to regulate the transcription of BIP. Thus, we speculate that extracellular Aβ accumulation may activate CaN/NFAT signaling pathway to induce chaperone BIP expression, which results in Sigma receptor ubiquitination and its degradation. PMID:27648137
Brown, Nicola J M; Ramalho, Michal; Pedersen, Eva W; Moravcsik, Eva; Solomon, Ellen; Grimwade, David
2009-01-01
The promyelocytic leukemia gene (PML) encodes a protein which localizes to PML-nuclear bodies (NBs), sub-nuclear multi-protein structures, which have been implicated in diverse biological functions such as apoptosis, cell proliferation and senescence. However, the exact biochemical and molecular basis of PML function up until now has not been defined. Strikingly, over a decade ago, PML-NBs were found to be disrupted in acute promyelocytic leukemia (APL) in which PML is fused to the gene encoding retinoic acid receptor alpha (RARA) due to the t(15;17) chromosomal translocation, generating the PML-RARA chimeric protein. The treatment of APL patients with all-transretinoic acid (ATRA) and arsenic trioxide which target the PML-RARA oncoprotein results in clinical remission, associated with blast cell differentiation and reformation of the PML NBs, thus linking NB integrity with disease status. This review focuses on the current theories for molecular and biochemical functions of the PML-NBs, which would imply a role in the pathogenesis of APL, whilst also discussing the intriguing possibility that their disruption may not be in itself a significant oncogenic event.
CD147 promotes the formation of functional osteoclasts through NFATc1 signalling.
Nishioku, Tsuyoshi; Terasawa, Mariko; Baba, Misaki; Yamauchi, Atsushi; Kataoka, Yasufumi
2016-04-29
CD147, a membrane glycoprotein of the immunoglobulin superfamily, is highly upregulated during dynamic cellular events including tissue remodelling. Elevated CD147 expression is present in the joint of rheumatoid arthritis patients. However, the role of CD147 in bone destruction remains unclear. To determine whether CD147 is involved in osteoclastogenesis, we studied its expression in mouse osteoclasts and its role in osteoclast differentiation and function. CD147 expression was markedly upregulated during osteoclast differentiation. To investigate the role of CD147 in receptor activator of nuclear factor-kappa B ligand (RANKL)-induced osteoclastogenesis and bone resorption activity, osteoclast precursor cells were transfected with CD147 siRNA. Decreased CD147 expression inhibited osteoclast formation and bone resorption, inhibited RANKL-induced nuclear translocation of the nuclear factor of activated T cells (NFAT) c1 and decreased the expression of the d2 isoform of vacuolar ATPase Vo domain and cathepsin K. Therefore, CD147 plays a critical role in the differentiation and function of osteoclasts by upregulating NFATc1 through the autoamplification of its expression in osteoclastogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.
Macejova, Dana; Toporova, L; Brtko, J
2016-07-01
Retinoic acid (RA), an active form of vitamin A, regulates the embryonic development, male and female reproduction and induces important effects on the cell development, proliferation, and differentiation. These effects are mediated by the retinoid (RAR) and rexinoid nuclear receptors (RXR), which are considered to be a ligand-activated, DNA-binding, trans-acting, and transcription-modulating proteins, involved in a general molecular mechanism responsible for the transcriptional responses in target genes. Organotin compounds are typical environmental contaminants and suspected endocrine disrupting substances. They may affect processes of reproductive system in mammals, predominantly via nuclear receptor signaling pathways. Triorganotins, such as tributyltin chloride (TBTCl) and triphenyltin chloride (TPTCl), are capable to bind to RXR molecules, and thus represent potent agonists of RXR subtypes of nuclear receptors not sharing any structural characteristics with endogenous ligands of nuclear receptors. Th is article summarizes selected effects of biologically active retinoids and rexinoids on both male and female reproduction and also deals with the effects of organotin compounds evoking endocrine disrupting actions in reproduction.
Virtual and biomolecular screening converge on a selective agonist for GPR30.
Bologa, Cristian G; Revankar, Chetana M; Young, Susan M; Edwards, Bruce S; Arterburn, Jeffrey B; Kiselyov, Alexander S; Parker, Matthew A; Tkachenko, Sergey E; Savchuck, Nikolay P; Sklar, Larry A; Oprea, Tudor I; Prossnitz, Eric R
2006-04-01
Estrogen is a hormone critical in the development, normal physiology and pathophysiology of numerous human tissues. The effects of estrogen have traditionally been solely ascribed to estrogen receptor alpha (ERalpha) and more recently ERbeta, members of the soluble, nuclear ligand-activated family of transcription factors. We have recently shown that the seven-transmembrane G protein-coupled receptor GPR30 binds estrogen with high affinity and resides in the endoplasmic reticulum, where it activates multiple intracellular signaling pathways. To differentiate between the functions of ERalpha or ERbeta and GPR30, we used a combination of virtual and biomolecular screening to isolate compounds that selectively bind to GPR30. Here we describe the identification of the first GPR30-specific agonist, G-1 (1), capable of activating GPR30 in a complex environment of classical and new estrogen receptors. The development of compounds specific to estrogen receptor family members provides the opportunity to increase our understanding of these receptors and their contribution to estrogen biology.
0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang Heng; Denhard, Leslie A.; Zhou Huaxin
Using an in silico approach, a putative nuclear receptor-interacting protein 0610009K11Rik was identified in mouse testis. We named this gene testis-specific nuclear receptor-interacting protein-1 (Tnrip-1). Tnrip-1 was predominantly expressed in the testis of adult mouse tissues. Expression of Tnrip-1 in the testis was regulated during postnatal development, with robust expression in 14-day-old or older testes. In situ hybridization analyses showed that Tnrip-1 is highly expressed in pachytene spermatocytes and spermatids. Consistent with its mRNA expression, Tnrip-1 protein was detected in adult mouse testes. Immunohistochemical studies showed that Tnrip-1 is a nuclear protein and mainly expressed in pachytene spermatocytes and roundmore » spermatids. Moreover, co-immunoprecipitation analyses showed that endogenous Tnrip-1 protein can interact with germ cell nuclear receptor (GCNF) in adult mouse testes. Our results suggest that Tnrip-1 is a testis-specific and GCNF-interacting protein which may be involved in the modulation of GCNF-mediated gene transcription in spermatogenic cells within the testis.« less
Modulation of NRF2 signaling pathway by nuclear receptors: implications for cancer.
Namani, Akhileshwar; Li, Yulong; Wang, Xiu Jun; Tang, Xiuwen
2014-09-01
Nuclear factor-erythroid 2 p45-related factor 2 (NRF2, also known as Nfe2l2) plays a critical role in regulating cellular defense against electrophilic and oxidative stress by activating the expression of an array of antioxidant response element-dependent genes. On one hand, NRF2 activators have been used in clinical trials for cancer prevention and the treatment of diseases associated with oxidative stress; on the other hand, constitutive activation of NRF2 in many types of tumors contributes to the survival and growth of cancer cells, as well as resistance to anticancer therapy. In this review, we provide an overview of the NRF2 signaling pathway and discuss its role in carcinogenesis. We also introduce the inhibition of NRF2 by nuclear receptors. Further, we address the biological significance of regulation of the NRF2 signaling pathway by nuclear receptors in health and disease. Finally, we discuss the possible impact of NRF2 inhibition by nuclear receptors on cancer therapy. Copyright © 2014 Elsevier B.V. All rights reserved.
Functional interaction between nonreceptor tyrosine kinase c-Abl and SR-Rich protein RBM39
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mai, Sanyue; Qu, Xiuhua; Li, Ping
RBM39, also known as splicing factor HCC1.4, acts as a transcriptional coactivator for the steroid nuclear receptors JUN/AP-1, ESR1/ER-α and ESR2/ER-β. RBM39 is involved in the regulation of the transcriptional responses of these steroid nuclear receptors and promotes transcriptional initiation. In this paper, we report that RBM39 interacts with the nonreceptor tyrosine kinase c-Abl. Both the Src homology (SH) 2 and SH3 domains of c-Abl interact with RBM39. The major tyrosine phosphorylation sites on RBM39 that are phosphorylated by c-Abl are Y95 and Y99, as demonstrated by liquid chromatography coupled with tandem mass spectrometry (LC/MS/MS) and mutational analysis. c-Abl wasmore » shown boost the transcriptional coactivation activity of RBM39 for ERα and PRβ in a tyrosine kinase-dependent manner. The results suggest that mammalian c-Abl plays an important role in steroid hormone receptor-mediated transcription by regulating RBM39. - Highlights: • c-Abl interacts with RBM39. • RBM39 is phosphorylated by c-Abl. • c-Abl regulates transcriptional coactivation activity of RBM39 on the ERα and PRβ.« less
Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly
2013-01-01
A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017
Colella, Eileen; Li, Shaolin; Roy, Richard
2016-08-01
When faced with suboptimal growth conditions, Caenorhabditis elegans larvae can enter a diapause-like stage called "dauer" that is specialized for dispersal and survival. The decision to form a dauer larva is controlled by three parallel signaling pathways, whereby a compromise of TGFβ, cyclic guanosine monophosphate, or insulin/IGF-like signaling (ILS) results in dauer formation. Signals from these pathways converge on DAF-12, a nuclear hormone receptor that triggers the changes required to initiate dauer formation. DAF-12 is related to the vitamin D, liver-X, and androstane receptors, and like these human receptors, it responds to lipophilic hormone ligands. When bound to its ligand, DAF-12 acquires transcriptional activity that directs reproductive development, while unliganded DAF-12 forms a dauer-specifying complex with its interacting protein DIN-1S to regulate the transcription of genes required for dauer development. We report here that din-1S is required in parallel to par-4/LKB1 signaling within the gonad to establish cell cycle quiescence during the onset of the dauer stage. We show that din-1S is important for postdauer reproduction when ILS is impaired and is necessary for long-term dauer survival in response to reduced ILS. Our work uncovers several previously uncharacterized functions of DIN-1S in executing and maintaining many of the cellular and physiological processes required for appropriate dauer arrest, while also shedding light on the coordination of nuclear hormone signaling, the LKB1/AMPK signaling cascade, and ILS/TGFβ in the control of cell cycle quiescence and tissue growth: a key feature that is often misregulated in a number of hormone-dependent cancers. Copyright © 2016 by the Genetics Society of America.
Nuclear Receptor Activity and Liver Cancer Lesion Progression
Nuclear receptors (NRs) are ligand-activated transcription factors that control diverse cellular processes. Chronic stimulation of some NRs is a non-genotoxic mechanism of rodent liver cancer with unclear relevance to humans. We explored this question using human CAR, PXR, PPARα,...
Evidence for triclosan-induced activation of human and rodent xenobiotic nuclear receptors
The bacteriostat triclosan (2,4,40-trichloro-20-hydroxydiphenylether) (TCS) decreases rat serum thyroxine via putative nuclear receptor (NR) interaction(s) and subsequent transcriptional up-regulation of hepatic catabolism and clearance. However, due to the evolutionary divergenc...
Mode of action from dose-response microarray data: case study using 10 environmental chemicals
Ligand-activated nuclear receptors regulate many biological processes through complex interactions with biological macromolecules. Certain xenobiotics alter nuclear receptor signaling through direct or indirect interactions. Defining the mode of action of such xenobiotics is di...
Hunt, J Porter; Schinn, Song-Min; Jones, Matthew D; Bundy, Bradley C
2017-12-04
Endocrine disrupting chemicals (EDC) are structurally diverse compounds that can interact with nuclear hormone receptors, posing significant risk to human and ecological health. Unfortunately, many conventional biosensors have been too structure-specific, labor-intensive or laboratory-oriented to detect broad ranges of EDC effectively. Recently, several technological advances are providing more rapid, portable, and affordable detection of endocrine-disrupting activity through ligand-nuclear hormone receptor interactions. Here, we overview these recent advances applied to EDC biosensors - including cell lyophilization, cell immobilization, cell-free systems, smartphone-based signal detection, and improved competitive binding assays.
The CCDC55 couples cannabinoid receptor CNR1 to a putative DISC1 schizophrenia pathway.
Xie, J; Gizatullin, R; Vukojevic, V; Leopardi, R
2015-12-03
Our previous study suggested that the coiled coil domain-containing 55 gene (CCDC55), also named as NSRP1 (nuclear speckle splicing regulatory protein 1 (NSRP1)), was encompassed in a haplotype block spanning over the serotonin transporter (5-HTT) gene in patients with schizophrenia (SCZ). However, the neurobiological function of CCDC55 gene remains unknown. This study aims to uncover the potential role of CCDC55 in SCZ-associated molecular pathways. Using molecular cloning, sequencing and immune blotting to identify basic properties, yeast two-hybrid screening and glutathione S-transferase (GST) pull-down assay to test protein-protein interaction, and confocal laser scanning microscopy (CSLM) to show intracellular interaction of proteins. (i) CCDC55 is expressed as a nuclear protein in human neuronal cells; (ii) Protein-protein interaction analyses showed CCDC55 physically interacted with Ran binding protein 9 (RanBP9) and disrupted in schizophrenia 1 (DISC1); (iii) CCDC55 and RanBP9 co-localized in the nucleus of human neuronal cells; (iv) CCDC55 also interacted with the cannabinoid receptor 1 (CNR1), and with the brain cannabinoid receptor-interacting protein 1a (CNRIP1a); (v) CNR1 activation in differentiated human neuronal cells resulted in an altered RanBP9 localization. CCDC55 may be involved in a functional bridging between the CNR1 activation and the DISC1/RanBP9-associated pathways. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Deuschle, Ulrich; Birkel, Manfred; Hambruch, Eva; Hornberger, Martin; Kinzel, Olaf; Perović-Ottstadt, Sanja; Schulz, Andreas; Hahn, Ulrike; Burnet, Michael; Kremoser, Claus
2015-06-01
The nuclear bile acid receptor Farnesoid X receptor (FXR) is strongly expressed in liver and intestine, controls bile acid and lipid homeostasis and exerts tumor-protective functions in liver and intestine. Histidine-rich glycoprotein (HRG) is an abundant plasma protein produced by the liver with the proposed function as a pattern recognition molecule involved in the clearance of immune complexes, necrotic cells and pathogens, the modulation of angiogenesis, the normalization of deranged endothelial vessel structure in tumors and tumor suppression. FXR recognition sequences were identified within a human HRG promoter fragment that mediated FXR/FXR-agonist dependent reporter gene activity in vitro. We show that HRG is a novel transcriptional target gene of FXR in human hepatoma cells, human upcyte® primary hepatocytes and 3D human liver microtissues in vitro and in mouse liver in vivo. Prolonged administration of the potent nonsteroidal FXR agonist PX20606 increases HRG levels in mouse plasma. Finally, daily oral administration of this FXR agonist for seven days resulted in a significant increase of HRG levels in the plasma of healthy human male volunteers during a clinical Phase I safety study. HRG might serve as a surrogate marker indicative of liver-specific FXR activation in future human clinical studies. Furthermore, potent FXR agonists might be beneficial in serious health conditions where HRG is reduced, for example, in hepatocellular carcinoma but also other solid cancers, liver failure, sepsis and pre-eclampsia. © 2014 UICC.
Molecular adaptation and resilience of the insect’s nuclear receptor USP
2012-01-01
Background The maintenance of biological systems requires plasticity and robustness. The function of the ecdysone receptor, a heterodimer composed of the nuclear receptors ECR (NR1H1) and USP (NR2B4), was maintained in insects despite a dramatic divergence that occurred during the emergence of Mecopterida. This receptor is therefore a good model to study the evolution of plasticity. We tested the hypothesis that selection has shaped the Ligand-Binding Domain (LBD) of USP during evolution of Mecopterida. Results We isolated usp and cox1 in several species of Drosophilidae, Tenebrionidae and Blattaria and estimated non-synonymous/synonymous rate ratios using maximum-likelihood methods and codon-based substitution models. Although the usp sequences were mainly under negative selection, we detected relaxation at residues located on the surface of the LBD within Mecopterida families. Using branch-site models, we also detected changes in selective constraints along three successive branches of the Mecopterida evolution. Residues located at the bottom of the ligand-binding pocket (LBP) underwent strong positive selection during the emergence of Mecopterida. This change is correlated with the acquisition of a large LBP filled by phospholipids that probably allowed the stabilisation of the new Mecopterida structure. Later, when the two subgroups of Mecopterida (Amphiesmenoptera: Lepidoptera, Trichoptera; Antliophora: Diptera, Mecoptera, Siphonaptera) diverged, the same positions became under purifying selection. Similarly, several positions of the heterodimerisation interface experienced positive selection during the emergence of Mecopterida, rapidly followed by a phase of constrained evolution. An enlargement of the heterodimerisation surface is specific for Mecopterida and was associated with a reinforcement of the obligatory partnership between ECR and USP, at the expense of homodimerisation. Conclusions In order to explain the episodic mode of evolution of USP, we propose a model in which the molecular adaptation of this protein is seen as a process of resilience for the maintenance of the ecdysone receptor functionality. PMID:23039844
Expanding the Definition of the Classical Bipartite Nuclear Localization Signal
Lange, Allison; McLane, Laura M.; Mills, Ryan E.; Devine, Scott E.; Corbett, Anita H.
2010-01-01
Nuclear localization signals (NLSs) are amino acid sequences that target cargo proteins into the nucleus. Rigorous characterization of NLS motifs is essential to understanding and predicting pathways for nuclear import. The best-characterized NLS is the classical NLS (cNLS), which is recognized by the cNLS receptor, importin-α. cNLSs are conventionally defined as having one (monopartite) or two clusters of basic amino acids separated by a 9-12 amino acid linker (bipartite). Motivated by the finding that Ty1 integrase, which contains an unconventional putative bipartite cNLS with a 29 amino acid linker, exploits the classical nuclear import machinery, we assessed the functional boundaries for linker length within a bipartite cNLS. We confirmed that the integrase cNLS is a bona fide bipartite cNLS, then carried out a systematic analysis of linker length in an obligate bipartite cNLS cargo, which revealed that some linkers longer than conventionally defined can function in nuclear import. Linker function is dependent on the sequence and likely the inherent flexibility of the linker. Subsequently, we interrogated the Saccharomyces cerevisiae proteome to identify cellular proteins containing putative long bipartite cNLSs. We experimentally confirmed that Rrp4 contains a bipartite cNLS with a 25 amino acid linker. Our studies reveal that the traditional definition of bipartite cNLSs is too restrictive and linker length can vary depending on amino acid composition PMID:20028483
The Sigma-1 Receptor as a Pluripotent Modulator in Living Systems.
Su, Tsung-Ping; Su, Tzu-Chieh; Nakamura, Yoki; Tsai, Shang-Yi
2016-04-01
The sigma-1 receptor (Sig-1R) is an endoplasmic reticulum (ER) protein that resides specifically in the mitochondria-associated endoplasmic reticulum (ER) membrane (MAM), an interface between ER and mitochondria. In addition to being able to translocate to the plasma membrane (PM) to interact with ion channels and other receptors, Sig-1R also occurs at the nuclear envelope, where it recruits chromatin-remodeling factors to affect the transcription of genes. Sig-1Rs have also been reported to interact with other membranous or soluble proteins at other loci, including the cytosol, and to be involved in several central nervous system (CNS) diseases. Here, we propose that Sig-1R is a pluripotent modulator with resultant multiple functional manifestations in living systems. Published by Elsevier Ltd.
Ouedraogo, Zangbéwendé Guy; Fouache, Allan; Trousson, Amalia; Baron, Silvère; Lobaccaro, Jean-Marc A
2017-10-01
Liver X receptors (LXRs) are members of the nuclear receptor superfamily that have been shown to regulate various physiological functions such as lipid metabolism and cholesterol homeostasis. Concordant reports have elicited the possibility to target them to cure many human diseases including arteriosclerosis, cancer, arthritis, and diabetes. The high relevance of modulating LXR activities to treat numerous skin diseases, mainly those with exacerbated inflammation processes, contrasts with the lack of approved therapeutic use. This review makes an assessment to sum up the findings regarding the physiological roles of LXRs in skin and help progress towards the therapeutic and safe management of their activities. It focuses on the possible pharmacological targeting of LXRs to cure or prevent selected skin diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Sigma-1 Receptor as a Pluripotent Modulator in the Living System
Su, Tsung-Ping; Su, Tzu-Chieh; Nakamura, Yoki; Tsai, Shang-Yi
2016-01-01
The sigma-1 receptor (Sig-1R) is an endoplasmic reticulum (ER) protein resides specifically at the interface between ER and mitochondria, called the MAM, where the Sig-1R is recently reported to be involved in certain CNS diseases. In addition to being able to translocate to the plasma membrane to interact with ion channels and other receptors, the Sig-1R is found to exist at the nuclear envelope where it recruits chromatin-remodeling factors to affect the transcription of genes. As well, thorough experimental and bioinformatic means, Sig-1Rs are reported to interact with other membranous or soluble proteins at other loci, including the cytosol. We propose that the Sig-1R is a pluripotent modulator with resultant multiple functional manifestations in the living system. PMID:26869505
Discrimination between NL1- and NL2-Mediated Nuclear Localization of the Glucocorticoid Receptor
Savory, Joanne G. A.; Hsu, Brian; Laquian, Ian R.; Giffin, Ward; Reich, Terry; Haché, Robert J. G.; Lefebvre, Yvonne A.
1999-01-01
Glucocorticoid receptor (GR) cycles between a free liganded form that is localized to the nucleus and a heat shock protein (hsp)-immunophilin-complexed, unliganded form that is usually localized to the cytoplasm but that can also be nuclear. In addition, rapid nucleocytoplasmic exchange or shuttling of the receptor underlies its localization. Nuclear import of liganded GR is mediated through a well-characterized sequence, NL1, adjacent to the receptor DNA binding domain and a second, uncharacterized motif, NL2, that overlaps with the ligand binding domain. In this study we report that rapid nuclear import (half-life [t1/2] of 4 to 6 min) of agonist- and antagonist-treated GR and the localization of unliganded, hsp-associated GRs to the nucleus in G0 are mediated through NL1 and correlate with the binding of GR to pendulin/importin α. By contrast, NL2-mediated nuclear transfer of GR occurred more slowly (t1/2 = 45 min to 1 h), was agonist specific, and appeared to be independent of binding to importin α. Together, these results suggest that NL2 mediates the nuclear import of GR through an alternative nuclear import pathway. Nuclear export of GR was inhibited by leptomycin B, suggesting that the transfer of GR to the cytoplasm is mediated through the CRM1-dependent pathway. Inhibition of GR nuclear export by leptomycin B enhanced the nuclear localization of both unliganded, wild-type GR and hormone-treated NL1− GR. These results highlight that the subcellular localization of both liganded and unliganded GRs is determined, at least in part, by a flexible equilibrium between the rates of nuclear import and export. PMID:9891038
Vitamin D and alternative splicing of RNA
Zhou, Rui; Chun, Rene F.; Lisse, Thomas S.; Garcia, Alejandro J.; Xu, Jianzhong; Adams, John S.; Hewison, Martin
2014-01-01
The active form of vitamin D (1α,25-dihydroxyvitamin D, 1,25(OH)2D) exerts its genomic effects via binding to a nuclear high-affinity vitamin D receptor (VDR). Recent deep sequencing analysis of VDR binding locations across the complete genome has significantly expanded our understanding of the actions of vitamin D and VDR on gene transcription. However, these studies have also promoted appreciation of the extra-transcriptional impact of vitamin D on gene expression. It is now clear that vitamin D interacts with the epigenome via effects on DNA methylation, histone acetylation, and microRNA generation to maintain normal biological functions. There is also increasing evidence that vitamin D can influence pre-mRNA constitutive splicing and alternative splicing, although the mechanism for this remains unclear. Pre-mRNA splicing has long been thought to be a post-transcription RNA processing event, but current data indicate that this occurs co-transcriptionally. Several steroid hormones have been recognized to coordinately control gene transcription and pre-mRNA splicing through the recruitment of nuclear receptor co-regulators that can both control gene transcription and splicing. The current review will discuss this concept with specific reference to vitamin D, and the potential role of heterogeneous nuclear ribonucleoprotein C (hnRNPC), a nuclear factor with an established function in RNA splicing. hnRNPC, has been shown to be involved in the VDR transcriptional complex as a vitamin D-response element-binding protein (VDRE-BP), and may act as a coupling factor linking VDR-directed gene transcription with RNA splicing. In this way hnRNPC may provide an additional mechanism for the fine-tuning of vitamin D-regulated target gene expression. PMID:25447737
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms. PMID:26872259
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.
Daphnia HR96 is a Promiscuous Xenobiotic and Endobiotic Nuclear Receptor
Karimullina, Elina; Li, Yangchun; Ginjupalli, Gautam; Baldwin, William S.
2012-01-01
Daphnia pulex is the first crustacean to have its genome sequenced. The genome project provides new insight and data into how an aquatic crustacean may respond to environmental stressors, including toxicants. We cloned Daphnia pulex HR96 (DappuHR96), a nuclear receptor orthologous to the CAR/PXR/VDR group of nuclear receptors. In Drosophila melanogaster, (hormone receptor 96) HR96 responds to phenobarbital exposure and has been hypothesized as a toxicant receptor. Therefore, we set up a transactivation assay to test whether DappuHR96 is a promiscuous receptor activated by xenobiotics and endobiotics similar to the constitutive androstane receptor (CAR) and the pregnane X-receptor (PXR). Transactivation assays performed with a GAL4-HR96 chimera demonstrate that HR96 is a promiscuous toxicant receptor activated by a diverse set of chemicals such as pesticides, hormones, and fatty acids. Several environmental toxicants activate HR96 including estradiol, pyriproxyfen, chlorpyrifos, atrazine, and methane arsonate. We also observed repression of HR96 activity by chemicals such as triclosan, androstanol, and fluoxetine. Nearly 50% of the chemicals tested activated or inhibited HR96. Interestingly, unsaturated fatty acids were common activators or inhibitors of HR96 activity, indicating a link between diet and toxicant response. The omega-6 and omega-9 unsaturated fatty acids linoleic and oleic acid activated HR96, but the omega-3 unsaturated fatty acids alpha-linolenic acid and docosahexaenoic acid inhibited HR96, suggesting that these two distinct sets of lipids perform opposing roles in Daphnia physiology. This also provides a putative mechanism by which the ratio of dietary unsaturated fats may affect the ability of an organism to respond to a toxic insult. In summary, HR96 is a promiscuous nuclear receptor activated by numerous endo- and xenobiotics. PMID:22466357
Using Nuclear Receptor Activity to Stratify Hepatocarcinogens
Nuclear receptors (NR) are a superfamily of ligand-activated transcription factors that control a range of cellular processes. Persistent stimulation of some NR is a non-genotoxic mechanism of rodent liver cancer with unclear relevance to humans. Here we report on a systematic an...
A Boolean Network Model of Nuclear Receptor Mediated Cell Cycle Progression
Nuclear receptors (NRs) are ligand-activated transcription factors that regulate a broad range of cellular processes. Hormones, lipids and xenobiotics have been shown to activate NRs with a range of consequences on development, metabolism, oxidative stress, apoptosis, and prolif...
A Boolean Network Model of Nuclear Receptor Mediated Cell Cycle Progression (S)
Nuclear receptors (NRs) are ligand-activated transcription factors that regulate a broad range of cellular processes. Hormones, lipids and xenobiotics have been shown to activate NRs with a range of consequences on development, metabolism, oxidative stress, apoptosis, and prolif...
Nucleocytoplasmic Transport of RNAs and RNA-Protein Complexes.
Sloan, Katherine E; Gleizes, Pierre-Emmanuel; Bohnsack, Markus T
2016-05-22
RNAs and ribonucleoprotein complexes (RNPs) play key roles in mediating and regulating gene expression. In eukaryotes, most RNAs are transcribed, processed and assembled with proteins in the nucleus and then either function in the cytoplasm or also undergo a cytoplasmic phase in their biogenesis. This compartmentalization ensures that sequential steps in gene expression and RNP production are performed in the correct order and it allows important quality control mechanisms that prevent the involvement of aberrant RNAs/RNPs in these cellular pathways. The selective exchange of RNAs/RNPs between the nucleus and cytoplasm is enabled by nuclear pore complexes, which function as gateways between these compartments. RNA/RNP transport is facilitated by a range of nuclear transport receptors and adaptors, which are specifically recruited to their cargos and mediate interactions with nucleoporins to allow directional translocation through nuclear pore complexes. While some transport factors are only responsible for the export/import of a certain class of RNA/RNP, others are multifunctional and, in the case of large RNPs, several export factors appear to work together to bring about export. Recent structural studies have revealed aspects of the mechanisms employed by transport receptors to enable specific cargo recognition, and genome-wide approaches have provided the first insights into the diverse composition of pre-mRNPs during export. Furthermore, the regulation of RNA/RNP export is emerging as an important means to modulate gene expression under stress conditions and in disease. Copyright © 2015. Published by Elsevier Ltd.
Nguyen, Minh M.; Dar, Javid A.; Ai, Junkui; Wang, Yujuan; Masoodi, Khalid Z.; Shun, Tongying; Shinde, Sunita; Camarco, Daniel P.; Hua, Yun; Huryn, Donna M.; Wilson, Gabriela Mustata; Lazo, John S.; Nelson, Joel B.; Wipf, Peter
2016-01-01
Abstract Patients with castration-resistant prostate cancer (CRPC) can be treated with abiraterone, a potent inhibitor of androgen synthesis, or enzalutamide, a second-generation androgen receptor (AR) antagonist, both targeting AR signaling. However, most patients relapse after several months of therapy and a majority of patients with relapsed CRPC tumors express the AR target gene prostate-specific antigen (PSA), suggesting that AR signaling is reactivated and can be targeted again to inhibit the relapsed tumors. Novel small molecules capable of inhibiting AR function may lead to urgently needed therapies for patients resistant to abiraterone, enzalutamide, and/or other previously approved antiandrogen therapies. Here, we describe a high-throughput high-content screening (HCS) campaign to identify small-molecule inhibitors of AR nuclear localization in the C4-2 CRPC cell line stably transfected with GFP-AR-GFP (2GFP-AR). The implementation of this HCS assay to screen a National Institutes of Health library of 219,055 compounds led to the discovery of 3 small molecules capable of inhibiting AR nuclear localization and function in C4-2 cells, demonstrating the feasibility of using this cell-based phenotypic assay to identify small molecules targeting the subcellular localization of AR. Furthermore, the three hit compounds provide opportunities to develop novel AR drugs with potential for therapeutic intervention in CRPC patients who have relapsed after treatment with antiandrogens, such as abiraterone and/or enzalutamide. PMID:27187604
Moreno, S; Farioli-Vecchioli, S; Cerù, M P
2004-01-01
Peroxisome proliferator-activated and retinoid X receptors (PPARs and RXRs) are transcription factors belonging to the steroid hormone receptor superfamily. Upon activation by their ligands, PPARs and RXRs bind to their target genes as heterodimers. Ligands of these receptors include lipophylic molecules, such as retinoids, fatty acids and eicosanoids, the importance of which in the metabolism and functioning of the nervous tissue is well documented. The immunohistochemical distribution of PPARs and RXRs in the CNS of the adult rat was studied by means of a sensitive biotinyl-tyramide method. All PPAR (alpha, beta/delta and gamma) and RXR (alpha, beta and gamma) isotypes were detected and found to exhibit specific patterns of localization in the different areas of the brain and spinal cord. The presence of the nuclear receptors was observed in both neuronal and glial cells. While PPAR beta/delta and RXR beta showed a widespread distribution, alpha and gamma isotypes exhibited a more restricted pattern of expression. The frontal cortex, basal ganglia, reticular formation, some cranial nerve nuclei, deep cerebellar nuclei, and cerebellar Golgi cells appeared rather rich in all studied receptors. Based on our data, we suggest that in the adult CNS, PPARs and RXRs, besides playing roles common to many other tissues, may have specific functions in regulating the expression of genes involved in neurotransmission, and therefore play roles in complex processes, such as aging, neurodegeneration, learning and memory.
Sandlund, Liv; Nilsen, Frank; Male, Rune; Grotmol, Sindre; Kongshaug, Heidi; Dalvin, Sussie
2015-02-01
The salmon louse Lepeophtheirus salmonis (Copepoda, Caligidae) is an important parasite in the salmon farming industry in the Northern Hemisphere causing annual losses of hundreds of millions of dollars (US) worldwide. To facilitate development of a vaccine or other novel measures to gain control of the parasite, knowledge about molecular biological functions of L. salmonis is vital. In arthropods, a nuclear receptor complex consisting of the ecdysone receptor and the retinoid X receptor, ultraspiracle, are well known to be involved in a variety of both developmental and reproductive processes. To investigate the role of the ecdysone receptor in the salmon louse, we isolated and characterised cDNA with the 5'untranslated region of the predicted L. salmonis EcR (LsEcR). The LsEcR cDNA was 1608 bp encoding a 536 amino acid sequence that demonstrated high sequence similarities to other arthropod ecdysone receptors including Tribolium castaneum and Locusta migratoria. Moreover, in situ analysis of adult female lice revealed that the LsEcR transcript is localised in a wide variety of tissues such as ovaries, sub-cuticula and oocytes. Knock-down studies of LsEcR using RNA interference terminated egg production, indicating that the LsEcR plays important roles in reproduction and oocyte maturation. We believe this is the first report on the ecdysone receptor in the economically important parasite L. salmonis. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Xiang, Jin; Wang, Ying; Su, Ke; Liu, Min; Hu, Peng-Chao; Ma, Tian; Li, Jia-Xi; Wei, Lei; Zheng, Zhongliang; Yang, Fang
2014-10-01
Estrogenic actions are closely related to cardiovascular disease. Ritonavir (RTV), a human immunodeficiency virus (HIV) protease inhibitor, induces atherosclerosis in an estrogen-related manner. However, how RTV induce pathological phenotypes through estrogen pathway remains unclear. In this study, we found that RTV increases thickness of coronary artery walls of Sprague Dawley rats and plasma free fatty acids (FFA) levels. In addition, RTV could induce foam cell formation, downregulate both estrogen receptor α (ERα) and ERβ expression, upregulate G protein-coupled estrogen receptor (GPER) expression, and all of them could be partially blocked by 17β-estradiol (E2), suggesting RTV acts as an antagonist for E2. Computational modeling shows a similar interaction with ERα between RTV and 2-aryl indoles, which are highly subtype-selective ligands for ERα. We also found that RTV directly bound to ERα and selectively inhibited the nuclear localization of ERα, and residue Leu536 in the hydrophobic core of ligand binding domain (LBD) was essential for the interaction with RTV. In addition, RTV did not change the secondary structure of ERα-LBD like E2, which explained how ERα lost the capacity of nuclear translocation under the treatment of RTV. All of the evidences suggest that ritonavir acts as an antagonist for 17β-estradiol in regulating α subtype estrogen receptor function and early events of atherosclerosis. Copyright © 2014 Elsevier Inc. All rights reserved.
Cho, Gota; Bragiel, Aneta M; Wang, Di; Pieczonka, Tomasz D; Skowronski, Mariusz T; Shono, Masayuki; Nielsen, Søren; Ishikawa, Yasuko
2015-04-01
The subcellular distribution of aquaporin-5 (AQP5) in rat parotid acinar cells in response to muscarinic acetylcholine receptor (mAChR) activation remains unclear. Immunoconfocal and immunoelectron microscopy were used to visualize the distribution of AQP5 in parotid acinar cells. Western blotting was used to analyze AQP5 levels in membranes. To clarify the characteristics of membrane domains associated with AQP5, detergent solubility and sucrose-density flotation experiments were performed. Under control conditions, AQP5 was diffusely distributed on the apical plasma membrane (APM) and apical plasmalemmal region and throughout the cytoplasm. Upon mAChR activation, AQP5 was predominantly located in the nucleus, APM and lateral plasma membrane (LPM). Subsequently, localization of AQP5 in the nucleus, APM and LPM was decreased. Prolonged atropine treatment inhibited mAChR agonist-induced translocation of AQP5 to the nucleus, APM and LPM. AQP5 levels were enhanced in isolated nuclei and nuclear membranes prepared from parotid tissues incubated with mAChR agonist. mAChR agonist induced AQP5 levels in both soluble and insoluble nuclear fractions solubilized with Triton X-100 or Lubrol WX. Small amounts of AQP5 in nuclei were detected using low-density sucrose gradient. When AQP5 was present in the nuclear membrane, nuclear size decreased. The activation of mAChR induced AQP5 translocation to the nucleus, APM and LPM, and AQP5 may trigger water transport across the nuclear membrane and plasma membrane in rat parotid acinar cells. AQP5 translocates to the nuclear membrane and may trigger the movement of water, inducing shrinkage of the nucleus and the start of nuclear functions. Copyright © 2015 Elsevier B.V. All rights reserved.
Dittmann, K H; Rothmund, M C; Paasch, A; Mayer, C; Fehrenbacher, B; Schaller, M; Frauenstein, K; Fritsche, E; Haarmann-Stemmann, T; Braeuning, A; Rodemann, H P
2016-01-05
In the present study, we explored the role of the aryl hydrocarbon receptor (AhR) for γ-H2AX associated DNA repair in response to treatment with ionizing radiation. Ionizing radiation was able to stabilize AhR protein and to induce a nuclear translocation in a similar way as described for exposure to aromatic hydrocarbons. A comparable AhR protein stabilization was obtained by treatment with hydroxyl-nonenal-generated by radiation-induced lipid peroxidation. AhR knockdown resulted in significant radio-sensitization of both A549- and HaCaT cells. Under these conditions an increased amount of residual γ-H2AX foci and a delayed decline of γ-H2AX foci was observed. Knockdown of the co-activator ARNT, which is essential for transcriptional activation of AhR target genes, reduced AhR-dependent CYP1A expression in response to irradiation, but was without effect on the amount of residual γ-H2AX foci. Nuclear AhR was found in complex with γ-H2AX, DNA-PK, ATM and Lamin A. AhR and γ-H2AX form together nuclear foci, which disappear during DNA repair. Presence of nuclear AhR protein is associated with ATM activation and chromatin relaxation indicated by acetylation of histone H3. Taken together, we could show, that beyond the function as a transcription factor the nuclear AhR is involved in the regulation of DNA repair. Reduction of nuclear AhR inhibits DNA-double stand repair and radiosensitizes cells. First hints for its molecular mechanism suggest a role during ATM activation and chromatin relaxation, both essential for DNA repair. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Zhuo, Jia L.; Ferrao, Fernanda M.; Zheng, Yun; Li, Xiao C.
2013-01-01
The renin-angiotensin system (RAS) is well-recognized as one of the oldest and most important regulators of arterial blood pressure, cardiovascular, and renal function. New frontiers have recently emerged in the RAS research well beyond its classic paradigm as a potent vasoconstrictor, an aldosterone release stimulator, or a sodium-retaining hormone. First, two new members of the RAS have been uncovered, which include the renin/(Pro)renin receptor (PRR) and angiotensin-converting enzyme 2 (ACE2). Recent studies suggest that prorenin may act on the PRR independent of the classical ACE/ANG II/AT1 receptor axis, whereas ACE2 may degrade ANG II to generate ANG (1–7), which activates the Mas receptor. Second, there is increasing evidence that ANG II may function as an intracellular peptide to activate intracellular and/or nuclear receptors. Third, currently there is a debate on the relative contribution of systemic versus intrarenal RAS to the physiological regulation of blood pressure and the development of hypertension. The objectives of this article are to review and discuss the new insights and perspectives derived from recent studies using novel transgenic mice that either overexpress or are deficient of one key enzyme, ANG peptide, or receptor of the RAS. This information may help us better understand how ANG II acts, both independently or through interactions with other members of the system, to regulate the kidney function and blood pressure in health and disease. PMID:24273531
A Functional Nuclear Localization Sequence in the C. elegans TRPV Channel OCR-2
Ezak, Meredith J.; Ferkey, Denise M.
2011-01-01
The ability to modulate gene expression in response to sensory experience is critical to the normal development and function of the nervous system. Calcium is a key activator of the signal transduction cascades that mediate the process of translating a cellular stimulus into transcriptional changes. With the recent discovery that the mammalian Cav1.2 calcium channel can be cleaved, enter the nucleus and act as a transcription factor to control neuronal gene expression, a more direct role for the calcium channels themselves in regulating transcription has begun to be appreciated. Here we report the identification of a nuclear localization sequence (NLS) in the C. elegans transient receptor potential vanilloid (TRPV) cation channel OCR-2. TRPV channels have previously been implicated in transcriptional regulation of neuronal genes in the nematode, although the precise mechanism remains unclear. We show that the NLS in OCR-2 is functional, being able to direct nuclear accumulation of a synthetic cargo protein as well as the carboxy-terminal cytosolic tail of OCR-2 where it is endogenously found. Furthermore, we discovered that a carboxy-terminal portion of the full-length channel can localize to the nucleus of neuronal cells. These results suggest that the OCR-2 TRPV cation channel may have a direct nuclear function in neuronal cells that was not previously appreciated. PMID:21957475
Xpo7 is a broad-spectrum exportin and a nuclear import receptor.
Aksu, Metin; Pleiner, Tino; Karaca, Samir; Kappert, Christin; Dehne, Heinz-Jürgen; Seibel, Katharina; Urlaub, Henning; Bohnsack, Markus T; Görlich, Dirk
2018-05-10
Exportins bind cargo molecules in a RanGTP-dependent manner inside nuclei and transport them through nuclear pores to the cytoplasm. CRM1/Xpo1 is the best-characterized exportin because specific inhibitors such as leptomycin B allow straightforward cargo validations in vivo. The analysis of other exportins lagged far behind, foremost because no such inhibitors had been available for them. In this study, we explored the cargo spectrum of exportin 7/Xpo7 in depth and identified not only ∼200 potential export cargoes but also, surprisingly, ∼30 nuclear import substrates. Moreover, we developed anti-Xpo7 nanobodies that acutely block Xpo7 function when transfected into cultured cells. The inhibition is pathway specific, mislocalizes export cargoes of Xpo7 to the nucleus and import substrates to the cytoplasm, and allowed validation of numerous tested cargo candidates. This establishes Xpo7 as a broad-spectrum bidirectional transporter and paves the way for a much deeper analysis of exportin and importin function in the future. © 2018 Aksu et al.
Natively Unfolded FG Repeats Stabilize the Structure of the Nuclear Pore Complex.
Onischenko, Evgeny; Tang, Jeffrey H; Andersen, Kasper R; Knockenhauer, Kevin E; Vallotton, Pascal; Derrer, Carina P; Kralt, Annemarie; Mugler, Christopher F; Chan, Leon Y; Schwartz, Thomas U; Weis, Karsten
2017-11-02
Nuclear pore complexes (NPCs) are ∼100 MDa transport channels assembled from multiple copies of ∼30 nucleoporins (Nups). One-third of these Nups contain phenylalanine-glycine (FG)-rich repeats, forming a diffusion barrier, which is selectively permeable for nuclear transport receptors that interact with these repeats. Here, we identify an additional function of FG repeats in the structure and biogenesis of the yeast NPC. We demonstrate that GLFG-containing FG repeats directly bind to multiple scaffold Nups in vitro and act as NPC-targeting determinants in vivo. Furthermore, we show that the GLFG repeats of Nup116 function in a redundant manner with Nup188, a nonessential scaffold Nup, to stabilize critical interactions within the NPC scaffold needed for late steps of NPC assembly. Our results reveal a previously unanticipated structural role for natively unfolded GLFG repeats as Velcro to link NPC subcomplexes and thus add a new layer of connections to current models of the NPC architecture. Copyright © 2017 Elsevier Inc. All rights reserved.
Functions of Intracellular Retinoid Binding-Proteins.
Napoli, Joseph L
Multiple binding and transport proteins facilitate many aspects of retinoid biology through effects on retinoid transport, cellular uptake, metabolism, and nuclear delivery. These include the serum retinol binding protein sRBP (aka Rbp4), the plasma membrane sRBP receptor Stra6, and the intracellular retinoid binding-proteins such as cellular retinol-binding proteins (CRBP) and cellular retinoic acid binding-proteins (CRABP). sRBP transports the highly lipophilic retinol through an aqueous medium. The major intracellular retinol-binding protein, CRBP1, likely enhances efficient retinoid use by providing a sink to facilitate retinol uptake from sRBP through the plasma membrane or via Stra6, delivering retinol or retinal to select enzymes that generate retinyl esters or retinoic acid, and protecting retinol/retinal from excess catabolism or opportunistic metabolism. Intracellular retinoic acid binding-proteins (CRABP1 and 2, and FABP5) seem to have more diverse functions distinctive to each, such as directing retinoic acid to catabolism, delivering retinoic acid to specific nuclear receptors, and generating non-canonical actions. Gene ablation of intracellular retinoid binding-proteins does not cause embryonic lethality or gross morphological defects. Metabolic and functional defects manifested in knockouts of CRBP1, CRBP2 and CRBP3, however, illustrate their essentiality to health, and in the case of CRBP2, to survival during limited dietary vitamin A. Future studies should continue to address the specific molecular interactions that occur between retinoid binding-proteins and their targets and their precise physiologic contributions to retinoid homeostasis and function.
Cross-talk among HMGA1 and FoxO1 in control of nuclear insulin signaling.
Chiefari, Eusebio; Arcidiacono, Biagio; Palmieri, Camillo; Corigliano, Domenica Maria; Morittu, Valeria Maria; Britti, Domenico; Armoni, Michal; Foti, Daniela Patrizia; Brunetti, Antonio
2018-06-04
As a mediator of insulin-regulated gene expression, the FoxO1 transcription factor represents a master regulator of liver glucose metabolism. We previously reported that the high-mobility group AT-hook 1 (HMGA1) protein, a molecular switch for the insulin receptor gene, functions also as a downstream target of the insulin receptor signaling pathway, representing a critical nuclear mediator of insulin function. Here, we investigated whether a functional relationship existed between FoxO1 and HMGA1, which might help explain insulin-mediated gene transcription in the liver. To this end, as a model study, we investigated the canonical FoxO1-HMGA1-responsive IGFBP1 gene, whose hepatic expression is regulated by insulin. By using a conventional GST-pull down assay combined with co-immunoprecipitation and Fluorescence Resonance Energy Transfer (FRET) analyses, we provide evidence of a physical interaction between FoxO1 and HMGA1. Further investigation with chromatin immunoprecipitation, confocal microscopy, and Fluorescence Recovery After Photobleaching (FRAP) technology indicated a functional significance of this interaction, in both basal and insulin-stimulated states, providing evidence that, by modulating FoxO1 transactivation, HMGA1 is essential for FoxO1-induced IGFBP1 gene expression, and thereby a critical modulator of insulin-mediated FoxO1 regulation in the liver. Collectively, our findings highlight a novel FoxO1/HMGA1-mediated mechanism by which insulin may regulate gene expression and metabolism.
CD147 promotes the formation of functional osteoclasts through NFATc1 signalling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishioku, Tsuyoshi, E-mail: nishiokut@niu.ac.jp; Department of Pharmaceutical Care and Health Sciences, Faculty of Pharmaceutical Sciences, Fukuoka University, 8-19-1 Nanakuma, Jonan-ku, Fukuoka 814-0180; Terasawa, Mariko
CD147, a membrane glycoprotein of the immunoglobulin superfamily, is highly upregulated during dynamic cellular events including tissue remodelling. Elevated CD147 expression is present in the joint of rheumatoid arthritis patients. However, the role of CD147 in bone destruction remains unclear. To determine whether CD147 is involved in osteoclastogenesis, we studied its expression in mouse osteoclasts and its role in osteoclast differentiation and function. CD147 expression was markedly upregulated during osteoclast differentiation. To investigate the role of CD147 in receptor activator of nuclear factor-kappa B ligand (RANKL)-induced osteoclastogenesis and bone resorption activity, osteoclast precursor cells were transfected with CD147 siRNA. Decreasedmore » CD147 expression inhibited osteoclast formation and bone resorption, inhibited RANKL-induced nuclear translocation of the nuclear factor of activated T cells (NFAT) c1 and decreased the expression of the d2 isoform of vacuolar ATPase Vo domain and cathepsin K. Therefore, CD147 plays a critical role in the differentiation and function of osteoclasts by upregulating NFATc1 through the autoamplification of its expression in osteoclastogenesis. - Highlights: • CD147 expression was markedly upregulated during osteoclast differentiation. • Downregulation of CD147 expression inhibited osteoclastgenesis and bone resorption. • Decreased CD147 expression inhibited RANKL-induced nuclear translocation of NFATc1.« less
Subramanian, Gayathri; Chaudhury, Pulkit; Malu, Krishnakumar; Fowler, Samantha; Manmode, Rahul; Gotur, Deepali; Zwerger, Monika; Ryan, David; Roberti, Rita; Gaines, Peter
2012-01-01
Lamin B receptor (LBR) is a bifunctional nuclear membrane protein with N-terminal lamin B and chromatin-binding domains plus a C-terminal sterol Δ(14) reductase domain. LBR expression increases during neutrophil differentiation, and deficient expression disrupts neutrophil nuclear lobulation characteristic of Pelger-Huët anomaly. Thus, LBR plays a critical role in regulating myeloid differentiation, but how the two functional domains of LBR support this role is currently unclear. We previously identified abnormal proliferation and deficient functional maturation of promyelocytes (erythroid, myeloid, and lymphoid [EML]-derived promyelocytes) derived from EML-ic/ic cells, a myeloid model of ichthyosis (ic) bone marrow that lacks Lbr expression. In this study, we provide new evidence that cholesterol biosynthesis is important to myeloid cell growth and is supported by the sterol reductase domain of Lbr. Cholesterol biosynthesis inhibitors caused growth inhibition of EML cells that increased in EML-derived promyelocytes, whereas cells lacking Lbr exhibited complete growth arrest at both stages. Lipid production increased during wild-type neutrophil maturation, but ic/ic cells exhibited deficient levels of lipid and cholesterol production. Ectopic expression of a full-length Lbr in EML-ic/ic cells rescued both nuclear lobulation and growth arrest in cholesterol starvation conditions. Lipid production also was rescued, and a deficient respiratory burst was corrected. Expression of just the C-terminal sterol reductase domain of Lbr in ic/ic cells also improved each of these phenotypes. Our data support the conclusion that the sterol Δ(14) reductase domain of LBR plays a critical role in cholesterol biosynthesis and that this process is essential to both myeloid cell growth and functional maturation.
Subramanian, Gayathri; Chaudhury, Pulkit; Malu, Krishnakumar; Fowler, Samantha; Manmode, Rahul; Gotur, Deepali; Zwerger, Monika; Ryan, David; Roberti, Rita; Gaines, Peter
2011-01-01
Lamin B receptor (LBR) is a bifunctional nuclear membrane protein with N-terminal lamin B and chromatin binding domains plus a C-terminal sterol Δ14 reductase domain. LBR expression increases during neutrophil differentiation and deficient expression disrupts neutrophil nuclear lobulation characteristic of Pelger-Huët anomaly. Thus LBR plays a critical role in regulating myeloid differentiation, but how the two functional domains of LBR support this role is currently unclear. We previously identified abnormal proliferation and deficient functional maturation of promyelocytes (EPRO cells) derived from EML-ic/ic cells, a myeloid model of ichthyosis (ic) bone marrow that lacks Lbr expression. Here we provide new evidence that cholesterol biosynthesis is important to myeloid cell growth and is supported by the sterol reductase domain of Lbr. Cholesterol biosynthesis inhibitors caused growth inhibition of EML cells that increased in EPRO cells, whereas cells lacking Lbr exhibited complete growth arrest at both stages. Lipid production increased during wild-type neutrophil maturation, but ic/ic cells exhibited deficient levels of lipid and cholesterol production. Ectopic expression of a full length Lbr in EML-ic/ic cells rescued both nuclear lobulation and growth arrest in cholesterol starvation conditions. Lipid production also was rescued, and a deficient respiratory burst was corrected. Expression of just the C-terminal sterol reductase domain of Lbr in ic/ic cells also improved each of these phenotypes. Our data support the conclusion that the sterol Δ14 reductase domain of LBR plays a critical role in cholesterol biosynthesis, and that this process is essential to both myeloid cell growth and functional maturation. PMID:22140257
Nuclear receptors (NRs) are important biological macromolecular transcription factors that are implicated in multiple biological pathways and may interact with other xenobiotics that are endocrine disruptors present in the environment. Examples of important NRs include the androg...
ROR nuclear receptors: structures, related diseases, and drug discovery
Zhang, Yan; Luo, Xiao-yu; Wu, Dong-hai; Xu, Yong
2015-01-01
Nuclear receptors (NRs) are ligand-regulated transcription factors that regulate metabolism, development and immunity. The NR superfamily is one of the major classes of drug targets for human diseases. Retinoic acid receptor-related orphan receptor (ROR) α, β and γ belong to the NR superfamily, and these receptors are still considered as 'orphan' receptors because the identification of their endogenous ligands has been controversial. Recent studies have demonstrated that these receptors are regulated by synthetic ligands, thus emerge as important drug targets for the treatment of multiple sclerosis, rheumatoid arthritis, psoriasis, etc. Studying the structural basis and ligand development of RORs will pave the way for a better understanding of the roles of these receptors in human diseases. Here, we review the structural basis, disease relevance, strategies for ligand identification, and current status of development of therapeutic ligands for RORs. PMID:25500868
Effect of propofol on androgen receptor activity in prostate cancer cells.
Tatsumi, Kenichiro; Hirotsu, Akiko; Daijo, Hiroki; Matsuyama, Tomonori; Terada, Naoki; Tanaka, Tomoharu
2017-08-15
Androgen receptor is a nuclear receptor and transcription factor activated by androgenic hormones. Androgen receptor activity plays a pivotal role in the development and progression of prostate cancer. Although accumulating evidence suggests that general anesthetics, including opioids, affect cancer cell growth and impact patient prognosis, the effect of those drugs on androgen receptor in prostate cancer is not clear. The purpose of this study was to investigate the effect of the general anesthetic propofol on androgen receptor activity in prostate cancer cells. An androgen-dependent human prostate cancer cell line (LNCaP) was stimulated with dihydrotestosterone (DHT) and exposed to propofol. The induction of androgen receptor target genes was investigated using real-time reverse transcription polymerase chain reaction, and androgen receptor protein levels and localization patterns were analyzed using immunoblotting and immunofluorescence assays. The effect of propofol on the proliferation of LNCaP cells was analyzed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays. Propofol significantly inhibited DHT-induced expression of androgen receptor target genes in a dose- and time-dependent manner, and immunoblotting and immunofluorescence assays indicated that propofol suppressed nuclear levels of androgen receptor proteins. Exposure to propofol for 24h suppressed the proliferation of LNCaP cells, whereas 4h of exposure did not exert significant effects. Together, our results indicate that propofol suppresses nuclear androgen receptor protein levels, and inhibits androgen receptor transcriptional activity and proliferation in LNCaP cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Identification of ligands for DAF-12 that govern dauer formation and reproduction in C. elegans.
Motola, Daniel L; Cummins, Carolyn L; Rottiers, Veerle; Sharma, Kamalesh K; Li, Tingting; Li, Yong; Suino-Powell, Kelly; Xu, H Eric; Auchus, Richard J; Antebi, Adam; Mangelsdorf, David J
2006-03-24
In response to environmental and dietary cues, the C. elegans orphan nuclear receptor, DAF-12, regulates dauer diapause, reproductive development, fat metabolism, and life span. Despite strong evidence for hormonal control, the identification of the DAF-12 ligand has remained elusive. In this work, we identified two distinct 3-keto-cholestenoic acid metabolites of DAF-9, a cytochrome P450 involved in hormone production, that function as ligands for DAF-12. At nanomolar concentrations, these steroidal ligands (called dafachronic acids) bind and transactivate DAF-12 and rescue the hormone deficiency of daf-9 mutants. Interestingly, DAF-9 has a biochemical activity similar to mammalian CYP27A1 catalyzing addition of a terminal acid to the side chain of sterol metabolites. Together, these results define the first steroid hormones in nematodes as ligands for an invertebrate orphan nuclear receptor and demonstrate that steroidal regulation of reproduction, from biology to molecular mechanism, is conserved from worms to humans.
The signaling phospholipid PIP 3 creates a new interaction surface on the nuclear receptor SF-1
Blind, Raymond D.; Sablin, Elena P.; Kuchenbecker, Kristopher M.; ...
2014-10-06
We previously reported that lipids PI(4,5)P 2 (PIP 2) and PI(3,4,5)P 3 (PIP 3) bind NR5A nuclear receptors to regulate their activity. Here, the crystal structures of PIP 2 and PIP 3 bound to NR5A1 (SF-1) define a new interaction surface that is organized by the solvent-exposed PIPn headgroups. We find that stabilization by the PIP 3 ligand propagates a signal that increases coactivator recruitment to SF-1, consistent with our earlier work showing that PIP 3 increases SF-1 activity. This newly created surface harbors a cluster of human mutations that lead to endocrine disorders, thus explaining how these puzzling mutationsmore » cripple SF-1 activity. Finally, we propose that this new surface acts as a PIP 3-regulated interface between SF-1 and coregulatory proteins, analogous to the function of membrane-bound phosphoinositides.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Won Il; Park, Min Jung; An, Jin Kwang
2008-05-02
Bile reflux is considered to be one of the most important causative factors in gastric carcinogenesis, due to the attendant inflammatory changes in the gastric mucosa. In this study, we have assessed the molecular mechanisms inherent to the contribution of bile acid to the transcriptional regulation of inflammatory-related genes. In this study, we demonstrated that bile acid induced the expression of the SHP orphan nuclear receptor at the transcriptional level via c-Jun activation. Bile acid also enhanced the protein interaction of NF-{kappa}B and SHP, thereby resulting in an increase in c-Jun expression and the production of the inflammatory cytokine, TNF{alpha}.more » These results indicate that bile acid performs a critical function in the regulation of the induction of inflammatory-related genes in gastric cells, and that bile acid-mediated gene expression provides a pre-clue for the development of gastric cellular malformation.« less
Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi
2012-11-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.
Volpon, Laurent; Culjkovic-Kraljacic, Biljana; Sohn, Hye Seon; Blanchet-Cohen, Alexis; Osborne, Michael J; Borden, Katherine L B
2017-06-01
The eukaryotic translation initiation factor eIF4E acts in the nuclear export and translation of a subset of mRNAs. Both of these functions contribute to its oncogenic potential. While the biochemical mechanisms that underlie translation are relatively well understood, the molecular basis for eIF4E's role in mRNA export remains largely unexplored. To date, over 3000 transcripts, many encoding oncoproteins, were identified as potential nuclear eIF4E export targets. These target RNAs typically contain a ∼50-nucleotide eIF4E sensitivity element (4ESE) in the 3' UTR and a 7-methylguanosine cap on the 5' end. While eIF4E associates with the cap, an unknown factor recognizes the 4ESE element. We previously identified cofactors that functionally interacted with eIF4E in mammalian cell nuclei including the leucine-rich pentatricopeptide repeat protein LRPPRC and the export receptor CRM1/XPO1. LRPPRC simultaneously interacts with both eIF4E bound to the 5' mRNA cap and the 4ESE element in the 3' UTR. In this way, LRPPRC serves as a specificity factor to recruit 4ESE-containing RNAs within the nucleus. Further, we show that CRM1 directly binds LRPPRC likely acting as the export receptor for the LRPPRC-eIF4E-4ESE RNA complex. We also found that Importin 8, the nuclear importer for cap-free eIF4E, imports RNA-free LRPPRC, potentially providing both coordinated nuclear recycling of the export machinery and an important surveillance mechanism to prevent futile export cycles. Our studies provide the first biochemical framework for the eIF4E-dependent mRNA export pathway. © 2017 Volpon et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Singh, Narendra P.; Singh, Udai P.; Nagarkatti, Prakash S.
2012-01-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions. PMID:22888145
Guerard, Marie; Robin, Thomas; Perron, Pascal; Hatat, Anne-Sophie; David-Boudet, Laurence; Vanwonterghem, Laetitia; Busser, Benoit; Coll, Jean-Luc; Lantuejoul, Sylvie; Eymin, Beatrice; Hurbin, Amandine; Gazzeri, Sylvie
2018-04-28
Many Receptor Tyrosine Kinases translocate from the cell surface to the nucleus in normal and pathological conditions, including cancer. Here we report the nuclear expression of insulin-like growth factor-1 receptor (IGF1R) in primary human lung tumours. Using lung cancer cell lines and lung tumour xenografts, we demonstrate that the epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) gefitinib induces the nuclear accumulation of IGF1R in mucinous lung adenocarcinoma by a mechanism involving the intracellular re-localization of the growth factor amphiregulin. Amphiregulin allows the binding of IGF1R to importin-β1 and promotes its nuclear transport. The nuclear accumulation of IGF1R by amphiregulin induces cell cycle arrest through p21 WAF1/CIP1 upregulation, and prevents the induction of apoptosis in response to gefitinib. These results identify amphiregulin as the first nuclear localization signal-containing protein that interacts with IGF1R and allows its nuclear translocation. Furthermore they indicate that nuclear expression of IGF1R contributes to EGFR-TKI resistance in lung cancer. Copyright © 2018 Elsevier B.V. All rights reserved.
Kok, Tineke; Wolters, Henk; Bloks, Vincent W; Havinga, Rick; Jansen, Peter L M; Staels, Bart; Kuipers, Folkert
2003-01-01
Fatty acids are natural ligands of the peroxisome proliferator-activated receptor alpha (PPARalpha). Synthetic ligands of this nuclear receptor, i.e., fibrates, induce the hepatic expression of the multidrug resistance 2 gene (Mdr2), encoding the canalicular phospholipid translocator, and affect hepatobiliary lipid transport. We tested whether fasting-associated fatty acid release from adipose tissues alters hepatic transporter expression and bile formation in a PPARalpha-dependent manner. A 24-hour fasting/48-hour refeeding schedule was used in wild-type and Pparalpha((-/-)) mice. Expression of genes involved in the control of bile formation was determined and related to secretion rates of biliary components. Expression of Pparalpha, farnesoid X receptor, and liver X receptor alpha genes encoding nuclear receptors that control hepatic bile salt and sterol metabolism was induced on fasting in wild-type mice only. The expression of Mdr2 was 5-fold increased in fasted wild-type mice and increased only marginally in Pparalpha((-/-)) mice, and it normalized on refeeding. Mdr2 protein levels and maximal biliary phospholipid secretion rates were clearly increased in fasted wild-type mice. Hepatic expression of the liver X receptor target genes ATP binding cassette transporter a1 (Abca1), Abcg5, and Abcg8, implicated in hepatobiliary cholesterol transport, was induced in fasted wild-type mice only. However, the maximal biliary cholesterol secretion rate was reduced by approximately 50%. Induction of Mdr2 expression and function is part of the PPARalpha-mediated fasting response in mice. Fasting also induces expression of the putative hepatobiliary cholesterol transport genes Abca1, Abcg5, and Abcg8, but, nonetheless, maximal biliary cholesterol excretion is decreased after fasting.
PGC-1α dictates endothelial function through regulation of eNOS expression
Craige, Siobhan M.; Kröller-Schön, Swenja; Li, Chunying; Kant, Shashi; Cai, Shenghe; Chen, Kai; Contractor, Mayur M.; Pei, Yongmei; Schulz, Eberhard; Keaney, John F.
2016-01-01
Endothelial dysfunction is a characteristic of many vascular related diseases such as hypertension. Peroxisome proliferator activated receptor gamma, coactivator 1α (PGC-1α) is a unique stress sensor that largely acts to promote adaptive responses. Therefore, we sought to define the role of endothelial PGC-1α in vascular function using mice with endothelial specific loss of function (PGC-1α EC KO) and endothelial specific gain of function (PGC-1α EC TG). Here we report that endothelial PGC-1α is suppressed in angiotensin-II (ATII)-induced hypertension. Deletion of endothelial PGC-1α sensitized mice to endothelial dysfunction and hypertension in response to ATII, whereas PGC-1α EC TG mice were protected. Mechanistically, PGC-1α promotes eNOS expression and activity, which is necessary for protection from ATII-induced dysfunction as mice either treated with an eNOS inhibitor (LNAME) or lacking eNOS were no longer responsive to transgenic endothelial PGC-1α expression. Finally, we determined that the orphan nuclear receptor, estrogen related receptor α (ERRα) is required to coordinate the PGC-1α -induced eNOS expression. In conclusion, endothelial PGC-1α expression protects from vascular dysfunction by promoting NO• bioactivity through ERRα induced expression of eNOS. PMID:27910955
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deng, Hua; Lin, Yingbo; Badin, Margherita
2011-01-14
Research highlights: {yields} SUMOylation mediates nuclear translocation of IGF-1R which activates transcription. {yields} Here we show that nuclear IGF-1R over-accumulates in tumor cells. {yields} This requires overexpression of the receptor that is a common feature in tumor cells. {yields} An increased expression of the SUMO ligase Ubc9 seems to be an involved mechanism too. -- Abstract: The insulin-like growth factor 1 receptor (IGF-1R) plays crucial roles in tumor cell growth and is overexpressed in many cancers. IGF-1R's trans-membrane kinase signaling pathways have been well characterized. Very recently, we showed that SUMOylation mediates nuclear translocation of the IGF-1R, and that nuclearmore » IGF-1R (nIGF-1R) binds to enhancer regions and activates transcription. We identified three lysine residues in the {beta}-subunit of the receptor and that mutation of these blocks nuclear translocation and gene activation. Furthermore, accumulation of nIGF-1R was proven strongly dependent on the specific SUMO-conjugating enzyme Ubc9. Here we show that nIGF-1R originates solely from the cell membrane and that phosphorylation of the core tyrosine residues of the receptor kinase is crucial for nuclear accumulation. We also compared the levels of nIGF-1R, measured as nuclear/membrane ratios, in tumor and normal cells. We found that the breast cancer cell line MCF-7 has 13-fold higher amounts of nIGF-1R than breast epithelial cells (IME) which showed only a small amount of nIGF-1R. In comparison, the total expression of IGF-1R was only 3.7- higher in MCF-7. Comparison of several other tumor and normal cell lines showed similar tumor cell over-accumulation of nIGF-1R, exceeding the total receptor expression substantially. Ectopic overexpression (>10-fold) of the receptor increased nIGF-1R in IME cells but not to that high level as in wild type MCF-7. The levels of Ubc9 were higher in all tumor cell lines, compared to the normal cells, and this probably contributes to over-accumulation of nIGF-1R. Over-accumulation of nIGF-1R may contribute to deregulated gene expression and therewith play a pathophysiological role in cancer cells.« less
Differential hydrogen/deuterium exchange mass spectrometry analysis of protein–ligand interactions
Chalmers, Michael J; Busby, Scott A; Pascal, Bruce D; West, Graham M; Griffin, Patrick R
2011-01-01
Functional regulation of ligand-activated receptors is driven by alterations in the conformational dynamics of the protein upon ligand binding. Differential hydrogen/deuterium exchange (HDX) coupled with mass spectrometry has emerged as a rapid and sensitive approach for characterization of perturbations in conformational dynamics of proteins following ligand binding. While this technique is sensitive to detecting ligand interactions and alterations in receptor dynamics, it also can provide important mechanistic insights into ligand regulation. For example, HDX has been used to determine a novel mechanism of ligand activation of the nuclear receptor peroxisome proliferator activated receptor-γ, perform detailed analyses of binding modes of ligands within the ligand-binding pocket of two estrogen receptor isoforms, providing insight into selectivity, and helped classify different types of estrogen receptor-α ligands by correlating their pharmacology with the way they interact with the receptor based solely on hierarchical clustering of receptor HDX signatures. Beyond small-molecule–receptor interactions, this technique has also been applied to study protein–protein complexes, such as mapping antibody–antigen interactions. In this article, we summarize the current state of the differential HDX approaches and the future outlook. We summarize how HDX analysis of protein–ligand interactions has had an impact on biology and drug discovery. PMID:21329427
Nuclear receptors in pancreatic tumor cells.
Damaskos, Christos; Garmpis, Nikolaos; Karatzas, Theodore; Kostakis, Ioannis D; Nikolidakis, Lampros; Kostakis, Alkiviadis; Kouraklis, Gregory
2014-12-01
This review focuses on nuclear receptors expressed in pancreatic cancer. An extensive search of articles published up to March 2013 was conducted using the MEDLINE database. The key words used were "pancreatic cancer", "molecular receptors" and "growth factors". A total of 112 articles referred to pancreatic cancer, molecular receptors and/or growth factors were included. Receptors of growth factors, such as the epithelial growth factor receptor, insulin-like growth factor-1 receptor, vascular endothelial growth factor receptor and others, such as integrin α5β1, somatostatin receptors, the death receptor 5, claudin, notch receptors, mesothelin receptors, follicle-stimulating hormone receptors, the MUC1 receptor, the adrenomedullin receptor, the farnesoid X receptor, the transferrin receptor, sigma-2 receptors, the chemokine receptor CXCR4, the urokinase plasminogen activator receptor, the ephrine A2 receptor, the GRIA3 receptor, the RON receptor and the angiotensin II receptor AT-1 are expressed in pancreatic tumor cells. These molecules are implicated in tumor growth, apoptosis, angiogenesis, metastasis etc. After identifying the molecular receptors associated with the pancreatic cancer, many more target molecules playing important roles in tumor pathophysiology and senescence-associated signal transduction in cancer cells will be identified. This may have a significant influence on diagnosis, therapy and prognosis of pancreatic cancer. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Thyroid hormone and COUP-TF1 regulate kallikrein-binding protein (KBP) gene expression.
Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen; Brent, Gregory A
2011-03-01
Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T(3) and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5' flanking region (-53 to -29) and nTRE2, located in the first intron (104-132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T(3). COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T(3) repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T(3). Nuclear corepressor knockdown resulted in loss of T(3) repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T(3) induction of positive thyroid hormone response elements, reverses T(3) repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T(3) and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T(3).
Thyroid Hormone and COUP-TF1 Regulate Kallikrein-Binding Protein (KBP) Gene Expression
Liu, Yan-Yun; Nakatani, Teruyo; Kogai, Takahiko; Mody, Kaizeen
2011-01-01
Kallikrein-binding protein (KBP) is a component of the kallikrein-kinin system that mediates vasodilation and inhibits tumor growth by antagonizing vascular endothelial growth factor-mediated angiogenesis. We demonstrate that KBP gene expression is repressed by T3 and modulated by the orphan nuclear receptor, chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1). In hypothyroid mice, KBP mRNA expression in the testis was increased 2.1-fold compared with euthyroid mice. We have identified two negative thyroid hormone response elements (nTREs) in the mouse KBP gene, nTRE1 located in the 5′ flanking region (−53 to −29) and nTRE2, located in the first intron (104–132). We used functional assays, cofactor knockdown, and chromatin immunoprecipitation assays to characterize nTRE1 and nTRE2 in hepatic (HepG2) and testes (GC-1spg) cell lines. Reporter expression directed by both elements was enhanced with addition of thyroid hormone receptor and repressed with the addition of T3. COUP-TF1 enhanced basal expression of both elements but blunted unliganded thyroid hormone receptor enhancement and T3 repression of nTRE1 but not nTRE2. Both nTREs bound nuclear corepressor and binding increased in response to T3. Nuclear corepressor knockdown resulted in loss of T3 repression of both nTRE1 and nTRE2. COUP-TF1, which usually represses T3 induction of positive thyroid hormone response elements, reverses T3 repression mediated by nTRE1 in the mouse KBP gene. Endogenous KBP expression is repressed by T3 and two functional nTREs, both of which are required, have been characterized in the KBP gene. COUP-TF1 may be an important factor to modulate expression of genes that are repressed by T3. PMID:21266512
Nuclear Receptor SHP Activates miR-206 Expression via a Cascade Dual Inhibitory Mechanism
Song, Guisheng; Wang, Li
2009-01-01
MicroRNAs play a critical role in many essential cellular functions in the mammalian species. However, limited information is available regarding the regulation of miRNAs gene transcription. Microarray profiling and real-time PCR analysis revealed a marked down-regulation of miR-206 in nuclear receptor SHP−/− mice. To understand the regulatory function of SHP with regard to miR-206 gene expression, we determined the putative transcriptional initiation site of miR-206 and also its full length primary transcript using a database mining approach and RACE. We identified the transcription factor AP1 binding sites on the miR-206 promoter and further showed that AP1 (c-Jun and c-Fos) induced miR-206 promoter transactivity and expression which was repressed by YY1. ChIP analysis confirmed the physical association of AP1 (c-Jun) and YY1 with the endogenous miR-206 promoter. In addition, we also identified nuclear receptor ERRγ (NR3B3) binding site on the YY1 promoter and showed that YY1 promoter was transactivated by ERRγ, which was inhibited by SHP (NROB2). ChIP analysis confirmed the ERRγ binding to the YY1 promoter. Forced expression of SHP and AP1 induced miR-206 expression while overexpression of ERRγ and YY1 reduced its expression. The effects of AP1, ERRγ, and YY1 on miR-206 expression were reversed by siRNA knockdown of each gene, respectively. Thus, we propose a novel cascade “dual inhibitory” mechanism governing miR-206 gene transcription by SHP: SHP inhibition of ERRγ led to decreased YY1 expression and the de-repression of YY1 on AP1 activity, ultimately leading to the activation of miR-206. This is the first report to elucidate a cascade regulatory mechanism governing miRNAs gene transcription. PMID:19721712
Priya, Anusha; Johar, Kaid; Wong-Riley, Margaret T T
2013-01-01
Neuronal activity and energy metabolism are tightly coupled processes. Previously, we found that nuclear respiratory factor 1 (NRF-1) transcriptionally co-regulates energy metabolism and neuronal activity by regulating all 13 subunits of the critical energy generating enzyme, cytochrome c oxidase (COX), as well as N-methyl-d-aspartate (NMDA) receptor subunits 1 and 2B, GluN1 (Grin1) and GluN2B (Grin2b). We also found that another transcription factor, nuclear respiratory factor 2 (NRF-2 or GA-binding protein) regulates all subunits of COX as well. The goal of the present study was to test our hypothesis that NRF-2 also regulates specific subunits of NMDA receptors, and that it functions with NRF-1 via one of three mechanisms: complementary, concurrent and parallel, or a combination of complementary and concurrent/parallel. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation of mouse neuroblastoma cells and rat visual cortical tissue, promoter mutations, real-time quantitative PCR, and western blot analysis, NRF-2 was found to functionally regulate Grin1 and Grin2b genes, but not any other NMDA subunit genes. Grin1 and Grin2b transcripts were up-regulated by depolarizing KCl, but silencing of NRF-2 prevented this up-regulation. On the other hand, over-expression of NRF-2 rescued the down-regulation of these subunits by the impulse blocker TTX. NRF-2 binding sites on Grin1 and Grin2b are conserved among species. Our data indicate that NRF-2 and NRF-1 operate in a concurrent and parallel manner in mediating the tight coupling between energy metabolism and neuronal activity at the molecular level. Copyright © 2012 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takata, Akemi; Otsuka, Motoyuki, E-mail: otsukamo-tky@umin.ac.jp; Kojima, Kentaro
2011-08-12
Highlights: {yields} miRNAs were screened for their ability to regulate NF-{kappa}B activity. {yields} miRNA-22 and miRNA-140-3p suppress NF-{kappa}B activity by regulating coactivators. {yields} miRNA-22 targets nuclear receptor coactivator 1 (NCOA1). {yields} miRNA-140-3p targets nuclear receptor-interacting protein 1 (NRIP1). -- Abstract: Nuclear factor {kappa}B (NF-{kappa}B) is a transcription factor that regulates a set of genes that are critical to many biological phenomena, including liver tumorigenesis. To identify microRNAs (miRNAs) that regulate NF-{kappa}B activity in the liver, we screened 60 miRNAs expressed in hepatocytes for their ability to modulate NF-{kappa}B activity. We found that miRNA-22 and miRNA-140-3p significantly suppressed NF-{kappa}B activity bymore » regulating the expression of nuclear receptor coactivator 1 (NCOA1) and nuclear receptor-interacting protein 1 (NRIP1), both of which are NF-{kappa}B coactivators. Our results provide new information about the roles of miRNAs in the regulation of NF-{kappa}B activity.« less
A structural perspective on nuclear receptors as targets of environmental compounds
Delfosse, Vanessa; Maire, Albane le; Balaguer, Patrick; Bourguet, William
2015-01-01
Nuclear receptors (NRs) are members of a large superfamily of evolutionarily related transcription factors that control a plethora of biological processes. NRs orchestrate complex events such as development, organ homeostasis, metabolism, immune function, and reproduction. Approximately one-half of the 48 human NRs have been shown to act as ligand-regulated transcription factors and respond directly to a large variety of endogenous hormones and metabolites that are generally hydrophobic and small in size (eg, retinoic acid or estradiol). The second half of the NR family comprises the so-called orphan receptors, for which regulatory ligands are still unknown or may not exist despite the presence of a C-terminal ligand-binding domain, which is the hallmark of all NRs. Several chemicals released into the environment (eg, bisphenols, phthalates, parabens, etc) share some physicochemical properties with natural ligands, allowing them to bind to NRs and activate or inhibit their action. Collectively referred to as endocrine disruptors or endocrine-disrupting chemicals (EDCs), these environmental pollutants are highly suspected to cause a wide range of developmental, reproductive, neurological, or metabolic defects in humans and wildlife. Crystallographic studies are revealing unanticipated mechanisms by which chemically diverse EDCs interact with the ligand-binding domain of NRs. These studies thereby provide a rational basis for designing novel chemicals with lower impacts on human and animal health. In this review, we provide a structural and mechanistic view of endocrine disrupting action using estrogen receptors α and β, (ERα/β), peroxisome proliferator activated receptor γ (PPARγ), and their respective environmental ligands as representative examples. PMID:25500867
Aberrant localization of lamin B receptor (LBR) in cellular senescence in human cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arai, Rumi; En, Atsuki; Ukekawa, Ryo
2016-05-13
5-Bromodeoxyuridine (BrdU), a thymidine analogue, induces cellular senescence in mammalian cells. BrdU induces cellular senescence probably through the regulation of chromatin because BrdU destabilizes or disrupts nucleosome positioning and decondenses heterochromatin. Since heterochromatin is tethered to the nuclear periphery through the interaction with the nuclear envelope proteins, we examined the localization of the several nuclear envelope proteins such as lamins, lamin-interacting proteins, nuclear pore complex proteins, and nuclear transport proteins in senescent cells. We have shown here that lamin B receptor (LBR) showed a change in localization in both BrdU-induced and replicative senescent cells.
Nuclear receptors (NRs) are ligand-activated transcription factors that control diverse cellular processes. Chronic stimulation of some NRs in rodents can result in increased incidence of liver tumors. These are generally thought to develop through a non-genotoxic mechanism with...
SMILE upregulated by metformin inhibits the function of androgen receptor in prostate cancer cells.
Lee, Seung-Yon; Song, Chin-Hee; Xie, Yuan-Bin; Jung, Chaeyong; Choi, Hueng-Sik; Lee, Keesook
2014-11-28
Metformin, a diabetes drug, has been reported to inhibit the growth of prostate cancer cells. In this study, we investigated the effect and action mechanism of metformin on the function of androgen receptor (AR), a key molecule in the proliferation of prostate cancer cells. Metformin was found to reduce androgen-dependent cell growth and the expression of AR target genes by inhibiting AR function in prostate cancer cells such as LNCaP and C4-2 cells. Interestingly, metformin upregulated the protein level of small heterodimer partner-interacting leucine zipper (SMILE), a coregulator of nuclear receptors, and knockdown of SMILE expression with shRNA abolished the inhibitory effect of metformin on AR function. Further studies revealed that SMILE protein itself suppressed the transactivation of AR, and its ectopic expression resulted in the repressed expression of endogenous AR target genes, PSA and NKX3.1, in LNCaP cells. In addition, SMILE protein physically interacted with AR and competed with the AR coactivator SRC-1 to modulate AR transactivation. As expected, SMILE repressed androgen-dependent growth of LNCaP and C4-2 cells. Taken together, these results suggest that SMILE, which is induced by metformin, functions as a novel AR corepressor and may mediate the inhibitory effect of metformin on androgen-dependent growth of prostate cancer cells. Copyright © 2014. Published by Elsevier Ireland Ltd.
Cian, Raúl E.; Drago, Silvina R.; Sánchez de Medina, Fermín; Martínez-Augustin, Olga
2015-01-01
Based on their composition, marine algae, and namely red seaweeds, are good potential functional foods. Intestinal mucosal barrier function refers to the capacity of the intestine to provide adequate containment of luminal microorganisms and molecules. Here, we will first outline the component of seaweeds and will summarize the effects of these on the regulation of mucosal barrier function. Special attention will be paid to unique components of red seaweeds: proteins and derived peptides (e.g., phycobiliproteins, glycoproteins that contain “cellulose binding domains”, phycolectins and the related mycosporine-like amino acids) together with polysaccharides (e.g., floridean starch and sulfated galactans, such as carrageenans, agarans and “dl-hybrid”) and minerals. These compounds have been shown to exert prebiotic effects, to regulate intestinal epithelial cell, macrophage and lymphocyte proliferation and differentiation and to modulate the immune response. Molecular mechanisms of action of peptides and polysaccharides are starting to be elucidated, and evidence indicating the involvement of epidermal growth factor receptor (EGFR), insulin-like growth factor receptor (IGFR), Toll-like receptors (TLR) and signal transduction pathways mediated by protein kinase B (PKB or AKT), nuclear factor-κB (NF-κB) and mitogen activated protein kinases (MAPK) will also be summarized. The need for further research is clear, but in vivo experiments point to an overall antiinflammatory effect of these algae, indicating that they can reinforce membrane barrier function. PMID:26308006
Cian, Raúl E; Drago, Silvina R; de Medina, Fermín Sánchez; Martínez-Augustin, Olga
2015-08-20
Based on their composition, marine algae, and namely red seaweeds, are good potential functional foods. Intestinal mucosal barrier function refers to the capacity of the intestine to provide adequate containment of luminal microorganisms and molecules. Here, we will first outline the component of seaweeds and will summarize the effects of these on the regulation of mucosal barrier function. Special attention will be paid to unique components of red seaweeds: proteins and derived peptides (e.g., phycobiliproteins, glycoproteins that contain "cellulose binding domains", phycolectins and the related mycosporine-like amino acids) together with polysaccharides (e.g., floridean starch and sulfated galactans, such as carrageenans, agarans and "dl-hybrid") and minerals. These compounds have been shown to exert prebiotic effects, to regulate intestinal epithelial cell, macrophage and lymphocyte proliferation and differentiation and to modulate the immune response. Molecular mechanisms of action of peptides and polysaccharides are starting to be elucidated, and evidence indicating the involvement of epidermal growth factor receptor (EGFR), insulin-like growth factor receptor (IGFR), Toll-like receptors (TLR) and signal transduction pathways mediated by protein kinase B (PKB or AKT), nuclear factor-κB (NF-κB) and mitogen activated protein kinases (MAPK) will also be summarized. The need for further research is clear, but in vivo experiments point to an overall antiinflammatory effect of these algae, indicating that they can reinforce membrane barrier function.
The roles of bile acids and sphingosine-1-phosphate signaling in the hepatobiliary diseases
Nagahashi, Masayuki; Yuza, Kizuki; Hirose, Yuki; Nakajima, Masato; Ramanathan, Rajesh; Hait, Nitai C.; Hylemon, Phillip B.; Zhou, Huiping; Takabe, Kazuaki; Wakai, Toshifumi
2016-01-01
Based on research carried out over the last decade, it has become increasingly evident that bile acids act not only as detergents, but also as important signaling molecules that exert various biological effects via activation of specific nuclear receptors and cell signaling pathways. Bile acids also regulate the expression of numerous genes encoding enzymes and proteins involved in the synthesis and metabolism of bile acids, glucose, fatty acids, and lipoproteins, as well as energy metabolism. Receptors activated by bile acids include, farnesoid X receptor α, pregnane X receptor, vitamin D receptor, and G protein-coupled receptors, TGR5, muscarinic receptor 2, and sphingosine-1-phosphate receptor (S1PR)2. The ligand of S1PR2, sphingosine-1-phosphate (S1P), is a bioactive lipid mediator that regulates various physiological and pathophysiological cellular processes. We have recently reported that conjugated bile acids, via S1PR2, activate and upregulate nuclear sphingosine kinase 2, increase nuclear S1P, and induce genes encoding enzymes and transporters involved in lipid and sterol metabolism in the liver. Here, we discuss the role of bile acids and S1P signaling in the regulation of hepatic lipid metabolism and in hepatobiliary diseases. PMID:27459945
Casa, Angelo J; Hochbaum, Daniel; Sreekumar, Sreeja; Oesterreich, Steffi; Lee, Adrian V
2015-11-05
Fulvestrant, a selective estrogen receptor down-regulator (SERD) is a pure competitive antagonist of estrogen receptor alpha (ERα). Fulvestrant binds ERα and reduces the receptor's half-life by increasing protein turnover, however, its mechanism of action is not fully understood. In this study, we show that removal of the ERα nuclear localization sequence (ERΔNLS) resulted in a predominantly cytoplasmic ERα that was degraded in response to 17-β-estradiol (E2) but was resistant to degradation by fulvestrant. ERΔNLS bound the ligands and exhibited receptor interaction similar to ERα, indicating that the lack of degradation was not due to disruption of these processes. Forcing ERΔNLS into the nucleus with a heterologous SV40-NLS did not restore degradation, suggesting that the NLS domain itself, and not merely receptor localization, is critical for fulvestrant-induced ERα degradation. Indeed, cloning of the endogenous ERα NLS onto the N-terminus of ERΔNLS significantly restored both its nuclear localization and turnover in response to fulvestrant. Moreover, mutation of the sumoylation targets K266 and K268 within the NLS impaired fulvestrant-induced ERα degradation. In conclusion, our study provides evidence for the unique role of the ERα NLS in fulvestrant-induced degradation of the receptor. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Angelis Campos, Ana Carolina; Rodrigues, Michele Angela; Andrade, Carolina de
2011-08-26
Highlights: {yields} EGF and its receptor translocates to the nucleus in liver cells. {yields} Real time imaging shows that EGF moves to the nucleus. {yields} EGF moves with its receptor to the nucleus. {yields} Dynamin and clathrin are necessary for EGFR nuclear translocation. -- Abstract: The epidermal growth factor (EGF) transduces its actions via the EGF receptor (EGFR), which can traffic from the plasma membrane to either the cytoplasm or the nucleus. However, the mechanism by which EGFR reaches the nucleus is unclear. To investigate these questions, liver cells were analyzed by immunoblot of cell fractions, confocal immunofluorescence and realmore » time confocal imaging. Cell fractionation studies showed that EGFR was detectable in the nucleus after EGF stimulation with a peak in nuclear receptor after 10 min. Movement of EGFR to the nucleus was confirmed by confocal immunofluorescence and labeled EGF moved with the receptor to the nucleus. Small interference RNA (siRNA) was used to knockdown clathrin in order to assess the first endocytic steps of EGFR nuclear translocation in liver cells. A mutant dynamin (dynamin K44A) was also used to determine the pathways for this traffic. Movement of labeled EGF or EGFR to the nucleus depended upon dynamin and clathrin. This identifies the pathway that mediates the first steps for EGFR nuclear translocation in liver cells.« less
da Silva Novaes, Antônio; Ribeiro, Rosemara Silva; Pereira, Luciana Guilhermino; Borges, Fernanda Teixeira; Boim, Mirian Aparecida
2018-02-17
Biological effects of angiotensin II (AngII) such as regulation of AngII target genes may be triggered by interaction of AngII with intracellular AngII receptor types 1 and 2 (AT 1 and AT 2 ), defined as intracrine response. The aim of this study was to examine the presence of AT 1 and AT 2 receptors in nuclear membrane of human mesangial cells (HMCs) and evaluate the possible biological effects mediated by intracellular AT 1 through an intracrine mechanism. Subcellular distribution of AT 1 and AT 2 was evaluated by immunofluorescence and by western blot in isolated nuclear extract. Endogenous intracellular synthesis of AngII was stimulated by high glucose (HG). Effects of HG were analyzed in the presence of candesartan, which prevents AngII internalization. Both receptors were found in nuclear membrane. Fluorescein isothiocyanate (FITC)-labeled AngII added to isolated nuclei produced a fluorescence that was reduced in the presence of losartan or PD-123319 and quenched in the presence of both inhibitors simultaneously. HG induced overexpression of fibronectin and increased cell proliferation in the presence of candesartan, indicating an intracrine action of AngII induced by HG. Results showed the presence of nuclear receptors in HMCs that can be activated by AngII through an intracrine response independent of cytoplasmic membrane AngII receptors.
Sakamoto, Yohei; Yoshida, Midori; Tamura, Kei; Takahashi, Miwa; Kodama, Yukio; Inoue, Kaoru
2015-12-01
Nuclear receptors play important roles in chemically induced liver hypertrophy in rodents. To clarify the involvement of constitutive androstane receptor (CAR) and other nuclear receptors in mouse liver hypertrophy induced by different doses of piperonyl butoxide (PBO), wild-type and CAR-knockout mice were administered PBO (200, 1,000, or 5,000 ppm) in the basal diet for 1 week. Increased liver weight and diffuse hepatocellular hypertrophy were observed at 5,000 ppm for both genotypes, accompanied by increased Cyp3a11 mRNA and CYP3A protein expression, suggesting that CAR-independent pathway, possibly pregnane X receptor (PXR), plays a major role in the induction of hypertrophy. Moreover, wild-type mice at 5,000 ppm showed enhanced hepatocellular hypertrophy and strong positive staining for CYP2B in the centrilobular area, suggesting the localized contribution of CAR. At 1,000 ppm, only wild-type mice showed liver weight increase and centrilobular hepatocellular hypertrophy concurrent with elevated Cyp2b10 mRNA expression and strong CYP2B staining, indicating that CAR was essential at 1,000 ppm. We concluded that high-dose PBO induced hypertrophy via CAR and another pathway, while lower dose of PBO induced a pathway mediated predominantly by CAR. The dose-responsiveness on liver hypertrophy is important for understanding the involvement of nuclear receptors.
Cytosol-nucleus traffic and colocalization with FXR of conjugated bile acids in rat hepatocytes.
Monte, Maria J; Rosales, Ruben; Macias, Rocio I R; Iannota, Valeria; Martinez-Fernandez, Almudena; Romero, Marta R; Hofmann, Alan F; Marin, Jose J G
2008-07-01
Bile acids (BAs) are natural ligands of nuclear receptors, in particular farnesoid X receptor (FXR). Whether, in addition to protein-mediated cytosolic-nuclear BA translocation, other mechanisms are involved in the access of BAs to nuclear FXR was investigated. When rat hepatocytes were incubated with radiolabeled taurocholic acid, taurodeoxycholic acid, taurochenodeoxycholic acid, and tauroursodeoxycholic acid, their nuclear accumulation was proportional to their intracellular levels. With the use of flow cytometry analysis, the accumulation by nuclei isolated from rat liver cells was found to differ for several fluorescent compounds of similar molecular weight and different charge, including fluorescein-tagged BAs [cholylglycyl amidofluorescein (CGamF), ursodeoxycholylglycyl amidofluorescein, or chenodeoxycholylglycyl amidofluorescein]. When we varied nuclear volume by incubation with different sucrose concentrations, a similar relationship between nuclear volume and content of FITC and 4-kDa FITC-dextran was found. In contrast, this relationship was markedly lower for CGamF. Confocal microscopy studies revealed that fluorescein-tagged BAs, but also FITC or 10-kDa FITC-dextran were found in the nuclear envelope and concentrated in regions where DNA was less densely packed. In contrast to the cytosolic subcellular localization of peroxisome proliferator-activated receptor-alpha, FXR and nucleolin (a marker of transcriptional active chromatin) were also localized by immunoreactivity in these intranuclear regions. In conclusion, although intranuclear levels of small organic molecules including conjugated BAs depend on their concentrations in the extranuclear space, the existence of certain molecular selectivity (not strictly dependent on molecular weight or charge) suggests that, in addition to simple diffusional exchange, other mechanisms may be also involved in determining their overall nuclear content in regions where these compounds coincide and may interact with nuclear receptors such as FXR.
Eswara, Manoja B K; Clayton, Ashley; Mangroo, Dev
2012-12-01
Utp8p is an essential nucleolar protein that channels aminoacyl-tRNAs from aminoacyl-tRNA synthetases in the nucleolus to the nuclear tRNA export receptors located in the nucleoplasm and nuclear pore complex in Saccharomyces cerevisiae. Utp8p is also part of the U3 snoRNA-associated protein complex involved in 18S rRNA biogenesis in the nucleolus. We report that Utp22p, which is another member of the U3 snoRNA-associated protein complex, is also an intranuclear component of the nuclear tRNA export machinery. Depletion of Utp22p results in nuclear retention of mature tRNAs derived from intron-containing and intronless precursors. Moreover, Utp22p copurifies with the nuclear tRNA export receptor Los1p, the aminoacyl-tRNA synthetase Tys1p and Utp8p, but not with the RanGTPase Gsp1p and the nuclear tRNA export receptor Msn5p. Utp22p interacts directly with Utp8p and Los1p in a tRNA-independent manner in vitro. Utp22p also interacts directly with Tys1p, but this binding is stimulated when Tys1p is bound to tRNA. However, Utp22p, unlike Utp8p, does not bind tRNA saturably. These data suggest that Utp22p recruits Utp8p to aminoacyl-tRNA synthetases in the nucleolus to collect aminoacyl-tRNA and then accompanies the Utp8p-tRNA complex to deliver the aminoacyl-tRNAs to Los1p but not Msn5p. It is possible that Nrap/Nol6, the mammalian orthologue of Utp22p, plays a role in channelling aminoacyl-tRNA to the nuclear tRNA export receptor exportin-t.
Tran, Elizabeth J.; King, Megan C.; Corbett, Anita H.
2014-01-01
Transport of macromolecules between the cytoplasm and the nucleus is critical for the function of all eukaryotic cells. Large macromolecular channels termed nuclear pore complexes that span the nuclear envelope mediate the bidirectional transport of cargoes between the nucleus and cytoplasm. However, the influence of macromolecular trafficking extends past the nuclear pore complex to transcription and RNA processing within the nucleus and signaling pathways that reach into the cytoplasm and beyond. At the Mechanisms of Nuclear Transport biennial meeting held from October 18-23, 2013 in Woods Hole, MA, researchers in the field met to report on their recent findings. The work presented highlighted significant advances in understanding nucleocytoplasmic trafficking including how transport receptors and cargoes pass through the nuclear pore complex, the many signaling pathways that impinge on transport pathways, interplay between the nuclear envelope, nuclear pore complexes, and transport pathways, and numerous links between transport pathways and human disease. The goal of this review is to highlight newly emerging themes in nuclear transport and underscore the major questions that are likely to be the focus of future research in the field. PMID:25116306
Purification and characterization of rat liver nuclear thyroid hormone receptors.
Ichikawa, K; DeGroot, L J
1987-01-01
Nuclear thyroid hormone receptor was purified to 904 pmol of L-3,5,3'-triiodothyronine (T3) binding capacity per mg of protein with 2.5-5.2% recovery by sequentially using hydroxylapatite column chromatography, ammonium sulfate precipitation, Sephadex G-150 gel filtration, DNA-cellulose column chromatography, DEAE-Sephadex column chromatography, and heparin-Sepharose column chromatography. Assuming that one T3 molecule binds to the 49,000-Da unit of the receptor, we reproducibly obtained 6.4-14.7 micrograms of receptor protein with 4.2-4.9% purity from 4-5 kg of rat liver. Elution of receptor from the heparin-Sepharose column was performed using 10 mM pyridoxal 5'-phosphate, which was observed to diminish binding of receptor to heparin-Sepharose or DNA-cellulose. This effect was specific for pyridoxal 5'-phosphate, since related compounds were not effective. Purified receptor bound T3 with high affinity (6.0 X 10(9) liter/mol), and the order of affinity of iodothyronine analogues to purified receptor was identical to that observed with crude receptor preparations [3,5,3'-triiodothyroacetic acid greater than L-T3 greater than D-3,5,3'-triiodothyronine (D-T3) greater than L-thyroxine greater than D-thyroxine]. Purified receptor had a sedimentation coefficient of 3.4 S, Stokes radius of 34 A, and calculated molecular mass of 49,000. Among several bands identified by silver staining after electrophoresis in NaDodSO4/polyacrylamide gels, one 49,000-Da protein showed photoaffinity labeling with [125I]thyroxine that was displaceable with excess unlabeled T3. The tryptic fragment and endogenous proteinase-digested fragment of the affinity-labeled receptor showed saturable binding in 27,000-Da and 36,000-Da peptides, respectively. These molecular masses are in agreement with estimates from gel filtration and gradient sedimentation, indicating that affinity labeling occurred at the hormone binding domain of nuclear thyroid hormone receptor. This procedure reproducibly provides classical native rat liver T3 nuclear receptor in useful quantity and purity and of the highest specific activity so far reported. Images PMID:3472213
Do unliganded thyroid hormone receptors have physiological functions?
Chassande, O
2003-08-01
Thyroid hormone (TH) is required for the development of vertebrates and exerts numerous homeostatic functions in adults. TH acts through nuclear receptors which control the transcription of target genes. Unliganded and liganded thyroid hormone receptors (TRs) have been shown to exert opposite effects on the transcription of target genes in vitro. However, the occurance of an aporeceptor activity in vivo and its potential physiological significance has not been clearly addressed. Several data generated using experimental hypothyroidism and thyrotoxicosis in wild type and TR knockout mice support the notion that apoTRs have an intrinsic activity in several tIssues. ApoTRs, and in particular TRalpha1, are predominant during the early stages of vertebrate development and must be turned into holoTRs for post-natal development to proceed normally. However, the absence of striking alterations of embryonic and fetal development in mice devoid of TRs indicates that apoTRs do not play a fundamental role. During development, as well as in adults, apoTRs rather appears as a system which increases the range of transcriptional responses to moderate variations of T3.
Tan, Nguan-Soon; Shaw, Natacha S.; Vinckenbosch, Nicolas; Liu, Peng; Yasmin, Rubina; Desvergne, Béatrice; Wahli, Walter; Noy, Noa
2002-01-01
Lipophilic compounds such as retinoic acid and long-chain fatty acids regulate gene transcription by activating nuclear receptors such as retinoic acid receptors (RARs) and peroxisome proliferator-activated receptors (PPARs). These compounds also bind in cells to members of the family of intracellular lipid binding proteins, which includes cellular retinoic acid-binding proteins (CRABPs) and fatty acid binding proteins (FABPs). We previously reported that CRABP-II enhances the transcriptional activity of RAR by directly targeting retinoic acid to the receptor. Here, potential functional cooperation between FABPs and PPARs in regulating the transcriptional activities of their common ligands was investigated. We show that adipocyte FABP and keratinocyte FABP (A-FABP and K-FABP, respectively) selectively enhance the activities of PPARγ and PPARβ, respectively, and that these FABPs massively relocate to the nucleus in response to selective ligands for the PPAR isotype which they activate. We show further that A-FABP and K-FABP interact directly with PPARγ and PPARβ and that they do so in a receptor- and ligand-selective manner. Finally, the data demonstrate that the presence of high levels of K-FABP in keratinocytes is essential for PPARβ-mediated induction of differentiation of these cells. Taken together, the data establish that A-FABP and K-FABP govern the transcriptional activities of their ligands by targeting them to cognate PPARs in the nucleus, thereby enabling PPARs to exert their biological functions. PMID:12077340
The VPAC1 receptor: structure and function of a class B GPCR prototype
Couvineau, A.; Ceraudo, E.; Tan, Y.-V.; Nicole, P.; Laburthe, M.
2012-01-01
The class B G protein-coupled receptors (GPCRs) represents a small sub-family encompassing 15 members, and are very promising targets for the development of drugs to treat many diseases such as chronic inflammation, neurodegeneration, diabetes, stress, and osteoporosis. The VPAC1 receptor which is an archetype of the class B GPCRs binds Vasoactive Intestinal Peptide (VIP), a neuropeptide widely distributed in central and peripheral nervous system modulating many physiological processes including regulation of exocrine secretions, hormone release, foetal development, immune response … VIP appears to exert beneficial effect in neurodegenerative and inflammatory diseases. This article reviews the current knowledge regarding the structure and molecular pharmacology of VPAC1 receptors. Over the past decade, structure–function relationship studies have demonstrated that the N-terminal ectodomain (N-ted) of VPAC1 plays a pivotal role in VIP recognition. The use of different approaches such as directed mutagenesis, photoaffinity labeling, Nuclear Magnetic Resonance (NMR), molecular modeling, and molecular dynamic simulation has led to demonstrate that: (1) the central and C-terminal part of the VIP molecule interacts with the N-ted of VPAC1 receptor which is itself structured as a « Sushi » domain; (2) the N-terminal end of the VIP molecule interacts with the first transmembrane domain of the receptor where three residues (K143, T144, and T147) play an important role in VPAC1 interaction with the first histidine residue of VIP. PMID:23162538