Recent advance in the design of small molecular modulators of estrogen-related receptors.

PubMed

Lu, Xiaoyun; Peng, Lijie; Lv, Man; ding, Ke

2012-01-01

The estrogen-related receptors (ERRs), comprising ERRα, ERRβ and ERRγ, are the members of the nuclear receptor superfamily, which have been functionally implicated in estrogen signal pathway in various patterns. However, no natural ligand of ERRs has been identified to data, so identification of the synthetic modulators (inverse agonist and agonist) of ERRs would be highly effective in the treatment of estrogen-related pathologies, such as diabetes, breast cancer and osteoporosis. This review summarizes the structures and biological functions of ERR subtypes, and the progress in designing the small molecular modulators of ERRs as well as the detailed description of available co-crystal structures of the LBD of ERRs in three distinct states: unligand, inverse agonist bound, and agonist bound.

Insulin-induced translocation of IR to the nucleus in insulin responsive cells requires a nuclear translocation sequence.

PubMed

Kesten, Dov; Horovitz-Fried, Miriam; Brutman-Barazani, Tamar; Sampson, Sanford R

2018-04-01

Insulin binding to its cell surface receptor (IR) activates a cascade of events leading to its biological effects. The Insulin-IR complex is rapidly internalized and then is either recycled back to the plasma membrane or sent to lysosomes for degradation. Although most of the receptor is recycled or degraded, a small amount may escape this pathway and migrate to the nucleus of the cell where it might be important in promulgation of receptor signals. In this study we explored the mechanism by which insulin induces IR translocation to the cell nucleus. Experiments were performed cultured L6 myoblasts, AML liver cells and 3T3-L1 adipocytes. Insulin treatment induced a rapid increase in nuclear IR protein levels within 2 to 5 min. Treatment with WGA, an inhibitor of nuclear import, reduced insulin-induced increases nuclear IR protein; IR was, however, translocated to a perinuclear location. Bioinformatics tools predicted a potential nuclear localization sequence (NLS) on IR. Immunofluorescence staining showed that a point mutation on the predicted NLS blocked insulin-induced IR nuclear translocation. In addition, blockade of nuclear IR activation in isolated nuclei by an IR blocking antibody abrogated insulin-induced increases in IR tyrosine phosphorylation and nuclear PKCδ levels. Furthermore, over expression of mutated IR reduced insulin-induced glucose uptake and PKB phosphorylation. When added to isolated nuclei, insulin induced IR phosphorylation but had no effect on nuclear IR protein levels. These results raise questions regarding the possible role of nuclear IR in IR signaling and insulin resistance. Copyright © 2018 Elsevier B.V. All rights reserved.

Over-accumulation of nuclear IGF-1 receptor in tumor cells requires elevated expression of the receptor and the SUMO-conjugating enzyme Ubc9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng, Hua; Lin, Yingbo; Badin, Margherita

2011-01-14

Research highlights: {yields} SUMOylation mediates nuclear translocation of IGF-1R which activates transcription. {yields} Here we show that nuclear IGF-1R over-accumulates in tumor cells. {yields} This requires overexpression of the receptor that is a common feature in tumor cells. {yields} An increased expression of the SUMO ligase Ubc9 seems to be an involved mechanism too. -- Abstract: The insulin-like growth factor 1 receptor (IGF-1R) plays crucial roles in tumor cell growth and is overexpressed in many cancers. IGF-1R's trans-membrane kinase signaling pathways have been well characterized. Very recently, we showed that SUMOylation mediates nuclear translocation of the IGF-1R, and that nuclearmore » IGF-1R (nIGF-1R) binds to enhancer regions and activates transcription. We identified three lysine residues in the {beta}-subunit of the receptor and that mutation of these blocks nuclear translocation and gene activation. Furthermore, accumulation of nIGF-1R was proven strongly dependent on the specific SUMO-conjugating enzyme Ubc9. Here we show that nIGF-1R originates solely from the cell membrane and that phosphorylation of the core tyrosine residues of the receptor kinase is crucial for nuclear accumulation. We also compared the levels of nIGF-1R, measured as nuclear/membrane ratios, in tumor and normal cells. We found that the breast cancer cell line MCF-7 has 13-fold higher amounts of nIGF-1R than breast epithelial cells (IME) which showed only a small amount of nIGF-1R. In comparison, the total expression of IGF-1R was only 3.7- higher in MCF-7. Comparison of several other tumor and normal cell lines showed similar tumor cell over-accumulation of nIGF-1R, exceeding the total receptor expression substantially. Ectopic overexpression (>10-fold) of the receptor increased nIGF-1R in IME cells but not to that high level as in wild type MCF-7. The levels of Ubc9 were higher in all tumor cell lines, compared to the normal cells, and this probably contributes to over-accumulation of nIGF-1R. Over-accumulation of nIGF-1R may contribute to deregulated gene expression and therewith play a pathophysiological role in cancer cells.« less

Stable cellular models of nuclear receptor PXR for high-throughput evaluation of small molecules.

PubMed

Negi, Seema; Singh, Shashi Kala; Kumar, Sanjay; Kumar, Subodh; Tyagi, Rakesh K

2018-06-19

Pregnane & Xenobiotic Receptor (PXR) is one of the 48 members of the ligand-modulated transcription factors belonging to nuclear receptor superfamily. Though PXR is now well-established as a 'xenosensor', regulating the central detoxification and drug metabolizing machinery, it has also emerged as a key player in several metabolic disorders. This makes PXR attractive to both, researchers and pharmaceutical industry since clinical success of small drug molecules can be pre-evaluated on PXR platform. At the early stages of drug discovery, cell-based assays are used for high-throughput screening of small molecules. The future success or failure of a drug can be predicted by this approach saving expensive resources and time. In view of this, we have developed human liver cell line-based, dual-level screening and validation protocol on PXR platform having application to assess small molecules. We have generated two different stably transfected cell lines, (i) a stable promoter-reporter cell line (HepXREM) expressing PXR and a commonly used CYP3A4 promoter-reporter i.e. XREM-luciferase; and (ii) two stable cell lines integrated with proximal PXR-promoter-reporter (Hepx-1096/+43 and Hepx-497/+43). Employing HepXREM, Hepx-1096/+43 and Hepx-497/+43 stable cell lines > 25 anti-cancer herbal drug ingredients were screened for examining their modulatory effects on a) PXR transcriptional activity and, b) PXR-promoter activity. In conclusion, the present report provides a convenient and economical, dual-level screening system to facilitate the identification of superior therapeutic small molecules. Copyright © 2018. Published by Elsevier Ltd.

Targeting xenobiotic receptors PXR and CAR in human diseases

PubMed Central

Banerjee, Monimoy; Robbins, Delira; Chen, Taosheng

2014-01-01

Nuclear receptors such as the pregnane X receptor (PXR) and constitutive androstane receptor (CAR) are xenobiotic receptors regulating not only drug metabolism and disposition but also various human diseases such as cancer, diabetes, inflammatory disease, metabolic disease and liver diseases, suggesting that PXR and CAR are promising targets for drug discovery. Consequently, there is an urgent need to discover and develop small molecules that target these PXR- and/or CAR-mediated human-disease-related pathways for relevant therapeutic applications. This review proposes approaches to target PXR and CAR, either individually or simultaneously, in the context of various human diseases, taking into consideration the structural differences between PXR and CAR. PMID:25463033

Transcriptional activation of NAD+-dependent protein deacetylase SIRT1 by nuclear receptor TLX.

PubMed

Iwahara, Naotoshi; Hisahara, Shin; Hayashi, Takashi; Horio, Yoshiyuki

2009-09-04

An orphan nuclear receptor TLX is a transcriptional repressor that promotes the proliferation and self-renewal of neural precursor cells (NPCs). SIRT1, an NAD(+)-dependent protein deacetylase, is highly expressed in the NPCs and participates in neurogenesis. Here, we found that TLX colocalized with SIRT1 and knockdown of TLX by small interfering RNAs decreased SIRT1 levels in NPCs. TLX increased the SIRT1 expression by binding to the newly identified TLX-activating element in the SIRT1 gene promoter in HEK293 cells. Thus, TLX is an inducer of SIRT1 and may contribute to neurogenesis both as a transactivator and as a repressor.

Transcriptional activation of NAD{sup +}-dependent protein deacetylase SIRT1 by nuclear receptor TLX

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iwahara, Naotoshi; Hisahara, Shin; Hayashi, Takashi

2009-09-04

An orphan nuclear receptor TLX is a transcriptional repressor that promotes the proliferation and self-renewal of neural precursor cells (NPCs). SIRT1, an NAD{sup +}-dependent protein deacetylase, is highly expressed in the NPCs and participates in neurogenesis. Here, we found that TLX colocalized with SIRT1 and knockdown of TLX by small interfering RNAs decreased SIRT1 levels in NPCs. TLX increased the SIRT1 expression by binding to the newly identified TLX-activating element in the SIRT1 gene promoter in HEK293 cells. Thus, TLX is an inducer of SIRT1 and may contribute to neurogenesis both as a transactivator and as a repressor.

Development and Implementation of a High-Throughput High-Content Screening Assay to Identify Inhibitors of Androgen Receptor Nuclear Localization in Castration-Resistant Prostate Cancer Cells

PubMed Central

Nguyen, Minh M.; Dar, Javid A.; Ai, Junkui; Wang, Yujuan; Masoodi, Khalid Z.; Shun, Tongying; Shinde, Sunita; Camarco, Daniel P.; Hua, Yun; Huryn, Donna M.; Wilson, Gabriela Mustata; Lazo, John S.; Nelson, Joel B.; Wipf, Peter

2016-01-01

Abstract Patients with castration-resistant prostate cancer (CRPC) can be treated with abiraterone, a potent inhibitor of androgen synthesis, or enzalutamide, a second-generation androgen receptor (AR) antagonist, both targeting AR signaling. However, most patients relapse after several months of therapy and a majority of patients with relapsed CRPC tumors express the AR target gene prostate-specific antigen (PSA), suggesting that AR signaling is reactivated and can be targeted again to inhibit the relapsed tumors. Novel small molecules capable of inhibiting AR function may lead to urgently needed therapies for patients resistant to abiraterone, enzalutamide, and/or other previously approved antiandrogen therapies. Here, we describe a high-throughput high-content screening (HCS) campaign to identify small-molecule inhibitors of AR nuclear localization in the C4-2 CRPC cell line stably transfected with GFP-AR-GFP (2GFP-AR). The implementation of this HCS assay to screen a National Institutes of Health library of 219,055 compounds led to the discovery of 3 small molecules capable of inhibiting AR nuclear localization and function in C4-2 cells, demonstrating the feasibility of using this cell-based phenotypic assay to identify small molecules targeting the subcellular localization of AR. Furthermore, the three hit compounds provide opportunities to develop novel AR drugs with potential for therapeutic intervention in CRPC patients who have relapsed after treatment with antiandrogens, such as abiraterone and/or enzalutamide. PMID:27187604

A live zebrafish-based screening system for human nuclear receptor ligand and cofactor discovery.

PubMed

Tiefenbach, Jens; Moll, Pamela R; Nelson, Meryl R; Hu, Chun; Baev, Lilia; Kislinger, Thomas; Krause, Henry M

2010-03-22

Nuclear receptors (NRs) belong to a superfamily of transcription factors that regulate numerous homeostatic, metabolic and reproductive processes. Taken together with their modulation by small lipophilic molecules, they also represent an important and successful class of drug targets. Although many NRs have been targeted successfully, the majority have not, and one third are still orphans. Here we report the development of an in vivo GFP-based reporter system suitable for monitoring NR activities in all cells and tissues using live zebrafish (Danio rerio). The human NR fusion proteins used also contain a new affinity tag cassette allowing the purification of receptors with bound molecules from responsive tissues. We show that these constructs 1) respond as expected to endogenous zebrafish hormones and cofactors, 2) facilitate efficient receptor and cofactor purification, 3) respond robustly to NR hormones and drugs and 4) yield readily quantifiable signals. Transgenic lines representing the majority of human NRs have been established and are available for the investigation of tissue- and isoform-specific ligands and cofactors.

Nuclear Receptors, Mitochondria, and Lipid Metabolism

PubMed Central

Alaynick, William A.

2009-01-01

Lipid metabolism is a continuum from emulsification and uptake of lipids in the intestine to cellular uptake and transport to compartments such as mitochondria. Whether fats are shuttled into lipid droplets in adipose tissue or oxidized in mitochondria and peroxisomes depends on metabolic substrate availability, energy balance and endocrine signaling of the organism. Several members of the nuclear hormone receptor superfamily are lipid-sensing factors that affect all aspects of lipid metabolism. The physiologic actions of glandular hormones (e.g. thyroid, mineralocorticoid and glucocorticoid), vitamins (e.g. vitamins A and D) and reproductive hormones (e.g. progesterone, estrogen and testosterone) and their cognate receptors are well established. The peroxisome proliferator activated receptors (PPARs) and Liver X receptors (LXRs), acting in concert with PPARγ Coactivator 1α (PGC-1α), have been shown to regulate insulin sensitivity and lipid handling. These receptors are the focus of intense pharmacologic studies to expand the armamentarium of small molecule ligands to treat diabetes and the metabolic syndrome (hypertension, insulin resistance, hyperglycemia, dyslipidemia, and obesity). Recently, additional partners of PGC-1α have moved to the forefront of metabolic research, the Estrogen-related Receptors (ERRs). Although no endogenous ligands for these receptors have been identified, phenotypic analyses of knockout mouse models demonstrate an important role for these molecules in substrate sensing and handling as well as mitochondrial function. PMID:18375192

Transcriptional corepressor SMILE recruits SIRT1 to inhibit nuclear receptor estrogen receptor-related receptor gamma transactivation.

PubMed

Xie, Yuan-Bin; Park, Jeong-Hoh; Kim, Don-Kyu; Hwang, Jung Hwan; Oh, Sangmi; Park, Seung Bum; Shong, Minho; Lee, In-Kyu; Choi, Hueng-Sik

2009-10-16

SMILE (small heterodimer partner interacting leucine zipper protein) has been identified as a corepressor of the glucocorticoid receptor, constitutive androstane receptor, and hepatocyte nuclear factor 4alpha. Here we show that SMILE also represses estrogen receptor-related receptor gamma (ERRgamma) transactivation. Knockdown of SMILE gene expression increases ERRgamma activity. SMILE directly interacts with ERRgamma in vitro and in vivo. Domain mapping analysis showed that SMILE binds to the AF2 domain of ERRgamma. SMILE represses ERRgamma transactivation partially through competition with coactivators PGC-1alpha, PGC-1beta, and GRIP1. Interestingly, the repression of SMILE on ERRgamma is released by SIRT1 inhibitors, a catalytically inactive SIRT1 mutant, and SIRT1 small interfering RNA but not by histone protein deacetylase inhibitor. In vivo glutathione S-transferase pulldown and coimmunoprecipitation assays validated that SMILE physically interacts with SIRT1. Furthermore, the ERRgamma inverse agonist GSK5182 enhances the interaction of SMILE with ERRgamma and SMILE-mediated repression. Knockdown of SMILE or SIRT1 blocks the repressive effect of GSK5182. Moreover, chromatin immunoprecipitation assays revealed that GSK5182 augments the association of SMILE and SIRT1 on the promoter of the ERRgamma target PDK4. GSK5182 and adenoviral overexpression of SMILE cooperate to repress ERRgamma-induced PDK4 gene expression, and this repression is released by overexpression of a catalytically defective SIRT1 mutant. Finally, we demonstrated that ERRgamma regulates SMILE gene expression, which in turn inhibits ERRgamma. Overall, these findings implicate SMILE as a novel corepressor of ERRgamma and recruitment of SIRT1 as a novel repressive mechanism for SMILE and ERRgamma inverse agonist.

Reflections on the theory of "silver bullet" octreotide tracers: implications for ligand-receptor interactions in the age of peptides, heterodimers, receptor mosaics, truncated receptors, and multifractal analysis

PubMed Central

2011-01-01

The classical attitude of Nuclear Medicine practitioners on matters of peptide-receptor interactions has maintained an intrinsic monogamic character since many years. New advances in the field of biochemistry and even in clinical Nuclear Medicine have challenged this type of thinking, which prompted me to work on this review. The central issue of this paper will be the use of somatostatin analogs, i.e., octreotide, in clinical imaging procedures as well as in relation to neuroendocirne tumors. Newly described characteristics of G-protein coupled receptors such as the formation of receptor mosaics will be discussed. A small section will enumerate the regulatory processes found in the cell membrane. Possible new interpretations, other than tumor detection, based on imaging procedures with somatostatin analogs will be presented. The readers will be taken to situations such as inflammation, nociception, mechanosensing, chemosensing, fibrosis, taste, and vascularity where somatostatin is involved. Thyroid-associated orbitopathy will be used as a model for the development of multi-agent therapeutics. The final graphical summary depicts the multifactorial properties of ligand binding. PMID:22214590

Targeting Nuclear Receptors with Marine Natural Products

PubMed Central

Yang, Chunyan; Li, Qianrong; Li, Yong

2014-01-01

Nuclear receptors (NRs) are important pharmaceutical targets because they are key regulators of many metabolic and inflammatory diseases, including diabetes, dyslipidemia, cirrhosis, and fibrosis. As ligands play a pivotal role in modulating nuclear receptor activity, the discovery of novel ligands for nuclear receptors represents an interesting and promising therapeutic approach. The search for novel NR agonists and antagonists with enhanced selectivities prompted the exploration of the extraordinary chemical diversity associated with natural products. Recent studies involving nuclear receptors have disclosed a number of natural products as nuclear receptor ligands, serving to re-emphasize the translational possibilities of natural products in drug discovery. In this review, the natural ligands of nuclear receptors will be described with an emphasis on their mechanisms of action and their therapeutic potentials, as well as on strategies to determine potential marine natural products as nuclear receptor modulators. PMID:24473166

Inhibition of mRNA export in vertebrate cells by nuclear export signal conjugates

PubMed Central

Pasquinelli, Amy E.; Powers, Maureen A.; Lund, Elsebet; Forbes, Douglass; Dahlberg, James E.

1997-01-01

Leucine-rich nuclear export signals (NESs) are recognized by the NES receptor exportin 1 and are central to the export of multiple shuttling proteins and RNAs. The export of messenger RNA in vertebrates was, however, thought to occur by a different pathway, because inhibition by injection of a synthetic Rev NES conjugate could not be demonstrated. Here we find that peptide conjugates composed of the NES of either protein kinase A inhibitor protein (PKI) or the HIV-1 Rev protein, when coupled to human serum albumin, are potent inhibitors of mRNA and small nuclear RNA export. These results provide direct evidence that mRNA export in vertebrates depends on interactions between an NES and its cognate NES receptors. PKI NES conjugates are significantly more efficient at inhibiting RNA export than are REV NES conjugates, indicating that different NESs may have different abilities to promote protein and RNA export. Surprisingly, an expected control conjugate containing the mutant Rev NES sequence M10 strongly inhibited the export of intronless dihydrofolate reductase mRNA. Nuclear injection of NES peptide conjugates led to mislocalization to the nucleus of 10–20% of the cytoplasmic Ran GTPase-binding protein (RanBP1) indicating that RanBP1 shuttles between the nucleus and the cytoplasm via an NES pathway. These results demonstrate that in vertebrates the export of mRNA, like that of small nuclear RNA, 5S rRNA, and transport factors such as RanBP1, employs NES-mediated molecular machinery. PMID:9405623

Stress-specific p38 MAPK activation is sufficient to drive EGFR endocytosis but not its nuclear translocation.

PubMed

Tomas, Alejandra; Jones, Sylwia; Vaughan, Simon O; Hochhauser, Daniel; Futter, Clare E

2017-08-01

EGF receptor (EGFR) endocytosis is induced by stress in a manner dependent on the p38 MAPK family. Ligand and stresses such as X-rays, reportedly promote nuclear trafficking of endocytosed EGFR for regulation of gene transcription and DNA repair. We fail to detect EGFR endocytosis or nuclear transport following X-ray treatment of HeLa or head and neck cancer cells, despite extensive DNA damage induction. Apparent nuclear staining with EGFR extracellular domain antibody remained present despite reduced/absent EGFR expression, and so did not represent nuclear EGFR. UVB and UVC, but not X-ray or UVA, treatment induced p38 activation and EGFR endocytosis, although all of these stresses induced DNA damage, indicating that DNA damage alone is not sufficient to induce EGFR endocytosis. Increased reactive oxygen species (ROS) levels following UVB treatment, compared to that seen with X-rays, do not alone explain differences in p38 activation. UVB, like UVC, induced EGFR accumulation predominantly in perinuclear endosomes, rather than in the nucleus. Our morphological techniques identifying major changes in receptor distribution do not exclude the possibility that small but biologically relevant amounts of EGFR enter the nucleus. This study highlights the importance and limitations of morphological analyses of receptor distribution in understanding signaling outcome. © 2017. Published by The Company of Biologists Ltd.

Nmd3p Is a Crm1p-Dependent Adapter Protein for Nuclear Export of the Large Ribosomal Subunit

PubMed Central

Ho, Jennifer Hei-Ngam; Kallstrom, George; Johnson, Arlen W.

2000-01-01

In eukaryotic cells, nuclear export of nascent ribosomal subunits through the nuclear pore complex depends on the small GTPase Ran. However, neither the nuclear export signals (NESs) for the ribosomal subunits nor the receptor proteins, which recognize the NESs and mediate export of the subunits, have been identified. We showed previously that Nmd3p is an essential protein from yeast that is required for a late step in biogenesis of the large (60S) ribosomal subunit. Here, we show that Nmd3p shuttles and that deletion of the NES from Nmd3p leads to nuclear accumulation of the mutant protein, inhibition of the 60S subunit biogenesis, and inhibition of the nuclear export of 60S subunits. Moreover, the 60S subunits that accumulate in the nucleus can be coimmunoprecipitated with the NES-deficient Nmd3p. 60S subunit biogenesis and export of truncated Nmd3p were restored by the addition of an exogenous NES. To identify the export receptor for Nmd3p we show that Nmd3p shuttling and 60S export is blocked by the Crm1p-specific inhibitor leptomycin B. These results identify Crm1p as the receptor for Nmd3p export. Thus, export of the 60S subunit is mediated by the adapter protein Nmd3p in a Crm1p-dependent pathway. PMID:11086007

Regulation of calcium signals in the nucleus by a nucleoplasmic reticulum

PubMed Central

Echevarría, Wihelma; Leite, M. Fatima; Guerra, Mateus T.; Zipfel, Warren R.; Nathanson, Michael H.

2013-01-01

Calcium is a second messenger in virtually all cells and tissues1. Calcium signals in the nucleus have effects on gene transcription and cell growth that are distinct from those of cytosolic calcium signals; however, it is unknown how nuclear calcium signals are regulated. Here we identify a reticular network of nuclear calcium stores that is continuous with the endoplasmic reticulum and the nuclear envelope. This network expresses inositol 1,4,5-trisphosphate (InsP3) receptors, and the nuclear component of InsP3-mediated calcium signals begins in its locality. Stimulation of these receptors with a little InsP3 results in small calcium signals that are initiated in this region of the nucleus. Localized release of calcium in the nucleus causes nuclear protein kinase C (PKC) to translocate to the region of the nuclear envelope, whereas release of calcium in the cytosol induces translocation of cytosolic PKC to the plasma membrane. Our findings show that the nucleus contains a nucleoplasmic reticulum with the capacity to regulate calcium signals in localized subnuclear regions. The presence of such machinery provides a potential mechanism by which calcium can simultaneously regulate many independent processes in the nucleus. PMID:12717445

The Nuclear Receptor HIZR-1 Uses Zinc as a Ligand to Mediate Homeostasis in Response to High Zinc

PubMed Central

Warnhoff, Kurt; Roh, Hyun C.; Kocsisova, Zuzana; Tan, Chieh-Hsiang; Morrison, Andrew; Croswell, Damari; Schneider, Daniel L.; Kornfeld, Kerry

2017-01-01

Nuclear receptors were originally defined as endocrine sensors in humans, leading to the identification of the nuclear receptor superfamily. Despite intensive efforts, most nuclear receptors have no known ligand, suggesting new ligand classes remain to be discovered. Furthermore, nuclear receptors are encoded in the genomes of primitive organisms that lack endocrine signaling, suggesting the primordial function may have been environmental sensing. Here we describe a novel Caenorhabditis elegans nuclear receptor, HIZR-1, that is a high zinc sensor in an animal and the master regulator of high zinc homeostasis. The essential micronutrient zinc acts as a HIZR-1 ligand, and activated HIZR-1 increases transcription of genes that promote zinc efflux and storage. The results identify zinc as the first inorganic molecule to function as a physiological ligand for a nuclear receptor and direct environmental sensing as a novel function of nuclear receptors. PMID:28095401

Atypical nuclear localization of VIP receptors in glioma cell lines and patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbarin, Alice; Séité, Paule; Godet, Julie

Highlights: • The VIP receptor VPAC1 contains a putative NLS signal. • VPAC1 is predominantly nuclear in GBM cell lines but not VPAC2. • Non-nuclear VPAC1/2 protein expression is correlated with glioma grade. • Nuclear VPAC1 is observed in 50% of stage IV glioma (GBM). - Abstract: An increasing number of G protein-coupled receptors, like receptors for vasoactive intestinal peptide (VIP), are found in cell nucleus. As VIP receptors are involved in the regulation of glioma cell proliferation and migration, we investigated the expression and the nuclear localization of the VIP receptors VPAC1 and VPAC2 in this cancer. First, bymore » applying Western blot and immunofluorescence detection in three human glioblastoma (GBM) cell lines, we observed a strong nuclear staining for the VPAC1 receptor and a weak nuclear VPAC2 receptor staining. Second, immunohistochemical staining of VPAC1 and VPAC2 on tissue microarrays (TMA) showed that the two receptors were expressed in normal brain and glioma tissues. Expression in the non-nuclear compartment of the two receptors significantly increased with the grade of the tumors. Analysis of nuclear staining revealed a significant increase of VPAC1 staining with glioma grade, with up to 50% of GBM displaying strong VPAC1 nuclear staining, whereas nuclear VPAC2 staining remained marginal. The increase in VPAC receptor expression with glioma grades and the enhanced nuclear localization of the VPAC1 receptors in GBM might be of importance for glioma progression.« less

PGE2/EP3/SRC signaling induces EGFR nuclear translocation and growth through EGFR ligands release in lung adenocarcinoma cells

PubMed Central

Bazzani, Lorenzo; Donnini, Sandra; Finetti, Federica; Christofori, Gerhard; Ziche, Marina

2017-01-01

Prostaglandin E2 (PGE2) interacts with tyrosine kinases receptor signaling in both tumor and stromal cells supporting tumor progression. Here we demonstrate that in non-small cell lung carcinoma (NSCLC) cells, A549 and GLC82, PGE2 promotes nuclear translocation of epidermal growth factor receptor (nEGFR), affects gene expression and induces cell growth. Indeed, cyclin D1, COX-2, iNOS and c-Myc mRNA levels are upregulated following PGE2 treatment. The nuclear localization sequence (NLS) of EGFR as well as its tyrosine kinase activity are required for the effect of PGE2 on nEGFR and downstream signaling activities. PGE2 binds its bona fide receptor EP3 which by activating SRC family kinases, induces ADAMs activation which, in turn, releases EGFR-ligands from the cell membrane and promotes nEGFR. Amphiregulin (AREG) and Epiregulin (EREG) appear to be involved in nEGFR promoted by the PGE2/EP3-SRC axis. Pharmacological inhibition or silencing of the PGE2/EP3/SRC-ADAMs signaling axis or EGFR ligands i.e. AREG and EREG expression abolishes nEGFR induced by PGE2. In conclusion, PGE2 induces NSCLC cell proliferation by EP3 receptor, SRC-ADAMs activation, EGFR ligands shedding and finally, phosphorylation and nEGFR. Since nuclear EGFR is a hallmark of cancer aggressiveness, our findings reveal a novel mechanism for the contribution of PGE2 to tumor progression. PMID:28415726

TLX: An elusive receptor.

PubMed

Benod, Cindy; Villagomez, Rosa; Webb, Paul

2016-03-01

TLX (tailless receptor) is a member of the nuclear receptor superfamily and belongs to a class of nuclear receptors for which no endogenous or synthetic ligands have yet been identified. TLX is a promising therapeutic target in neurological disorders and brain tumors. Thus, regulatory ligands for TLX need to be identified to complete the validation of TLX as a useful target and would serve as chemical probes to pursue the study of this receptor in disease models. It has recently been proved that TLX is druggable. However, to identify potent and specific TLX ligands with desirable biological activity, a deeper understanding of where ligands bind, how they alter TLX conformation and of the mechanism by which TLX mediates the transcription of its target genes is needed. While TLX is in the process of escaping from orphanhood, future ligand design needs to progress in parallel with improved understanding of (i) the binding cavity or surfaces to target with small molecules on the TLX ligand binding domain and (ii) the nature of the TLX coregulators in particular cell and disease contexts. Both of these topics are discussed in this review. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nuclear receptors and nonalcoholic fatty liver disease1

PubMed Central

Cave, Matthew C.; Clair, Heather B.; Hardesty, Josiah E.; Falkner, K. Cameron; Feng, Wenke; Clark, Barbara J.; Sidey, Jennifer; Shi, Hongxue; Aqel, Bashar A.; McClain, Craig J.; Prough, Russell A.

2016-01-01

Nuclear receptors are transcription factors which sense changing environmental or hormonal signals and effect transcriptional changes to regulate core life functions including growth, development, and reproduction. To support this function, following ligand-activation by xenobiotics, members of subfamily 1 nuclear receptors (NR1s) may heterodimerize with the retinoid X receptor (RXR) to regulate transcription of genes involved in energy and xenobiotic metabolism and inflammation. Several of these receptors including the peroxisome proliferator-activated receptors (PPARs), the pregnane and xenobiotic receptor (PXR), the constitutive androstane receptor (CAR), the liver X receptor (LXR) and the farnesoid X receptor (FXR) are key regulators of the gut:liver:adipose axis and serve to coordinate metabolic responses across organ systems between the fed and fasting states. Non-alcoholic fatty liver disease (NAFLD) is the most common liver disease and may progress to cirrhosis and even hepatocellular carcinoma. NAFLD is associated with inappropriate nuclear receptor function and perturbations along the gut:liver:adipose axis including obesity, increased intestinal permeability with systemic inflammation, abnormal hepatic lipid metabolism, and insulin resistance. Environmental chemicals may compound the problem by directly interacting with nuclear receptors leading to metabolic confusion and the inability to differentiate fed from fasting conditions. This review focuses on the impact of nuclear receptors in the pathogenesis and treatment of NAFLD. Clinical trials including PIVENS and FLINT demonstrate that nuclear receptor targeted therapies may lead to the paradoxical dissociation of steatosis, inflammation, fibrosis, insulin resistance, dyslipidemia and obesity. Novel strategies currently under development (including tissue-specific ligands and dual receptor agonists) may be required to separate the beneficial effects of nuclear receptor activation from unwanted metabolic side effects. The impact of nuclear receptor crosstalk in NAFLD is likely to be profound, but requires further elucidation. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. PMID:26962021

Nuclear import of HIV-1 intracellular reverse transcription complexes is mediated by importin 7

PubMed Central

Fassati, Ariberto; Görlich, Dirk; Harrison, Ian; Zaytseva, Lyubov; Mingot, José-Manuel

2003-01-01

Human immunodeficiency virus type 1 (HIV-1), like other lentiviruses, can infect non-dividing cells. This property depends on the active nuclear import of its intracellular reverse transcription complex (RTC). We have studied nuclear import of purified HIV-1 RTCs in primary macrophages and found that importin 7, an import receptor for ribosomal proteins and histone H1, is involved in the process. Nuclear import of RTCs requires, in addition, energy and the com ponents of the Ran system. Depletion of importin 7 from cultured cells by small interfering RNA inhibits HIV-1 infection. These results provide a new insight into the molecular mechanism for HIV-1 nuclear import and reveal potential targets for therapeutic intervention. PMID:12853482

Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

2008-04-11

Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

Thyroid Hormone Receptor Antagonists: From Environmental Pollution to Novel Small Molecules.

PubMed

Mackenzie, Louise S

2018-01-01

Thyroid hormone receptors (TRs) are nuclear receptors which control transcription, and thereby have effects in all cells within the body. TRs are an important regulator in many basic physiological processes including development, growth, metabolism, and cardiac function. The hyperthyroid condition results from an over production of thyroid hormones resulting in a continual stimulation of thyroid receptors which is detrimental for the patient. Therapies for hyperthyroidism are available, but there is a need for new small molecules that act as TR antagonists to treat hyperthyroidism. Many compounds exhibit TR antagonism and are considered detrimental to health. Some drugs in the clinic (most importantly, amiodarone) and environmental pollution exhibit TR antagonist properties and thus have the potential to induce hypothyroidism in some people. This chapter provides an overview of novel small molecules that have been specifically designed or screened for their TR antagonist activity as novel treatments for hyperthyroidism. While novel compounds have been identified, to date none have been developed sufficiently to enter clinical trials. Furthermore, a discussion on other sources of TR antagonists is discussed in terms of side effects of current drugs in the clinic as well as environmental pollution. © 2018 Elsevier Inc. All rights reserved.

The emerging roles of orphan nuclear receptors in prostate cancer.

PubMed

Wu, Dinglan; Cheung, Alyson; Wang, Yuliang; Yu, Shan; Chan, Franky L

2016-08-01

Orphan nuclear receptors are members of the nuclear receptor (NR) superfamily and are so named because their endogenous physiological ligands are either unknown or may not exist. Because of their important regulatory roles in many key physiological processes, dysregulation of signalings controlled by these receptors is associated with many diseases including cancer. Over years, studies of orphan NRs have become an area of great interest because their specific physiological and pathological roles have not been well-defined, and some of them are promising drug targets for diseases. The recently identified synthetic small molecule ligands, acting as agonists or antagonists, to these orphan NRs not only help to understand better their functional roles but also highlight that the signalings mediated by these ligand-independent NRs in diseases could be therapeutically intervened. This review is a summary of the recent advances in elucidating the emerging functional roles of orphan NRs in cancers, especially prostate cancer. In particular, some orphan NRs, RORγ, TR2, TR4, COUP-IFII, ERRα, DAX1 and SHP, exhibit crosstalk or interference with androgen receptor (AR) signaling in either normal or malignant prostatic cells, highlighting their involvement in prostate cancer progression as androgen and AR signaling pathway play critical roles in this process. We also propose that a better understanding of the mechanism of actions of these orphan NRs in prostate gland or prostate cancer could help to evaluate their potential value as therapeutic targets for prostate cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

Recent Progress in the Design and Discovery of RXR Modulators Targeting Alternate Binding Sites of the Receptor.

PubMed

Su, Ying; Zeng, Zhiping; Chen, Ziwen; Xu, Dan; Zhang, Weidong; Zhang, Xiao-Kun

2017-01-01

Retinoid X receptors (RXRs) occupy a central position within the nuclear receptor superfamily. They not only function as important transcriptional factors but also exhibit diverse nongenomic biological activities. The pleiotropic actions of RXRs under both physiological and pathophysiological conditions confer RXRs important drug targets for the treatment of cancer, and metabolic and neurodegenerative diseases. RXR modulators have been studied for the purpose of developing both drug molecules and chemical tools for biological investigation of RXR. Development of RXR modulators has focused on small molecules targeting the canonical ligand-binding pocket. However, accumulating results have demonstrated that there are other binding mechanisms by which small molecules interact with RXR to act as RXR modulators. This review discusses the recent development in the design and discovery of RXR modulators with a focus on those targeting novel binding sites on RXR.

An emerging link between LIM domain proteins and nuclear receptors.

PubMed

Sala, Stefano; Ampe, Christophe

2018-06-01

Nuclear receptors are ligand-activated transcription factors that partake in several biological processes including development, reproduction and metabolism. Over the last decade, evidence has accumulated that group 2, 3 and 4 LIM domain proteins, primarily known for their roles in actin cytoskeleton organization, also partake in gene transcription regulation. They shuttle between the cytoplasm and the nucleus, amongst other as a consequence of triggering cells with ligands of nuclear receptors. LIM domain proteins act as important coregulators of nuclear receptor-mediated gene transcription, in which they can either function as coactivators or corepressors. In establishing interactions with nuclear receptors, the LIM domains are important, yet pleiotropy of LIM domain proteins and nuclear receptors frequently occurs. LIM domain protein-nuclear receptor complexes function in diverse physiological processes. Their association is, however, often linked to diseases including cancer.

The NS2 proteins of parvovirus minute virus of mice are required for efficient nuclear egress of progeny virions in mouse cells.

PubMed

Eichwald, Virginie; Daeffler, Laurent; Klein, Michèle; Rommelaere, Jean; Salomé, Nathalie

2002-10-01

The small nonstructural NS2 proteins of parvovirus minute virus of mice (MVMp) were previously shown to interact with the nuclear export receptor Crm1. We report here the analysis of two MVM mutant genomic clones generating NS2 proteins that are unable to interact with Crm1 as a result of amino acid substitutions within their nuclear export signal (NES) sequences. Upon transfection of human and mouse cells, the MVM-NES21 and MVM-NES22 mutant genomic clones were proficient in synthesis of the four virus-encoded proteins. While the MVM-NES22 clone was further able to produce infectious mutant virions, no virus could be recovered from cells transfected with the MVM-NES21 clone. Whereas the defect of MVM-NES21 appeared to be complex, the phenotype of MVM-NES22 could be traced back to a novel distinct NS2 function. Infection of mouse cells with the MVM-NES22 mutant led to stronger nuclear retention not only of the NS2 proteins but also of infectious progeny MVM particles. This nuclear sequestration correlated with a severe delay in the release of mutant virions in the medium and with prolonged survival of the infected cell populations compared with wild-type virus-treated cultures. This defect could explain, at least in part, the small size of the plaques generated by the MVM-NES22 mutant when assayed on mouse indicator cells. Altogether, our data indicate that the interaction of MVMp NS2 proteins with the nuclear export receptor Crm1 plays a critical role at a late stage of the parvovirus life cycle involved in release of progeny viruses.

The NS2 Proteins of Parvovirus Minute Virus of Mice Are Required for Efficient Nuclear Egress of Progeny Virions in Mouse Cells

PubMed Central

Eichwald, Virginie; Daeffler, Laurent; Klein, Michèle; Rommelaere, Jean; Salomé, Nathalie

2002-01-01

The small nonstructural NS2 proteins of parvovirus minute virus of mice (MVMp) were previously shown to interact with the nuclear export receptor Crm1. We report here the analysis of two MVM mutant genomic clones generating NS2 proteins that are unable to interact with Crm1 as a result of amino acid substitutions within their nuclear export signal (NES) sequences. Upon transfection of human and mouse cells, the MVM-NES21 and MVM-NES22 mutant genomic clones were proficient in synthesis of the four virus-encoded proteins. While the MVM-NES22 clone was further able to produce infectious mutant virions, no virus could be recovered from cells transfected with the MVM-NES21 clone. Whereas the defect of MVM-NES21 appeared to be complex, the phenotype of MVM-NES22 could be traced back to a novel distinct NS2 function. Infection of mouse cells with the MVM-NES22 mutant led to stronger nuclear retention not only of the NS2 proteins but also of infectious progeny MVM particles. This nuclear sequestration correlated with a severe delay in the release of mutant virions in the medium and with prolonged survival of the infected cell populations compared with wild-type virus-treated cultures. This defect could explain, at least in part, the small size of the plaques generated by the MVM-NES22 mutant when assayed on mouse indicator cells. Altogether, our data indicate that the interaction of MVMp NS2 proteins with the nuclear export receptor Crm1 plays a critical role at a late stage of the parvovirus life cycle involved in release of progeny viruses. PMID:12239307

Liver X receptors interfere with the deleterious effect of diethylstilbestrol on testicular physiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oumeddour, Abdelkader; CNRS, UMR 6293, GReD, F-63171 Aubiere; INSERM, UMR 1103, GReD, F-63171 Aubiere

Highlights: • Part of the neonatal effect of DES on testis needs the presence of Lxrα/β. • Some DES-induced pathways are blocked in Lxr-deficient mice. • Lxr-deficient mice analysis defines DES-target genes protected by Lxr. - Abstract: Liver X receptors LXRα (NR1H3) and LXRβ (NR1H2) are transcription factors belonging to the nuclear receptor superfamily, activated by specific oxysterols, oxidized derivatives of cholesterol. These receptors are involved in the regulation of testis physiology. Lxr-deficient mice pointed to the physiological roles of these nuclear receptors in steroid synthesis, lipid homeostasis and germ cell apoptosis and proliferation. Diethylstilbestrol (DES) is a synthetic estrogenmore » considered as an endocrine disruptor that affects the functions of the testis. Various lines of evidences have made a clear link between estrogens, their nuclear receptors ERα (NR3A1) and ERβ (NR3A2), and Lxrα/β. As LXR activity could also be regulated by the nuclear receptor small heterodimer partner (SHP, NR0A2) and DES could act through SHP, we wondered whether LXR could be targeted by estrogen-like endocrine disruptors such as DES. For that purpose, wild-type and Lxr-deficient mice were daily treated with 0.75 μg DES from days 1 to 5 after birth. The effects of DES were investigated at 10 or 45 days of age. We demonstrated that DES induced a decrease of the body mass at 10 days only in the Lxr-deficient mice suggesting a protective effect of Lxr. We defined three categories of DES-target genes in testis: those whose accumulation is independent of Lxr; those whose accumulation is enhanced by the lack of both Lxrα/β; those whose accumulation is repressed by the absence of Lxrα/β. Lipid accumulation is also modified by neonatal DES injection. Lxr-deficient mice present different lipid profiles, demonstrating that DES could have its effects in part due to Lxrα/β. Altogether, our study shows that both nuclear receptors Lxrα and Lxrβ are not only basally important for testicular physiology but could also have a preventive effect against estrogen-like endocrine disruptors.« less

Nuclear Receptors in Neurodegenerative Diseases

PubMed Central

Skerrett, Rebecca; Malm, Tarja; Landreth, Gary

2014-01-01

Nuclear receptors have generated substantial interest in the past decade as potential therapeutic targets for the treatment of neurodegenerative disorders. Despite years of effort, effective treatments for progressive neurodegenerative diseases such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease and ALS remain elusive, making non-classical drug targets such as nuclear receptors an attractive alternative. A substantial literature in mouse models of disease and several clinical trials have investigated the role of nuclear receptors in various neurodegenerative disorders, most prominently AD. These studies have met with mixed results, yet the majority of studies in mouse models report positive outcomes. The mechanisms by which nuclear receptor agonists affect disease pathology remain unclear. Deciphering the complex signaling underlying nuclear receptor action in neurodegenerative diseases is essential for understanding this variability in preclinical studies, and for the successful translation of nuclear receptor agonists into clinical therapies. PMID:24874548

Orphan nuclear receptor oestrogen-related receptor γ (ERRγ) plays a key role in hepatic cannabinoid receptor type 1-mediated induction of CYP7A1 gene expression

PubMed Central

Zhang, Yaochen; Kim, Don-Kyu; Lee, Ji-Min; Park, Seung Bum; Jeong, Won-IL; Kim, Seong Heon; Lee, In-Kyu; Lee, Chul-Ho; Chiang, John Y.L.; Choi, Hueng-Sik

2017-01-01

Bile acids are primarily synthesized from cholesterol in the liver and have important roles in dietary lipid absorption and cholesterol homoeostasis. Detailed roles of the orphan nuclear receptors regulating cholesterol 7α-hydroxylase (CYP7A1), the rate-limiting enzyme in bile acid synthesis, have not yet been fully elucidated. In the present study, we report that oestrogen-related receptor γ (ERRγ) is a novel transcriptional regulator of CYP7A1 expression. Activation of cannabinoid receptor type 1 (CB1 receptor) signalling induced ERRγ-mediated transcription of the CYP7A1 gene. Overexpression of ERRγ increased CYP7A1 expression in vitro and in vivo, whereas knockdown of ERRγ attenuated CYP7A1 expression. Deletion analysis of the CYP7A1 gene promoter and a ChIP assay revealed an ERRγ -binding site on the CYP7A1 gene promoter. Small heterodimer partner (SHP) inhibited the transcriptional activity of ERRγ and thus regulated CYP7A1 expression. Overexpression of ERRγ led to increased bile acid levels, whereas an inverse agonist of ERRγ, GSK5182, reduced CYP7A1 expression and bile acid synthesis. Finally, GSK5182 significantly reduced hepatic CB1 receptor-mediated induction of CYP7A1 expression and bile acid synthesis in alcohol-treated mice. These results provide the molecular mechanism linking ERRγ and bile acid metabolism. PMID:26348907

Nuclear Receptors, RXR, and the Big Bang.

PubMed

Evans, Ronald M; Mangelsdorf, David J

2014-03-27

Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.

Tyrosine dephosphorylation enhances the therapeutic target activity of epidermal growth factor receptor (EGFR) by disrupting its interaction with estrogen receptor (ER).

PubMed

Ma, Shao; Yin, Ning; Qi, Xiaomei; Pfister, Sandra L; Zhang, Mei-Jie; Ma, Rong; Chen, Guan

2015-05-30

Protein-protein interactions can increase or decrease its therapeutic target activity and the determining factors involved, however, are largely unknown. Here, we report that tyrosine-dephosphorylation of epidermal growth factor receptor (EGFR) increases its therapeutic target activity by disrupting its interaction with estrogen receptor (ER). Protein tyrosine phosphatase H1 (PTPH1) dephosphorylates the tyrosine kinase EGFR, disrupts its interaction with the nuclear receptor ER, and increases breast cancer sensitivity to small molecule tyrosine kinase inhibitors (TKIs). These effects require PTPH1 catalytic activity and its interaction with EGFR, suggesting that the phosphatase may increase the sensitivity by dephosphorylating EGFR leading to its dissociation with ER. Consistent with this notion, a nuclear-localization defective ER has a higher EGFR-binding activity and confers the resistance to TKI-induced growth inhibition. Additional analysis show that PTPH1 stabilizes EGFR, stimulates the membranous EGFR accumulation, and enhances the growth-inhibitory activity of a combination therapy of TKIs with an anti-estrogen. Since EGFR and ER both are substrates for PTPH1 in vitro and in intact cells, these results indicate that an inhibitory EGFR-ER protein complex can be switched off through a competitive enzyme-substrate binding. Our results would have important implications for the treatment of breast cancer with targeted therapeutics.

Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior

PubMed Central

Molenda, Heather A.; Kilts, Caitlin P.; Allen, Rachel L.; Tetel, Marc J.

2009-01-01

Gonadal steroid hormones act throughout the body to elicit changes in gene expression that result in profound effects on reproductive physiology and behavior. Steroid hormones exert many of these effects by binding to their respective intracellular receptors, which are members of a nuclear receptor superfamily of transcriptional activators. A variety of in vitro studies indicate that nuclear receptor coactivators are required for efficient transcriptional activity of steroid receptors. Many of these coactivators are found in a variety of steroid hormone-responsive reproductive tissues, including the reproductive tract, mammary gland, and brain. While many nuclear receptor coactivators have been investigated in vitro, we are only now beginning to understand their function in reproductive physiology and behavior. In this review, we discuss the general mechanisms of action of nuclear receptor coactivators in steroid-dependent gene transcription. We then review some recent and exciting findings on the function of nuclear receptor coactivators in steroid-dependent brain development and reproductive physiology and behavior. PMID:12855594

Identification of Gene Markers for Activation of the Nuclear Receptor Pregnane X Receptor

EPA Science Inventory

Many environmentally-relevant chemicals and drugs activate the nuclear receptor pregnane X receptor (PXR). Activation of PXR in the mouse liver can lead to increases in liver weight in part through increased hepatocyte replication similar to chemicals that activate other nuclear ...

COPI-mediated retrograde trafficking from the Golgi to the ER regulates EGFR nuclear transport

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Ying-Nai; Wang, Hongmei; Yamaguchi, Hirohito

2010-09-03

Research highlights: {yields} ARF1 activation is involved in the EGFR transport to the ER and the nucleus. {yields} Assembly of {gamma}-COP coatomer mediates EGFR transport to the ER and the nucleus. {yields} Golgi-to-ER retrograde trafficking regulates nuclear transport of EGFR. -- Abstract: Emerging evidence indicates that cell surface receptors, such as the entire epidermal growth factor receptor (EGFR) family, have been shown to localize in the nucleus. A retrograde route from the Golgi to the endoplasmic reticulum (ER) is postulated to be involved in the EGFR trafficking to the nucleus; however, the molecular mechanism in this proposed model remains unexplored.more » Here, we demonstrate that membrane-embedded vesicular trafficking is involved in the nuclear transport of EGFR. Confocal immunofluorescence reveals that in response to EGF, a portion of EGFR redistributes to the Golgi and the ER, where its NH{sub 2}-terminus resides within the lumen of Golgi/ER and COOH-terminus is exposed to the cytoplasm. Blockage of the Golgi-to-ER retrograde trafficking by brefeldin A or dominant mutants of the small GTPase ADP-ribosylation factor, which both resulted in the disassembly of the coat protein complex I (COPI) coat to the Golgi, inhibit EGFR transport to the ER and the nucleus. We further find that EGF-dependent nuclear transport of EGFR is regulated by retrograde trafficking from the Golgi to the ER involving an association of EGFR with {gamma}-COP, one of the subunits of the COPI coatomer. Our findings experimentally provide a comprehensive pathway that nuclear transport of EGFR is regulated by COPI-mediated vesicular trafficking from the Golgi to the ER, and may serve as a general mechanism in regulating the nuclear transport of other cell surface receptors.« less

The Biarylpyrazole Compound AM251 Alters Mitochondrial Physiology via Proteolytic Degradation of ERRα

PubMed Central

Krzysik-Walker, Susan M.; González-Mariscal, Isabel; Scheibye-Knudsen, Morten; Indig, Fred E.

2013-01-01

The orphan nuclear receptor estrogen-related receptor alpha (ERRα) directs the transcription of nuclear genes involved in energy homeostasis control and the regulation of mitochondrial mass and function. A crucial role for controlling ERRα-mediated target gene expression has been ascribed to the biarylpyrazole compound 1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-1-piperidinyl-1H-pyrazole-3-carboxamide (AM251) through direct binding to and destabilization of ERRα protein. Here, we provide evidence that structurally related AM251 analogs also have negative impacts on ERRα protein levels in a cell-type-dependent manner while having no deleterious actions on ERRγ. We show that these off-target cellular effects of AM251 are mediated by proteasomal degradation of nuclear ERRα. Cell treatment with the nuclear export inhibitor leptomycin B did not prevent AM251-induced destabilization of ERRα protein, whereas proteasome inhibition with MG132 stabilized and maintained its DNA-binding function, indicative of ERRα being a target of nuclear proteasomal complexes. NativePAGE analysis revealed that ERRα formed a ∼220-kDa multiprotein nuclear complex that was devoid of ERRγ and the coregulator peroxisome proliferator-activated receptor γ coactivator-1. AM251 induced SUMO-2,3 incorporation in ERRα in conjunction with increased protein kinase C activity, whose activation by phorbol ester also promoted ERRα protein loss. Down-regulation of ERRα by AM251 or small interfering RNA led to increased mitochondria biogenesis while negatively impacting mitochondrial membrane potential. These results reveal a novel molecular mechanism by which AM251 and related compounds alter mitochondrial physiology through destabilization of ERRα. PMID:23066093

Peptide hormones and lung cancer.

PubMed

Moody, T W

2006-03-01

Several peptide hormones have been identified which alter the proliferation of lung cancer. Small cell lung cancer (SCLC), which is a neuroendocrine cancer, produces and secretes gastrin releasing peptide (GRP), neurotensin (NT) and adrenomedullin (AM) as autocrine growth factors. GRP, NT and AM bind to G-protein coupled receptors causing phosphatidylinositol turnover or elevated cAMP in SCLC cells. Addition of GRP, NT or AM to SCLC cells causes altered expression of nuclear oncogenes, such as c-fos, and stimulation of growth. Antagonists have been developed for GRP, NT and AM receptors which function as cytostatic agents and inhibit SCLC growth. Growth factor antagonists, such as the NT1 receptor antagonist SR48692, facilitate the ability of chemotherapeutic drugs to kill lung cancer cells. It remains to be determined if GRP, NT and AM receptors will served as molecular targets, for development of new therapies for the treatment of SCLC patients. Non-small cell lung cancer (NSCLC) cells also have a high density of GRP, NT, AM and epidermal growth factor (EGF) receptors. Several NSCLC patients with EGF receptor mutations respond to gefitinib, a tyrosine kinase inhibitor. Gefitinib relieves NSCLC symptoms, maintaining stable disease in patients who are not eligible for systemic chemotherapy. It is important to develop new therapeutic approaches using translational research techniques for the treatment of lung cancer patients.

PGE2 mediates EGFR internalization and nuclear translocation via caveolin endocytosis promoting its transcriptional activity and proliferation in human NSCLC cells

PubMed Central

Bazzani, Lorenzo; Donnini, Sandra; Giachetti, Antonio; Christofori, Gerhard; Ziche, Marina

2018-01-01

Prostaglandin E2 (PGE2) contributes to tumor progression by promoting cancer cell growth, invasion and by creating a favorable pro-tumor microenvironment. PGE2 has been reported to transactivate and internalize into the nucleus receptor tyrosine kinases such as Epidermal growth factor receptor (EGFR), thereby supporting tumor progression. Here we demonstrate that in non-small cell lung carcinoma (NSCLC) cells, PGE2 induces EGFR nuclear translocation via different dynamin-dependent endocytic pathways, promotes the formation of an EGFR-STAT3 complex, affects nuclear EGFR target gene expression and mediates tumor cell proliferation. Indeed, we find that PGE2 induces EGFR internalization and consequent nuclear import through Clathrin- and Caveolin-mediated endocytosis and through the interaction of EGFR with Importin β1. Within the nucleus, EGFR forms a complex with STAT3, an event blocked by ablation of Clathrin Heavy Chain or Caveolin-1. The combination of EGF and PGE2 prolongs nuclear EGFR transcriptional activity manifested by the upregulation of CCND1, PTGS2, MYC and NOS2 mRNA levels and potentiates nuclear EGFR-induced NSCLC cell proliferation. Additionally, NSCLC patients with high expression of a nuclear EGFR gene signature display shorter survival times than those with low expression, thus showing a putative correlation between nuclear EGFR and poor prognosis in NSCLC. Together, our findings indicate a complex mechanism underlying PGE2-induced EGF/EGFR signaling and transcriptional control, which plays a key role in cancer progression. PMID:29599917

PGE2 mediates EGFR internalization and nuclear translocation via caveolin endocytosis promoting its transcriptional activity and proliferation in human NSCLC cells.

PubMed

Bazzani, Lorenzo; Donnini, Sandra; Giachetti, Antonio; Christofori, Gerhard; Ziche, Marina

2018-03-13

Prostaglandin E 2 (PGE 2 ) contributes to tumor progression by promoting cancer cell growth, invasion and by creating a favorable pro-tumor microenvironment. PGE 2 has been reported to transactivate and internalize into the nucleus receptor tyrosine kinases such as Epidermal growth factor receptor (EGFR), thereby supporting tumor progression. Here we demonstrate that in non-small cell lung carcinoma (NSCLC) cells, PGE 2 induces EGFR nuclear translocation via different dynamin-dependent endocytic pathways, promotes the formation of an EGFR-STAT3 complex, affects nuclear EGFR target gene expression and mediates tumor cell proliferation. Indeed, we find that PGE 2 induces EGFR internalization and consequent nuclear import through Clathrin- and Caveolin-mediated endocytosis and through the interaction of EGFR with Importin β1. Within the nucleus, EGFR forms a complex with STAT3, an event blocked by ablation of Clathrin Heavy Chain or Caveolin-1. The combination of EGF and PGE 2 prolongs nuclear EGFR transcriptional activity manifested by the upregulation of CCND1 , PTGS2 , MYC and NOS2 mRNA levels and potentiates nuclear EGFR-induced NSCLC cell proliferation. Additionally, NSCLC patients with high expression of a nuclear EGFR gene signature display shorter survival times than those with low expression, thus showing a putative correlation between nuclear EGFR and poor prognosis in NSCLC. Together, our findings indicate a complex mechanism underlying PGE 2 -induced EGF/EGFR signaling and transcriptional control, which plays a key role in cancer progression.

SMILE, a new orphan nuclear receptor SHP-interacting protein, regulates SHP-repressed estrogen receptor transactivation.

PubMed

Xie, Yuan-Bin; Lee, Ok-Hee; Nedumaran, Balachandar; Seong, Hyun-A; Lee, Kyeong-Min; Ha, Hyunjung; Lee, In-Kyu; Yun, Yungdae; Choi, Hueng-Sik

2008-12-15

SHP (small heterodimer partner) is a well-known NR (nuclear receptor) co-regulator. In the present study, we have identified a new SHP-interacting protein, termed SMILE (SHP-interacting leucine zipper protein), which was previously designated as ZF (Zhangfei) via a yeast two-hybrid system. We have determined that the SMILE gene generates two isoforms [SMILE-L (long isoform of SMILE) and SMILE-S (short isoform of SMILE)]. Mutational analysis has demonstrated that the SMILE isoforms arise from the alternative usage of initiation codons. We have confirmed the in vivo interaction and co-localization of the SMILE isoforms and SHP. Domain-mapping analysis indicates that the entire N-terminus of SHP and the middle region of SMILE-L are involved in this interaction. Interestingly, the SMILE isoforms counteract the SHP repressive effect on the transactivation of ERs (estrogen receptors) in HEK-293T cells (human embryonic kidney cells expressing the large T-antigen of simian virus 40), but enhance the SHP-repressive effect in MCF-7, T47D and MDA-MB-435 cells. Knockdown of SMILE gene expression using siRNA (small interfering RNA) in MCF-7 cells increases ER-mediated transcriptional activity. Moreover, adenovirus-mediated overexpression of SMILE and SHP down-regulates estrogen-induced mRNA expression of the critical cell-cycle regulator E2F1. Collectively, these results indicate that SMILE isoforms regulate the inhibition of ER transactivation by SHP in a cell-type-specific manner and act as a novel transcriptional co-regulator in ER signalling.

Protein kinase A is part of a mechanism that regulates nuclear reimport of the nuclear tRNA export receptors Los1p and Msn5p.

PubMed

Pierce, Jacqueline B; van der Merwe, George; Mangroo, Dev

2014-02-01

The two main signal transduction mechanisms that allow eukaryotes to sense and respond to changes in glucose availability in the environment are the cyclic AMP (cAMP)/protein kinase A (PKA) and AMP-activated protein kinase (AMPK)/Snf1 kinase-dependent pathways. Previous studies have shown that the nuclear tRNA export process is inhibited in Saccharomyces cerevisiae deprived of glucose. However, the signal transduction pathway involved and the mechanism by which glucose availability regulates nuclear-cytoplasmic tRNA trafficking are not understood. Here, we show that inhibition of nuclear tRNA export is caused by a block in nuclear reimport of the tRNA export receptors during glucose deprivation. Cytoplasmic accumulation of the tRNA export receptors during glucose deprivation is not caused by activation of Snf1p. Evidence obtained suggests that PKA is part of the mechanism that regulates nuclear reimport of the tRNA export receptors in response to glucose availability. This mechanism does not appear to involve phosphorylation of the nuclear tRNA export receptors by PKA. The block in nuclear reimport of the tRNA export receptors appears to be caused by activation of an unidentified mechanism when PKA is turned off during glucose deprivation. Taken together, the data suggest that PKA facilitates return of the tRNA export receptors to the nucleus by inhibiting an unidentified activity that facilitates cytoplasmic accumulation of the tRNA export receptors when glucose in the environment is limiting. A PKA-independent mechanism was also found to regulate nuclear tRNA export in response to glucose availability. This mechanism, however, does not regulate nuclear reimport of the tRNA export receptors.

Protein Kinase A Is Part of a Mechanism That Regulates Nuclear Reimport of the Nuclear tRNA Export Receptors Los1p and Msn5p

PubMed Central

Pierce, Jacqueline B.; van der Merwe, George

2014-01-01

The two main signal transduction mechanisms that allow eukaryotes to sense and respond to changes in glucose availability in the environment are the cyclic AMP (cAMP)/protein kinase A (PKA) and AMP-activated protein kinase (AMPK)/Snf1 kinase-dependent pathways. Previous studies have shown that the nuclear tRNA export process is inhibited in Saccharomyces cerevisiae deprived of glucose. However, the signal transduction pathway involved and the mechanism by which glucose availability regulates nuclear-cytoplasmic tRNA trafficking are not understood. Here, we show that inhibition of nuclear tRNA export is caused by a block in nuclear reimport of the tRNA export receptors during glucose deprivation. Cytoplasmic accumulation of the tRNA export receptors during glucose deprivation is not caused by activation of Snf1p. Evidence obtained suggests that PKA is part of the mechanism that regulates nuclear reimport of the tRNA export receptors in response to glucose availability. This mechanism does not appear to involve phosphorylation of the nuclear tRNA export receptors by PKA. The block in nuclear reimport of the tRNA export receptors appears to be caused by activation of an unidentified mechanism when PKA is turned off during glucose deprivation. Taken together, the data suggest that PKA facilitates return of the tRNA export receptors to the nucleus by inhibiting an unidentified activity that facilitates cytoplasmic accumulation of the tRNA export receptors when glucose in the environment is limiting. A PKA-independent mechanism was also found to regulate nuclear tRNA export in response to glucose availability. This mechanism, however, does not regulate nuclear reimport of the tRNA export receptors. PMID:24297441

RNA Export through the NPC in Eukaryotes.

PubMed

Okamura, Masumi; Inose, Haruko; Masuda, Seiji

2015-03-20

In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC.

RNA Export through the NPC in Eukaryotes

PubMed Central

Okamura, Masumi; Inose, Haruko; Masuda, Seiji

2015-01-01

In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC. PMID:25802992

Nuclear receptors in bile acid metabolism

PubMed Central

Li, Tiangang; Chiang, John Y. L.

2013-01-01

Bile acids are signaling molecules that activate nuclear receptors, such as farnesoid X receptor, pregnane X receptor, constitutive androstane receptor, and vitamin D receptor, and play a critical role in the regulation of lipid, glucose, energy, and drug metabolism. These xenobiotic/endobiotic-sensing nuclear receptors regulate phase I oxidation, phase II conjugation, and phase III transport in bile acid and drug metabolism in the digestive system. Integration of bile acid metabolism with drug metabolism controls absorption, transport, and metabolism of nutrients and drugs to maintain metabolic homeostasis and also protects against liver injury, inflammation, and related metabolic diseases, such as nonalcoholic fatty liver disease, diabetes, and obesity. Bile-acid–based drugs targeting nuclear receptors are in clinical trials for treating cholestatic liver diseases and fatty liver disease. PMID:23330546

REV-ERB and ROR nuclear receptors as drug targets

PubMed Central

Kojetin, Douglas J.; Burris, Thomas P.

2016-01-01

The nuclear receptors REV-ERB (consisting of REV-ERBα and REV-ERBβ) and retinoic acid receptor-related orphan receptors (RORs; consisting of RORα, RORβ and RORγ) are involved in many physiological processes, including regulation of metabolism, development and immunity as well as the circadian rhythm. The recent characterization of endogenous ligands for these former orphan nuclear receptors has stimulated the development of synthetic ligands and opened up the possibility of targeting these receptors to treat several diseases, including diabetes, atherosclerosis, autoimmunity and cancer. This Review focuses on the latest developments in ROR and REV-ERB pharmacology indicating that these nuclear receptors are druggable targets and that ligands targeting these receptors may be useful in the treatment of several disorders. PMID:24577401

The nuclear tRNA aminoacylation-dependent pathway may be the principal route used to export tRNA from the nucleus in Saccharomyces cerevisiae.

PubMed

Steiner-Mosonyi, Marta; Mangroo, Dev

2004-03-15

Nuclear tRNA export in Saccharomyces cerevisiae has been proposed to involve three pathways, designated Los1p-dependent, Los1p-independent nuclear aminoacylation-dependent, and Los1p- and nuclear aminoacylation-independent. Here, a comprehensive biochemical analysis was performed to identify tRNAs exported by the aminoacylation-dependent and -independent pathways of S. cerevisiae. Interestingly, the major tRNA species of at least 19 families were found in the aminoacylated form in the nucleus. tRNAs known to be exported by the export receptor Los1p were also aminoacylated in the nucleus of both wild-type and mutant Los1p strains. FISH (fluorescence in situ hybridization) analyses showed that tRNA(Tyr) co-localizes with the U18 small nucleolar RNA in the nucleolus of a tyrosyl-tRNA synthetase mutant strain defective in nuclear tRNA(Tyr) export because of a block in nuclear tRNA(Tyr) aminoacylation. tRNA(Tyr) was also found in the nucleolus of a utp8 mutant strain defective in nuclear tRNA export but not nuclear tRNA aminoacylation. These results strongly suggest that the nuclear aminoacylation-dependent pathway is principally responsible for tRNA export in S. cerevisiae and that Los1p is an export receptor of this pathway. It is also likely that in mammalian cells tRNAs are mainly exported from the nucleus by the nuclear aminoacylation-dependent pathway. In addition, the data are consistent with the idea that nuclear aminoacylation is used as a quality control mechanism for ensuring nuclear export of only mature and functional tRNAs, and that this quality assurance step occurs in the nucleolus.

Nanoscale stiffness topography reveals structure and mechanics of the transport barrier in intact nuclear pore complexes.

PubMed

Bestembayeva, Aizhan; Kramer, Armin; Labokha, Aksana A; Osmanović, Dino; Liashkovich, Ivan; Orlova, Elena V; Ford, Ian J; Charras, Guillaume; Fassati, Ariberto; Hoogenboom, Bart W

2015-01-01

The nuclear pore complex (NPC) is the gate for transport between the cell nucleus and the cytoplasm. Small molecules cross the NPC by passive diffusion, but molecules larger than ∼5 nm must bind to nuclear transport receptors to overcome a selective barrier within the NPC. Although the structure and shape of the cytoplasmic ring of the NPC are relatively well characterized, the selective barrier is situated deep within the central channel of the NPC and depends critically on unstructured nuclear pore proteins, and is therefore not well understood. Here, we show that stiffness topography with sharp atomic force microscopy tips can generate nanoscale cross-sections of the NPC. The cross-sections reveal two distinct structures, a cytoplasmic ring and a central plug structure, which are consistent with the three-dimensional NPC structure derived from electron microscopy. The central plug persists after reactivation of the transport cycle and resultant cargo release, indicating that the plug is an intrinsic part of the NPC barrier. Added nuclear transport receptors accumulate on the intact transport barrier and lead to a homogenization of the barrier stiffness. The observed nanomechanical properties in the NPC indicate the presence of a cohesive barrier to transport and are quantitatively consistent with the presence of a central condensate of nuclear pore proteins in the NPC channel.

Nanoscale stiffness topography reveals structure and mechanics of the transport barrier in intact nuclear pore complexes

PubMed Central

Labokha, Aksana A.; Osmanović, Dino; Liashkovich, Ivan; Orlova, Elena V.; Ford, Ian J.; Charras, Guillaume; Fassati, Ariberto; Hoogenboom, Bart W.

2014-01-01

The nuclear pore complex (NPC) is the gate for transport between the cell nucleus and the cytoplasm. Small molecules cross the NPC by passive diffusion, but molecules larger than ~5 nm must bind to nuclear transport receptors to overcome a selective barrier within the NPC1. Whilst the structure and shape of the cytoplasmic ring of the NPC are relatively well characterized2-5, the selective barrier is situated deep within the central channel of the NPC and depends critically on unstructured nuclear pore proteins5,6, and is therefore not well understood. Here, we show that stiffness topography7 with sharp atomic force microscopy tips can generate nanoscale cross sections of the NPC. The cross sections reveal two distinct structures, a cytoplasmic ring and a central plug structure, which are consistent with the three-dimensional NPC structure derived from electron microscopy2-5. The central plug persists after reactivation of the transport cycle and resultant cargo release, indicating that the plug is an intrinsic part of the NPC barrier. Added nuclear transport receptors accumulate on the intact transport barrier and lead to a homogenization of the barrier stiffness. The observed nanomechanical properties in the NPC indicate the presence of a cohesive barrier to transport, and are quantitatively consistent with the presence of a central condensate of nuclear pore proteins in the NPC channel. PMID:25420031

Nanoscale stiffness topography reveals structure and mechanics of the transport barrier in intact nuclear pore complexes

NASA Astrophysics Data System (ADS)

Bestembayeva, Aizhan; Kramer, Armin; Labokha, Aksana A.; Osmanović, Dino; Liashkovich, Ivan; Orlova, Elena V.; Ford, Ian J.; Charras, Guillaume; Fassati, Ariberto; Hoogenboom, Bart W.

2015-01-01

The nuclear pore complex (NPC) is the gate for transport between the cell nucleus and the cytoplasm. Small molecules cross the NPC by passive diffusion, but molecules larger than ∼5 nm must bind to nuclear transport receptors to overcome a selective barrier within the NPC. Although the structure and shape of the cytoplasmic ring of the NPC are relatively well characterized, the selective barrier is situated deep within the central channel of the NPC and depends critically on unstructured nuclear pore proteins, and is therefore not well understood. Here, we show that stiffness topography with sharp atomic force microscopy tips can generate nanoscale cross-sections of the NPC. The cross-sections reveal two distinct structures, a cytoplasmic ring and a central plug structure, which are consistent with the three-dimensional NPC structure derived from electron microscopy. The central plug persists after reactivation of the transport cycle and resultant cargo release, indicating that the plug is an intrinsic part of the NPC barrier. Added nuclear transport receptors accumulate on the intact transport barrier and lead to a homogenization of the barrier stiffness. The observed nanomechanical properties in the NPC indicate the presence of a cohesive barrier to transport and are quantitatively consistent with the presence of a central condensate of nuclear pore proteins in the NPC channel.

Regulation of Small Ubiquitin-Like Modifier-1, Nuclear Receptor Coreceptor, Histone Deacetylase 3, and Peroxisome Proliferator-Activated Receptor-γ in Human Adipose Tissue

PubMed Central

Bodles-Brakhop, Angela M.; Yao-Borengasser, Aiwei; Zhu, Beibei; Starnes, Catherine P.; McGehee, Robert E.; Peterson, Charlotte A.; Kern, Philip A.

2012-01-01

Abstract Background This study investigated the regulation of peroxisome proliferator-activated receptor-γ (PPARγ), the histone deacetylase 3 (HDAC3)–nuclear receptor coreceptor (NCoR) complex (a corepressor of transcription used by PPARγ), and small ubiquitin-like modifier-1 (SUMO-1) (a posttranslational modifier of PPARγ) in human adipose tissue and both adipocyte and macrophage cell lines. The objective was to determine whether there were alterations in the human adipose tissue gene expression levels of PPARγ, HDAC3, NCoR, and SUMO-1 associated either with obesity or with treatment of impaired glucose tolerance (IGT) subjects with insulin-sensitizing medications. Methods We obtained subcutaneous adipose tissue biopsies from 86 subjects with a wide range of body mass index (BMI) and insulin sensitivity (SI). Additionally, adipose tissue biopsies were obtained from a randomized subgroup of IGT subjects before and after 10 weeks of treatment with either pioglitazone or metformin. Results The adipose mRNA levels of PPARγ, NCoR, HDAC3, and SUMO-1 correlated strongly with each other (P<0.0001); however, SUMO-1, NCoR, and HDAC3 gene expression were not significantly associated with BMI or SI. Pioglitazone increased SUMO-1 expression by 23% (P<0.002) in adipose tissue and an adipocyte cell line (P<0.05), but not in macrophages. Small interfering RNA (siRNA)-mediated knockdown of SUMO-1 decreased PPARγ, HDAC3, and NCoR in THP-1 cells and increased tumor necrosis factor-α (TNF-α) induction in response to lipopolysaccharide (LPS). Conclusions These results suggest that the coordinate regulation of SUMO-1, PPARγ1/2, HDAC3, and NCoR may be more tightly controlled in macrophages than in adipocytes in human adipose and that these modulators of PPARγ activity may be particularly important in the negative regulation of macrophage-mediated adipose inflammation by pioglitazone. PMID:22651256

Improved prediction of drug-target interactions using regularized least squares integrating with kernel fusion technique.

PubMed

Hao, Ming; Wang, Yanli; Bryant, Stephen H

2016-02-25

Identification of drug-target interactions (DTI) is a central task in drug discovery processes. In this work, a simple but effective regularized least squares integrating with nonlinear kernel fusion (RLS-KF) algorithm is proposed to perform DTI predictions. Using benchmark DTI datasets, our proposed algorithm achieves the state-of-the-art results with area under precision-recall curve (AUPR) of 0.915, 0.925, 0.853 and 0.909 for enzymes, ion channels (IC), G protein-coupled receptors (GPCR) and nuclear receptors (NR) based on 10 fold cross-validation. The performance can further be improved by using a recalculated kernel matrix, especially for the small set of nuclear receptors with AUPR of 0.945. Importantly, most of the top ranked interaction predictions can be validated by experimental data reported in the literature, bioassay results in the PubChem BioAssay database, as well as other previous studies. Our analysis suggests that the proposed RLS-KF is helpful for studying DTI, drug repositioning as well as polypharmacology, and may help to accelerate drug discovery by identifying novel drug targets. Published by Elsevier B.V.

Selectivity Mechanism of the Nuclear Pore Complex Characterized by Single Cargo Tracking

PubMed Central

Lowe, Alan R.; Siegel, Jake J.; Kalab, Petr; Siu, Merek; Weis, Karsten; Liphardt, Jan T.

2010-01-01

The Nuclear Pore Complex (NPC) mediates all exchange between the cytoplasm and the nucleus. Small molecules can passively diffuse through the NPC, while larger cargos require transport receptors to translocate1. How the NPC facilitates the translocation of transport receptor/cargo complexes remains unclear. Here, we track single protein-functionalized Quantum Dot (QD) cargos as they translocate the NPC. Import proceeds by successive sub-steps comprising cargo capture, filtering and translocation, and release into the nucleus. The majority of QDs are rejected at one of these steps and return to the cytoplasm including very large cargos that abort at a size-selective barrier. Cargo movement in the central channel is subdiffusive and cargos that can bind more transport receptors diffuse more freely. Without Ran, cargos still explore the entire NPC, but have a markedly reduced probability of exit into the nucleus, suggesting that NPC entry and exit steps are not equivalent and that the pore is functionally asymmetric to importing cargos. The overall selectivity of the NPC appears to arise from the cumulative action of multiple reversible sub-steps and a final irreversible exit step. PMID:20811366

Structural insights into FRS2α PTB domain recognition by neurotrophin receptor TrkB.

PubMed

Zeng, Lei; Kuti, Miklos; Mujtaba, Shiraz; Zhou, Ming-Ming

2014-07-01

The fibroblast growth factor receptor (FGFR) substrate 2 (FRS2) family proteins function as scaffolding adapters for receptor tyrosine kinases (RTKs). The FRS2α proteins interact with RTKs through the phosphotyrosine-binding (PTB) domain and transfer signals from the activated receptors to downstream effector proteins. Here, we report the nuclear magnetic resonance structure of the FRS2α PTB domain bound to phosphorylated TrkB. The structure reveals that the FRS2α-PTB domain is comprised of two distinct but adjacent pockets for its mutually exclusive interaction with either nonphosphorylated juxtamembrane region of the FGFR, or tyrosine phosphorylated peptides TrkA and TrkB. The new structural insights suggest rational design of selective small molecules through targeting of the two conjunct pockets in the FRS2α PTB domain. © 2014 Wiley Periodicals, Inc.

International Union of Basic and Clinical Pharmacology. XC. multisite pharmacology: recommendations for the nomenclature of receptor allosterism and allosteric ligands.

PubMed

Christopoulos, Arthur; Changeux, Jean-Pierre; Catterall, William A; Fabbro, Doriano; Burris, Thomas P; Cidlowski, John A; Olsen, Richard W; Peters, John A; Neubig, Richard R; Pin, Jean-Philippe; Sexton, Patrick M; Kenakin, Terry P; Ehlert, Frederick J; Spedding, Michael; Langmead, Christopher J

2014-10-01

Allosteric interactions play vital roles in metabolic processes and signal transduction and, more recently, have become the focus of numerous pharmacological studies because of the potential for discovering more target-selective chemical probes and therapeutic agents. In addition to classic early studies on enzymes, there are now examples of small molecule allosteric modulators for all superfamilies of receptors encoded by the genome, including ligand- and voltage-gated ion channels, G protein-coupled receptors, nuclear hormone receptors, and receptor tyrosine kinases. As a consequence, a vast array of pharmacologic behaviors has been ascribed to allosteric ligands that can vary in a target-, ligand-, and cell-/tissue-dependent manner. The current article presents an overview of allostery as applied to receptor families and approaches for detecting and validating allosteric interactions and gives recommendations for the nomenclature of allosteric ligands and their properties. U.S. Government work not protected by U.S. copyright.

Benzo[ghi]perylene activates the AHR pathway to exert biological effects on the NL-20 human bronchial cell line.

PubMed

Zaragoza-Ojeda, Montserrat; Eguía-Aguilar, Pilar; Perezpeña-Díazconti, Mario; Arenas-Huertero, Francisco

2016-08-10

Polycyclic aromatic hydrocarbons (PAH) are produced by incomplete combustion of organic material. In the Mexico City atmosphere, the most abundant PAH is benzo[ghi]perylene (BghiP), a gasoline combustion marker. At present, there are no reports of the effects of BghiP on human bronchial cells, so the aim of the study was to evaluate the effects in vitro of BghiP on the NL-20 cell line. Results showed that BghiP induced the formation of small vesicles throughout the cytoplasm, with absence of nuclear fragmentation. At 48h exposition, damage in cell membrane increased significantly at 1.24μg/mL of BghiP (p<0.05). Immunocytochemistry revealed that BghiP provokes nuclear translocation of AhR receptor, which indicates that this compound can induce transcription of genes via receptor binding (AhR pathway activation). BghiP induced a two-fold increase (p<0.05) in the expression of AhR and CYP4B1 (a lung-specific pathway effector). In the presence of the receptor antagonist CH-223191, the loss of viability, the nuclear translocation and the overexpression of genes decreased, though this did not prevent the formation of vesicles. BghiP induced oxidative stress and in presence of the receptor antagonist this increased significantly. In conclusion, BghiP can activate the overexpression of AhR and CYP4B1, and the effects are abated by the AhR receptor antagonist. This is the first report to prove that BghiP utilizes the AhR pathway to exert its toxic effects on the NL-20 human bronchial cell line . Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

NR4A nuclear receptors support memory enhancement by histone deacetylase inhibitors

PubMed Central

Hawk, Joshua D.; Bookout, Angie L.; Poplawski, Shane G.; Bridi, Morgan; Rao, Allison J.; Sulewski, Michael E.; Kroener, Brian T.; Manglesdorf, David J.; Abel, Ted

2012-01-01

The formation of a long-lasting memory requires a transcription-dependent consolidation period that converts a short-term memory into a long-term memory. Nuclear receptors compose a class of transcription factors that regulate diverse biological processes, and several nuclear receptors have been implicated in memory formation. Here, we examined the potential contribution of nuclear receptors to memory consolidation by measuring the expression of all 49 murine nuclear receptors after learning. We identified 13 nuclear receptors with increased expression after learning, including all 3 members of the Nr4a subfamily. These CREB-regulated Nr4a genes encode ligand-independent “orphan” nuclear receptors. We found that blocking NR4A activity in memory-supporting brain regions impaired long-term memory but did not impact short-term memory in mice. Further, expression of Nr4a genes increased following the memory-enhancing effects of histone deacetylase (HDAC) inhibitors. Blocking NR4A signaling interfered with the ability of HDAC inhibitors to enhance memory. These results demonstrate that the Nr4a gene family contributes to memory formation and is a promising target for improving cognitive function. PMID:22996661

Targeting nuclear receptors for the treatment of fatty liver disease.

PubMed

Tanaka, Naoki; Aoyama, Toshifumi; Kimura, Shioko; Gonzalez, Frank J

2017-11-01

Ligand-activated nuclear receptors, including peroxisome proliferator-activated receptor alpha (PPARα), pregnane X receptor, and constitutive androstane receptor, were first identified as key regulators of the responses against chemical toxicants. However, numerous studies using mouse disease models and human samples have revealed critical roles for these receptors and others, such as PPARβ/δ, PPARγ, farnesoid X receptor (FXR), and liver X receptor (LXR), in maintaining nutrient/energy homeostasis in part through modulation of the gut-liver-adipose axis. Recently, disorders associated with disrupted nutrient/energy homeostasis, e.g., obesity, metabolic syndrome, and non-alcoholic fatty liver disease (NAFLD), are increasing worldwide. Notably, in NAFLD, a progressive subtype exists, designated as non-alcoholic steatohepatitis (NASH) that is characterized by typical histological features resembling alcoholic steatohepatitis (ASH), and NASH/ASH are recognized as major causes of hepatitis virus-unrelated liver cirrhosis and hepatocellular carcinoma. Since hepatic steatosis is basically caused by an imbalance between fat/energy influx and utilization, abnormal signaling of these nuclear receptors contribute to the pathogenesis of fatty liver disease. Standard therapeutic interventions have not been fully established for fatty liver disease, but some new agents that activate or inhibit nuclear receptor signaling have shown promise as possible therapeutic targets. In this review, we summarize recent findings on the roles of nuclear receptors in fatty liver disease and discuss future perspectives to develop promising pharmacological strategies targeting nuclear receptors for NAFLD/NASH. Copyright © 2017 Elsevier Inc. All rights reserved.

Characterization of a Novel Small Molecule Subtype Specific Estrogen-Related Receptor α Antagonist in MCF-7 Breast Cancer Cells

PubMed Central

Chisamore, Michael J.; Cunningham, Michael E.; Flores, Osvaldo; Wilkinson, Hilary A.; Chen, J. Don

2009-01-01

Background The orphan nuclear receptor estrogen-related receptor α (ERRα) is a member of the nuclear receptor superfamily. It was identified through a search for genes encoding proteins related to estrogen receptor α (ERα). An endogenous ligand has not been found. Novel ERRα antagonists that are highly specific for binding to the ligand binding domain (LBD) of ERRα have been recently reported. Research suggests that ERRα may be a novel drug target to treat breast cancer and/or metabolic disorders and this has led to an effort to characterize the mechanisms of action of N-[(2Z)-3-(4,5-dihydro-1,3-thiazol-2-yl)-1,3-thiazolidin-2-yl idene]-5H dibenzo[a,d][7]annulen-5-amine, a novel ERRα specific antagonist. Methodology/Principal Findings We demonstrate this ERRα ligand inhibits ERRα transcriptional activity in MCF-7 cells by luciferase assay but does not affect mRNA levels measured by real-time RT-PCR. Also, ERα (ESR1) mRNA levels were not affected upon treatment with the ERRα antagonist, but other ERRα (ESRRA) target genes such as pS2 (TFF1), osteopontin (SPP1), and aromatase (CYP19A1) mRNA levels decreased. In vitro, the ERRα antagonist prevents the constitutive interaction between ERRα and nuclear receptor coactivators. Furthermore, we use Western blots to demonstrate ERRα protein degradation via the ubiquitin proteasome pathway is increased by the ERRα-subtype specific antagonist. We demonstrate by chromatin immunoprecipitation (ChIP) that the interaction between ACADM, ESRRA, and TFF1 endogenous gene promoters and ERRα protein is decreased when cells are treated with the ligand. Knocking-down ERRα (shRNA) led to similar genomic effects seen when MCF-7 cells were treated with our ERRα antagonist. Conclusions/Significance We report the mechanism of action of a novel ERRα specific antagonist that inhibits transcriptional activity of ERRα, disrupts the constitutive interaction between ERRα and nuclear coactivators, and induces proteasome-dependent ERRα protein degradation. Additionally, we confirmed that knocking-down ERRα lead to similar genomic effects demonstrated in vitro when treated with the ERRα specific antagonist. PMID:19462000

Computational identification of post-translational modification-based nuclear import regulations by characterizing nuclear localization signal-import receptor interaction.

PubMed

Lin, Jhih-Rong; Liu, Zhonghao; Hu, Jianjun

2014-10-01

The binding affinity between a nuclear localization signal (NLS) and its import receptor is closely related to corresponding nuclear import activity. PTM-based modulation of the NLS binding affinity to the import receptor is one of the most understood mechanisms to regulate nuclear import of proteins. However, identification of such regulation mechanisms is challenging due to the difficulty of assessing the impact of PTM on corresponding nuclear import activities. In this study we proposed NIpredict, an effective algorithm to predict nuclear import activity given its NLS, in which molecular interaction energy components (MIECs) were used to characterize the NLS-import receptor interaction, and the support vector regression machine (SVR) was used to learn the relationship between the characterized NLS-import receptor interaction and the corresponding nuclear import activity. Our experiments showed that nuclear import activity change due to NLS change could be accurately predicted by the NIpredict algorithm. Based on NIpredict, we developed a systematic framework to identify potential PTM-based nuclear import regulations for human and yeast nuclear proteins. Application of this approach has identified the potential nuclear import regulation mechanisms by phosphorylation of two nuclear proteins including SF1 and ORC6. © 2014 Wiley Periodicals, Inc.

The Orphan Nuclear Receptor TR4 Is a Vitamin A-activated Nuclear Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, X. Edward; Suino-Powell, Kelly M.; Xu, Yong

2015-11-30

Testicular receptors 2 and 4 (TR2/4) constitute a subgroup of orphan nuclear receptors that play important roles in spermatogenesis, lipid and lipoprotein regulation, and the development of the central nervous system. Currently, little is known about the structural features and the ligand regulation of these receptors. Here we report the crystal structure of the ligand-free TR4 ligand binding domain, which reveals an autorepressed conformation. The ligand binding pocket of TR4 is filled by the C-terminal half of helix 10, and the cofactor binding site is occupied by the AF-2 helix, thus preventing ligand-independent activation of the receptor. However, TR4 exhibitsmore » constitutive transcriptional activity on multiple promoters, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, or ligand binding substantially reduce the transcriptional activity of this receptor. Importantly, both retinol and retinoic acid are able to promote TR4 to recruit coactivators and to activate a TR4-regulated reporter. These findings demonstrate that TR4 is a ligand-regulated nuclear receptor and suggest that retinoids might have a much wider regulatory role via activation of orphan receptors such as TR4.« less

Evolution of the nuclear receptor gene superfamily.

PubMed Central

Laudet, V; Hänni, C; Coll, J; Catzeflis, F; Stéhelin, D

1992-01-01

Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplication from a common ancestor or if their different domains came from different independent sources. To test these possibilities we have constructed and compared the phylogenetic trees derived from two different domains of 30 nuclear receptor genes. The tree built from the DNA binding C domain clearly shows a common progeny of all nuclear receptors, which can be grouped into three subfamilies: (i) thyroid hormone and retinoic acid receptors, (ii) orphan receptors and (iii) steroid hormone receptors. The tree constructed from the central part of the E domain which is implicated in transcriptional regulation and dimerization shows the same distribution in three subfamilies but two groups of receptors are in a different position from that in the C domain tree: (i) the Drosophila knirps family genes have acquired very different E domains during evolution, and (ii) the vitamin D and ecdysone receptors, as well as the FTZ-F1 and the NGF1B genes, seem to have DNA binding and hormone binding domains belonging to different classes. These data suggest a complex evolutionary history for nuclear receptor genes in which gene duplication events and swapping between domains of different origins took place. PMID:1312460

Differential Subcellular Localization of the Glucocorticoid Receptor in Distinct Neural Stem and Progenitor Populations of the Mouse Telencephalon In Vivo

PubMed Central

Tsiarli, Maria A.; Monaghan, A. Paula; DeFranco, Donald B.

2013-01-01

Glucocorticoids are given to pregnant women at risk for premature delivery to promote lung maturation. Despite reports of detrimental effects of glucocorticoids on telencephalic neural stem/progenitor cells (NSPCs), the regional and cellular expression of the glucocorticoid receptor (GR) in various NSPC populations in the intact brain has not been thoroughly assessed. Therefore in this study we performed a detailed analysis of GR protein expression in the developing mouse ventral and dorsal telencephalon in vivo. At embryonic day 11.5 (E11.5), the majority of Pax6-positive radial glial cells (RGCs) and Tbr2-positive intermediate progenitor cells (IPCs) expressed nuclear GR, while a small number of RGCs on the apical ventricular zone (aVZ), expressed cytoplasmic GR. However, on E13.5, the latter population of RGCs increased in size, whereas abventricular NSPCs and especially neurons of the cortical plate, expressed nuclear GR. In IPCs, GR was always nuclear. A similar expression profile was observed throughout the ventral telencephalon, hippocampus and olfactory bulb, with NSPCs of the aVZ primarily expressing cytoplasmic GR, while abventricular NSPCs and mature cells primarily expressed nuclear GR. Close to birth, nuclear GR accumulated within specific cortical areas such as layer V, the subplate and CA1 area of the hippocampus. In summary, our data show that GR protein is present in early NSPCs of the dorsal and ventral telencephalon at E11.5 and primarily occupies the nucleus. Moreover, our study suggests that the subcellular localization of the receptor may be subjected to region and neurodevelopmental stage-specific regulation. PMID:23751362

Differential subcellular localization of the glucocorticoid receptor in distinct neural stem and progenitor populations of the mouse telencephalon in vivo.

PubMed

Tsiarli, Maria A; Paula Monaghan, A; Defranco, Donald B

2013-07-26

Glucocorticoids are given to pregnant women at risk for premature delivery to promote lung maturation. Despite reports of detrimental effects of glucocorticoids on telencephalic neural stem/progenitor cells (NSPCs), the regional and cellular expressions of the glucocorticoid receptor (GR) in various NSPC populations in the intact brain have not been thoroughly assessed. Therefore in this study we performed a detailed analysis of GR protein expression in the developing mouse ventral and dorsal telencephalon in vivo. At embryonic day 11.5 (E11.5), the majority of Pax6-positive radial glial cells (RGCs) and Tbr2-positive intermediate progenitor cells (IPCs) expressed nuclear GR, while a small number of RGCs on the apical ventricular zone (aVZ), expressed cytoplasmic GR. However, on E13.5, the latter population of RGCs increased in size, whereas abventricular NSPCs and especially neurons of the cortical plate, expressed nuclear GR. In IPCs, GR was always nuclear. A similar expression profile was observed throughout the ventral telencephalon, hippocampus and olfactory bulb, with NSPCs of the aVZ primarily expressing cytoplasmic GR, while abventricular NSPCs and mature cells primarily expressed nuclear GR. Close to birth, nuclear GR accumulated within specific cortical areas such as layer V, the subplate and CA1 area of the hippocampus. In summary, our data show that GR protein is present in early NSPCs of the dorsal and ventral telencephalon at E11.5 and primarily occupies the nucleus. Moreover, our study suggests that the subcellular localization of the receptor may be subjected to region and neurodevelopmental stage-specific regulation. Copyright © 2013 Elsevier B.V. All rights reserved.

Lipid-sensors, enigmatic-orphan and orphan nuclear receptors as therapeutic targets in breast-cancer.

PubMed

Garattini, Enrico; Bolis, Marco; Gianni', Maurizio; Paroni, Gabriela; Fratelli, Maddalena; Terao, Mineko

2016-07-05

Breast-cancer is heterogeneous and consists of various groups with different biological characteristics. Innovative pharmacological approaches accounting for this heterogeneity are needed. The forty eight human Nuclear-Hormone-Receptors are ligand-dependent transcription-factors and are classified into Endocrine-Receptors, Adopted-Orphan-Receptors (Lipid-sensors and Enigmatic-Orphans) and Orphan-receptors. Nuclear-Receptors represent ideal targets for the design/synthesis of pharmacological ligands. We provide an overview of the literature available on the expression and potential role played by Lipid-sensors, Enigmatic-Orphans and Orphan-Receptors in breast-cancer. The data are complemented by an analysis of the expression levels of each selected Nuclear-Receptor in the PAM50 breast-cancer groups, following re-elaboration of the data publicly available. The major aim is to support the idea that some of the Nuclear-Receptors represent largely unexploited therapeutic-targets in breast-cancer treatment/chemo-prevention. On the basis of our analysis, we conclude that the Lipid-Sensors, NR1C3, NR1H2 and NR1H3 are likely to be onco-suppressors in breast-cancer. The Enigmatic-Orphans, NR1F1 NR2A1 and NR3B3 as well as the Orphan-Receptors, NR0B1, NR0B2, NR1D1, NR2F1, NR2F2 and NR4A3 exert a similar action. These Nuclear-Receptors represent candidates for the development of therapeutic strategies aimed at increasing their expression or activating them in tumor cells. The group of Nuclear-Receptors endowed with potential oncogenic properties consists of the Lipid-Sensors, NR1C2 and NR1I2, the Enigmatic-Orphans, NR1F3, NR3B1 and NR5A2, as well as the Orphan-Receptors, NR2E1, NR2E3 and NR6A1. These oncogenic Nuclear-Receptors should be targeted with selective antagonists, reverse-agonists or agents/strategies capable of reducing their expression in breast-cancer cells.

Panning for SNuRMs: using cofactor profiling for the rational discovery of selective nuclear receptor modulators.

PubMed

Kremoser, Claus; Albers, Michael; Burris, Thomas P; Deuschle, Ulrich; Koegl, Manfred

2007-10-01

Drugs that target nuclear receptors are clinically, as well as commercially, successful. Their widespread use, however, is limited by an inherent propensity of nuclear receptors to trigger beneficial, as well as adverse, pharmacological effects upon drug activation. Hence, selective drugs that display reduced adverse effects, such as the selective estrogen receptor modulator (SERM) Raloxifene, have been developed by guidance through classical cell culture assays and animal trials. Full agonist and selective modulator nuclear receptor drugs, in general, differ by their ability to recruit certain cofactors to the receptor protein. Hence, systematic cofactor profiling is advancing into an approach for the rationally guided identification of selective NR modulators (SNuRMs) with improved therapeutic ratio.

The Nuclear Receptor Corepressor Has Organizational Effects within the Developing Amygdala on Juvenile Social Play and Anxiety-Like Behavior

PubMed Central

Jessen, Heather M.; Kolodkin, Mira H.; Bychowski, Meaghan E.; Auger, Catherine J.; Auger, Anthony P.

2010-01-01

Nuclear receptor function on DNA is regulated by the balanced recruitment of coregulatory complexes. Recruited proteins that increase gene expression are called coactivators, and those that decrease gene expression are called corepressors. Little is known about the role of corepressors, such as nuclear receptor corepressor (NCoR), on the organization of behavior. We used real-time PCR to show that NCoR mRNA levels are sexually dimorphic, that females express higher levels of NCoR mRNA within the developing amygdala and hypothalamus, and that NCoR mRNA levels are reduced by estradiol treatment. To investigate the functional role of NCoR on juvenile social behavior, we infused small interfering RNA targeted against NCoR within the developing rat amygdala and assessed the enduring impact on juvenile social play behavior, sociability, and anxiety-like behavior. As expected, control males exhibited higher levels of juvenile social play than control females. Reducing NCoR expression during development further increased juvenile play in males only. Interestingly, decreased NCoR expression within the developing amygdala had lasting effects on increasing juvenile anxiety-like behavior in males and females. These data suggest that the corepressor NCoR functions to blunt sex differences in juvenile play behavior, a sexually dimorphic and hormone-dependent behavior, and appears critical for appropriate anxiety-like behavior in juvenile males and females. PMID:20051490

The nuclear receptor corepressor has organizational effects within the developing amygdala on juvenile social play and anxiety-like behavior.

PubMed

Jessen, Heather M; Kolodkin, Mira H; Bychowski, Meaghan E; Auger, Catherine J; Auger, Anthony P

2010-03-01

Nuclear receptor function on DNA is regulated by the balanced recruitment of coregulatory complexes. Recruited proteins that increase gene expression are called coactivators, and those that decrease gene expression are called corepressors. Little is known about the role of corepressors, such as nuclear receptor corepressor (NCoR), on the organization of behavior. We used real-time PCR to show that NCoR mRNA levels are sexually dimorphic, that females express higher levels of NCoR mRNA within the developing amygdala and hypothalamus, and that NCoR mRNA levels are reduced by estradiol treatment. To investigate the functional role of NCoR on juvenile social behavior, we infused small interfering RNA targeted against NCoR within the developing rat amygdala and assessed the enduring impact on juvenile social play behavior, sociability, and anxiety-like behavior. As expected, control males exhibited higher levels of juvenile social play than control females. Reducing NCoR expression during development further increased juvenile play in males only. Interestingly, decreased NCoR expression within the developing amygdala had lasting effects on increasing juvenile anxiety-like behavior in males and females. These data suggest that the corepressor NCoR functions to blunt sex differences in juvenile play behavior, a sexually dimorphic and hormone-dependent behavior, and appears critical for appropriate anxiety-like behavior in juvenile males and females.

A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects

USDA-ARS?s Scientific Manuscript database

Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unu...

PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex.

PubMed

Surapureddi, Sailesh; Viswakarma, Navin; Yu, Songtao; Guo, Dongsheng; Rao, M Sambasiva; Reddy, Janardan K

2006-05-05

Ciprofibrate, a potent peroxisome proliferator, induces pleiotropic responses in liver by activating peroxisome proliferator-activated receptor alpha (PPARalpha), a nuclear receptor. Transcriptional regulation by liganded nuclear receptors involves the participation of coregulators that form multiprotein complexes possibly to achieve cell and gene specific transcription. SDS-PAGE and matrix-assisted laser desorption/ionization reflection time-of-flight mass spectrometric analyses of ciprofibrate-binding proteins from liver nuclear extracts obtained using ciprofibrate-Sepharose affinity matrix resulted in the identification of a new high molecular weight nuclear receptor coactivator, which we designated PRIC320. The full-length human cDNA encoding this protein has an open-reading frame that codes for a 320kDa protein containing 2882 amino acids. PRIC320 contains five LXXLL signature motifs that mediate interaction with nuclear receptors. PRIC320 binds avidly to nuclear receptors PPARalpha, CAR, ERalpha, and RXR, but only minimally with PPARgamma. PRIC320 also interacts with transcription cofactors CBP, PRIP, and PBP. Immunoprecipitation-immunoblotting as well as cellular localization studies confirmed the interaction between PPARalpha and PRIC320. PRIC320 acts as a transcription coactivator by stimulating PPARalpha-mediated transcription. We conclude that ciprofibrate, a PPARalpha ligand, binds a multiprotein complex and PRIC320 cloned from this complex functions as a nuclear receptor coactivator.

Natural compounds regulate energy metabolism by the modulating the activity of lipid-sensing nuclear receptors.

PubMed

Goto, Tsuyoshi; Kim, Young-Il; Takahashi, Nobuyuki; Kawada, Teruo

2013-01-01

Obesity causes excess fat accumulation in various tissues, most notoriously in the adipose tissue, along with other insulin-responsive organs such as skeletal muscle and the liver, which predisposes an individual to the development of metabolic abnormalities. The molecular mechanisms underlying obesity-induced metabolic abnormalities have not been completely elucidated; however, in recent years, the search for therapies to prevent the development of obesity and obesity-associated metabolic disorders has increased. It is known that several nuclear receptors, when activated by specific ligands, regulate carbohydrate and lipid metabolism at the transcriptional level. The expression of lipid metabolism-related enzymes is directly regulated by the activity of various nuclear receptors via their interaction with specific response elements in promoters of those genes. Many natural compounds act as ligands of nuclear receptors and regulate carbohydrate and lipid metabolism by regulating the activities of these nuclear receptors. In this review, we describe our current knowledge of obesity, the role of lipid-sensing nuclear receptors in energy metabolism, and several examples of food factors that act as agonists or antagonists of nuclear receptors, which may be useful for the management of obesity and the accompanying energy metabolism abnormalities. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Med1 subunit of the mediator complex in nuclear receptor-regulated energy metabolism, liver regeneration, and hepatocarcinogenesis.

PubMed

Jia, Yuzhi; Viswakarma, Navin; Reddy, Janardan K

2014-01-01

Several nuclear receptors regulate diverse metabolic functions that impact on critical biological processes, such as development, differentiation, cellular regeneration, and neoplastic conversion. In the liver, some members of the nuclear receptor family, such as peroxisome proliferator-activated receptors (PPARs), constitutive androstane receptor (CAR), farnesoid X receptor (FXR), liver X receptor (LXR), pregnane X receptor (PXR), glucocorticoid receptor (GR), and others, regulate energy homeostasis, the formation and excretion of bile acids, and detoxification of xenobiotics. Excess energy burning resulting from increases in fatty acid oxidation systems in liver generates reactive oxygen species, and the resulting oxidative damage influences liver regeneration and liver tumor development. These nuclear receptors are important sensors of exogenous activators as well as receptor-specific endogenous ligands. In this regard, gene knockout mouse models revealed that some lipid-metabolizing enzymes generate PPARα-activating ligands, while others such as ACOX1 (fatty acyl-CoA oxidase1) inactivate these endogenous PPARα activators. In the absence of ACOX1, the unmetabolized ACOX1 substrates cause sustained activation of PPARα, and the resulting increase in energy burning leads to hepatocarcinogenesis. Ligand-activated nuclear receptors recruit the multisubunit Mediator complex for RNA polymerase II-dependent gene transcription. Evidence indicates that the Med1 subunit of the Mediator is essential for PPARα, PPARγ, CAR, and GR signaling in liver. Med1 null hepatocytes fail to respond to PPARα activators in that these cells do not show induction of peroxisome proliferation and increases in fatty acid oxidation enzymes. Med1-deficient hepatocytes show no increase in cell proliferation and do not give rise to liver tumors. Identification of nuclear receptor-specific coactivators and Mediator subunits should further our understanding of the complexities of metabolic diseases associated with increased energy combustion in liver.

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Studying Nuclear Receptor Complexes in the Cellular Environment.

PubMed

Schaufele, Fred

2016-01-01

The ligand-regulated structure and biochemistry of nuclear receptor complexes are commonly determined by in vitro studies of isolated receptors, cofactors, and their fragments. However, in the living cell, the complexes that form are governed not just by the relative affinities of isolated cofactors for the receptor but also by the cell-specific sequestration or concentration of subsets of competing or cooperating cofactors, receptors, and other effectors into distinct subcellular domains and/or their temporary diversion into other cellular activities. Most methods developed to understand nuclear receptor function in the cellular environment involve the direct tagging of the nuclear receptor or its cofactors with fluorescent proteins (FPs) and the tracking of those FP-tagged factors by fluorescence microscopy. One of those approaches, Förster resonance energy transfer (FRET) microscopy, quantifies the transfer of energy from a higher energy "donor" FP to a lower energy "acceptor" FP attached to a single protein or to interacting proteins. The amount of FRET is influenced by the ligand-induced changes in the proximities and orientations of the FPs within the tagged nuclear receptor complexes, which is an indicator of the structure of the complexes, and by the kinetics of the interaction between FP-tagged factors. Here, we provide a guide for parsing information about the structure and biochemistry of nuclear receptor complexes from FRET measurements in living cells.

Heterodimers of Retinoic Acid Receptors and Thyroid Hormone Receptors Display Unique Combinatorial Regulatory Properties

PubMed Central

Lee, Sangho; Privalsky, Martin L.

2009-01-01

Nuclear receptors are ligand-regulated transcription factors that regulate key aspects of metazoan development, differentiation, and homeostasis. Nuclear receptors recognize target genes by binding to specific DNA recognition sequences, denoted hormone response elements (HREs). Many nuclear receptors can recognize HREs as either homodimers or heterodimers. Retinoid X receptors (RXRs), in particular, serve as important heterodimer partners for many other nuclear receptors, including thyroid hormone receptors (TRs), and RXR/TR heterodimers have been proposed to be the primary mediators of target gene regulation by T3 hormone. Here, we report that the retinoic acid receptors (RARs), a distinct class of nuclear receptors, are also efficient heterodimer partners for TRs. These RAR/TR heterodimers form with similar affinities as RXR/TR heterodimers on an assortment of consensus and natural HREs, and preferentially assemble with the RAR partner 5′ of the TR moiety. The corepressor and coactivator recruitment properties of these RAR/TR heterodimers and their transcriptional activities in vivo are distinct from those observed with the corresponding RXR heterodimers. Our studies indicate that RXRs are not unique in their ability to partner with TRs, and that RARs can also serve as robust heterodimer partners and combinatorial regulators of T3-modulated gene expression. PMID:15650024

Clinical validation of nuclear factor kappa B expression in invasive breast cancer.

PubMed

Agrawal, Anil Kumar; Pielka, Ewa; Lipinski, Artur; Jelen, Michal; Kielan, Wojciech; Agrawal, Siddarth

2018-01-01

Breast cancer is the most commonly diagnosed cancer in Polish women. The expression of transcription nuclear factor kappa B, a key inducer of inflammatory response promoting carcinogenesis and cancer progression in breast cancer, is not well-established. We assessed the nuclear factor kappa B expression in a total of 119 invasive breast carcinomas and 25 healthy control samples and correlated this expression pattern with several clinical and pathologic parameters including histologic type and grade, tumor size, lymph node status, estrogen receptor status, and progesterone receptor status. The data used for the analysis were derived from medical records. An immunohistochemical analysis of nuclear factor kappa B, estrogen receptor, and progesterone receptor was carried out and evaluation of stainings was performed. The expression of nuclear factor kappa B was significantly higher than that in the corresponding healthy control samples. No statistical difference was demonstrated in nuclear factor kappa B expression in relation to age, menopausal status, lymph node status, tumor size and location, grade and histologic type of tumor, and hormonal status (estrogen receptor and progesterone receptor). Nuclear factor kappa B is significantly overexpressed in invasive breast cancer tissues. Although nuclear factor kappa B status does not correlate with clinicopathological findings, it might provide important additional information on prognosis and become a promising object for targeted therapy.

Flow cytometric monitoring of hormone receptor expression in human solid tumors

NASA Astrophysics Data System (ADS)

Krishan, Awtar

2002-05-01

Hormone receptor expression in human breast and prostate tumors is of diagnostic and therapeutic importance. With the availability of anti-estrogen, androgen and progesterone antibodies, immunohistochemistry has become a standard tool for determination of receptor expression in human tumor biopsies. However, this method is dependent on examination of a small number of cells under a microscope and the data obtained in most cases is not quantitative. As most of the commercially used anti-hormone antibodies have nuclear specificity, we have developed methods for isolation and antigen unmasking of nuclei from formalin fixed/paraffin embedded archival human tumors. After immunostaining with the antibodies and propidium iodide (for DNA content and cell cycle analysis), nuclei are analyzed by multiparametric laser flow cytometry for hormone receptor expression, DNA content, aneuploidy and cell cycle determination. These multiparametric methods are especially important for retrospective studies seeking to correlate hormone receptor expression with clinical response to anti-hormonal therapy of human breast and prostate tumors.

Cross-species extrapolation of an adverse outcome pathway for ecdysone receptor activation

EPA Science Inventory

Different invertebrate nuclear receptors serve as targets for a variety of environmental contaminants. One of these is the ecdysteroid receptor (EcR). Due to the important role of this nuclear receptor in regulating development and reproduction in invertebrates, particularly duri...

Cross-species extrapolation of an adverse outcome pathway for ecdysteroid receptor activation

EPA Science Inventory

Different invertebrate nuclear receptors serve as targets for a variety of environmental contaminants. One of these is the ecdysteroid receptor (EcR). Due to the important role of this nuclear receptor in regulating development and reproduction in invertebrates, particularly duri...

Balanced nuclear and cytoplasmic activities of EDS1 are required for a complete plant innate immune response.

PubMed

García, Ana V; Blanvillain-Baufumé, Servane; Huibers, Robin P; Wiermer, Marcel; Li, Guangyong; Gobbato, Enrico; Rietz, Steffen; Parker, Jane E

2010-07-01

An important layer of plant innate immunity to host-adapted pathogens is conferred by intracellular nucleotide-binding/oligomerization domain-leucine rich repeat (NB-LRR) receptors recognizing specific microbial effectors. Signaling from activated receptors of the TIR (Toll/Interleukin-1 Receptor)-NB-LRR class converges on the nucleo-cytoplasmic immune regulator EDS1 (Enhanced Disease Susceptibility1). In this report we show that a receptor-stimulated increase in accumulation of nuclear EDS1 precedes or coincides with the EDS1-dependent induction and repression of defense-related genes. EDS1 is capable of nuclear transport receptor-mediated shuttling between the cytoplasm and nucleus. By enhancing EDS1 export from inside nuclei (through attachment of an additional nuclear export sequence (NES)) or conditionally releasing EDS1 to the nucleus (by fusion to a glucocorticoid receptor (GR)) in transgenic Arabidopsis we establish that the EDS1 nuclear pool is essential for resistance to biotrophic and hemi-biotrophic pathogens and for transcriptional reprogramming. Evidence points to post-transcriptional processes regulating receptor-triggered accumulation of EDS1 in nuclei. Changes in nuclear EDS1 levels become equilibrated with the cytoplasmic EDS1 pool and cytoplasmic EDS1 is needed for complete resistance and restriction of host cell death at infection sites. We propose that coordinated nuclear and cytoplasmic activities of EDS1 enable the plant to mount an appropriately balanced immune response to pathogen attack.

BXR, an embryonic orphan nuclear receptor activated by a novel class of endogenous benzoate metabolites

PubMed Central

Blumberg, Bruce; Kang, Heonjoong; Bolado, Jack; Chen, Hongwu; Craig, A. Grey; Moreno, Tanya A.; Umesono, Kazuhiko; Perlmann, Thomas; De Robertis, Eddy M.; Evans, Ronald M.

1998-01-01

Nuclear receptors are ligand-modulated transcription factors that respond to steroids, retinoids, and thyroid hormones to control development and body physiology. Orphan nuclear receptors, which lack identified ligands, provide a unique, and largely untapped, resource to discover new principles of physiologic homeostasis. We describe the isolation and characterization of the vertebrate orphan receptor, BXR, which heterodimerizes with RXR and binds high-affinity DNA sites composed of a variant thyroid hormone response element. A bioactivity-guided screen of embryonic extracts revealed that BXR is activatable by low-molecular-weight molecules with spectral patterns distinct from known nuclear receptor ligands. Mass spectrometry and 1H NMR analysis identified alkyl esters of amino and hydroxy benzoic acids as potent, stereoselective activators. In vitro cofactor association studies, along with competable binding of radiolabeled compounds, establish these molecules as bona fide ligands. Benzoates comprise a new molecular class of nuclear receptor ligand and their activity suggests that BXR may control a previously unsuspected vertebrate signaling pathway. PMID:9573044

A New Family of Nuclear Receptor Coregulators That Integrate Nuclear Receptor Signaling through CREB-Binding Protein

PubMed Central

Mahajan, Muktar A.; Samuels, Herbert H.

2000-01-01

We describe the cloning and characterization of a new family of nuclear receptor coregulators (NRCs) which modulate the function of nuclear hormone receptors in a ligand-dependent manner. NRCs are expressed as alternatively spliced isoforms which may exhibit different intrinsic activities and receptor specificities. The NRCs are organized into several modular structures and contain a single functional LXXLL motif which associates with members of the steroid hormone and thyroid hormone/retinoid receptor subfamilies with high affinity. Human NRC (hNRC) harbors a potent N-terminal activation domain (AD1), which is as active as the herpesvirus VP16 activation domain, and a second activation domain (AD2) which overlaps with the receptor-interacting LXXLL region. The C-terminal region of hNRC appears to function as an inhibitory domain which influences the overall transcriptional activity of the protein. Our results suggest that NRC binds to liganded receptors as a dimer and this association leads to a structural change in NRC resulting in activation. hNRC binds CREB-binding protein (CBP) with high affinity in vivo, suggesting that hNRC may be an important functional component of a CBP complex involved in mediating the transcriptional effects of nuclear hormone receptors. PMID:10866662

Inhibitors for the Vitamin D Receptor–Coregulator Interaction

PubMed Central

Teske, Kelly A.; Yu, Olivia; Arnold, Leggy A.

2016-01-01

The vitamin D receptor (VDR) belongs to the superfamily of nuclear receptors and is activated by the endogenous ligand 1,25-dihydroxyvitamin D3. The genomic effects mediated by VDR consist of the activation and repression of gene transcription, which includes the formation of multi-protein complexes with coregulator proteins. Coregulators bind many nuclear receptors and can be categorized according their role as coactivators (gene activation) or corepressors (gene repression). Herein, different approaches to develop compounds that modulate the interaction between VDR and coregulators are summarized. This include coregulator peptides that were identified by creating phage display libraries. Subsequent modification of these peptides including the introduction of a tether or non-hydrolysable bonds resulted in the first direct VDR–coregulator inhibitors. Later, small molecules that inhibit VDR–coregulator inhibitors were identified using rational drug design and high throughput screening. Early on, allosteric inhibition of VDR–coregulator interactions was achieved with VDR antagonists that change the conformation of VDR and modulate the interactions with coregulators. A detailed discussion of their dual agonist/antagonist effects is given as well as a summary of their biological effects in cell-based assays and in vivo studies. PMID:26827948

XPO1-dependent nuclear export is a druggable vulnerability in KRAS-mutant lung cancer

PubMed Central

Kim, Jimi; McMillan, Elizabeth; Kim, Hyun Seok; Venkateswaran, Niranjan; Makkar, Gurbani; Rodriguez-Canales, Jaime; Villalobos, Pamela; Neggers, Jasper Edgar; Mendiratta, Saurabh; Wei, Shuguang; Landesman, Yosef; Senapedis, William; Baloglu, Erkan; Chow, Chi-Wan B.; Frink, Robin E.; Gao, Boning; Roth, Michael; Minna, John D.; Daelemans, Dirk; Wistuba, Ignacio I.; Posner, Bruce A.; Scaglioni, PierPaolo; White, Michael A.

2016-01-01

The common participation of oncogenic KRAS proteins in many of the most lethal human cancers, together with the ease of detecting somatic KRAS mutant alleles in patient samples, has spurred persistent and intensive efforts to develop drugs that inhibit KRAS activity1. However, advances have been hindered by the pervasive inter- and intra-lineage diversity in the targetable mechanisms that underlie KRAS-driven cancers, limited pharmacological accessibility of many candidate synthetic-lethal interactions and the swift emergence of unanticipated resistance mechanisms to otherwise effective targeted therapies. Here we demonstrate the acute and specific cell-autonomous addiction of KRAS-mutant non-small-cell lung cancer cells to receptor-dependent nuclear export. A multi-genomic, data-driven approach, utilizing 106 human non-small-cell lung cancer cell lines, was used to interrogate 4,725 biological processes with 39,760 short interfering RNA pools for those selectively required for the survival of KRAS-mutant cells that harbour a broad spectrum of phenotypic variation. Nuclear transport machinery was the sole process-level discriminator of statistical significance. Chemical perturbation of the nuclear export receptor XPO1 (also known as CRM1), with a clinically available drug, revealed a robust synthetic-lethal interaction with native or engineered oncogenic KRAS both in vitro and in vivo. The primary mechanism underpinning XPO1 inhibitor sensitivity was intolerance to the accumulation of nuclear IκBα (also known as NFKBIA), with consequent inhibition of NFκB transcription factor activity. Intrinsic resistance associated with concurrent FSTL5 mutations was detected and determined to be a consequence of YAP1 activation via a previously unappreciated FSTL5–Hippo pathway regulatory axis. This occurs in approximately 17% of KRAS-mutant lung cancers, and can be overcome with the co-administration of a YAP1–TEAD inhibitor. These findings indicate that clinically available XPO1 inhibitors are a promising therapeutic strategy for a considerable cohort of patients with lung cancer when coupled to genomics-guided patient selection and observation. PMID:27680702

Bmal1 is a direct transcriptional target of the orphan nuclear receptor, NR2F1

USDA-ARS?s Scientific Manuscript database

Orphan nuclear receptor NR2F1 (also known as COUP-TFI, Chicken Ovalbumin Upstream Promoter Transcription Factor I) is a highly conserved member of the nuclear receptor superfamily. NR2F1 plays a critical role during embryonic development, particularly in the central and peripheral nervous systems a...

A protein that interacts with members of the nuclear hormone receptor family: identification and cDNA cloning.

PubMed Central

Zeiner, M; Gehring, U

1995-01-01

In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784

Mode of Action and Human Relevance Analysis for Nuclear Receptor-Mediated Liver Toxicity: A Case Study with Phenobarbital as a Model Constitutive Androstane Receptor (CAR) Activator

EPA Science Inventory

The constitutive androstane receptor (CAR) and pregnane X receptor (PXR) are key nuclear receptors involved in the regulation of cellular responses. to exposure to many xenobiotics and various physiological processes. Phenobarbital (PB) is a non­ genotoxic i...

Role of human pregnane X receptor in tamoxifen- and 4-hydroxytamoxifen-mediated CYP3A4 induction in primary human hepatocytes and LS174T cells.

PubMed

Sane, Rucha S; Buckley, Donna J; Buckley, Arthur R; Nallani, Srikanth C; Desai, Pankaj B

2008-05-01

Previously we observed that the antiestrogens tamoxifen and 4-hydroxytamoxifen (4OHT) induce CYP3A4 in primary human hepatocytes and activate human pregnane X receptor (PXR) in cell-based reporter assays. Given the complex cross-talk between nuclear receptors, tissue-specific expression of CYP3A4, and the potential for tamoxifen and 4OHT to interact with a myriad of receptors, this study was undertaken to gain mechanistic insights into the inductive effects of tamoxifen and 4OHT. First, we observed that transfection of the primary cultures of human hepatocytes with PXR-specific small interfering RNA reduced the PXR mRNA expression and the extent of CYP3A4 induction by tamoxifen and 4OHT by 50%. Second, in LS174T colon carcinoma cells, which were observed to have significantly lower PXR expression relative to human hepatocytes, neither tamoxifen nor 4OHT induced CYP3A4. Third, N-desmethyltamoxifen, which did not induce CYP3A4 in human hepatocytes, also did not activate PXR in LS174T cells. We then used cell-based reporter assay to evaluate the effects of other receptors such as glucocorticoid receptor GR alpha and estrogen receptor ER alpha on the transcriptional activation of PXR. The cotransfection of GR alpha in LS174T cells augmented PXR activation by tamoxifen and 4OHT. On the other hand, the presence of ER alpha inhibited PXR-mediated basal activation of CYP3A4 promoter, possibly via competing for common cofactors such as steroid receptor coactivator 1 and glucocorticoid receptor interacting protein 1. Collectively, our findings suggest that the CYP3A4 induction by tamoxifen and 4OHT is primarily mediated by PXR but the overall stoichiometry of other nuclear receptors and transcription cofactors also contributes to the extent of the inductive effect.

Schizophrenia, vitamin D, and brain development.

PubMed

Mackay-Sim, Alan; Féron, François; Eyles, Darryl; Burne, Thomas; McGrath, John

2004-01-01

Schizophrenia research is invigorated at present by the recent discovery of several plausible candidate susceptibility genes identified from genetic linkage and gene expression studies of brains from persons with schizophrenia. It is a current challenge to reconcile this gathering evidence for specific candidate susceptibility genes with the "neurodevelopmental hypothesis," which posits that schizophrenia arises from gene-environment interactions that disrupt brain development. We make the case here that schizophrenia may result not from numerous genes of small effect, but a few genes of transcriptional regulation acting during brain development. In particular we propose that low vitamin D during brain development interacts with susceptibility genes to alter the trajectory of brain development, probably by epigenetic regulation that alters gene expression throughout adult life. Vitamin D is an attractive "environmental" candidate because it appears to explain several key epidemiological features of schizophrenia. Vitamin D is an attractive "genetic" candidate because its nuclear hormone receptor regulates gene expression and nervous system development. The polygenic quality of schizophrenia, with linkage to many genes of small effect, maybe brought together via this "vitamin D hypothesis." We also discuss the possibility of a broader set of environmental and genetic factors interacting via the nuclear hormone receptors to affect the development of the brain leading to schizophrenia.

Nuclear actions of insulin-like growth factor binding protein-3.

PubMed

Baxter, Robert C

2015-09-10

In addition to its actions outside the cell, cellular uptake and nuclear import of insulin-like growth factor binding protein-3 (IGFBP-3) has been recognized for almost two decades, but knowledge of its nuclear actions has been slow to emerge. IGFBP-3 has a functional nuclear localization signal and interacts with the nuclear transport protein importin-β. Within the nucleus IGFBP-3 appears to have a role in transcriptional regulation. It can bind to the nuclear receptor, retinoid X receptor-α and several of its dimerization partners, including retinoic acid receptor, vitamin D receptor (VDR), and peroxisome proliferator-activated receptor-γ (PPARγ). These interactions modulate the functions of these receptors, for example inhibiting VDR-dependent transcription in osteoblasts and PPARγ-dependent transcription in adipocytes. Nuclear IGFBP-3 can be detected by immunohistochemistry in cancer and other tissues, and its presence in the nucleus has been shown in many cell culture studies to be necessary for its pro-apoptotic effect, which may also involve interaction with the nuclear receptor Nur77, and export from the nucleus. IGFBP-3 is p53-inducible and in response to DNA damage, forms a complex with the epidermal growth factor receptor (EGFR), translocating to the nucleus to interact with DNA-dependent protein kinase. Inhibition of EGFR kinase activity or downregulation of IGFBP-3 can inhibit DNA double strand-break repair by nonhomologous end joining. IGFBP-3 thus has the ability to influence many cell functions through its interactions with intranuclear pathways, but the importance of these interactions in vivo, and their potential to be targeted for therapeutic benefit, require further investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

Rethinking Nuclear Receptors as Potential Therapeutic Targets for Retinal Diseases.

PubMed

Choudhary, Mayur; Malek, Goldis

2016-12-01

Collectively, retinal diseases, including age-related macular degeneration, retinitis pigmentosa, and diabetic retinopathy, result in severe vision impairment worldwide. The absence and/or limited availability of successful drug therapies for these blinding disorders necessitates further understanding their pathobiology and identifying new targetable signaling pathways. Nuclear receptors are transcription regulators of many key aspects of human physiology, as well as pathophysiology, with reported roles in development, aging, and disease. Some of the pathways regulated by nuclear receptors include, but are not limited to, angiogenesis, inflammation, and lipid metabolic dysregulation, mechanisms also important in the initiation and development of several retinal diseases. Herein, we present an overview of the biology of three diseases affecting the posterior eye, summarize a growing body of evidence that suggests direct or indirect involvement of nuclear receptors in disease progression, and discuss the therapeutic potential of targeting nuclear receptors for treatment.

Rethinking Nuclear Receptors as Potential Therapeutic Targets for Retinal Diseases

PubMed Central

Choudhary, Mayur; Malek, Goldis

2017-01-01

Collectively, retinal diseases, including age-related macular degeneration, retinitis pigmentosa, and diabetic retinopathy, result in severe vision impairment worldwide. The absence and/or limited availability of successful drug therapies for these blinding disorders necessitates further understanding their pathobiology and identifying new targetable signaling pathways. Nuclear receptors are transcription regulators of many key aspects of human physiology, as well as pathophysiology, with reported roles in development, aging, and disease. Some of the pathways regulated by nuclear receptors include, but are not limited to, angiogenesis, inflammation, and lipid metabolic dysregulation, mechanisms also important in the initiation and development of several retinal diseases. Herein, we present an overview of the biology of three diseases affecting the posterior eye, summarize a growing body of evidence that suggests direct or indirect involvement of nuclear receptors in disease progression, and discuss the therapeutic potential of targeting nuclear receptors for treatment. PMID:27455994

Mediator-dependent Nuclear Receptor Functions

PubMed Central

Chen, Wei; Roeder, Robert

2011-01-01

As gene-specific transcription factors, nuclear hormone receptors are broadly involved in many important biological processes. Their function on target genes requires the stepwise assembly of different coactivator complexes that facilitate chromatin remodeling and subsequent preinitiation complex (PIC) formation and function. Mediator has proved to be a crucial, and general, nuclear receptor-interacting coactivator, with demonstrated functions in transcription steps ranging from chromatin remodeling to subsequent PIC formation and function. Here we discuss (i) our current understanding of pathways that nuclear receptors and other interacting cofactors employ to recruit Mediator to target gene enhancers and promoters, including conditional requirements for the strong NR-Mediator interactions mediated by the NR AF2 domain and the MED1 LXXLLL motifs and (ii) mechanisms by which Mediator acts to transmit signals from enhancer-bound nuclear receptors to the general transcription machinery at core promoters to effect PIC formation and function. PMID:21854863

Negative Effects of SRD5A1 on Nuclear Activity of Progesterone Receptor Isoform B in JEG3 Cells.

PubMed

Miao, Zhuo; Sun, Min; Jiang, Feng; Yao, Yuanqing; Li, Yi

2016-02-01

Progesterone withdrawal signals labor in mammals. Elevated intracellular metabolism contributes to progesterone functional withdrawal through unknown mechanism, which is thought to act via progesterone receptor (PR). This study aims to investigate molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. We investigated the role of 5α-reductase type I (SRD5A1) in enzymatic catalysis of progesterone and loss of PR function in a human trophoblast choriocarcinoma cell line JEG3. The PR isoform B (PR-B) was robustly expressed in JEG3 cells. The SRD5A1 small-interfering RNA knockdown led to significant increase in PR-B nuclear import, ectopic, whereas SRD5A1 overexpression resulted in remarkable inhibition of nuclear PR-B in P4-treated cells. Repression of SRD5A1 activated PR-B responsive gene, whereas overexpression of SRD5A1 possessed an inhibitory effect. JEG3 cell line is a valuable tool to study mechanisms responsible for loss of PR function and screening of drugs for preterm birth treatment. Our study aims to investigate the molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. © The Author(s) 2015.

Identification of Modulators of the Nuclear Receptor Peroxisome Proliferator-Activated Receptor α (PPARα) in a Mouse Liver Gene Expression Compendium

EPA Science Inventory

The nuclear receptor family member peroxisome proliferator-activated receptor α (PPARα) is activated by therapeutic hypolipidemic drugs and environmentally-relevant chemicals to regulate genes involved in lipid transport and catabolism. Chronic activation of PPARα in rodents inc...

Stimulus-dependent regulation of nuclear Ca2+ signaling in cardiomyocytes: a role of neuronal calcium sensor-1.

PubMed

Nakao, Shu; Wakabayashi, Shigeo; Nakamura, Tomoe Y

2015-01-01

In cardiomyocytes, intracellular calcium (Ca2+) transients are elicited by electrical and receptor stimulations, leading to muscle contraction and gene expression, respectively. Although such elevations of Ca2+levels ([Ca2+]) also occur in the nucleus, the precise mechanism of nuclear [Ca2+] regulation during different kinds of stimuli, and its relationship with cytoplasmic [Ca2+] regulation are not fully understood. To address these issues, we used a new region-specific fluorescent protein-based Ca2+ indicator, GECO, together with the conventional probe Fluo-4 AM. We confirmed that nuclear Ca2+ transients were elicited by both electrical and receptor stimulations in neonatal mouse ventricular myocytes. Kinetic analysis revealed that electrical stimulation-elicited nuclear Ca2+ transients are slower than cytoplasmic Ca2+ transients, and chelating cytoplasmic Ca2+ abolished nuclear Ca2+ transients, suggesting that nuclear Ca2+ are mainly derived from the cytoplasm during electrical stimulation. On the other hand, receptor stimulation such as with insulin-like growth factor-1 (IGF-1) preferentially increased nuclear [Ca2+] compared to cytoplasmic [Ca2+]. Experiments using inhibitors revealed that electrical and receptor stimulation-elicited Ca2+ transients were mainly mediated by ryanodine receptors and inositol 1,4,5-trisphosphate receptors (IP3Rs), respectively, suggesting different mechanisms for the two signals. Furthermore, IGF-1-elicited nuclear Ca2+ transient amplitude was significantly lower in myocytes lacking neuronal Ca2+ sensor-1 (NCS-1), a Ca2+ binding protein implicated in IP3R-mediated pathway in the heart. Moreover, IGF-1 strengthened the interaction between NCS-1 and IP3R. These results suggest a novel mechanism for receptor stimulation-induced nuclear [Ca2+] regulation mediated by IP3R and NCS-1 that may further fine-tune cardiac Ca2+ signal regulation.

Identification of an allosteric binding site for RORγt inhibition

PubMed Central

Scheepstra, Marcel; Leysen, Seppe; van Almen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc

2015-01-01

RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors. PMID:26640126

The expression of Toll-like receptors 2, 4, 5, 7 and 9 in Merkel cell carcinoma.

PubMed

Jouhi, Lauri; Koljonen, Virve; Böhling, Tom; Haglund, Caj; Hagström, Jaana

2015-04-01

We sought to clarify whether the expression of toll-like receptors (TLR) in Merkel cell carcinoma (MCC) is linked to tumor and patient characteristics, especially the presence of Merkel cell polyoma virus (MCV). The study comprised of 128 patients with data on Merkel cell polyomavirus (MCV) status and clinical features were included in the study. Immunohistochemistry for TLR expression was performed on tissue microarray (TMA) slides. TLR 2, 4, 5, 7 and 9 expression was noted in most of the tumor specimens. Decreased expression of TLR 9 correlated strongly with MCV positivity. Cytoplasmic TLR 2 expression correlated with small tumor size, while nuclear TLR 2 and TLR 5 expressions with larger tumors. Increased nuclear TLR 4 expression and decreased TLR 7 expression were associated with older age. TLR 2, 4, 5, 7 and 9 appear to reflect certain clinicopathological variables and prognostic markers of MCC tumors. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway

PubMed Central

Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O.

2017-01-01

Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans. This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12–dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans. This finding suggests the existence of a conserved CYP4V2-POR–nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage. PMID:28760992

Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.

PubMed

Li, Shiwei; Li, Qi; Kong, Yuanyuan; Wu, Shuang; Cui, Qingpo; Zhang, Mingming; Zhang, Shaobing O

2017-08-15

Nuclear receptors play important roles in regulating fat metabolism and energy production in humans. The regulatory functions and endogenous ligands of many nuclear receptors are still unidentified, however. Here, we report that CYP-37A1 (ortholog of human cytochrome P450 CYP4V2), EMB-8 (ortholog of human P450 oxidoreductase POR), and DAF-12 (homolog of human nuclear receptors VDR/LXR) constitute a hormone synthesis and nuclear receptor pathway in Caenorhabditis elegans This pathway specifically regulates the thermosensitive fusion of fat-storing lipid droplets. CYP-37A1, together with EMB-8, synthesizes a lipophilic hormone not identical to Δ7-dafachronic acid, which represses the fusion-promoting function of DAF-12. CYP-37A1 also negatively regulates thermotolerance and lifespan at high temperature in a DAF-12-dependent manner. Human CYP4V2 can substitute for CYP-37A1 in C. elegans This finding suggests the existence of a conserved CYP4V2-POR-nuclear receptor pathway that functions in converting multilocular lipid droplets to unilocular ones in human cells; misregulation of this pathway may lead to pathogenic fat storage.

Mapping the Dynamics of the Glucocorticoid Receptor within the Nuclear Landscape.

PubMed

Stortz, Martin; Presman, Diego M; Bruno, Luciana; Annibale, Paolo; Dansey, Maria V; Burton, Gerardo; Gratton, Enrico; Pecci, Adali; Levi, Valeria

2017-07-24

The distribution of the transcription machinery among different sub-nuclear domains raises the question on how the architecture of the nucleus modulates the transcriptional response. Here, we used fluorescence fluctuation analyses to quantitatively explore the organization of the glucocorticoid receptor (GR) in the interphase nucleus of living cells. We found that this ligand-activated transcription factor diffuses within the nucleus and dynamically interacts with bodies enriched in the coregulator NCoA-2, DNA-dependent foci and chromatin targets. The distribution of the receptor among the nuclear compartments depends on NCoA-2 and the conformation of the receptor as assessed with synthetic ligands and GR mutants with impaired transcriptional abilities. Our results suggest that the partition of the receptor in different nuclear reservoirs ultimately regulates the concentration of receptor available for the interaction with specific targets, and thus has an impact on transcription regulation.

RORα, a Potential Tumor Suppressor and Therapeutic Target of Breast Cancer

PubMed Central

Du, Jun; Xu, Ren

2012-01-01

The function of the nuclear receptor (NR) in breast cancer progression has been investigated for decades. The majority of the nuclear receptors have well characterized natural ligands, but a few of them are orphan receptors for which no ligand has been identified. RORα, one member of the retinoid orphan nuclear receptor (ROR) subfamily of orphan receptors, regulates various cellular and pathological activities. RORα is commonly down-regulated and/or hypoactivated in breast cancer compared to normal mammary tissue. Expression of RORα suppresses malignant phenotypes in breast cancer cells, in vitro and in vivo. Activity of RORα can be categorized into the canonical and non-canonical nuclear receptor pathways, which in turn regulate various breast cancer cellular function, including cell proliferation, apoptosis and invasion. This information suggests that RORα is a potent tumor suppressor and a potential therapeutic target for breast cancer. PMID:23443091

Phenobarbital Meets Phosphorylation of Nuclear Receptors

PubMed Central

2017-01-01

Phenobarbital was the first therapeutic drug to be characterized for its induction of hepatic drug metabolism. Essentially at the same time, cytochrome P450, an enzyme that metabolizes drugs, was discovered. After nearly 50 years of investigation, the molecular target of phenobarbital induction has now been delineated to phosphorylation at threonine 38 of the constitutive androstane receptor (NR1I3), a member of the nuclear receptor superfamily. Determining this mechanism has provided us with the molecular basis to understand drug induction of drug metabolism and disposition. Threonine 38 is conserved as a phosphorylation motif in the majority of both mouse and human nuclear receptors, providing us with an opportunity to integrate diverse functions of nuclear receptors. Here, I review the works and accomplishments of my laboratory at the National Institutes of Health National Institute of Environmental Health Sciences and the future research directions of where our study of the constitutive androstane receptor might take us. PMID:28356313

Minireview: The Role of Nuclear Receptors in Photoreceptor Differentiation and Disease

PubMed Central

Swaroop, Anand

2012-01-01

Rod and cone photoreceptors are specialized sensory cells that mediate vision. Transcriptional controls are critical for the development and long-term survival of photoreceptors; when these controls become ineffective, retinal dysfunction or degenerative disease may result. This review discusses the role of nuclear receptors, a class of ligand-regulated transcription factors, at key stages of photoreceptor life in the mammalian retina. Nuclear receptors with known ligands, such as retinoids or thyroid hormone, together with several orphan receptors without identified physiological ligands, complement other classes of transcription factors in directing the differentiation and functional maintenance of photoreceptors. The potential of nuclear receptors to respond to ligands introduces versatility into the control of photoreceptor development and function and may suggest new opportunities for treatments of photoreceptor disease. PMID:22556342

How does oxygen rise drive evolution? Clues from oxygen-dependent biosynthesis of nuclear receptor ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Ying-Ying; Kong, De-Xin; Qin, Tao

2010-01-08

It is well known that oxygen rise greatly facilitated biological evolution. However, the underlying mechanisms remain elusive. Recently, Raymond and Segre revealed that molecular oxygen allows 1000 more metabolic reactions than can occur in anoxic conditions. From the novel metabolites produced in aerobic metabolism, we serendipitously found that some of the metabolites are signaling molecules that target nuclear receptors. Since nuclear signaling systems are indispensable to superior organisms, we speculated that aerobic metabolism may facilitate biological evolution through promoting the establishment of nuclear signaling systems. This hypothesis is validated by the observation that most (97.5%) nuclear receptor ligands are producedmore » by aerobic metabolism, which is further explained in terms of the chemical criteria (appropriate volume and rather high hydrophobicity) of nuclear receptor ligands that aerobic metabolites are more ready than anaerobic counterparts to satisfy these criteria.« less

Androgen Receptor Functional Analyses by High Throughput Imaging: Determination of Ligand, Cell Cycle, and Mutation-Specific Effects

PubMed Central

Szafran, Adam T.; Szwarc, Maria; Marcelli, Marco; Mancini, Michael A.

2008-01-01

Background Understanding how androgen receptor (AR) function is modulated by exposure to steroids, growth factors or small molecules can have important mechanistic implications for AR-related disease therapies (e.g., prostate cancer, androgen insensitivity syndrome, AIS), and in the analysis of environmental endocrine disruptors. Methodology/Principal Findings We report the development of a high throughput (HT) image-based assay that quantifies AR subcellular and subnuclear distribution, and transcriptional reporter gene activity on a cell-by-cell basis. Furthermore, simultaneous analysis of DNA content allowed determination of cell cycle position and permitted the analysis of cell cycle dependent changes in AR function in unsynchronized cell populations. Assay quality for EC50 coefficients of variation were 5–24%, with Z' values reaching 0.91. This was achieved by the selective analysis of cells expressing physiological levels of AR, important because minor over-expression resulted in elevated nuclear speckling and decreased transcriptional reporter gene activity. A small screen of AR-binding ligands, including known agonists, antagonists, and endocrine disruptors, demonstrated that nuclear translocation and nuclear “speckling” were linked with transcriptional output, and specific ligands were noted to differentially affect measurements for wild type versus mutant AR, suggesting differing mechanisms of action. HT imaging of patient-derived AIS mutations demonstrated a proof-of-principle personalized medicine approach to rapidly identify ligands capable of restoring multiple AR functions. Conclusions/Significance HT imaging-based multiplex screening will provide a rapid, systems-level analysis of compounds/RNAi that may differentially affect wild type AR or clinically relevant AR mutations. PMID:18978937

The Therapeutic Role of Xenobiotic Nuclear Receptors against Metabolic Syndrome.

PubMed

Pu, Shuqi; Wu, Xiaojie; Yang, Xiaoying; Zhang, Yunzhan; Dai, Yunkai; Zhang, Yueling; Wu, Xiaoting; Liu, Yan; Cui, Xiaona; Jin, Haiyong; Cao, Jianhong; Li, Ruliu; Cai, Jiazhong; Cao, Qizhi; Hu, Ling; Gao, Yong

2018-06-10

Xenobiotic nuclear receptors (XNRs) are nuclear receptors that characterized by coordinately regulating the expression of genes encoding drug-metabolizing enzymes and transporters to essentially eliminate and detoxify xenobiotics and endobiotics from the body, including the peroxisome proliferator-activated receptor (PPAR), the farnesoid X receptor (FXR), the liver X receptor (LXR), the pregnane X receptor (PXR) and the constitutive androstane receptor (CAR). Heretofore, increasing evidences have suggested that these five XNRs are not only involved in the regulation of xeno-/endo-biotics detoxication but also the development of human diseases, such as cancer, obesity and diabetes. PPAR, FXR, LXR, PXR and CAR, as the receptors for numerous natural or synthetic compounds may be the most effective therapeutic targets in the treatment of metabolic diseases. In this review, we will focus on these five XNRs and their recently discovered functions in diabetes and its complications. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Analysis of the Heat Shock Response in Mouse Liver Reveals Transcriptional Dependence on the Nuclear Receptor Peroxisome Proliferator-Activated Receptor alpha (PPARα)

EPA Science Inventory

BACKGROUND: The nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha) regulates responses to chemical or physical stress in part by altering expression of genes involved in proteome maintenance. Many of these genes are also transcriptionally regulated by h...

The relationship of the oestrogen and progestin receptors in the abnormal uterus of the adult anovulatory rat. Effects of neonatal treatment with testosterone propionate or clomiphene citrate.

PubMed Central

White, J O; Moore, P A; Elder, M G; Lim, L

1981-01-01

The neonatal administration of testosterone propionate to Wistar rats resulted in anovulatory adults in persistent vaginal oestrus. Clomiphene citrate had a similar effect. In both groups of adults, hyperplasia of the uterine epithelium and occasional metaplasia was observed. The uterine nuclear and cytosol oestrogen and progestin receptors of these anovulatory rats were found to have affinities for their respective ligands similar to those of normal females. The nuclear oestrogen receptor comprised occupied and unoccupied components, as in normal females. The content of the nuclear oestrogen receptor was comparable with that of females in the late dioestrous or pro-oestrous phase. This content was higher in the clomiphene-treated group. Despite the relatively high nuclear oestrogen receptor content the content of progestin receptors, a putative index of the oestrogenic response, was lower in the treated rats than in normal adult females throughout the cycle. Administration of oestradiol to both treatment groups resulted in depletion of cytosol oestrogen receptor content 1 h later, which, however, was not reflected by an increase in the content of nuclear oestrogen receptors. There was no measurable increase in progesterone receptor content in treated rats after daily administration of oestrogen (5 microgram/rat) for 3 days. These changes in sex-hormone-receptor interactions involving an impairment of the normal oestrogenic response may be associated with the abnormal differentiation of the uterus in these sterile, anovulatory animals. Images Fig. 1. Fig. 2. PMID:7316994

Bile Acid Receptor Agonist GW4064 Regulates PPARγ Coactivator-1α Expression Through Estrogen Receptor-Related Receptor α

PubMed Central

Dwivedi, Shailendra Kumar Dhar; Singh, Nidhi; Kumari, Rashmi; Mishra, Jay Sharan; Tripathi, Sarita; Banerjee, Priyam; Shah, Priyanka; Kukshal, Vandana; Tyagi, Abdul Malik; Gaikwad, Anil Nilkanth; Chaturvedi, Rajnish Kumar; Mishra, Durga Prasad; Trivedi, Arun Kumar; Sanyal, Somali; Chattopadhyay, Naibedya; Ramachandran, Ravishankar; Siddiqi, Mohammad Imran; Bandyopadhyay, Arun; Arora, Ashish; Lundåsen, Thomas; Anakk, Sayee Priyadarshini; Moore, David D.

2011-01-01

Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) is induced in energy-starved conditions and is a key regulator of energy homeostasis. This makes PGC-1α an attractive therapeutic target for metabolic syndrome and diabetes. In our effort to identify new regulators of PGC-1α expression, we found that GW4064, a widely used synthetic agonist for the nuclear bile acid receptor [farnesoid X receptor (FXR)] strongly enhances PGC-1α promoter reporter activity, mRNA, and protein expression. This induction in PGC-1α concomitantly enhances mitochondrial mass and expression of several PGC-1α target genes involved in mitochondrial function. Using FXR-rich or FXR-nonexpressing cell lines and tissues, we found that this effect of GW4064 is not mediated directly by FXR but occurs via activation of estrogen receptor-related receptor α (ERRα). Cell-based, biochemical and biophysical assays indicate GW4064 as an agonist of ERR proteins. Interestingly, FXR disruption alters GW4064 induction of PGC-1α mRNA in a tissue-dependent manner. Using FXR-null [FXR knockout (FXRKO)] mice, we determined that GW4064 induction of PGC-1α expression is not affected in oxidative soleus muscles of FXRKO mice but is compromised in the FXRKO liver. Mechanistic studies to explain these differences revealed that FXR physically interacts with ERR and protects them from repression by the atypical corepressor, small heterodimer partner in liver. Together, this interplay between ERRα-FXR-PGC-1α and small heterodimer partner offers new insights into the biological functions of ERRα and FXR, thus providing a knowledge base for therapeutics in energy balance-related pathophysiology. PMID:21493670

Activation of muscarinic receptors in rat parotid acinar cells induces AQP5 trafficking to nuclei and apical plasma membrane.

PubMed

Cho, Gota; Bragiel, Aneta M; Wang, Di; Pieczonka, Tomasz D; Skowronski, Mariusz T; Shono, Masayuki; Nielsen, Søren; Ishikawa, Yasuko

2015-04-01

The subcellular distribution of aquaporin-5 (AQP5) in rat parotid acinar cells in response to muscarinic acetylcholine receptor (mAChR) activation remains unclear. Immunoconfocal and immunoelectron microscopy were used to visualize the distribution of AQP5 in parotid acinar cells. Western blotting was used to analyze AQP5 levels in membranes. To clarify the characteristics of membrane domains associated with AQP5, detergent solubility and sucrose-density flotation experiments were performed. Under control conditions, AQP5 was diffusely distributed on the apical plasma membrane (APM) and apical plasmalemmal region and throughout the cytoplasm. Upon mAChR activation, AQP5 was predominantly located in the nucleus, APM and lateral plasma membrane (LPM). Subsequently, localization of AQP5 in the nucleus, APM and LPM was decreased. Prolonged atropine treatment inhibited mAChR agonist-induced translocation of AQP5 to the nucleus, APM and LPM. AQP5 levels were enhanced in isolated nuclei and nuclear membranes prepared from parotid tissues incubated with mAChR agonist. mAChR agonist induced AQP5 levels in both soluble and insoluble nuclear fractions solubilized with Triton X-100 or Lubrol WX. Small amounts of AQP5 in nuclei were detected using low-density sucrose gradient. When AQP5 was present in the nuclear membrane, nuclear size decreased. The activation of mAChR induced AQP5 translocation to the nucleus, APM and LPM, and AQP5 may trigger water transport across the nuclear membrane and plasma membrane in rat parotid acinar cells. AQP5 translocates to the nuclear membrane and may trigger the movement of water, inducing shrinkage of the nucleus and the start of nuclear functions. Copyright © 2015 Elsevier B.V. All rights reserved.

Mechanism regulating nuclear calcium signaling.

PubMed

Malviya, Anant N; Klein, Christian

2006-01-01

Although the outer nuclear membrane is continuous with the endoplasmic reticulum, it is possible to isolate nuclei both intact and free from endoplasmic reticulum contaminants. The outer and the inner nuclear membranes can be purified free from cross-contamination. Evidence in support of autonomous regulation of nuclear calcium signaling relies upon the investigations with isolated nuclei. Mechanisms for generating calcium signaling in the nucleus have been identified. Two calcium transporting systems, an ATP-dependant nuclear Ca(2+)-ATPase and an IP4-mediated inositol 1,3,4,5-tetrakisphosphate receptor, are located on the outer nuclear membrane. Thus, ATP and IP4, depending on external free calcium concentrations, are responsible for filling the nuclear envelope calcium pool. The inositol 1,4,5-trisphosphate receptor is located on the inner nuclear membrane with its ligand binding domain facing toward the nucleoplasm. Likewise, the ryanodine receptor is located on the inner nuclear membrane and its ligand cADP-ribose is generated within the nucleus. A 120 kDa protein fragment of nuclear PLC-gamma1 is stimulated in vivo by epidermal growth factor nuclear signaling coincident with the time course of nuclear membrane epidermal growth factor receptor activation. Stimulated 120 kDa protein fragment interacts with PIKE, a nuclear GTPase, and together they form a complex with PI[3]kinase serving as a module for nuclear PI[3]K stimulation. Thus, the nucleus has its own IP(3) generating system.

Differential hydrogen/deuterium exchange mass spectrometry analysis of protein–ligand interactions

PubMed Central

Chalmers, Michael J; Busby, Scott A; Pascal, Bruce D; West, Graham M; Griffin, Patrick R

2011-01-01

Functional regulation of ligand-activated receptors is driven by alterations in the conformational dynamics of the protein upon ligand binding. Differential hydrogen/deuterium exchange (HDX) coupled with mass spectrometry has emerged as a rapid and sensitive approach for characterization of perturbations in conformational dynamics of proteins following ligand binding. While this technique is sensitive to detecting ligand interactions and alterations in receptor dynamics, it also can provide important mechanistic insights into ligand regulation. For example, HDX has been used to determine a novel mechanism of ligand activation of the nuclear receptor peroxisome proliferator activated receptor-γ, perform detailed analyses of binding modes of ligands within the ligand-binding pocket of two estrogen receptor isoforms, providing insight into selectivity, and helped classify different types of estrogen receptor-α ligands by correlating their pharmacology with the way they interact with the receptor based solely on hierarchical clustering of receptor HDX signatures. Beyond small-molecule–receptor interactions, this technique has also been applied to study protein–protein complexes, such as mapping antibody–antigen interactions. In this article, we summarize the current state of the differential HDX approaches and the future outlook. We summarize how HDX analysis of protein–ligand interactions has had an impact on biology and drug discovery. PMID:21329427

An integrated mechanism of cardiomyocyte nuclear Ca(2+) signaling.

PubMed

Ibarra, Cristián; Vicencio, Jose Miguel; Varas-Godoy, Manuel; Jaimovich, Enrique; Rothermel, Beverly A; Uhlén, Per; Hill, Joseph A; Lavandero, Sergio

2014-10-01

In cardiomyocytes, Ca(2+) plays a central role in governing both contraction and signaling events that regulate gene expression. Current evidence indicates that discrimination between these two critical functions is achieved by segregating Ca(2+) within subcellular microdomains: transcription is regulated by Ca(2+) release within nuclear microdomains, and excitation-contraction coupling is regulated by cytosolic Ca(2+). Accordingly, a variety of agonists that control cardiomyocyte gene expression, such as endothelin-1, angiotensin-II or insulin-like growth factor-1, share the feature of triggering nuclear Ca(2+) signals. However, signaling pathways coupling surface receptor activation to nuclear Ca(2+) release, and the phenotypic responses to such signals, differ between agonists. According to earlier hypotheses, the selective control of nuclear Ca(2+) signals by activation of plasma membrane receptors relies on the strategic localization of inositol trisphosphate receptors at the nuclear envelope. There, they mediate Ca(2+) release from perinuclear Ca(2+) stores upon binding of inositol trisphosphate generated in the cytosol, which diffuses into the nucleus. More recently, identification of such receptors at nuclear membranes or perinuclear sarcolemmal invaginations has uncovered novel mechanisms whereby agonists control nuclear Ca(2+) release. In this review, we discuss mechanisms for the selective control of nuclear Ca(2+) signals with special focus on emerging models of agonist receptor activation. Copyright © 2014 Elsevier Ltd. All rights reserved.

Generalized Resistance to Thyroid Hormone Associated with a Mutation in the Ligand-Binding Domain of the Human Thyroid Hormone Receptor β

NASA Astrophysics Data System (ADS)

Sakurai, Akihiro; Takeda, Kyoko; Ain, Kenneth; Ceccarelli, Paola; Nakai, Akira; Seino, Susumu; Bell, Graeme I.; Refetoff, Samuel; Degroot, Leslie J.

1989-11-01

The syndrome of generalized resistance to thyroid hormone is characterized by elevated circulating levels of thyroid hormone in the presence of an overall eumetabolic state and failure to respond normally to triiodothyronine. We have evaluated a family with inherited generalized resistance to thyroid hormone for abnormalities in the thyroid hormone nuclear receptors. A single guanine --> cytosine replacement in the codon for amino acid 340 resulted in a glycine --> arginine substitution in the hormone-binding domain of one of two alleles of the patient's thyroid hormone nuclear receptor β gene. In vitro translation products of this mutant human thyroid hormone nuclear receptor β gene did not bind triiodothyronine. Thus, generalized resistance to thyroid hormone can result from expression of an abnormal thyroid hormone nuclear receptor molecule.

A muscle-specific knockout implicates nuclear receptor coactivator MED1 in the regulation of glucose and energy metabolism.

PubMed

Chen, Wei; Zhang, Xiaoting; Birsoy, Kivanc; Roeder, Robert G

2010-06-01

As conventional transcriptional factors that are activated in diverse signaling pathways, nuclear receptors play important roles in many physiological processes that include energy homeostasis. The MED1 subunit of the Mediator coactivator complex plays a broad role in nuclear receptor-mediated transcription by anchoring the Mediator complex to diverse promoter-bound nuclear receptors. Given the significant role of skeletal muscle, in part through the action of nuclear receptors, in glucose and fatty acid metabolism, we generated skeletal muscle-specific Med1 knockout mice. Importantly, these mice show enhanced insulin sensitivity and improved glucose tolerance as well as resistance to high-fat diet-induced obesity. Furthermore, the white muscle of these mice exhibits increased mitochondrial density and expression of genes specific to type I and type IIA fibers, indicating a fast-to-slow fiber switch, as well as markedly increased expression of the brown adipose tissue-specific UCP-1 and Cidea genes that are involved in respiratory uncoupling. These dramatic results implicate MED1 as a powerful suppressor in skeletal muscle of genetic programs implicated in energy expenditure and raise the significant possibility of therapeutical approaches for metabolic syndromes and muscle diseases through modulation of MED1-nuclear receptor interactions.

Calcium responses to synaptically activated bursts of action potentials and their synapse-independent replay in cultured networks of hippocampal neurons.

PubMed

Bengtson, C Peter; Kaiser, Martin; Obermayer, Joshua; Bading, Hilmar

2013-07-01

Both synaptic N-methyl-d-aspartate (NMDA) receptors and voltage-operated calcium channels (VOCCs) have been shown to be critical for nuclear calcium signals associated with transcriptional responses to bursts of synaptic input. However the direct contribution to nuclear calcium signals from calcium influx through NMDA receptors and VOCCs has been obscured by their concurrent roles in action potential generation and synaptic transmission. Here we compare calcium responses to synaptically induced bursts of action potentials with identical bursts devoid of any synaptic contribution generated using the pre-recorded burst as the voltage clamp command input to replay the burst in the presence of blockers of action potentials or ionotropic glutamate receptors. Synapse independent replays of bursts produced nuclear calcium responses with amplitudes around 70% of their original synaptically generated signals and were abolished by the L-type VOCC blocker, verapamil. These results identify a major direct source of nuclear calcium from local L-type VOCCs whose activation is boosted by NMDA receptor dependent depolarization. The residual component of synaptically induced nuclear calcium signals which was both VOCC independent and NMDA receptor dependent showed delayed kinetics consistent with a more distal source such as synaptic NMDA receptors or internal stores. The dual requirement of NMDA receptors and L-type VOCCs for synaptic activity-induced nuclear calcium dependent transcriptional responses most likely reflects a direct somatic calcium influx from VOCCs whose activation is amplified by synaptic NMDA receptor-mediated depolarization and whose calcium signal is boosted by a delayed input from distal calcium sources mostly likely entry through NMDA receptors and release from internal stores. This article is part of a Special Issue entitled: 12th European Symposium on Calcium. Copyright © 2013 Elsevier B.V. All rights reserved.

Phosphorylation of a conserved serine in the deoxyribonucleic acid binding domain of nuclear receptors alters intracellular localization.

PubMed

Sun, Kai; Montana, Vedrana; Chellappa, Karthikeyani; Brelivet, Yann; Moras, Dino; Maeda, Yutaka; Parpura, Vladimir; Paschal, Bryce M; Sladek, Frances M

2007-06-01

Nuclear receptors (NRs) are a superfamily of transcription factors whose genomic functions are known to be activated by lipophilic ligands, but little is known about how to deactivate them or how to turn on their nongenomic functions. One obvious mechanism is to alter the nuclear localization of the receptors. Here, we show that protein kinase C (PKC) phosphorylates a highly conserved serine (Ser) between the two zinc fingers of the DNA binding domain of orphan receptor hepatocyte nuclear factor 4alpha (HNF4alpha). This Ser (S78) is adjacent to several positively charged residues (Arg or Lys), which we show here are involved in nuclear localization of HNF4alpha and are conserved in nearly all other NRs, along with the Ser/threonine (Thr). A phosphomimetic mutant of HNF4alpha (S78D) reduced DNA binding, transactivation ability, and protein stability. It also impaired nuclear localization, an effect that was greatly enhanced in the MODY1 mutant Q268X. Treatment of the hepatocellular carcinoma cell line HepG2 with PKC activator phorbol 12-myristate 13-acetate also resulted in increased cytoplasmic localization of HNF4alpha as well as decreased endogenous HNF4alpha protein levels in a proteasome-dependent fashion. We also show that PKC phosphorylates the DNA binding domain of other NRs (retinoic acid receptor alpha, retinoid X receptor alpha, and thyroid hormone receptor beta) and that phosphomimetic mutants of the same Ser/Thr result in cytoplasmic localization of retinoid X receptor alpha and peroxisome proliferator-activated receptor alpha. Thus, phosphorylation of this conserved Ser between the two zinc fingers may be a common mechanism for regulating the function of NRs.

The Orphan Nuclear Receptors at Their 25th Year Reunion

PubMed Central

Mullican, Shannon E.; DiSpirito, Joanna R.; Lazar, Mitchell A.

2013-01-01

The Nuclear Receptor superfamily includes many receptors identified based on their similarity to steroid hormone receptors but without a known ligand. The study of how these receptors are diversely regulated to interact with genomic regions to control a plethora of biological processes has provided critical insight into development, physiology and the molecular pathology of disease. Here we provide a compendium of these so-called Orphan Receptors, and focus on what has been learned about their modes of action, physiological functions, and therapeutic promise. PMID:24096517

A structural perspective on nuclear receptors as targets of environmental compounds

PubMed Central

Delfosse, Vanessa; Maire, Albane le; Balaguer, Patrick; Bourguet, William

2015-01-01

Nuclear receptors (NRs) are members of a large superfamily of evolutionarily related transcription factors that control a plethora of biological processes. NRs orchestrate complex events such as development, organ homeostasis, metabolism, immune function, and reproduction. Approximately one-half of the 48 human NRs have been shown to act as ligand-regulated transcription factors and respond directly to a large variety of endogenous hormones and metabolites that are generally hydrophobic and small in size (eg, retinoic acid or estradiol). The second half of the NR family comprises the so-called orphan receptors, for which regulatory ligands are still unknown or may not exist despite the presence of a C-terminal ligand-binding domain, which is the hallmark of all NRs. Several chemicals released into the environment (eg, bisphenols, phthalates, parabens, etc) share some physicochemical properties with natural ligands, allowing them to bind to NRs and activate or inhibit their action. Collectively referred to as endocrine disruptors or endocrine-disrupting chemicals (EDCs), these environmental pollutants are highly suspected to cause a wide range of developmental, reproductive, neurological, or metabolic defects in humans and wildlife. Crystallographic studies are revealing unanticipated mechanisms by which chemically diverse EDCs interact with the ligand-binding domain of NRs. These studies thereby provide a rational basis for designing novel chemicals with lower impacts on human and animal health. In this review, we provide a structural and mechanistic view of endocrine disrupting action using estrogen receptors α and β, (ERα/β), peroxisome proliferator activated receptor γ (PPARγ), and their respective environmental ligands as representative examples. PMID:25500867

Phenobarbital Meets Phosphorylation of Nuclear Receptors.

PubMed

Negishi, Masahiko

2017-05-01

Phenobarbital was the first therapeutic drug to be characterized for its induction of hepatic drug metabolism. Essentially at the same time, cytochrome P450, an enzyme that metabolizes drugs, was discovered. After nearly 50 years of investigation, the molecular target of phenobarbital induction has now been delineated to phosphorylation at threonine 38 of the constitutive androstane receptor (NR1I3), a member of the nuclear receptor superfamily. Determining this mechanism has provided us with the molecular basis to understand drug induction of drug metabolism and disposition. Threonine 38 is conserved as a phosphorylation motif in the majority of both mouse and human nuclear receptors, providing us with an opportunity to integrate diverse functions of nuclear receptors. Here, I review the works and accomplishments of my laboratory at the National Institutes of Health National Institute of Environmental Health Sciences and the future research directions of where our study of the constitutive androstane receptor might take us. U.S. Government work not protected by U.S. copyright.

The peroxisome proliferator-activated receptor: A family of nuclear receptors role in various diseases

PubMed Central

Tyagi, Sandeep; Gupta, Paras; Saini, Arminder Singh; Kaushal, Chaitnya; Sharma, Saurabh

2011-01-01

Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors of nuclear hormone receptor superfamily comprising of the following three subtypes: PPARα, PPARγ, and PPARβ/δ. Activation of PPAR-α reduces triglyceride level and is involved in regulation of energy homeostasis. Activation of PPAR-γ causes insulin sensitization and enhances glucose metabolism, whereas activation of PPAR-β/δ enhances fatty acids metabolism. Thus, PPAR family of nuclear receptors plays a major regulatory role in energy homeostasis and metabolic function. The present review critically analyzes the protective and detrimental effect of PPAR agonists in dyslipidemia, diabetes, adipocyte differentiation, inflammation, cancer, lung diseases, neurodegenerative disorders, fertility or reproduction, pain, and obesity. PMID:22247890

Application of NMR Methods to Identify Detection Reagents for Use in the Development of Robust Nanosensors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Krishnan, V V; Balhorn, R

2004-04-29

Nuclear Magnetic Resonance (NMR) spectroscopy is a powerful technique for studying bi-molecular interactions at the atomic scale. Our NMR lab is involved in the identification of small molecules, or ligands that bind to target protein receptors, such as tetanus (TeNT) and botulinum (BoNT) neurotoxins, anthrax proteins and HLA-DR10 receptors on non-Hodgkin's lymphoma cancer cells. Once low affinity binders are identified, they can be linked together to produce multidentate synthetic high affinity ligands (SHALs) that have very high specificity for their target protein receptors. An important nanotechnology application for SHALs is their use in the development of robust chemical sensors ormore » biochips for the detection of pathogen proteins in environmental samples or body fluids. Here, we describe a recently developed NMR competition assay based on transferred nuclear Overhauser effect spectroscopy (trNOESY) that enables the identification of sets of ligands that bind to the same site, or a different site, on the surface of TeNT fragment C (TetC) than a known ''marker'' ligand, doxorubicin. Using this assay, we can identify the optimal pairs of ligands to be linked together for creating detection reagents, as well as estimate the relative binding constants for ligands competing for the same site.« less

Cross-talk between an activator of nuclear receptors-mediated transcription and the D1 dopamine receptor signaling pathway.

PubMed

Schmidt, Azriel; Vogel, Robert; Rutledge, Su Jane; Opas, Evan E; Rodan, Gideon A; Friedman, Eitan

2005-03-01

Nuclear receptors are transcription factors that usually interact, in a ligand-dependent manner, with specific DNA sequences located within promoters of target genes. The nuclear receptors can also be controlled in a ligand-independent manner via the action of membrane receptors and cellular signaling pathways. 5-Tetradecyloxy-2-furancarboxylic acid (TOFA) was shown to stimulate transcription from the MMTV promoter via chimeric receptors that consist of the DNA binding domain of GR and the ligand binding regions of the PPARbeta or LXRbeta nuclear receptors (GR/PPARbeta and GR/LXRbeta). TOFA and hydroxycholesterols also modulate transcription from NF-kappaB- and AP-1-controlled reporter genes and induce neurite differentiation in PC12 cells. In CV-1 cells that express D(1) dopamine receptors, D(1) dopamine receptor stimulation was found to inhibit TOFA-stimulated transcription from the MMTV promoter that is under the control of chimeric GR/PPARbeta and GR/LXRbeta receptors. Treatment with the D(1) dopamine receptor antagonist, SCH23390, prevented dopamine-mediated suppression of transcription, and by itself increased transcription controlled by GR/LXRbeta. Furthermore, combined treatment of CV-1 cells with TOFA and SCH23390 increased transcription controlled by the GR/LXRbeta chimeric receptor synergistically. The significance of this in vitro synergy was demonstrated in vivo, by the observation that SCH23390 (but not haloperidol)-mediated catalepsy in rats was potentiated by TOFA, thus showing that an agent that mimics the in vitro activities of compounds that activate members of the LXR and PPAR receptor families can influence D1 dopamine receptor elicited responses.

Insulin-Inducible SMILE Inhibits Hepatic Gluconeogenesis.

PubMed

Lee, Ji-Min; Seo, Woo-Young; Han, Hye-Sook; Oh, Kyoung-Jin; Lee, Yong-Soo; Kim, Don-Kyu; Choi, Seri; Choi, Byeong Hun; Harris, Robert A; Lee, Chul-Ho; Koo, Seung-Hoi; Choi, Hueng-Sik

2016-01-01

The role of a glucagon/cAMP-dependent protein kinase-inducible coactivator PGC-1α signaling pathway is well characterized in hepatic gluconeogenesis. However, an opposing protein kinase B (PKB)/Akt-inducible corepressor signaling pathway is unknown. A previous report has demonstrated that small heterodimer partner-interacting leucine zipper protein (SMILE) regulates the nuclear receptors and transcriptional factors that control hepatic gluconeogenesis. Here, we show that hepatic SMILE expression was induced by feeding in normal mice but not in db/db and high-fat diet (HFD)-fed mice. Interestingly, SMILE expression was induced by insulin in mouse primary hepatocyte and liver. Hepatic SMILE expression was not altered by refeeding in liver-specific insulin receptor knockout (LIRKO) or PKB β-deficient (PKBβ(-/-)) mice. At the molecular level, SMILE inhibited hepatocyte nuclear factor 4-mediated transcriptional activity via direct competition with PGC-1α. Moreover, ablation of SMILE augmented gluconeogenesis and increased blood glucose levels in mice. Conversely, overexpression of SMILE reduced hepatic gluconeogenic gene expression and ameliorated hyperglycemia and glucose intolerance in db/db and HFD-fed mice. Therefore, SMILE is an insulin-inducible corepressor that suppresses hepatic gluconeogenesis. Small molecules that enhance SMILE expression would have potential for treating hyperglycemia in diabetes. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

Ligand-dependent nucleo-cytoplasmic shuttling of peroxisome proliferator-activated receptors, PPARα and PPARγ.

PubMed

Umemoto, Tomoe; Fujiki, Yukio

2012-07-01

Peroxisome proliferator-activated receptors (PPARs) play important roles in diverse biological processes including metabolisms of sugars and lipids and differentiation of cells such as adipocytes. PPARs are transcription factors belonging to the ligand-dependent hormone receptor group. To function as transcription factors, PPARs translocate into nucleus where they associate with transcription apparatus. However, mechanisms underlying nuclear transport of PPARs remain enigmatic. We show here that PPARα and PPARγ dynamically shuttle between nucleus and cytoplasm, although they constitutively and predominantly appear in nucleus. With a series of truncation mutants, we identify that PPAR nuclear transport is mediated by at least two nuclear localization signals (NLSs) in DNA-binding domain (DBD)-hinge and activation function 1 (AF1) regions and their respective receptors including importinα/β, importin 7, and an unidentified receptor. PPARs also harbor two nuclear export signals in DBD and ligand-binding domain regions that are recognized by distinct export receptors, calreticulin and CRM1. Moreover, we show that nuclear-cytoplasmic shuttling of PPARs is regulated by respective PPAR ligands and Ca2+ concentration. Taken together, we suggest that the multiple pathways for the nuclear-cytoplasmic transport of PPARs regulate the biological functions of PPARs in response to external signals. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Analysis of ileal sodium/bile acid cotransporter and related nuclear receptor genes in a family with multiple cases of idiopathic bile acid malabsorption

PubMed Central

Montagnani, Marco; Abrahamsson, Anna; Gälman, Cecilia; Eggertsen, Gösta; Marschall, Hanns-Ulrich; Ravaioli, Elisa; Einarsson, Curt; Dawson, Paul A

2006-01-01

The etiology of most cases of idiopathic bile acid malabsorption (IBAM) is unknown. In this study, a Swedish family with bile acid malabsorption in three consecutive generations was screened for mutations in the ileal apical sodium-bile acid cotransporter gene (ASBT; gene symbol, SLC10A2) and in the genes for several of the nuclear receptors known to be important for ASBT expression: the farnesoid X receptor (FXR) and peroxisome proliferator activated receptor alpha (PPARα). The patients presented with a clinical history of idiopathic chronic watery diarrhea, which was responsive to cholestyramine treatment and consistent with IBAM. Bile acid absorption was determined using 75Se-homocholic acid taurine (SeHCAT); bile acid synthesis was estimated by measuring the plasma levels of 7α-hydroxy-4-cholesten-3-one (C4). The ASBT, FXR, and PPARα genes in the affected and unaffected family members were analyzed using single stranded conformation polymorphism (SSCP), denaturing HPLC, and direct sequencing. No ASBT mutations were identified and the ASBT gene did not segregate with the bile acid malabsorption phenotype. Similarly, no mutations or polymorphisms were identified in the FXR or PPARα genes associated with the bile acid malabsorption phenotype. These studies indicate that the intestinal bile acid malabsorption in these patients cannot be attributed to defects in ASBT. In the absence of apparent ileal disease, alternative explanations such as accelerated transit through the small intestine may be responsible for the IBAM. PMID:17171805

Ontogenetic expression of the vanilloid receptors TRPV1 and TRPV2 in the rat retina.

PubMed

Leonelli, Mauro; Martins, Daniel O; Kihara, Alexandre H; Britto, Luiz R G

2009-11-01

The present study aimed to analyze the gene and protein expression and the pattern of distribution of the vanilloid receptors TRPV1 and TRPV2 in the developing rat retina. During the early phases of development, TRPV1 was found mainly in the neuroblastic layer of the retina and in the pigmented epithelium. In the adult, TRPV1 was found in microglial cells, blood vessels, astrocytes and in neuronal structures, namely synaptic boutons of both retinal plexiform layers, as well as in cell bodies of the inner nuclear layer and the ganglion cell layer. The pattern of distribution of TRPV1 was mainly punctate, and there was higher TRPV1 labeling in the peripheral retina than in central regions. TRPV2 expression was quite distinct. Its expression was virtually undetectable by immunoblotting before P1, and that receptor was found by immunohistochemistry only by postnatal day 15 (P15). RNA and protein analysis showed that the adult levels are only reached by P60, which includes small processes in the retinal plexiform layers, and labeled cellular bodies in the inner nuclear layer and the ganglion cell layer. There was no overlapping between the signal observed for both receptors. In conclusion, our results showed that the patterns of distribution of TRPV1 and TRPV2 are different during the development of the rat retina, suggesting that they have specific roles in both visual processing and in providing specific cues to neural development.

Genome-wide identification of nuclear receptor (NR) superfamily genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Lee, Bo-Young; Kim, Hui-Su; Lee, Min Chul; Kyung, Do-Hyun; Om, Ae-Son; Rhee, Jae-Sung; Lee, Jae-Seong

2014-11-18

Nuclear receptors (NRs) are a large superfamily of proteins defined by a DNA-binding domain (DBD) and a ligand-binding domain (LBD). They function as transcriptional regulators to control expression of genes involved in development, homeostasis, and metabolism. The number of NRs differs from species to species, because of gene duplications and/or lineage-specific gene losses during metazoan evolution. Many NRs in arthropods interact with the ecdysteroid hormone and are involved in ecdysone-mediated signaling in arthropods. The nuclear receptor superfamily complement has been reported in several arthropods, including crustaceans, but not in copepods. We identified the entire NR repertoire of the copepod Tigriopus japonicus, which is an important marine model species for ecotoxicology and environmental genomics. Using whole genome and transcriptome sequences, we identified a total of 31 nuclear receptors in the genome of T. japonicus. Nomenclature of the nuclear receptors was determined based on the sequence similarities of the DNA-binding domain (DBD) and ligand-binding domain (LBD). The 7 subfamilies of NRs separate into five major clades (subfamilies NR1, NR2, NR3, NR4, and NR5/6). Although the repertoire of NR members in, T. japonicus was similar to that reported for other arthropods, there was an expansion of the NR1 subfamily in Tigriopus japonicus. The twelve unique nuclear receptors identified in T. japonicus are members of NR1L. This expansion may be a unique lineage-specific feature of crustaceans. Interestingly, E78 and HR83, which are present in other arthropods, were absent from the genomes of T. japonicus and two congeneric copepod species (T. japonicus and Tigriopus californicus), suggesting copepod lineage-specific gene loss. We identified all NR receptors present in the copepod, T. japonicus. Knowledge of the copepod nuclear receptor repertoire will contribute to a better understanding of copepod- and crustacean-specific NR evolution.

Androgen Receptor Content of the Normal and Hyperplastic Canine Prostate

PubMed Central

Shain, Sydney A.; Boesel, Robert W.

1978-01-01

A procedure was developed for measurement of androgen receptors in cytoplasmic extracts of prostates from intact dogs. The protocol utilized exchange saturation analysis at 15°C employing the synthetic androgen R1881 (17β-hydroxy-17α-methylestra-4,9,11-trien-3-one) as the ligand probe and quantitatively detected total cytoplasmic androgen receptor (Rc, androgen-free receptor, and RcA, androgen-occupied receptor) present at the initiation of the assay. This protocol was employed in conjunction with a tissue mince saturation analysis procedure (for quantitation of nuclear androgen receptor) to quantitate total androgen receptor content of normal and hyperplastic prostates obtained from young (2.5- or 4.6-yr old) and aged (12.5-yr old) purebred dogs of known birth date. The total cytoplasmic androgen receptor content (picomoles per prostate) of hyperplastic prostates was 4.6-fold greater than that of normal prostates. The total nuclear androgen receptor content of hyperplastic prostates (picomoles per prostate measured in crude nuclear preparations) was either 5.0- (4.6-yr-old dogs) or 7.8-fold (2.5-yr-old dogs) greater than that of normal prostates. However, androgen receptor content per cell was identical for hyperplastic and normal canine prostates, with the exception that nuclear androgen receptor was diminished in prostates from 2.5-yr-old dogs. The cell content per gram dry weight was identical for hyperplastic and normal canine prostates. We conclude that canine prostate hyperplasia is characterized by coordinate proliferation of androgen receptor-positive and androgen receptor-negative cells and is not a consequence of increased accumulation of 5α-dihydrotestosterone due to proliferation of androgen receptors per prostate cell. PMID:76635

Hormonal activation of let-7-C microRNAs via EcR is required for adult Drosophila melanogaster morphology and function

PubMed Central

Chawla, Geetanjali; Sokol, Nicholas S.

2012-01-01

Steroid hormones and their nuclear receptors drive developmental transitions in diverse organisms, including mammals. In this study, we show that the Drosophila steroid hormone 20-hydroxyecdysone (20E) and its nuclear receptor directly activate transcription of the evolutionarily conserved let-7-complex (let-7-C) locus, which encodes the co-transcribed microRNAs miR-100, let-7 and miR-125. These small RNAs post-transcriptionally regulate the expression of target genes, and are required for the remodeling of the Drosophila neuromusculature during the larval-to-adult transition. Deletion of three 20E responsive elements located in the let-7-C locus results in reduced levels of let-7-C microRNAs, leading to neuromuscular and behavioral defects in adults. Given the evolutionary conservation of let-7-C microRNA sequences and temporal expression profiles, these findings indicate that steroid hormone-coupled control of let-7-C microRNAs is part of an ancestral pathway controlling the transition from larval-to-reproductive animal forms. PMID:22510985

Comparison of steroid receptors from the androgen responsive DDT1 cell line and the nonresponsive HVP cell line.

PubMed

Norris, J S; Kohler, P O

1978-01-01

Two hamster cell lines have been isolated from androgen target tissue. The DDT1 cells derived from ductus deferens tissue exhibit a growth response to androgens, while the HVP cells derived from ventral prostate are androgen unresponsive. Both cell lines contain androgen receptors, that are similar when compared by kinetic methods, sedimentation velocity, chromatographic procedures or nuclear translocation ability. The forms of the high salt extracted nuclear receptors are indistinguishable chromatographically. Therefore, we postulate that the lesion preventing androgen induced growth in the HVP cell line is subseqent to nuclear translocation of the steroid receptor complex.

Cloning retinoid and peroxisome proliferator-activated nuclear receptors of the Pacific oyster and in silico binding to environmental chemicals

PubMed Central

Vogeler, Susanne; Galloway, Tamara S.; Isupov, Michail

2017-01-01

Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor’s functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor’s ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT). Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l), all-trans retinoic acid (ATRA) (0.06 mg/L) and perfluorooctanoic acid (20 mg/L) showed high effects on development (>74% abnormal developed D-shelled larvae), while rosiglitazone (40 mg/L) showed no effect. The results are discussed in relation to a putative direct (TBT) disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests either a disruptive effect through a pathway excluding nuclear receptors or an indirect interaction. Our findings provide valuable information on potential mechanisms of molluscan nuclear receptors and the effects of environmental pollution on aquatic invertebrates. PMID:28426724

Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

PubMed

Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

2017-08-01

Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

Steroid receptor coupling becomes nuclear.

PubMed

Galigniana, Mario D

2012-06-22

In this issue of Chemistry & Biology, Grossman et al. report a study on aldosterone-dependent nuclear translocation of the mineralocorticoid receptor (MR). They analyze the dependency of MR retrotransport, DNA-binding, and transcriptional activity on Hsp90 and demonstrate that MR dimerization is a nuclear event. Copyright © 2012 Elsevier Ltd. All rights reserved.

Atropisomers of 2,2',3,3',6,6'-hexachlorobiphenyl (PCB 136) exhibit stereoselective effects on activation of nuclear receptors in vitro.

PubMed

Pěnčíková, Kateřina; Brenerová, Petra; Svržková, Lucie; Hrubá, Eva; Pálková, Lenka; Vondráček, Jan; Lehmler, Hans-Joachim; Machala, Miroslav

2017-11-09

PCB 136 is an environmentally relevant chiral PCB congener, which has been found in vivo to be present in form of rotational isomers (atropisomers). Its atropselective biotransformation or neurotoxic effects linked with sensitization of ryanodine receptor suggest that it might interact also with other intracellular receptors in a stereospecific manner. However, possible atropselective effects of PCB 136 on nuclear receptor transactivation remain unknown. Therefore, in this study, atropselective effects of PCB 136 on nuclear receptors controlling endocrine signaling and/or expression of xenobiotic and steroid hormone catabolism were investigated. PCB136 atropisomers were found to exert differential effects on estrogen receptor (ER) activation; (+)-PCB 136 was estrogenic, while (-)-PCB 136 was antiestrogenic. In contrast, inhibition of androgen receptor (AR) activity was not stereospecific. Both PCB136 stereoisomers induced the constitutive androgen receptor (CAR)-dependent gene expression; however, no significant stereospecificity of PCB 136 atropisomers was observed. PCB136 was a partial inducer of the pregnane X receptor (PXR)-dependent gene expression. Here, (-)-PCB 136 was a significantly more potent inducer of PXR activity than (+)-PCB 136. Taken together, the present results indicate that at least two nuclear receptors participating in endocrine regulation or metabolism, ER and PXR, could be regulated in an atropselective manner by chiral PCB 136. The enantioselective enrichment of PCB atropisomers in animal and human tissues may thus have significant consequences for endocrine-disrupting effects of chiral ortho-substituted PCB congeners.

NR4A nuclear receptors are orphans but not lonesome.

PubMed

Kurakula, Kondababu; Koenis, Duco S; van Tiel, Claudia M; de Vries, Carlie J M

2014-11-01

The NR4A subfamily of nuclear receptors consists of three mammalian members: Nur77, Nurr1, and NOR-1. The NR4A receptors are involved in essential physiological processes such as adaptive and innate immune cell differentiation, metabolism and brain function. They act as transcription factors that directly modulate gene expression, but can also form trans-repressive complexes with other transcription factors. In contrast to steroid hormone nuclear receptors such as the estrogen receptor or the glucocorticoid receptor, no ligands have been described for the NR4A receptors. This lack of known ligands might be explained by the structure of the ligand-binding domain of NR4A receptors, which shows an active conformation and a ligand-binding pocket that is filled with bulky amino acid side-chains. Other mechanisms, such as transcriptional control, post-translational modifications and protein-protein interactions therefore seem to be more important in regulating the activity of the NR4A receptors. For Nur77, over 80 interacting proteins (the interactome) have been identified so far, and roughly half of these interactions has been studied in more detail. Although the NR4As show some overlap in interacting proteins, less information is available on the interactome of Nurr1 and NOR-1. Therefore, the present review will describe the current knowledge on the interactomes of all three NR4A nuclear receptors with emphasis on Nur77. Copyright © 2014 Elsevier B.V. All rights reserved.

Design principles of nuclear receptor signaling: how complex networking improves signal transduction

PubMed Central

Kolodkin, Alexey N; Bruggeman, Frank J; Plant, Nick; Moné, Martijn J; Bakker, Barbara M; Campbell, Moray J; van Leeuwen, Johannes P T M; Carlberg, Carsten; Snoep, Jacky L; Westerhoff, Hans V

2010-01-01

The topology of nuclear receptor (NR) signaling is captured in a systems biological graphical notation. This enables us to identify a number of ‘design' aspects of the topology of these networks that might appear unnecessarily complex or even functionally paradoxical. In realistic kinetic models of increasing complexity, calculations show how these features correspond to potentially important design principles, e.g.: (i) cytosolic ‘nuclear' receptor may shuttle signal molecules to the nucleus, (ii) the active export of NRs may ensure that there is sufficient receptor protein to capture ligand at the cytoplasmic membrane, (iii) a three conveyor belts design dissipating GTP-free energy, greatly aids response, (iv) the active export of importins may prevent sequestration of NRs by importins in the nucleus and (v) the unspecific nature of the nuclear pore may ensure signal-flux robustness. In addition, the models developed are suitable for implementation in specific cases of NR-mediated signaling, to predict individual receptor functions and differential sensitivity toward physiological and pharmacological ligands. PMID:21179018

NUREBASE: database of nuclear hormone receptors.

PubMed

Duarte, Jorge; Perrière, Guy; Laudet, Vincent; Robinson-Rechavi, Marc

2002-01-01

Nuclear hormone receptors are an abundant class of ligand activated transcriptional regulators, found in varying numbers in all animals. Based on our experience of managing the official nomenclature of nuclear receptors, we have developed NUREBASE, a database containing protein and DNA sequences, reviewed protein alignments and phylogenies, taxonomy and annotations for all nuclear receptors. The reviewed NUREBASE is completed by NUREBASE_DAILY, automatically updated every 24 h. Both databases are organized under a client/server architecture, with a client written in Java which runs on any platform. This client, named FamFetch, integrates a graphical interface allowing selection of families, and manipulation of phylogenies and alignments. NUREBASE sequence data is also accessible through a World Wide Web server, allowing complex queries. All information on accessing and installing NUREBASE may be found at http://www.ens-lyon.fr/LBMC/laudet/nurebase.html.

Fatty Acid Amide Hydrolase (FAAH) Inhibition Enhances Memory Acquisition through Activation of PPAR-alpha Nuclear Receptors

ERIC Educational Resources Information Center

Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil

2009-01-01

Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB[subscript 1]-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for alpha-type peroxisome proliferator-activated nuclear receptors, PPAR-alpha) when and where they are naturally released in the brain.…

Negative regulation of parathyroid hormone-related protein expression by steroid hormones

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kajitani, Takashi; Tamamori-Adachi, Mimi; Okinaga, Hiroko

Highlights: {yields} Steroid hormones repress expression of PTHrP in the cell lines where the corresponding nuclear receptors are expressed. {yields} Nuclear receptors are required for suppression of PTHrP expression by steroid hormones, except for androgen receptor. {yields} Androgen-induced suppression of PTHrP expression appears to be mediated by estrogen receptor. -- Abstract: Elevated parathyroid hormone-related protein (PTHrP) is responsible for humoral hypercalcemia of malignancy (HHM), which is of clinical significance in treatment of terminal patients with malignancies. Steroid hormones were known to cause suppression of PTHrP expression. However, detailed studies linking multiple steroid hormones to PTHrP expression are lacking. Here wemore » studied PTHrP expression in response to steroid hormones in four cell lines with excessive PTHrP production. Our study established that steroid hormones negatively regulate PTHrP expression. Vitamin D receptor, estrogen receptor {alpha}, glucocorticoid receptor, and progesterone receptor, were required for repression of PTHrP expression by the cognate ligands. A notable exception was the androgen receptor, which was dispensable for suppression of PTHrP expression in androgen-treated cells. We propose a pathway(s) involving nuclear receptors to suppress PTHrP expression.« less

Activity and subcellular compartmentalization of peroxisome proliferator-activated receptor alpha are altered by the centrosome-associated protein CAP350.

PubMed

Patel, Hansa; Truant, Ray; Rachubinski, Richard A; Capone, John P

2005-01-01

Peroxisome proliferator-activated nuclear hormone receptors (PPAR) are ligand-activated transcription factors that play pivotal roles in governing metabolic homeostasis and cell growth. PPARs are primarily in the nucleus but, under certain circumstances, can be found in the cytoplasm. We show here that PPAR(alpha) interacts with the centrosome-associated protein CAP350. CAP350 also interacts with PPAR(delta), PPAR(gamma) and liver-X-receptor alpha, but not with the 9-cis retinoic acid receptor, RXR(alpha). Immunofluorescence analysis indicated that PPAR(alpha) is diffusely distributed in the nucleus and excluded from the cytoplasm. However, in the presence of coexpressed CAP350, PPAR(alpha) colocalizes with CAP350 to discrete nuclear foci and to the centrosome, perinuclear region and intermediate filaments. In contrast, the subcellular distribution of RXR(alpha) or of thyroid hormone receptor alpha was not altered by coexpression of CAP350. An amino-terminal fragment of CAP350 was localized exclusively to nuclear foci and was sufficient to recruit PPAR(alpha) to these sites. Mutation of the single putative nuclear hormone receptor interacting signature motif LXXLL present in this fragment had no effect on its subnuclear localization but abrogated recruitment of PPAR(alpha) to nuclear foci. Surprisingly, mutation of the LXXLL motif in this CAP350 subfragment did not prevent its binding to PPAR(alpha) in vitro, suggesting that this motif serves some function other than PPAR(alpha) binding in recruiting PPAR(alpha) to nuclear spots. CAP350 inhibited PPAR(alpha)-mediated transactivation in an LXXLL-dependent manner, suggesting that CAP350 represses PPAR(alpha) function. Our findings implicate CAP350 in a dynamic process that recruits PPAR(alpha) to discrete nuclear and cytoplasmic compartments and suggest that altered intracellular compartmentalization represents a regulatory process that modulates PPAR function.

Action mechanisms of Liver X Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabbi, Chiara; Warner, Margaret; Gustafsson, Jan-Åke, E-mail: jgustafs@central.uh.edu

2014-04-11

Highlights: • LXRα and LXRβ are ligand-activated nuclear receptors. • They share oxysterol ligands and the same heterodimerization partner, RXR. • LXRs regulate lipid and glucose metabolism, CNS and immune functions, and water transport. - Abstract: The two Liver X Receptors, LXRα and LXRβ, are nuclear receptors belonging to the superfamily of ligand-activated transcription factors. They share more than 78% homology in amino acid sequence, a common profile of oxysterol ligands and the same heterodimerization partner, Retinoid X Receptor. LXRs play crucial roles in several metabolic pathways: lipid metabolism, in particular in preventing cellular cholesterol accumulation; glucose homeostasis; inflammation; centralmore » nervous system functions and water transport. As with all nuclear receptors, the transcriptional activity of LXR is the result of an orchestration of numerous cellular factors including ligand bioavailability, presence of corepressors and coactivators and cellular context i.e., what other pathways are activated in the cell at the time the receptor recognizes its ligand. In this mini-review we summarize the factors regulating the transcriptional activity and the mechanisms of action of these two receptors.« less

The Genomic Actions and Functional Implications of Nuclear PRLr in Human Breast Carcinoma

DTIC Science & Technology

2011-03-01

Johnston CL, Cox HC, Gomm JJ, Coombes RC 1995 Fibroblast growth factor receptors ( FGFRs ) localize in different cellular compartments. A splice variant...has been observed (11). The Jak2/Stat5a pathway is widely shared with other transmembrane receptors such as epidermal growth factor receptor (EGFR...2005 Novel prognostic value of nuclear epidermal growth factor receptor in breast cancer. Cancer Res 65:338-348 13. Lin SY, Makino K, Xia W, Matin A

Identification of COUP-TFII Orphan Nuclear Receptor as a Retinoic Acid-Activated Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruse, Schoen W; Suino-Powell, Kelly; Zhou, X Edward

2010-01-12

The chicken ovalbumin upstream promoter-transcription factors (COUP-TFI and II) make up the most conserved subfamily of nuclear receptors that play key roles in angiogenesis, neuronal development, organogenesis, cell fate determination, and metabolic homeostasis. Although the biological functions of COUP-TFs have been studied extensively, little is known of their structural features or aspects of ligand regulation. Here we report the ligand-free 1.48 {angstrom} crystal structure of the human COUP-TFII ligand-binding domain. The structure reveals an autorepressed conformation of the receptor, where helix {alpha}10 is bent into the ligand-binding pocket and the activation function-2 helix is folded into the cofactor binding site,more » thus preventing the recruitment of coactivators. In contrast, in multiple cell lines, COUP-TFII exhibits constitutive transcriptional activity, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, and ligand binding, substantially reduce the COUP-TFII transcriptional activity. Importantly, retinoid acids are able to promote COUP-TFII to recruit coactivators and activate a COUP-TF reporter construct. Although the concentration needed is higher than the physiological levels of retinoic acids, these findings demonstrate that COUP-TFII is a ligand-regulated nuclear receptor, in which ligands activate the receptor by releasing it from the autorepressed conformation.« less

SPR-based fragment screening with neurotensin receptor 1 generates novel small molecule ligands

PubMed Central

Huber, Sylwia; Casagrande, Fabio; Hug, Melanie N.; Wang, Lisha; Heine, Philipp; Kummer, Lutz; Plückthun, Andreas; Hennig, Michael

2017-01-01

The neurotensin receptor 1 represents an important drug target involved in various diseases of the central nervous system. So far, the full exploitation of potential therapeutic activities has been compromised by the lack of compounds with favorable physicochemical and pharmacokinetic properties which efficiently penetrate the blood-brain barrier. Recent progress in the generation of stabilized variants of solubilized neurotensin receptor 1 and its subsequent purification and successful structure determination presents a solid starting point to apply the approach of fragment-based screening to extend the chemical space of known neurotensin receptor 1 ligands. In this report, surface plasmon resonance was used as primary method to screen 6369 compounds. Thereby 44 hits were identified and confirmed in competition as well as dose-response experiments. Furthermore, 4 out of 8 selected hits were validated using nuclear magnetic resonance spectroscopy as orthogonal biophysical method. Computational analysis of the compound structures, taking the known crystal structure of the endogenous peptide agonist into consideration, gave insight into the potential fragment-binding location and interactions and inspires chemistry efforts for further exploration of the fragments. PMID:28510609

The story so far: post-translational regulation of peroxisome proliferator-activated receptors by ubiquitination and SUMOylation

PubMed Central

Wadosky, Kristine M.

2012-01-01

Many studies have implicated the peroxisome proliferator-activated receptor (PPAR) family of nuclear receptor transcription factors in regulating cardiac substrate metabolism and ATP generation. Recently, evidence from a variety of cell culture and organ systems has implicated ubiquitin and small ubiquitin-like modifier (SUMO) conjugation as post-translational modifications that regulate the activity of PPAR transcription factors and their coreceptors/coactivators. Here we introduce the ubiquitin and SUMO conjugation systems and extensively review how they have been shown to regulate all three PPAR isoforms (PPARα, PPARβ/δ, and PPARγ) in addition to the retinoid X receptor and PPARγ coactivator-1α subunits of the larger PPAR transcription factor complex. We then present how the specific ubiquitin (E3) ligases have been implicated and review emerging evidence that post-translational modifications of PPARs with ubiquitin and/or SUMO may play a role in cardiac disease. Because PPAR activity is perturbed in a variety of forms of heart disease and specific proteins regulate this process (E3 ligases), this may be a fruitful area of investigation with respect to finding new therapeutic targets. PMID:22037188

Integrated in silico and in vivo approaches to investigate effects of BDE-99 mediated by the nuclear receptors on developing zebrafish.

PubMed

Zhang, Li; Jin, Yaru; Han, Zhihua; Liu, Hongling; Shi, Laihao; Hua, Xiaoxue; Doering, Jon A; Tang, Song; Giesy, John P; Yu, Hongxia

2018-03-01

One of the most abundant polybrominated diphenyl ethers (PBDEs) is 2,2',4,4',5-pentabromodiphenyl ether (BDE-99), which persists and potentially bioaccumulates in aquatic wildlife. Previous studies in mammals have shown that BDE-99 affects development and disrupts certain endocrine functions through signaling pathways mediated by nuclear receptors. However, fewer studies have investigated the potential of BDE-99 to interact with nuclear receptors in aquatic vertebrates such as fish. In the present study, interactions between BDE-99 and nuclear receptors were investigated by in silico and in vivo approaches. This PBDE was able to dock into the ligand-binding domain of zebrafish aryl hydrocarbon receptor 2 (AhR2) and pregnane X receptor (PXR). It had a significant effect on the transcriptional profiles of genes associated with AhR or PXR. Based on the developed cytoscape of all zebrafish genes, it was also inferred that AhR and PXR could interact via cross-talk. In addition, both the in silico and in vivo approaches found that BDE-99 affected peroxisome proliferator-activated receptor alpha (PPARα), glucocorticoid receptor, and thyroid receptor. Collectively, our results demonstrate for the first time detailed in silico evidence that BDE-99 can bind to and interact with zebrafish AhR and PXR. These findings can be used to elaborate the molecular mechanism of BDE-99 and guide more objective environmental risk assessments. Environ Toxicol Chem 2018;37:780-787. © 2017 SETAC. © 2017 SETAC.

Nuclear receptor/microRNA circuitry links muscle fiber type to energy metabolism.

PubMed

Gan, Zhenji; Rumsey, John; Hazen, Bethany C; Lai, Ling; Leone, Teresa C; Vega, Rick B; Xie, Hui; Conley, Kevin E; Auwerx, Johan; Smith, Steven R; Olson, Eric N; Kralli, Anastasia; Kelly, Daniel P

2013-06-01

The mechanisms involved in the coordinate regulation of the metabolic and structural programs controlling muscle fitness and endurance are unknown. Recently, the nuclear receptor PPARβ/δ was shown to activate muscle endurance programs in transgenic mice. In contrast, muscle-specific transgenic overexpression of the related nuclear receptor, PPARα, results in reduced capacity for endurance exercise. We took advantage of the divergent actions of PPARβ/δ and PPARα to explore the downstream regulatory circuitry that orchestrates the programs linking muscle fiber type with energy metabolism. Our results indicate that, in addition to the well-established role in transcriptional control of muscle metabolic genes, PPARβ/δ and PPARα participate in programs that exert opposing actions upon the type I fiber program through a distinct muscle microRNA (miRNA) network, dependent on the actions of another nuclear receptor, estrogen-related receptor γ (ERRγ). Gain-of-function and loss-of-function strategies in mice, together with assessment of muscle biopsies from humans, demonstrated that type I muscle fiber proportion is increased via the stimulatory actions of ERRγ on the expression of miR-499 and miR-208b. This nuclear receptor/miRNA regulatory circuit shows promise for the identification of therapeutic targets aimed at maintaining muscle fitness in a variety of chronic disease states, such as obesity, skeletal myopathies, and heart failure.

Transcriptional activation of PPARalpha by phenobarbital in the absence of CAR and PXR.

PubMed

Tamasi, Viola; Juvan, Peter; Beer, Markus; Rozman, Damjana; Meyer, Urs A

2009-01-01

The nuclear receptors CAR (constitutive androstane receptor) and PXR (pregnane X receptor) mediate the effects of phenobarbital on gene transcription. To investigate the relative contribution of these nuclear receptors to the expression of specific genes we studied the effect of phenobarbital in livers of wild type, CAR(-/-), PXR(-/-) and CAR/PXR(-/-) knockout mice. Spotted Steroltalk v1 cDNA arrays were applied containing probes for genes involved in drug metabolism, sterol biosynthesis, steroid synthesis/transport and heme synthesis. In the absence of CAR and PXR, phenobarbital unexpectedly induced mRNAs of several nuclear receptors, including PPARalpha and its target genes Cyp4a10 and Cyp4a14. Interestingly, in primary cultures of hepatocytes isolated from CAR/PXR(-/-) knockout mice, phenobarbital increased HNF-4alpha levels. In further experiments in these hepatocyte cultures we provide evidence that phenobarbital directly induces transcription of the PPARalpha gene via its HNF-4alpha response element, and indirectly by lack of inhibitory crosstalk of AMPK, CAR and PXR with HNF-4alpha. Our results provide further insight into CAR and PXR-independent effects of phenobarbital and the crosstalk between different nuclear receptor signaling pathways.

The Peptide Near the C Terminus Regulates Receptor CAR Nuclear Translocation Induced by Xenochemicals in Mouse Liver

PubMed Central

Zelko, Igor; Sueyoshi, Tatsuya; Kawamoto, Takeshi; Moore, Rick; Negishi, Masahiko

2001-01-01

In response to phenobarbital (PB) and other PB-type inducers, the nuclear receptor CAR translocates to the mouse liver nucleus (T. Kawamoto et al., Mol. Cell. Biol. 19:6318–6322, 1999). To define the translocation mechanism, fluorescent protein-tagged human CAR (hCAR) was expressed in the mouse livers using the in situ DNA injection and gene delivery systems. As in the wild-type hCAR, the truncated receptor lacking the C-terminal 10 residues (i.e., AF2 domain) translocated to the nucleus, indicating that the PB-inducible translocation is AF2 independent. Deletion of the 30 C-terminal residues abolished the receptor translocation, and subsequent site-directed mutagenesis delineated the PB-inducible translocation activity of the receptor to the peptide L313GLL316AEL319. Ala mutations of Leu313, Leu316, or Leu319 abrogated the translocation of CAR in the livers, while those of Leu312 or Leu315 did not affect the nuclear translocation. The leucine-rich peptide dictates the nuclear translocation of hCAR in response to various PB-type inducers and appears to be conserved in the mouse and rat receptors. PMID:11283262

G protein-coupled receptor 84 controls osteoclastogenesis through inhibition of NF-κB and MAPK signaling pathways.

PubMed

Park, Ji-Wan; Yoon, Hye-Jin; Kang, Woo Youl; Cho, Seungil; Seong, Sook Jin; Lee, Hae Won; Yoon, Young-Ran; Kim, Hyun-Ju

2018-02-01

GPR84, a member of the G protein-coupled receptor family, is found predominantly in immune cells, such as macrophages, and functions as a pivotal modulator of inflammatory responses. In this study, we investigated the role of GPR84 in receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast differentiation. Our microarray data showed that GPR84 was significantly downregulated in osteoclasts compared to in their precursors, macrophages. The overexpression of GPR84 in bone marrow-derived macrophages suppressed the formation of multinucleated osteoclasts without affecting precursor proliferation. In addition, GPR84 overexpression attenuated the induction of c-Fos and nuclear factor of activated T cells, cytoplasmic 1 (NFATc1), which are transcription factors that are critical for osteoclastogenesis. Furthermore, knockdown of GPR84 using a small hairpin RNA promoted RANKL-mediated osteoclast differentiation and gene expression of osteoclastogenic markers. Mechanistically, GPR84 overexpression blocked RANKL-stimulated phosphorylation of IκBα and three MAPKs, JNK, ERK, and p38. GPR84 also suppressed NF-κB transcriptional activity mediated by RANKL. Conversely, GPR84 knockdown enhanced RANKL-induced activation of IκBα and the three MAPKs. Collectively, our results revealed that GPR84 functions as a negative regulator of osteoclastogenesis, suggesting that it may be a potential therapeutic target for osteoclast-mediated bone-destructive diseases. © 2017 Wiley Periodicals, Inc.

SRC-2-mediated coactivation of anti-tumorigenic target genes suppresses MYC-induced liver cancer

PubMed Central

Zhou, Xiaorong; Comerford, Sarah A.; York, Brian; O’Donnell, Kathryn A.

2017-01-01

Hepatocellular carcinoma (HCC) is the fifth most common solid tumor in the world and the third leading cause of cancer-associated deaths. A Sleeping Beauty-mediated transposon mutagenesis screen previously identified mutations that cooperate with MYC to accelerate liver tumorigenesis. This revealed a tumor suppressor role for Steroid Receptor Coactivator 2/Nuclear Receptor Coactivator 2 (Src-2/Ncoa2) in liver cancer. In contrast, SRC-2 promotes survival and metastasis in prostate cancer cells, suggesting a tissue-specific and context-dependent role for SRC-2 in tumorigenesis. To determine if genetic loss of SRC-2 is sufficient to accelerate MYC-mediated liver tumorigenesis, we bred Src-2-/- mice with a MYC-induced liver tumor model and observed a significant increase in liver tumor burden. RNA sequencing of liver tumors and in vivo chromatin immunoprecipitation assays revealed a set of direct target genes that are bound by SRC-2 and exhibit downregulated expression in Src-2-/- liver tumors. We demonstrate that activation of SHP (Small Heterodimer Partner), DKK4 (Dickkopf-4), and CADM4 (Cell Adhesion Molecule 4) by SRC-2 suppresses tumorigenesis in vitro and in vivo. These studies suggest that SRC-2 may exhibit oncogenic or tumor suppressor activity depending on the target genes and nuclear receptors that are expressed in distinct tissues and illuminate the mechanisms of tumor suppression by SRC-2 in liver. PMID:28273073

The REV-ERBs and RORs: molecular links between circadian rhythms and lipid homeostasis

PubMed Central

Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P

2011-01-01

Research efforts spanning the past two decades have established a clear link between nuclear receptor function, regulation of the circadian clock and lipid homeostasis. As such, this family of receptors represents an important area of research. Recent advances in the field have identified two nuclear receptor subfamilies, the REV-ERBs and the ‘retinoic acid receptor-related orphan receptors’ (RORs), as critical regulators of the circadian clock with significant roles in lipid homeostasis. In this review, the latest information garnered from cutting-edge research on these two nuclear receptor subfamilies will be discussed. Through direct targeting of the REV-ERBs and RORs with synthetic ligands, generation of novel tools aimed at characterizing their function in vivo have been developed, which may lead to novel therapeutics for the treatment of metabolic disorders. PMID:21526899

In vitro anticancer effects of a RAGE inhibitor discovered using a structure-based drug design system

PubMed Central

El-Far, Ali Hafez Ali Mohammed; Munesue, Seiichi; Harashima, Ai; Sato, Akira; Shindo, Mika; Nakajima, Shingo; Inada, Mana; Tanaka, Mariko; Takeuchi, Akihiko; Tsuchiya, Hiroyuki; Yamamoto, Hiroshi; Shaheen, Hazem M.E.; El-Sayed, Yasser S.; Kawano, Shuhei; Tanuma, Sei-Ichi; Yamamoto, Yasuhiko

2018-01-01

Receptor for advanced glycation end-products (RAGE) is a pattern recognition receptor implicated in the pathogenesis of certain types of cancer. In the present study, papaverine was identified as a RAGE inhibitor using the conversion to small molecules through optimized-peptide strategy drug design system. Papaverine significantly inhibited RAGE-dependent nuclear factor κ-B activation driven by high mobility group box-1, a RAGE ligand. Using RAGE- or dominant-negative RAGE-expressing HT1080 human fibrosarcoma cells, the present study revealed that papaverine suppressed RAGE-dependent cell proliferation and migration dose-dependently. Furthermore, papaverine significantly inhibited cell invasion. The results of the present study suggested that papaverine could inhibit RAGE, and provided novel insights into the field of RAGE biology, particularly anticancer therapies. PMID:29541234

Controlling Androgen receptor nuclear localization by dendrimer conjugates

NASA Astrophysics Data System (ADS)

Wang, Haoyu

Androgen Receptor (AR) antagonists, such as bicalutamide and flutamide have been used widely in the treatment of prostate cancer. Although initial treatment is effective, prostate cancer cells often acquire antiandrogen resistance with prolonged treatment. AR over-expression and AR mutations contribute to the development of antiandrogen resistant cancer. Second generation antiandrogens such as enzalutamide are more effective and show reduced AR nuclear localization. In this study, derivatives of PAN52, a small molecule antiandrogen previously developed in our lab, were conjugated to the surface of generation 4 and generation 6 PAMAM dendrimers to obtain antiandrogen PAMAM dendrimer conjugates (APDC). APDCs readily enter cells and associate with AR in the cytoplasm. Due to their large size and positive charge, they can not enter the nucleus, thus retaining AR in the cytoplasm. In addition, APDCs are effective in decreasing AR mediated transcription and cell proliferation. APDC is the first AR antagonists that inhibit DHT-induced nuclear localization of AR. By inhibiting AR nuclear localization, APDC represents a new class of antiandrogens that offer an alternative approach to addressing antiandrogen-resistant prostate cancer. Lysine post-translational modification of AR Nuclear Localization Sequence (NLS) has great impact on AR cellular localization. It is of interest to understand which modifications modulate AR translocation into the nucleus. In this study, we prepared dendrimer-based acetyltransferase mimetic (DATM), DATM is able to catalytically acetylate AR in CWR22Rv1 cells, which will be a useful tool for studying AR modification effect on AR cellular localization. Derivatives of DATM, which transfer other chemical groups to AR, can be prepared similarly, and with more dendrimer based AR modification tools prepared in future, we will be able to understand and control AR cellular localization through AR modification.

Distinct gene regulatory programs define the inhibitory effects of liver X receptors and PPARG on cancer cell proliferation.

PubMed

Savic, Daniel; Ramaker, Ryne C; Roberts, Brian S; Dean, Emma C; Burwell, Todd C; Meadows, Sarah K; Cooper, Sara J; Garabedian, Michael J; Gertz, Jason; Myers, Richard M

2016-07-11

The liver X receptors (LXRs, NR1H2 and NR1H3) and peroxisome proliferator-activated receptor gamma (PPARG, NR1C3) nuclear receptor transcription factors (TFs) are master regulators of energy homeostasis. Intriguingly, recent studies suggest that these metabolic regulators also impact tumor cell proliferation. However, a comprehensive temporal molecular characterization of the LXR and PPARG gene regulatory responses in tumor cells is still lacking. To better define the underlying molecular processes governing the genetic control of cellular growth in response to extracellular metabolic signals, we performed a comprehensive, genome-wide characterization of the temporal regulatory cascades mediated by LXR and PPARG signaling in HT29 colorectal cancer cells. For this analysis, we applied a multi-tiered approach that incorporated cellular phenotypic assays, gene expression profiles, chromatin state dynamics, and nuclear receptor binding patterns. Our results illustrate that the activation of both nuclear receptors inhibited cell proliferation and further decreased glutathione levels, consistent with increased cellular oxidative stress. Despite a common metabolic reprogramming, the gene regulatory network programs initiated by these nuclear receptors were widely distinct. PPARG generated a rapid and short-term response while maintaining a gene activator role. By contrast, LXR signaling was prolonged, with initial, predominantly activating functions that transitioned to repressive gene regulatory activities at late time points. Through the use of a multi-tiered strategy that integrated various genomic datasets, our data illustrate that distinct gene regulatory programs elicit common phenotypic effects, highlighting the complexity of the genome. These results further provide a detailed molecular map of metabolic reprogramming in cancer cells through LXR and PPARG activation. As ligand-inducible TFs, these nuclear receptors can potentially serve as attractive therapeutic targets for the treatment of various cancers.

Retinoids induce integrin-independent lymphocyte adhesion through RAR-α nuclear receptor activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whelan, Jarrett T.; Wang, Lei; Chen, Jianming

2014-11-28

Highlights: • Transcription and translation are required for retinoid-induced lymphocyte adhesion. • RAR activation is sufficient to induced lymphocyte cell adhesion. • Vitamin D derivatives inhibit RAR-prompted lymphocyte adhesion. • Adhesion occurs through a novel binding site within ADAM disintegrin domains. • RARα is a key nuclear receptor for retinoid-dependent lymphocyte cell adhesion. - Abstract: Oxidative metabolites of vitamin A, in particular all-trans-retinoic acid (atRA), have emerged as key factors in immunity by specifying the localization of immune cells to the gut. Although it is appreciated that isomers of retinoic acid activate the retinoic acid receptor (RAR) and retinoid Xmore » receptor (RXR) family of nuclear receptors to elicit cellular changes, the molecular details of retinoic acid action remain poorly defined in immune processes. Here we employ a battery of agonists and antagonists to delineate the specific nuclear receptors utilized by retinoids to evoke lymphocyte cell adhesion to ADAM (adisintegrin and metalloprotease) protein family members. We report that RAR agonism is sufficient to promote immune cell adhesion in both immortal and primary immune cells. Interestingly, adhesion occurs independent of integrin function, and mutant studies demonstrate that atRA-induced adhesion to ADAM members required a distinct binding interface(s) as compared to integrin recognition. Anti-inflammatory corticosteroids as well as 1,25-(OH){sub 2}D{sub 3}, a vitamin D metabolite that prompts immune cell trafficking to the skin, potently inhibited the observed adhesion. Finally, our data establish that induced adhesion was specifically attributable to the RAR-α receptor isotype. The current study provides novel molecular resolution as to which nuclear receptors transduce retinoid exposure into immune cell adhesion.« less

Nuclear hormone receptor coregulator: role in hormone action, metabolism, growth, and development.

PubMed

Mahajan, Muktar A; Samuels, Herbert H

2005-06-01

Nuclear hormone receptor coregulator (NRC) (also referred to as activating signal cointegrator-2, thyroid hormone receptor-binding protein, peroxisome proliferator activating receptor-interacting protein, and 250-kDa receptor associated protein) belongs to a growing class of nuclear cofactors widely known as coregulators or coactivators that are necessary for transcriptional activation of target genes. The NRC gene is also amplified and overexpressed in breast, colon, and lung cancers. NRC is a 2063-amino acid protein that harbors a potent N-terminal activation domain (AD1) and a second more centrally located activation domain (AD2) that is rich in Glu and Pro. Near AD2 is a receptor-interacting domain containing an LxxLL motif (LxxLL-1), which interacts with a wide variety of ligand-bound nuclear hormone receptors with high affinity. A second LxxLL motif (LxxLL-2) located in the C-terminal region of NRC is more restricted in its nuclear hormone receptor specificity. The intrinsic activation potential of NRC is regulated by a C-terminal serine, threonine, leucine-regulatory domain. The potential role of NRC as a cointegrator is suggested by its ability to enhance transcriptional activation of a wide variety of transcription factors and from its in vivo association with a number of known transcriptional regulators including CBP/p300. Recent studies in mice indicate that deletion of both NRC alleles leads to embryonic lethality resulting from general growth retardation coupled with developmental defects in the heart, liver, brain, and placenta. NRC(-/-) mouse embryo fibroblasts spontaneously undergo apoptosis, indicating the importance of NRC as a prosurvival and antiapoptotic gene. Studies with 129S6 NRC(+/-) mice indicate that NRC is a pleiotropic regulator that is involved in growth, development, reproduction, metabolism, and wound healing.

Identification of Putative Nuclear Receptors and Steroidogenic Enzymes in Murray-Darling Rainbowfish (Melanotaenia fluviatilis) Using RNA-Seq and De Novo Transcriptome Assembly.

PubMed

Bain, Peter A; Papanicolaou, Alexie; Kumar, Anupama

2015-01-01

Murray-Darling rainbowfish (Melanotaenia fluviatilis [Castelnau, 1878]; Atheriniformes: Melanotaeniidae) is a small-bodied teleost currently under development in Australasia as a test species for aquatic toxicological studies. To date, efforts towards the development of molecular biomarkers of contaminant exposure have been hindered by the lack of available sequence data. To address this, we sequenced messenger RNA from brain, liver and gonads of mature male and female fish and generated a high-quality draft transcriptome using a de novo assembly approach. 149,742 clusters of putative transcripts were obtained, encompassing 43,841 non-redundant protein-coding regions. Deduced amino acid sequences were annotated by functional inference based on similarity with sequences from manually curated protein sequence databases. The draft assembly contained protein-coding regions homologous to 95.7% of the complete cohort of predicted proteins from the taxonomically related species, Oryzias latipes (Japanese medaka). The mean length of rainbowfish protein-coding sequences relative to their medaka homologues was 92.1%, indicating that despite the limited number of tissues sampled a large proportion of the total expected number of protein-coding genes was captured in the study. Because of our interest in the effects of environmental contaminants on endocrine pathways, we manually curated subsets of coding regions for putative nuclear receptors and steroidogenic enzymes in the rainbowfish transcriptome, revealing 61 candidate nuclear receptors encompassing all known subfamilies, and 41 putative steroidogenic enzymes representing all major steroidogenic enzymes occurring in teleosts. The transcriptome presented here will be a valuable resource for researchers interested in biomarker development, protein structure and function, and contaminant-response genomics in Murray-Darling rainbowfish.

A genetic polymorphism repurposes the G-protein coupled and membrane-associated estrogen receptor GPER to a transcription factor-like molecule promoting paracrine signaling between stroma and breast carcinoma cells

PubMed Central

Pupo, Marco; Bodmer, Alexandre; Berto, Melissa; Maggiolini, Marcello; Dietrich, Pierre-Yves; Picard, Didier

2017-01-01

GPER is a membrane-associated estrogen receptor of the family of G-protein coupled receptors. For breast cancer, the contribution of GPER to promoting the proliferation and migration of both carcinoma cells and cancer-associated fibroblasts (CAFs) in response to estrogen and other agonists has extensively been investigated. Intriguingly, GPER was previously found to be localized to the nucleus in one isolate of breast CAFs. Moreover, this nuclear GPER was shown to bind regulatory sequences of cancer-relevant target genes and to induce their expression. We decided to find out what induces the nuclear localization of GPER, how general this phenomenon is, and what its functional significance is. We discovered that interfering with N-linked glycosylation of GPER, either by mutation of the predicted glycosylation sites or pharmacologically with tunicamycin, drives GPER into the nucleus. Surveying a small set of CAFs from breast cancer biopsies, we found that a relatively common single nucleotide polymorphism, which results in the expression of a GPER variant with the amino acid substitution P16L, is associated with the nuclear localization of GPER. GPER with P16L fails to be glycosylated, presumably because of a conformational effect on the nearby glycosylation sites. GPER P16L is defective for membrane-associated signaling, but instead acts like an estrogen-stimulated transcription factor. In CAFs, it induces the secretion of paracrine factors that promote the migration of carcinoma cells. This raises the possibility that the GPER P16L polymorphism could be a risk factor for breast cancer. PMID:28596490

The nuclear receptor ERβ engages AGO2 in regulation of gene transcription, RNA splicing and RISC loading.

PubMed

Tarallo, Roberta; Giurato, Giorgio; Bruno, Giuseppina; Ravo, Maria; Rizzo, Francesca; Salvati, Annamaria; Ricciardi, Luca; Marchese, Giovanna; Cordella, Angela; Rocco, Teresa; Gigantino, Valerio; Pierri, Biancamaria; Cimmino, Giovanni; Milanesi, Luciano; Ambrosino, Concetta; Nyman, Tuula A; Nassa, Giovanni; Weisz, Alessandro

2017-10-06

The RNA-binding protein Argonaute 2 (AGO2) is a key effector of RNA-silencing pathways It exerts a pivotal role in microRNA maturation and activity and can modulate chromatin remodeling, transcriptional gene regulation and RNA splicing. Estrogen receptor beta (ERβ) is endowed with oncosuppressive activities, antagonizing hormone-induced carcinogenesis and inhibiting growth and oncogenic functions in luminal-like breast cancers (BCs), where its expression correlates with a better prognosis of the disease. Applying interaction proteomics coupled to mass spectrometry to characterize nuclear factors cooperating with ERβ in gene regulation, we identify AGO2 as a novel partner of ERβ in human BC cells. ERβ-AGO2 association was confirmed in vitro and in vivo in both the nucleus and cytoplasm and is shown to be RNA-mediated. ChIP-Seq demonstrates AGO2 association with a large number of ERβ binding sites, and total and nascent RNA-Seq in ERβ + vs ERβ - cells, and before and after AGO2 knock-down in ERβ + cells, reveals a widespread involvement of this factor in ERβ-mediated regulation of gene transcription rate and RNA splicing. Moreover, isolation and sequencing by RIP-Seq of ERβ-associated long and small RNAs in the cytoplasm suggests involvement of the nuclear receptor in RISC loading, indicating that it may also be able to directly control mRNA translation efficiency and stability. These results demonstrate that AGO2 can act as a pleiotropic functional partner of ERβ, indicating that both factors are endowed with multiple roles in the control of key cellular functions.

A genetic polymorphism repurposes the G-protein coupled and membrane-associated estrogen receptor GPER to a transcription factor-like molecule promoting paracrine signaling between stroma and breast carcinoma cells.

PubMed

Pupo, Marco; Bodmer, Alexandre; Berto, Melissa; Maggiolini, Marcello; Dietrich, Pierre-Yves; Picard, Didier

2017-07-18

GPER is a membrane-associated estrogen receptor of the family of G-protein coupled receptors. For breast cancer, the contribution of GPER to promoting the proliferation and migration of both carcinoma cells and cancer-associated fibroblasts (CAFs) in response to estrogen and other agonists has extensively been investigated. Intriguingly, GPER was previously found to be localized to the nucleus in one isolate of breast CAFs. Moreover, this nuclear GPER was shown to bind regulatory sequences of cancer-relevant target genes and to induce their expression. We decided to find out what induces the nuclear localization of GPER, how general this phenomenon is, and what its functional significance is. We discovered that interfering with N-linked glycosylation of GPER, either by mutation of the predicted glycosylation sites or pharmacologically with tunicamycin, drives GPER into the nucleus. Surveying a small set of CAFs from breast cancer biopsies, we found that a relatively common single nucleotide polymorphism, which results in the expression of a GPER variant with the amino acid substitution P16L, is associated with the nuclear localization of GPER. GPER with P16L fails to be glycosylated, presumably because of a conformational effect on the nearby glycosylation sites. GPER P16L is defective for membrane-associated signaling, but instead acts like an estrogen-stimulated transcription factor. In CAFs, it induces the secretion of paracrine factors that promote the migration of carcinoma cells. This raises the possibility that the GPER P16L polymorphism could be a risk factor for breast cancer.

Brain nuclear receptors and body weight regulation

USDA-ARS?s Scientific Manuscript database

Neural pathways, especially those in the hypothalamus, integrate multiple nutritional, hormonal, and neural signals, resulting in the coordinated control of body weight balance and glucose homeostasis. Nuclear receptors (NRs) sense changing levels of nutrients and hormones, and therefore play essent...

Nuclear receptors HR96 and ultraspiracle from the fall armyworm (Spodoptera frugiperda), developmental expression and induction by xenobiotics.

PubMed

Giraudo, Maeva; Audant, Pascaline; Feyereisen, René; Le Goff, Gaëlle

2013-05-01

The fall armyworm Spodoptera frugiperda is a major polyphagous pest in agriculture and little is known on how this insect can adapt to the diverse and potentially toxic plant allelochemicals that they ingest or to insecticides. To investigate the involvement of nuclear receptors in the response of S. frugiperda to its chemical environment, we cloned SfHR96, a nuclear receptor orthologous to the mammalian xenobiotic receptors, pregnane X receptor (PXR) and constitutive androstane receptor (CAR). We also cloned ultraspiracle (USP), the ortholog of retinoid X receptor (RXR) that serves as partner of dimerization of PXR and CAR. Cloning of SfUSP revealed the presence of two isoforms, SfUSP-1 and SfUSP-2 in this species, that differ in their N-terminal region. The expression of these receptors as well as the ecdysone receptor was studied during specific steps of development in different tissues. SfHR96 was constitutively expressed in larval midgut, fat body and Malpighian tubules throughout the last two instars and pupal stage, as well as in Sf9 cells. EcR and SfUSP-2 showed peaks of expression before larval moults and during metamorphosis, whereas SfUSP-1 was mainly expressed in the pre-pupal stage. Receptor induction was followed after exposure of larvae or cells to 11 chemical compounds. SfHR96 was not inducible by the tested compounds. EcR was significantly induced by the 20-hydroxyecdysone agonist, methoxyfenozide, and SfUSP showed an increase expression when exposed to the juvenile hormone analog, methoprene. The cloning of these nuclear receptors is a first step in understanding the important capacities of adaptation of this insect pest. Copyright © 2013 Elsevier Ltd. All rights reserved.

Esophageal cancer alters the expression of nuclear pore complex binding protein Hsc70 and eIF5A-1.

PubMed

Moghanibashi, Mehdi; Rastgar Jazii, Ferdous; Soheili, Zahra-Soheila; Zare, Maryam; Karkhane, Aliasghar; Parivar, Kazem; Mohamadynejad, Parisa

2013-06-01

Nuclear pore complex (NPC) is the only corridor for macromolecules exchange between nucleus and cytoplasm. NPC and its components, nucleoporins, play important role in the diverse physiological processes including macromolecule exchange, chromosome segregation, apoptosis and gene expression. Recent reports also suggest involvement of nucleoporins in carcinogenesis. Applying proteomics, we analyzed expression pattern of the NPC components in a newly established esophageal cancer cell line from Persia (Iran), the high-risk region for esophageal cancer. Our results indicate overexpression of Hsc70 and downregulation of subunit alpha type-3 of proteasome, calpain small subunit 1, and eIF5A-1. Among these proteins, Hsc70 and eIF5A-1 are in direct interaction with NPC and involved in the nucleocytoplasmic exchange. Hsc70 plays a critical role as a chaperone in the formation of a cargo-receptor complex in nucleocytoplasmic transport. On the other hand, it is an NPC-associated protein that binds to nucleoporins and contributes in recycling of the nucleocytoplasmic transport receptors in mammals and affects transport of proteins between nucleus and cytoplasm. The other nuclear pore interacting protein: eIF5A-1 binds to the several nucleoporins and participates in nucleocytoplasmic transport. Altered expression of Hsc70 and eIF5A-1 may cause defects in nucleocytoplasmic transport and play a role in esophageal carcinogenesis.

The role of retinoic acid receptors and their cognate ligands in reproduction in a context of triorganotin based endocrine disrupting chemicals.

PubMed

Macejova, Dana; Toporova, L; Brtko, J

2016-07-01

Retinoic acid (RA), an active form of vitamin A, regulates the embryonic development, male and female reproduction and induces important effects on the cell development, proliferation, and differentiation. These effects are mediated by the retinoid (RAR) and rexinoid nuclear receptors (RXR), which are considered to be a ligand-activated, DNA-binding, trans-acting, and transcription-modulating proteins, involved in a general molecular mechanism responsible for the transcriptional responses in target genes. Organotin compounds are typical environmental contaminants and suspected endocrine disrupting substances. They may affect processes of reproductive system in mammals, predominantly via nuclear receptor signaling pathways. Triorganotins, such as tributyltin chloride (TBTCl) and triphenyltin chloride (TPTCl), are capable to bind to RXR molecules, and thus represent potent agonists of RXR subtypes of nuclear receptors not sharing any structural characteristics with endogenous ligands of nuclear receptors. Th is article summarizes selected effects of biologically active retinoids and rexinoids on both male and female reproduction and also deals with the effects of organotin compounds evoking endocrine disrupting actions in reproduction.

Nuclear deterrents: Intrinsic regulators of IL-1β-induced effects on hippocampal neurogenesis.

PubMed

O'Léime, Ciarán S; Cryan, John F; Nolan, Yvonne M

2017-11-01

Hippocampal neurogenesis, the process by which new neurons are born and develop into the host circuitry, begins during embryonic development and persists throughout adulthood. Over the last decade considerable insights have been made into the role of hippocampal neurogenesis in cognitive function and the cellular mechanisms behind this process. Additionally, an increasing amount of evidence exists on the impact of environmental factors, such as stress and neuroinflammation on hippocampal neurogenesis and subsequent impairments in cognition. Elevated expression of the pro-inflammatory cytokine interleukin-1β (IL-1β) in the hippocampus is established as a significant contributor to the neuronal demise evident in many neurological and psychiatric disorders and is now known to negatively regulate hippocampal neurogenesis. In order to prevent the deleterious effects of IL-1β on neurogenesis it is necessary to identify signalling pathways and regulators of neurogenesis within neural progenitor cells that can interact with IL-1β. Nuclear receptors are ligand regulated transcription factors that are involved in modulating a large number of cellular processes including neurogenesis. In this review we focus on the signalling mechanisms of specific nuclear receptors involved in regulating neurogenesis (glucocorticoid receptors, peroxisome proliferator activated receptors, estrogen receptors, and nuclear receptor subfamily 2 group E member 1 (NR2E1 or TLX)). We propose that these nuclear receptors could be targeted to inhibit neuroinflammatory signalling pathways associated with IL-1β. We discuss their potential to be therapeutic targets for neuroinflammatory disorders affecting hippocampal neurogenesis and associated cognitive function. Copyright © 2017 Elsevier Inc. All rights reserved.

0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Heng; Denhard, Leslie A.; Zhou Huaxin

Using an in silico approach, a putative nuclear receptor-interacting protein 0610009K11Rik was identified in mouse testis. We named this gene testis-specific nuclear receptor-interacting protein-1 (Tnrip-1). Tnrip-1 was predominantly expressed in the testis of adult mouse tissues. Expression of Tnrip-1 in the testis was regulated during postnatal development, with robust expression in 14-day-old or older testes. In situ hybridization analyses showed that Tnrip-1 is highly expressed in pachytene spermatocytes and spermatids. Consistent with its mRNA expression, Tnrip-1 protein was detected in adult mouse testes. Immunohistochemical studies showed that Tnrip-1 is a nuclear protein and mainly expressed in pachytene spermatocytes and roundmore » spermatids. Moreover, co-immunoprecipitation analyses showed that endogenous Tnrip-1 protein can interact with germ cell nuclear receptor (GCNF) in adult mouse testes. Our results suggest that Tnrip-1 is a testis-specific and GCNF-interacting protein which may be involved in the modulation of GCNF-mediated gene transcription in spermatogenic cells within the testis.« less

Modulation of NRF2 signaling pathway by nuclear receptors: implications for cancer.

PubMed

Namani, Akhileshwar; Li, Yulong; Wang, Xiu Jun; Tang, Xiuwen

2014-09-01

Nuclear factor-erythroid 2 p45-related factor 2 (NRF2, also known as Nfe2l2) plays a critical role in regulating cellular defense against electrophilic and oxidative stress by activating the expression of an array of antioxidant response element-dependent genes. On one hand, NRF2 activators have been used in clinical trials for cancer prevention and the treatment of diseases associated with oxidative stress; on the other hand, constitutive activation of NRF2 in many types of tumors contributes to the survival and growth of cancer cells, as well as resistance to anticancer therapy. In this review, we provide an overview of the NRF2 signaling pathway and discuss its role in carcinogenesis. We also introduce the inhibition of NRF2 by nuclear receptors. Further, we address the biological significance of regulation of the NRF2 signaling pathway by nuclear receptors in health and disease. Finally, we discuss the possible impact of NRF2 inhibition by nuclear receptors on cancer therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

Nuclear Receptor Activity and Liver Cancer Lesion Progression

EPA Science Inventory

Nuclear receptors (NRs) are ligand-activated transcription factors that control diverse cellular processes. Chronic stimulation of some NRs is a non-genotoxic mechanism of rodent liver cancer with unclear relevance to humans. We explored this question using human CAR, PXR, PPARα,...

Evidence for triclosan-induced activation of human and rodent xenobiotic nuclear receptors

EPA Science Inventory

The bacteriostat triclosan (2,4,40-trichloro-20-hydroxydiphenylether) (TCS) decreases rat serum thyroxine via putative nuclear receptor (NR) interaction(s) and subsequent transcriptional up-regulation of hepatic catabolism and clearance. However, due to the evolutionary divergenc...

Mode of action from dose-response microarray data: case study using 10 environmental chemicals

EPA Science Inventory

Ligand-activated nuclear receptors regulate many biological processes through complex interactions with biological macromolecules. Certain xenobiotics alter nuclear receptor signaling through direct or indirect interactions. Defining the mode of action of such xenobiotics is di...

Rapid, portable detection of endocrine disrupting chemicals through ligand-nuclear hormone receptor interactions.

PubMed

Hunt, J Porter; Schinn, Song-Min; Jones, Matthew D; Bundy, Bradley C

2017-12-04

Endocrine disrupting chemicals (EDC) are structurally diverse compounds that can interact with nuclear hormone receptors, posing significant risk to human and ecological health. Unfortunately, many conventional biosensors have been too structure-specific, labor-intensive or laboratory-oriented to detect broad ranges of EDC effectively. Recently, several technological advances are providing more rapid, portable, and affordable detection of endocrine-disrupting activity through ligand-nuclear hormone receptor interactions. Here, we overview these recent advances applied to EDC biosensors - including cell lyophilization, cell immobilization, cell-free systems, smartphone-based signal detection, and improved competitive binding assays.

Bile acid-FXRα pathways regulate male sexual maturation in mice

PubMed Central

Vega, Aurélie; Sédes, Lauriane; Rouaisnel, Betty; de Haze, Angélique; Baron, Silvère; Schoonjans, Kristina; Caira, Françoise; Volle, David H.

2016-01-01

The bile acid receptor Farnesol-X-Receptor alpha (FRXα) is a member of the nuclear receptor superfamily. FRXα is expressed in the interstitial compartment of the adult testes, which contain the Leydig cells. In adult, short term treatment (12 hours) with FRXα agonist inhibits the expression of steroidogenic genes via the induction of the Small heterodimer partner (SHP). However the consequences of FRXα activation on testicular pathophysiology have never been evaluated. We demonstrate here that mice fed a diet supplemented with bile acid during pubertal age show increased incidence of infertility. This is associated with altered differentiation and increase apoptosis of germ cells due to lower testosterone levels. At the molecular level, next to the repression of basal steroidogenesis via the induction expression of Shp and Dax-1, two repressors of steroidogenesis, the main action of the BA-FRXα signaling is through lowering the Leydig cell sensitivity to the hypothalamo-pituitary axis, the main regulator of testicular endocrine function. In conclusion, BA-FRXα signaling is a critical actor during sexual maturation. PMID:26848619

Vitamin D alters genes involved in follicular development and steroidogenesis in human cumulus granulosa cells.

PubMed

Merhi, Zaher; Doswell, Angela; Krebs, Kendall; Cipolla, Marilyn

2014-06-01

Vitamin D deficiency is common among reproductive-aged women and has a role in female reproduction. This study evaluated the role of 1,25-dihydroxyvitamin D3 (vit D3) in ovarian follicular development and steroidogenesis by using a human granulosa cell (GC) model. Fifty-four women who underwent in vitro fertilization were enrolled. Follicular fluid (FF) and mural and cumulus GCs were collected from small and large follicles. In separate experiments, primary cumulus GCs were cultured with or without vit D3 followed by RT-PCR for mRNA expression levels. The effect of recombinant anti-Mullerian hormone (AMH) on nuclear localization of phospho-Smad 1/5/8 was evaluated in the presence or absence of vit D3 by using immunofluorescence. 25-Hydroxyvitamin D levels in FF as well as cell culture media AMH, progesterone, and estradiol (E2) concentrations were determined by ELISA and RIA. The following were measured: 1) mRNA expression levels; 2) 3β-hydroxysteroid dehydrogenase (3β-HSD) enzyme activity; 3) FSH-induced aromatase mRNA and E2 production; and 4) nuclear localization of phospho-Smad 1/5/8. In a multivariate analysis, 25 OH-D levels in FF negatively correlated with AMH and AMH receptor (AMHR)-II mRNA levels in cumulus GCs of small follicles. Compared with women with replete 25-hydroxyvitamin D levels in FF, those with insufficient/deficient levels had a 2-fold increase in AMHR-II mRNA levels in cumulus GCs of small follicles (P = .02). Treatment with vit D3 caused a decrease in AMHR-II and FSH receptor mRNA but an increase in 3-βHSD mRNA levels compared with control (P < .05). Vit D3 enhanced 3-βHSD enzyme activity as assessed by increasing progesterone release; however, vit D3 did not affect FSH-induced aromatase mRNA and E2 production, but it decreased the phosphorylation of Smad 1/5/8 and its nuclear localization. These data suggest that vit D3 alters AMH signaling and steroidogenesis in human cumulus GCs, possibly reflecting a state of GC luteinization potentiation.

Role of NF-κB in oxidative stress-induced defective dopamine D1 receptor signaling in the renal proximal tubules of Sprague Dawley rats

PubMed Central

Fardoun, Riham Zein; Asghar, Mohammad; Lokhandwala, Mustafa

2009-01-01

Dopamine promotes sodium excretion, in part, via activation of D1 receptors in renal proximal tubules (PT) and subsequent inhibition of Na, K-ATPase. Recently, we have reported that oxidative stress causes D1 receptors-G-protein uncoupling via mechanisms involving Protein Kinase C (PKC) and G-protein Coupled Receptor Kinase 2 (GRK2) in the primary culture of renal PT of Sprague Dawley (SD) rats. There are reports suggesting that redox-sensitive nuclear transcription factor, NF-κB, is activated in conditions associated with oxidative stress. This study was designed to identify the role of NF-κB in oxidative stress–induced defective renal D1 receptor –G-protein coupling and function. Treatment of the PT with hydrogen peroxide (H2O2, 50 μM/20 min) induced the nuclear translocation of NF-κB, increased PKC activity, and triggered the translocation of GRK2 to the proximal tubular membranes. This was accompanied by hyperphosphorylation of D1 receptors and defective D1 receptor-G-protein coupling. The functional consequence of these changes was decreased D1 receptor activation-mediated inhibition of Na, K-ATPase activity. Interestingly, pre-treatment with pyrrolidine dithiocarbamate (PDTC, 25 μM/10min), an NF-κB inhibitor, blocked the H2O2-induced nuclear translocation of NF-κB, increase in PKC activity, as well as GRK2 translocation and hyperphosphorylation of D1 receptors in the proximal tubular membranes. Furthermore, PDTC restored D1 receptor G-protein coupling and D1 receptor agonist-mediated inhibition of the Na, KATPase activity. Therefore, we suggest that oxidative stress causes nuclear translocation of NF-κB in the renal proximal tubules, which contributes to defective D1-receptor-G-protein coupling and function via mechanism involving PKC, membranous translocation of GRK 2, and subsequent phosphorylation of dopamine D1 receptors. PMID:17320758

Endothelial nuclear lamina is not required for glucocorticoid receptor nuclear import but does affect receptor-mediated transcription activation.

PubMed

Nayebosadri, Arman; Ji, Julie Y

2013-08-01

The lamina serves to maintain the nuclear structure and stiffness while acting as a scaffold for heterochromatin and many transcriptional proteins. Its role in endothelial mechanotransduction, specifically how nuclear mechanics impact gene regulation under shear stress, is not fully understood. In this study, we successfully silenced lamin A/C in bovine aortic endothelial cells to determine its role in both glucocorticoid receptor (GR) nuclear translocation and glucocorticoid response element (GRE) transcriptional activation in response to dexamethasone and shear stress. Nuclear translocation of GR, an anti-inflammatory nuclear receptor, in response to dexamethasone or shear stress (5, 10, and 25 dyn/cm(2)) was observed via time-lapse cell imaging and quantified using a Bayesian image analysis algorithm. Transcriptional activity of the GRE promoter was assessed using a dual-luciferase reporter plasmid. We found no dependence on nuclear lamina for GR translocation from the cytoplasm into the nucleus. However, the absence of lamin A/C led to significantly increased expression of luciferase under dexamethasone and shear stress induction as well as changes in histone protein function. PCR results for NF-κB inhibitor alpha (NF-κBIA) and dual specificity phosphatase 1 (DUSP1) genes further supported our luciferase data with increased expression in the absence of lamin. Our results suggest that absence of lamin A/C does not hinder passage of GR into the nucleus, but nuclear lamina is important to properly regulate GRE transcription. Nuclear lamina, rather than histone deacetylase (HDAC), is a more significant mediator of shear stress-induced transcriptional activity, while dexamethasone-initiated transcription is more HDAC dependent. Our findings provide more insights into the molecular pathways involved in nuclear mechanotransduction.

Endothelial nuclear lamina is not required for glucocorticoid receptor nuclear import but does affect receptor-mediated transcription activation

PubMed Central

Nayebosadri, Arman

2013-01-01

The lamina serves to maintain the nuclear structure and stiffness while acting as a scaffold for heterochromatin and many transcriptional proteins. Its role in endothelial mechanotransduction, specifically how nuclear mechanics impact gene regulation under shear stress, is not fully understood. In this study, we successfully silenced lamin A/C in bovine aortic endothelial cells to determine its role in both glucocorticoid receptor (GR) nuclear translocation and glucocorticoid response element (GRE) transcriptional activation in response to dexamethasone and shear stress. Nuclear translocation of GR, an anti-inflammatory nuclear receptor, in response to dexamethasone or shear stress (5, 10, and 25 dyn/cm2) was observed via time-lapse cell imaging and quantified using a Bayesian image analysis algorithm. Transcriptional activity of the GRE promoter was assessed using a dual-luciferase reporter plasmid. We found no dependence on nuclear lamina for GR translocation from the cytoplasm into the nucleus. However, the absence of lamin A/C led to significantly increased expression of luciferase under dexamethasone and shear stress induction as well as changes in histone protein function. PCR results for NF-κB inhibitor alpha (NF-κBIA) and dual specificity phosphatase 1 (DUSP1) genes further supported our luciferase data with increased expression in the absence of lamin. Our results suggest that absence of lamin A/C does not hinder passage of GR into the nucleus, but nuclear lamina is important to properly regulate GRE transcription. Nuclear lamina, rather than histone deacetylase (HDAC), is a more significant mediator of shear stress-induced transcriptional activity, while dexamethasone-initiated transcription is more HDAC dependent. Our findings provide more insights into the molecular pathways involved in nuclear mechanotransduction. PMID:23703529

Discrimination between NL1- and NL2-Mediated Nuclear Localization of the Glucocorticoid Receptor

PubMed Central

Savory, Joanne G. A.; Hsu, Brian; Laquian, Ian R.; Giffin, Ward; Reich, Terry; Haché, Robert J. G.; Lefebvre, Yvonne A.

1999-01-01

Glucocorticoid receptor (GR) cycles between a free liganded form that is localized to the nucleus and a heat shock protein (hsp)-immunophilin-complexed, unliganded form that is usually localized to the cytoplasm but that can also be nuclear. In addition, rapid nucleocytoplasmic exchange or shuttling of the receptor underlies its localization. Nuclear import of liganded GR is mediated through a well-characterized sequence, NL1, adjacent to the receptor DNA binding domain and a second, uncharacterized motif, NL2, that overlaps with the ligand binding domain. In this study we report that rapid nuclear import (half-life [t1/2] of 4 to 6 min) of agonist- and antagonist-treated GR and the localization of unliganded, hsp-associated GRs to the nucleus in G0 are mediated through NL1 and correlate with the binding of GR to pendulin/importin α. By contrast, NL2-mediated nuclear transfer of GR occurred more slowly (t1/2 = 45 min to 1 h), was agonist specific, and appeared to be independent of binding to importin α. Together, these results suggest that NL2 mediates the nuclear import of GR through an alternative nuclear import pathway. Nuclear export of GR was inhibited by leptomycin B, suggesting that the transfer of GR to the cytoplasm is mediated through the CRM1-dependent pathway. Inhibition of GR nuclear export by leptomycin B enhanced the nuclear localization of both unliganded, wild-type GR and hormone-treated NL1− GR. These results highlight that the subcellular localization of both liganded and unliganded GRs is determined, at least in part, by a flexible equilibrium between the rates of nuclear import and export. PMID:9891038

PPAR-{gamma} agonist protects against intestinal injury during necrotizing enterocolitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baregamian, Naira; Mourot, Joshua M.; Ballard, Amie R.

2009-02-06

Necrotizing enterocolitis (NEC) remains a lethal condition for many premature infants. Peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}), a member of the nuclear hormone receptor family, has been shown to play a protective role in cellular inflammatory responses; however, its role in NEC is not clearly defined. We sought to examine the expression of PPAR-{gamma} in the intestine using an ischemia-reperfusion (I/R) model of NEC, and to assess whether PPAR-{gamma} agonist treatment would ameliorate I/R-induced gut injury. Swiss-Webster mice were randomized to receive sham (control) or I/R injury to the gut induced by transient occlusion of superior mesenteric artery for 45 min withmore » variable periods of reperfusion. I/R injury resulted in early induction of PPAR-{gamma} expression and activation of NF-{kappa}B in small intestine. Pretreatment with PPAR-{gamma} agonist, 15d-PGJ{sub 2}, attenuated intestinal NF-{kappa}B response and I/R-induced gut injury. Activation of PPAR-{gamma} demonstrated a protective effect on small bowel during I/R-induced gut injury.« less

Alternative function for the mitochondrial SAM complex in biogenesis of alpha-helical TOM proteins.

PubMed

Stojanovski, Diana; Guiard, Bernard; Kozjak-Pavlovic, Vera; Pfanner, Nikolaus; Meisinger, Chris

2007-12-03

The mitochondrial outer membrane contains two preprotein translocases: the general translocase of outer membrane (TOM) and the beta-barrel-specific sorting and assembly machinery (SAM). TOM functions as the central entry gate for nuclear-encoded proteins. The channel-forming Tom40 is a beta-barrel protein, whereas all Tom receptors and small Tom proteins are membrane anchored by a transmembrane alpha-helical segment in their N- or C-terminal portion. Synthesis of Tom precursors takes place in the cytosol, and their import occurs via preexisting TOM complexes. The precursor of Tom40 is then transferred to SAM for membrane insertion and assembly. Unexpectedly, we find that the biogenesis of alpha-helical Tom proteins with a membrane anchor in the C-terminal portion is SAM dependent. Each SAM protein is necessary for efficient membrane integration of the receptor Tom22, whereas assembly of the small Tom proteins depends on Sam37. Thus, the substrate specificity of SAM is not restricted to beta-barrel proteins but also includes the majority of alpha-helical Tom proteins.

Daphnia HR96 is a Promiscuous Xenobiotic and Endobiotic Nuclear Receptor

PubMed Central

Karimullina, Elina; Li, Yangchun; Ginjupalli, Gautam; Baldwin, William S.

2012-01-01

Daphnia pulex is the first crustacean to have its genome sequenced. The genome project provides new insight and data into how an aquatic crustacean may respond to environmental stressors, including toxicants. We cloned Daphnia pulex HR96 (DappuHR96), a nuclear receptor orthologous to the CAR/PXR/VDR group of nuclear receptors. In Drosophila melanogaster, (hormone receptor 96) HR96 responds to phenobarbital exposure and has been hypothesized as a toxicant receptor. Therefore, we set up a transactivation assay to test whether DappuHR96 is a promiscuous receptor activated by xenobiotics and endobiotics similar to the constitutive androstane receptor (CAR) and the pregnane X-receptor (PXR). Transactivation assays performed with a GAL4-HR96 chimera demonstrate that HR96 is a promiscuous toxicant receptor activated by a diverse set of chemicals such as pesticides, hormones, and fatty acids. Several environmental toxicants activate HR96 including estradiol, pyriproxyfen, chlorpyrifos, atrazine, and methane arsonate. We also observed repression of HR96 activity by chemicals such as triclosan, androstanol, and fluoxetine. Nearly 50% of the chemicals tested activated or inhibited HR96. Interestingly, unsaturated fatty acids were common activators or inhibitors of HR96 activity, indicating a link between diet and toxicant response. The omega-6 and omega-9 unsaturated fatty acids linoleic and oleic acid activated HR96, but the omega-3 unsaturated fatty acids alpha-linolenic acid and docosahexaenoic acid inhibited HR96, suggesting that these two distinct sets of lipids perform opposing roles in Daphnia physiology. This also provides a putative mechanism by which the ratio of dietary unsaturated fats may affect the ability of an organism to respond to a toxic insult. In summary, HR96 is a promiscuous nuclear receptor activated by numerous endo- and xenobiotics. PMID:22466357

In vitro nuclear receptor inhibition and cytotoxicity of hydraulic fracturing chemicals and their binary mixtures.

PubMed

Bain, Peter A; Kumar, Anu

2018-05-01

The widespread use of hydraulic fracturing (HF) in oil and gas extraction operations has led to concern over environmental risks posed by chemicals used in HF fluids. Here we employed a suite of stable luciferase reporter gene assays to investigate the potential for selected HF chemicals or geogenics to activate or antagonise nuclear receptor signalling. We screened three biocides (bronopol [BP], glutaraldehyde [GA], and tetrakis(hydroxymethyl)phosphonium sulfate [THPS]), a surfactant (2-butoxyethanol), a friction reducer (polyacrylamide), and a coal seam geogenic (o-cresol) for their potential to act as agonists or antagonists of the estrogen receptor, androgen receptor, progesterone receptor (PR), glucocorticoid receptor or peroxisome proliferator-activated receptor gamma (PPARγ). None of the chemicals induced luciferase activity in any of assays used in the study. In antagonistic mode, BP, GA and THPS caused reductions in luciferase activity in the reporter assays at higher concentrations (50-100 μM), while at low concentrations (2-10 μM) GA and THPS enhanced luciferase activity in some assays relative to controls. None of the other tested chemicals exhibited antagonism in the selected assays. In most cases, altered receptor signalling only occurred at concentrations exhibiting cytotoxicity. However, PPARγ activity, and to a lesser extent PR activity, were inhibited by THPS at sub-cytotoxic concentrations. The majority of binary combinations tested exhibited significantly less-than-additive cytotoxicity, and none of the combinations exhibited synergistic cytotoxicity. In summary, the results of the present study indicate that the selected chemicals are not likely to function as direct agonists of the nuclear receptors tested, and only one chemical, THPS was an apparent partial antagonist of two nuclear receptors. Copyright © 2017. Published by Elsevier Ltd.

Using Nuclear Receptor Activity to Stratify Hepatocarcinogens

EPA Science Inventory

Nuclear receptors (NR) are a superfamily of ligand-activated transcription factors that control a range of cellular processes. Persistent stimulation of some NR is a non-genotoxic mechanism of rodent liver cancer with unclear relevance to humans. Here we report on a systematic an...

A Boolean Network Model of Nuclear Receptor Mediated Cell Cycle Progression

EPA Science Inventory

Nuclear receptors (NRs) are ligand-activated transcription factors that regulate a broad range of cellular processes. Hormones, lipids and xenobiotics have been shown to activate NRs with a range of consequences on development, metabolism, oxidative stress, apoptosis, and prolif...

A Boolean Network Model of Nuclear Receptor Mediated Cell Cycle Progression (S)

EPA Science Inventory

Nuclear receptors (NRs) are ligand-activated transcription factors that regulate a broad range of cellular processes. Hormones, lipids and xenobiotics have been shown to activate NRs with a range of consequences on development, metabolism, oxidative stress, apoptosis, and prolif...

Orphan Nuclear Receptors as Targets for Drug Development

PubMed Central

Mukherjee, Subhajit

2012-01-01

Orphan nuclear receptors regulate diverse biological processes. These important molecules are ligand-activated transcription factors that act as natural sensors for a wide range of steroid hormones and xenobiotic ligands. Because of their importance in regulating various novel signaling pathways, recent research has focused on identifying xenobiotics targeting these receptors for the treatment of multiple human diseases. In this review, we will highlight these receptors in several physiologic and pathophysiologic actions and demonstrate how their functions can be exploited for the successful development of newer drugs. PMID:20372994

LASSO-ing Potential Nuclear Receptor Agonists and Antagonists: A New Computational Method for Database Screening

EPA Science Inventory

Nuclear receptors (NRs) are important biological macromolecular transcription factors that are implicated in multiple biological pathways and may interact with other xenobiotics that are endocrine disruptors present in the environment. Examples of important NRs include the androg...

Epigenetic regulation of the expression of genes involved in steroid hormone biosynthesis and action

PubMed Central

Martinez-Arguelles, Daniel B.; Papadopoulos, Vassilios

2010-01-01

Steroid hormones participate in organ development, reproduction, body homeostasis, and stress responses. The steroid machinery is expressed in a development- and tissue-specific manner, with the expression of these factors being tightly regulated by an array of transcription factors (TFs). Epigenetics provides an additional layer of gene regulation through DNA methylation and histone tail modifications. Evidence of epigenetic regulation of key steroidogenic enzymes is increasing, though this does not seem to be a predominant regulatory pathway. Steroid hormones exert their action in target tissues through steroid nuclear receptors belonging to the NR3A and NR3C families. Nuclear receptor expression levels and post-translational modifications regulate their function and dictate their sensitivity to steroid ligands. Nuclear receptors and TFs are more likely to be epigenetically regulated than proteins involved in steroidogenesis and have secondary impact on the expression of these steroidogenic enzymes. Here we review evidence for epigenetic regulation of enzymes, transcription factors, and nuclear receptors related to steroid biogenesis and action. PMID:20156469

ROR nuclear receptors: structures, related diseases, and drug discovery

PubMed Central

Zhang, Yan; Luo, Xiao-yu; Wu, Dong-hai; Xu, Yong

2015-01-01

Nuclear receptors (NRs) are ligand-regulated transcription factors that regulate metabolism, development and immunity. The NR superfamily is one of the major classes of drug targets for human diseases. Retinoic acid receptor-related orphan receptor (ROR) α, β and γ belong to the NR superfamily, and these receptors are still considered as 'orphan' receptors because the identification of their endogenous ligands has been controversial. Recent studies have demonstrated that these receptors are regulated by synthetic ligands, thus emerge as important drug targets for the treatment of multiple sclerosis, rheumatoid arthritis, psoriasis, etc. Studying the structural basis and ligand development of RORs will pave the way for a better understanding of the roles of these receptors in human diseases. Here, we review the structural basis, disease relevance, strategies for ligand identification, and current status of development of therapeutic ligands for RORs. PMID:25500868

Estrogen-related receptor β (ERRβ) – renaissance receptor or receptor renaissance?

PubMed Central

Divekar, Shailaja D.; Tiek, Deanna M.; Fernandez, Aileen; Riggins, Rebecca B.

2016-01-01

Estrogen-related receptors (ERRs) are founding members of the orphan nuclear receptor (ONR) subgroup of the nuclear receptor superfamily. Twenty-seven years of study have yet to identify cognate ligands for the ERRs, though they have firmly placed ERRα and ERRγ at the intersection of cellular metabolism and oncogenesis. The pace of discovery for novel functions of ERRβ, however, has until recently been somewhat slower than that of its family members. ERRβ has also been largely ignored in summaries and perspectives of the ONR literature. Here, we provide an overview of established and emerging knowledge of ERRβ in mouse, man, and other species, highlighting unique aspects of ERRβ biology that set it apart from the other two estrogen-related receptors, with a focus on the impact of alternative splicing on the structure and function of this receptor. PMID:27507929

Effect of propofol on androgen receptor activity in prostate cancer cells.

PubMed

Tatsumi, Kenichiro; Hirotsu, Akiko; Daijo, Hiroki; Matsuyama, Tomonori; Terada, Naoki; Tanaka, Tomoharu

2017-08-15

Androgen receptor is a nuclear receptor and transcription factor activated by androgenic hormones. Androgen receptor activity plays a pivotal role in the development and progression of prostate cancer. Although accumulating evidence suggests that general anesthetics, including opioids, affect cancer cell growth and impact patient prognosis, the effect of those drugs on androgen receptor in prostate cancer is not clear. The purpose of this study was to investigate the effect of the general anesthetic propofol on androgen receptor activity in prostate cancer cells. An androgen-dependent human prostate cancer cell line (LNCaP) was stimulated with dihydrotestosterone (DHT) and exposed to propofol. The induction of androgen receptor target genes was investigated using real-time reverse transcription polymerase chain reaction, and androgen receptor protein levels and localization patterns were analyzed using immunoblotting and immunofluorescence assays. The effect of propofol on the proliferation of LNCaP cells was analyzed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays. Propofol significantly inhibited DHT-induced expression of androgen receptor target genes in a dose- and time-dependent manner, and immunoblotting and immunofluorescence assays indicated that propofol suppressed nuclear levels of androgen receptor proteins. Exposure to propofol for 24h suppressed the proliferation of LNCaP cells, whereas 4h of exposure did not exert significant effects. Together, our results indicate that propofol suppresses nuclear androgen receptor protein levels, and inhibits androgen receptor transcriptional activity and proliferation in LNCaP cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Nuclear translocation of IGF1R by intracellular amphiregulin contributes to the resistance of lung tumour cells to EGFR-TKI.

PubMed

Guerard, Marie; Robin, Thomas; Perron, Pascal; Hatat, Anne-Sophie; David-Boudet, Laurence; Vanwonterghem, Laetitia; Busser, Benoit; Coll, Jean-Luc; Lantuejoul, Sylvie; Eymin, Beatrice; Hurbin, Amandine; Gazzeri, Sylvie

2018-04-28

Many Receptor Tyrosine Kinases translocate from the cell surface to the nucleus in normal and pathological conditions, including cancer. Here we report the nuclear expression of insulin-like growth factor-1 receptor (IGF1R) in primary human lung tumours. Using lung cancer cell lines and lung tumour xenografts, we demonstrate that the epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) gefitinib induces the nuclear accumulation of IGF1R in mucinous lung adenocarcinoma by a mechanism involving the intracellular re-localization of the growth factor amphiregulin. Amphiregulin allows the binding of IGF1R to importin-β1 and promotes its nuclear transport. The nuclear accumulation of IGF1R by amphiregulin induces cell cycle arrest through p21 WAF1/CIP1 upregulation, and prevents the induction of apoptosis in response to gefitinib. These results identify amphiregulin as the first nuclear localization signal-containing protein that interacts with IGF1R and allows its nuclear translocation. Furthermore they indicate that nuclear expression of IGF1R contributes to EGFR-TKI resistance in lung cancer. Copyright © 2018 Elsevier B.V. All rights reserved.

Coal dust alters β-naphthoflavone-induced aryl hydrocarbon receptor nuclear translocation in alveolar type II cells

PubMed Central

Ghanem, Mohamed M; Battelli, Lori A; Law, Brandon F; Castranova, Vincent; Kashon, Michael L; Nath, Joginder; Hubbs, Ann F

2009-01-01

Background Many polycyclic aromatic hydrocarbons (PAHs) can cause DNA adducts and initiate carcinogenesis. Mixed exposures to coal dust (CD) and PAHs are common in occupational settings. In the CD and PAH-exposed lung, CD increases apoptosis and causes alveolar type II (AT-II) cell hyperplasia but reduces CYP1A1 induction. Inflammation, but not apoptosis, appears etiologically associated with reduced CYP1A1 induction in this mixed exposure model. Many AT-II cells in the CD-exposed lungs have no detectable CYP1A1 induction after PAH exposure. Although AT-II cells are a small subfraction of lung cells, they are believed to be a potential progenitor cell for some lung cancers. Because CYP1A1 is induced via ligand-mediated nuclear translocation of the aryl hydrocarbon receptor (AhR), we investigated the effect of CD on PAH-induced nuclear translocation of AhR in AT-II cells isolated from in vivo-exposed rats. Rats received CD or vehicle (saline) by intratracheal (IT) instillation. Three days before sacrifice, half of the rats in each group started daily intraperitoneal injections of the PAH, β-naphthoflavone (BNF). Results Fourteen days after IT CD exposure and 1 day after the last intraperitoneal BNF injection, AhR immunofluorescence indicated that proportional AhR nuclear expression and the percentage of cells with nuclear AhR were significantly increased in rats receiving IT saline and BNF injections compared to vehicle controls. However, in CD-exposed rats, BNF did not significantly alter the nuclear localization or cytosolic expression of AhR compared to rats receiving CD and oil. Conclusion Our findings suggest that during particle and PAH mixed exposures, CD alters the BNF-induced nuclear translocation of AhR in AT-II cells. This provides an explanation for the modification of CYP1A1 induction in these cells. Thus, this study suggests that mechanisms for reduced PAH-induced CYP1A1 activity in the CD exposed lung include not only the effects of inflammation on the lung as a whole, but also reduced PAH-associated nuclear translocation of AhR in an expanded population of AT-II cells. PMID:19650907

How to find the optimal partner--studies of snurportin 1 interactions with U snRNA 5' TMG-cap analogues containing modified 2-amino group of 7-methylguanosine.

PubMed

Piecyk, Karolina; Niedzwiecka, Anna; Ferenc-Mrozek, Aleksandra; Lukaszewicz, Maciej; Darzynkiewicz, Edward; Jankowska-Anyszka, Marzena

2015-08-01

Snurportin 1 is an adaptor protein that mediates the active nuclear import of uridine-rich small nuclear RNAs (U snRNA) by the importin-β receptor pathway. Its cellular activity influences the overall transport yield of small ribonucleoprotein complexes containing N(2),N(2),7-trimethylguanosine (TMG) capped U snRNA. So far little is still known about structural requirements related to molecular recognition of the trimethylguanosine moiety by snurportin in solution. Since these interactions are of a great biomedical importance, we synthesized a series of new 7-methylguanosine cap analogues with extended substituents at the exocyclic 2-amino group to gain a deeper insight into how the TMG-cap is adapted into the snurportin cap-binding pocket. Prepared chemical tools were applied in binding assays using emission spectroscopy. Surprisingly, our results revealed strict selectivity of snurportin towards the TMG-cap structure that relied mainly on its structural stiffness and compactness. Copyright © 2015 Elsevier Ltd. All rights reserved.

ERRα: a metabolic function for the oldest orphan

PubMed Central

Villena, Josep A.; Kralli, Anastasia

2009-01-01

Estrogen receptor related receptor (ERR)α was one of the first identified (1988) orphan nuclear receptors. Many of the orphan receptors identified after ERRα were deorphanized in a timely manner and appreciated as key transcriptional regulators of metabolic pathways. ERRα, however, remains an orphan. Nevertheless, recent studies have defined regulatory mechanisms and transcriptional targets of ERRα, allowing this receptor to join ranks with other nuclear receptors that control metabolism. Notably, mice lacking ERRα show defects when challenged with stressors that require a ‘shift of gears’ in energy metabolism, such as exposure to cold, cardiac overload or infection. These findings establish the importance of ERRα for adaptive energy metabolism, and suggest that strategies targeting ERRα may be useful in fighting metabolic diseases. PMID:18778951

Nuclear receptors in pancreatic tumor cells.

PubMed

Damaskos, Christos; Garmpis, Nikolaos; Karatzas, Theodore; Kostakis, Ioannis D; Nikolidakis, Lampros; Kostakis, Alkiviadis; Kouraklis, Gregory

2014-12-01

This review focuses on nuclear receptors expressed in pancreatic cancer. An extensive search of articles published up to March 2013 was conducted using the MEDLINE database. The key words used were "pancreatic cancer", "molecular receptors" and "growth factors". A total of 112 articles referred to pancreatic cancer, molecular receptors and/or growth factors were included. Receptors of growth factors, such as the epithelial growth factor receptor, insulin-like growth factor-1 receptor, vascular endothelial growth factor receptor and others, such as integrin α5β1, somatostatin receptors, the death receptor 5, claudin, notch receptors, mesothelin receptors, follicle-stimulating hormone receptors, the MUC1 receptor, the adrenomedullin receptor, the farnesoid X receptor, the transferrin receptor, sigma-2 receptors, the chemokine receptor CXCR4, the urokinase plasminogen activator receptor, the ephrine A2 receptor, the GRIA3 receptor, the RON receptor and the angiotensin II receptor AT-1 are expressed in pancreatic tumor cells. These molecules are implicated in tumor growth, apoptosis, angiogenesis, metastasis etc. After identifying the molecular receptors associated with the pancreatic cancer, many more target molecules playing important roles in tumor pathophysiology and senescence-associated signal transduction in cancer cells will be identified. This may have a significant influence on diagnosis, therapy and prognosis of pancreatic cancer. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

MicroRNA-22 and microRNA-140 suppress NF-{kappa}B activity by regulating the expression of NF-{kappa}B coactivators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takata, Akemi; Otsuka, Motoyuki, E-mail: otsukamo-tky@umin.ac.jp; Kojima, Kentaro

2011-08-12

Highlights: {yields} miRNAs were screened for their ability to regulate NF-{kappa}B activity. {yields} miRNA-22 and miRNA-140-3p suppress NF-{kappa}B activity by regulating coactivators. {yields} miRNA-22 targets nuclear receptor coactivator 1 (NCOA1). {yields} miRNA-140-3p targets nuclear receptor-interacting protein 1 (NRIP1). -- Abstract: Nuclear factor {kappa}B (NF-{kappa}B) is a transcription factor that regulates a set of genes that are critical to many biological phenomena, including liver tumorigenesis. To identify microRNAs (miRNAs) that regulate NF-{kappa}B activity in the liver, we screened 60 miRNAs expressed in hepatocytes for their ability to modulate NF-{kappa}B activity. We found that miRNA-22 and miRNA-140-3p significantly suppressed NF-{kappa}B activity bymore » regulating the expression of nuclear receptor coactivator 1 (NCOA1) and nuclear receptor-interacting protein 1 (NRIP1), both of which are NF-{kappa}B coactivators. Our results provide new information about the roles of miRNAs in the regulation of NF-{kappa}B activity.« less

Aberrant localization of lamin B receptor (LBR) in cellular senescence in human cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arai, Rumi; En, Atsuki; Ukekawa, Ryo

2016-05-13

5-Bromodeoxyuridine (BrdU), a thymidine analogue, induces cellular senescence in mammalian cells. BrdU induces cellular senescence probably through the regulation of chromatin because BrdU destabilizes or disrupts nucleosome positioning and decondenses heterochromatin. Since heterochromatin is tethered to the nuclear periphery through the interaction with the nuclear envelope proteins, we examined the localization of the several nuclear envelope proteins such as lamins, lamin-interacting proteins, nuclear pore complex proteins, and nuclear transport proteins in senescent cells. We have shown here that lamin B receptor (LBR) showed a change in localization in both BrdU-induced and replicative senescent cells.

Bisphenol A affects androgen receptor function via multiple mechanisms.

PubMed

Teng, Christina; Goodwin, Bonnie; Shockley, Keith; Xia, Menghang; Huang, Ruili; Norris, John; Merrick, B Alex; Jetten, Anton M; Austin, Christopher P; Tice, Raymond R

2013-05-25

Bisphenol A (BPA), is a well-known endocrine disruptor compound (EDC) that affects the normal development and function of the female and male reproductive system, however the mechanisms of action remain unclear. To investigate the molecular mechanisms of how BPA may affect ten different nuclear receptors, stable cell lines containing individual nuclear receptor ligand binding domain (LBD)-linked to the β-Gal reporter were examined by a quantitative high throughput screening (qHTS) format in the Tox21 Screening Program of the NIH. The results showed that two receptors, estrogen receptor alpha (ERα) and androgen receptor (AR), are affected by BPA in opposite direction. To confirm the observed effects of BPA on ERα and AR, we performed transient transfection experiments with full-length receptors and their corresponding response elements linked to luciferase reporters. We also included in this study two BPA analogs, bisphenol AF (BPAF) and bisphenol S (BPS). As seen in African green monkey kidney CV1 cells, the present study confirmed that BPA and BPAF act as ERα agonists (half maximal effective concentration EC50 of 10-100 nM) and as AR antagonists (half maximal inhibitory concentration IC50 of 1-2 μM). Both BPA and BPAF antagonized AR function via competitive inhibition of the action of synthetic androgen R1881. BPS with lower estrogenic activity (EC50 of 2.2 μM), did not compete with R1881 for AR binding, when tested at 30 μM. Finally, the effects of BPA were also evaluated in a nuclear translocation assays using EGPF-tagged receptors. Similar to 17β-estradiol (E2) which was used as control, BPA was able to enhance ERα nuclear foci formation but at a 100-fold higher concentration. Although BPA was able to bind AR, the nuclear translocation was reduced. Furthermore, BPA was unable to induce functional foci in the nuclei and is consistent with the transient transfection study that BPA is unable to activate AR. Published by Elsevier Ireland Ltd.

BMP type I receptor ALK2 is required for angiotensin II-induced cardiac hypertrophy

PubMed Central

Spagnolli, Ester; Ernande, Laura; Thoonen, Robrecht; Kolodziej, Starsha A.; Leyton, Patricio A.; Cheng, Juan; Tainsh, Robert E. T.; Mayeur, Claire; Rhee, David K.; Wu, Mei. X.; Scherrer-Crosbie, Marielle; Buys, Emmanuel S.; Zapol, Warren M.; Bloch, Kenneth D.; Bloch, Donald B.

2016-01-01

Bone morphogenetic protein (BMP) signaling contributes to the development of cardiac hypertrophy. However, the identity of the BMP type I receptor involved in cardiac hypertrophy and the underlying molecular mechanisms are poorly understood. By using quantitative PCR and immunoblotting, we demonstrated that BMP signaling increased during phenylephrine-induced hypertrophy in cultured neonatal rat cardiomyocytes (NRCs), as evidenced by increased phosphorylation of Smads 1 and 5 and induction of Id1 gene expression. Inhibition of BMP signaling with LDN193189 or noggin, and silencing of Smad 1 or 4 using small interfering RNA diminished the ability of phenylephrine to induce hypertrophy in NRCs. Conversely, activation of BMP signaling with BMP2 or BMP4 induced hypertrophy in NRCs. Luciferase reporter assay further showed that BMP2 or BMP4 treatment of NRCs repressed atrogin-1 gene expression concomitant with an increase in calcineurin protein levels and enhanced activity of nuclear factor of activated T cells, providing a mechanism by which BMP signaling contributes to cardiac hypertrophy. In a model of cardiac hypertrophy, C57BL/6 mice treated with angiotensin II (A2) had increased BMP signaling in the left ventricle. Treatment with LDN193189 attenuated A2-induced cardiac hypertrophy and collagen deposition in left ventricles. Cardiomyocyte-specific deletion of BMP type I receptor ALK2 (activin-like kinase 2), but not ALK1 or ALK3, inhibited BMP signaling and mitigated A2-induced cardiac hypertrophy and left ventricular fibrosis in mice. The results suggest that BMP signaling upregulates the calcineurin/nuclear factor of activated T cell pathway via BMP type I receptor ALK2, contributing to cardiac hypertrophy and fibrosis. PMID:26873969

Evaluation of the osteoclastogenic process associated with RANK / RANK-L / OPG in odontogenic myxomas

PubMed Central

González-Galván, María del Carmen; Mosqueda-Taylor, Adalberto; Bologna-Molina, Ronell; Setien-Olarra, Amaia; Marichalar-Mendia, Xabier; Aguirre-Urizar, José-Manuel

2018-01-01

Background Odontogenic myxoma (OM) is a benign intraosseous neoplasm that exhibits local aggressiveness and high recurrence rates. Osteoclastogenesis is an important phenomenon in the tumor growth of maxillary neoplasms. RANK (Receptor Activator of Nuclear Factor κappa B) is the signaling receptor of RANK-L (Receptor activator of nuclear factor kappa-Β ligand) that activates the osteoclasts. OPG (osteoprotegerin) is a decoy receptor for RANK-L that inhibits pro-osteoclastogenesis. The RANK / RANKL / OPG system participates in the regulation of osteolytic activity under normal conditions, and its alteration has been associated with greater bone destruction, and also with tumor growth. Objectives To analyze the immunohistochemical expression of OPG, RANK and RANK-L proteins in odontogenic myxomas (OMs) and their relationship with the tumor size. Material and Methods Eighteen OMs, 4 small (<3 cm) and 14 large (> 3cm) and 18 dental follicles (DF) that were included as control were studied by means of standard immunohistochemical procedure with RANK, RANKL and OPG antibodies. For the evaluation, 5 fields (40x) of representative areas of OM and DF were selected where the expression of each antibody was determined. Descriptive and comparative statistical analyses were performed with the obtained data. Results There are significant differences in the expression of RANK in OM samples as compared to DF (p = 0.022) and among the OMSs and OMLs (p = 0.032). Also a strong association is recognized in the expression of RANK-L and OPG in OM samples. Conclusions Activation of the RANK / RANK-L / OPG triad seems to be involved in the mechanisms of bone balance and destruction, as well as associated with tumor growth in odontogenic myxomas. Key words:Odontogenic myxoma, dental follicle, RANK, RANK-L, OPG, osteoclastogenesis. PMID:29680857

Application of an in silico liver model to determine nuclear receptor mediated pathways in liver cancer

EPA Science Inventory

Nuclear receptors (NRs) are ligand-activated transcription factors that control diverse cellular processes. Chronic stimulation of some NRs in rodents can result in increased incidence of liver tumors. These are generally thought to develop through a non-genotoxic mechanism with...

Synthesis and Characterization of Tricarbonyl-Re/Tc(I) Chelate Probes Targeting the G Protein-Coupled Estrogen Receptor GPER/GPR30

PubMed Central

Burai, Ritwik; Ramesh, Chinnasamy; Nayak, Tapan K.; Dennis, Megan K.; Bryant, Bj K.; Prossnitz, Eric R.; Arterburn, Jeffrey B.

2012-01-01

The discovery of the G protein-coupled estrogen receptor GPER (also GPR30) and the resulting development of selective chemical probes have revealed new aspects of estrogen receptor biology. The potential clinical relevance of this receptor has been suggested from numerous studies that have identified GPER expression in breast, endometrial, ovarian and other cancers. Thus GPER can be considered a candidate biomarker and target for non-invasive imaging and therapy. We have designed and synthesized a series of organometallic tricarbonyl-rhenium complexes conjugated to a GPER-selective small molecule derived from tetrahydro-3H-cyclopenta[c]quinoline. The activity and selectivity of these chelates in GPER-mediated signaling pathways were evaluated. These results demonstrate that GPER targeting characteristics depend strongly on the structure of the chelate and linkage. Ethanone conjugates functioned as agonists, a 1,2,3-triazole spacer yielded an antagonist, and derivatives with increased steric volume exhibited decreased activities. Promising GPER selectivity was observed, as none of the complexes interacted with the nuclear estrogen receptors. Radiolabeling with technetium-99m in aqueous media was efficient and gave radioligands with high radiochemical yields and purity. These chelates have favorable physicochemical properties, show excellent stability in biologically relevant media, exhibit receptor specificity and are promising candidates for continuing development as diagnostic imaging agents targeting GPER expression in cancer. PMID:23077529

Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors.

PubMed

Mills, Ian G; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E

2005-07-18

Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription.

The roles of bile acids and sphingosine-1-phosphate signaling in the hepatobiliary diseases

PubMed Central

Nagahashi, Masayuki; Yuza, Kizuki; Hirose, Yuki; Nakajima, Masato; Ramanathan, Rajesh; Hait, Nitai C.; Hylemon, Phillip B.; Zhou, Huiping; Takabe, Kazuaki; Wakai, Toshifumi

2016-01-01

Based on research carried out over the last decade, it has become increasingly evident that bile acids act not only as detergents, but also as important signaling molecules that exert various biological effects via activation of specific nuclear receptors and cell signaling pathways. Bile acids also regulate the expression of numerous genes encoding enzymes and proteins involved in the synthesis and metabolism of bile acids, glucose, fatty acids, and lipoproteins, as well as energy metabolism. Receptors activated by bile acids include, farnesoid X receptor α, pregnane X receptor, vitamin D receptor, and G protein-coupled receptors, TGR5, muscarinic receptor 2, and sphingosine-1-phosphate receptor (S1PR)2. The ligand of S1PR2, sphingosine-1-phosphate (S1P), is a bioactive lipid mediator that regulates various physiological and pathophysiological cellular processes. We have recently reported that conjugated bile acids, via S1PR2, activate and upregulate nuclear sphingosine kinase 2, increase nuclear S1P, and induce genes encoding enzymes and transporters involved in lipid and sterol metabolism in the liver. Here, we discuss the role of bile acids and S1P signaling in the regulation of hepatic lipid metabolism and in hepatobiliary diseases. PMID:27459945

The estrogen receptor alpha nuclear localization sequence is critical for fulvestrant-induced degradation of the receptor.

PubMed

Casa, Angelo J; Hochbaum, Daniel; Sreekumar, Sreeja; Oesterreich, Steffi; Lee, Adrian V

2015-11-05

Fulvestrant, a selective estrogen receptor down-regulator (SERD) is a pure competitive antagonist of estrogen receptor alpha (ERα). Fulvestrant binds ERα and reduces the receptor's half-life by increasing protein turnover, however, its mechanism of action is not fully understood. In this study, we show that removal of the ERα nuclear localization sequence (ERΔNLS) resulted in a predominantly cytoplasmic ERα that was degraded in response to 17-β-estradiol (E2) but was resistant to degradation by fulvestrant. ERΔNLS bound the ligands and exhibited receptor interaction similar to ERα, indicating that the lack of degradation was not due to disruption of these processes. Forcing ERΔNLS into the nucleus with a heterologous SV40-NLS did not restore degradation, suggesting that the NLS domain itself, and not merely receptor localization, is critical for fulvestrant-induced ERα degradation. Indeed, cloning of the endogenous ERα NLS onto the N-terminus of ERΔNLS significantly restored both its nuclear localization and turnover in response to fulvestrant. Moreover, mutation of the sumoylation targets K266 and K268 within the NLS impaired fulvestrant-induced ERα degradation. In conclusion, our study provides evidence for the unique role of the ERα NLS in fulvestrant-induced degradation of the receptor. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Larval crowding accelerates C. elegans development and reduces lifespan.

PubMed

Ludewig, Andreas H; Gimond, Clotilde; Judkins, Joshua C; Thornton, Staci; Pulido, Dania C; Micikas, Robert J; Döring, Frank; Antebi, Adam; Braendle, Christian; Schroeder, Frank C

2017-04-01

Environmental conditions experienced during animal development are thought to have sustained impact on maturation and adult lifespan. Here we show that in the model organism C. elegans developmental rate and adult lifespan depend on larval population density, and that this effect is mediated by excreted small molecules. By using the time point of first egg laying as a marker for full maturity, we found that wildtype hermaphrodites raised under high density conditions developed significantly faster than animals raised in isolation. Population density-dependent acceleration of development (Pdda) was dramatically enhanced in fatty acid β-oxidation mutants that are defective in the biosynthesis of ascarosides, small-molecule signals that induce developmental diapause. In contrast, Pdda is abolished by synthetic ascarosides and steroidal ligands of the nuclear hormone receptor DAF-12. We show that neither ascarosides nor any known steroid hormones are required for Pdda and that another chemical signal mediates this phenotype, in part via the nuclear hormone receptor NHR-8. Our results demonstrate that C. elegans development is regulated by a push-pull mechanism, based on two antagonistic chemical signals: chemosensation of ascarosides slows down development, whereas population-density dependent accumulation of a different chemical signal accelerates development. We further show that the effects of high larval population density persist through adulthood, as C. elegans larvae raised at high densities exhibit significantly reduced adult lifespan and respond differently to exogenous chemical signals compared to larvae raised at low densities, independent of density during adulthood. Our results demonstrate how inter-organismal signaling during development regulates reproductive maturation and longevity.

Theoretical modeling of multiprotein complexes by iSPOT: Integration of small-angle X-ray scattering, hydroxyl radical footprinting, and computational docking.

PubMed

Huang, Wei; Ravikumar, Krishnakumar M; Parisien, Marc; Yang, Sichun

2016-12-01

Structural determination of protein-protein complexes such as multidomain nuclear receptors has been challenging for high-resolution structural techniques. Here, we present a combined use of multiple biophysical methods, termed iSPOT, an integration of shape information from small-angle X-ray scattering (SAXS), protection factors probed by hydroxyl radical footprinting, and a large series of computationally docked conformations from rigid-body or molecular dynamics (MD) simulations. Specifically tested on two model systems, the power of iSPOT is demonstrated to accurately predict the structures of a large protein-protein complex (TGFβ-FKBP12) and a multidomain nuclear receptor homodimer (HNF-4α), based on the structures of individual components of the complexes. Although neither SAXS nor footprinting alone can yield an unambiguous picture for each complex, the combination of both, seamlessly integrated in iSPOT, narrows down the best-fit structures that are about 3.2Å and 4.2Å in RMSD from their corresponding crystal structures, respectively. Furthermore, this proof-of-principle study based on the data synthetically derived from available crystal structures shows that the iSPOT-using either rigid-body or MD-based flexible docking-is capable of overcoming the shortcomings of standalone computational methods, especially for HNF-4α. By taking advantage of the integration of SAXS-based shape information and footprinting-based protection/accessibility as well as computational docking, this iSPOT platform is set to be a powerful approach towards accurate integrated modeling of many challenging multiprotein complexes. Copyright © 2016 Elsevier Inc. All rights reserved.

Larval crowding accelerates C. elegans development and reduces lifespan

PubMed Central

Ludewig, Andreas H.; Gimond, Clotilde; Judkins, Joshua C.; Thornton, Staci; Pulido, Dania C.; Micikas, Robert J.; Döring, Frank; Antebi, Adam; Braendle, Christian; Schroeder, Frank C.

2017-01-01

Environmental conditions experienced during animal development are thought to have sustained impact on maturation and adult lifespan. Here we show that in the model organism C. elegans developmental rate and adult lifespan depend on larval population density, and that this effect is mediated by excreted small molecules. By using the time point of first egg laying as a marker for full maturity, we found that wildtype hermaphrodites raised under high density conditions developed significantly faster than animals raised in isolation. Population density-dependent acceleration of development (Pdda) was dramatically enhanced in fatty acid β-oxidation mutants that are defective in the biosynthesis of ascarosides, small-molecule signals that induce developmental diapause. In contrast, Pdda is abolished by synthetic ascarosides and steroidal ligands of the nuclear hormone receptor DAF-12. We show that neither ascarosides nor any known steroid hormones are required for Pdda and that another chemical signal mediates this phenotype, in part via the nuclear hormone receptor NHR-8. Our results demonstrate that C. elegans development is regulated by a push-pull mechanism, based on two antagonistic chemical signals: chemosensation of ascarosides slows down development, whereas population-density dependent accumulation of a different chemical signal accelerates development. We further show that the effects of high larval population density persist through adulthood, as C. elegans larvae raised at high densities exhibit significantly reduced adult lifespan and respond differently to exogenous chemical signals compared to larvae raised at low densities, independent of density during adulthood. Our results demonstrate how inter-organismal signaling during development regulates reproductive maturation and longevity. PMID:28394895

The orphan nuclear receptor small heterodimer partner is required for thiazolidinedione effects in leptin-deficient mice.

PubMed

Tseng, Hsiu-Ting; Park, Young Joo; Lee, Yoon Kwang; Moore, David D

2015-05-08

Small heterodimer partner (SHP, NR0B2) is involved in diverse metabolic pathways, including hepatic bile acid, lipid and glucose homeostasis, and has been implicated in effects on the peroxisome proliferator-activated receptor γ (PPARγ), a master regulator of adipogenesis and the receptor for antidiabetic drugs thiazolidinediones (TZDs). In this study, we aim to investigate the role of SHP in TZD response by comparing TZD-treated leptin-deficient (ob/ob) and leptin-, SHP-deficient (ob/ob;Shp(-/-)) double mutant mice. Both ob/ob and double mutant ob/ob;Shp(-/-) mice developed hyperglycemia, insulin resistance, and hyperlipidemia, but hepatic fat accumulation was decreased in the double mutant ob/ob;Shp(-/-) mice. PPARγ2 mRNA levels were markedly lower in ob/ob;Shp(-/-) liver and decreased to a lesser extent in adipose tissue. The TZD troglitazone did not reduce glucose or circulating triglyceride levels in ob/ob;Shp(-/-) mice. Expression of the adipocytokines, such as adiponectin and resistin, was not stimulated by troglitazone treatment. Expression of hepatic lipogenic genes was also reduced in ob/ob;Shp(-/-) mice. Moreover, overexpression of SHP by adenovirus infection increased PPARγ2 mRNA levels in mouse primary hepatocytes. Our results suggest that SHP is required for both antidiabetic and hypolipidemic effects of TZDs in ob/ob mice through regulation of PPARγ expression.

Male breast carcinoma: an evaluation of prognostic factors contributing to a poorer outcome.

PubMed

Joshi, M G; Lee, A K; Loda, M; Camus, M G; Pedersen, C; Heatley, G J; Hughes, K S

1996-02-01

Although breast cancer in men is far less common than breast cancer in women, it is associated with a less favorable prognosis. Conventional histopathologic features and new prognostic markers were evaluated to explain the less favorable survival outcome. Forty-six consecutive male breast carcinomas were studied for size, histologic and nuclear grade, histologic subtype, presence of carcinoma in situ, nipple involvement, lymphovascular invasion, hormone receptor status, c-erbB-2 protein overexpression, and p53 protein accumulation. These findings were correlated with survival. Of the 46 carcinomas, 4 were noninvasive and 42 were invasive. In the invasive carcinomas, the median patient age was 64 years, and the median tumor size was 2 cm. The predominant histologic patterns were invasive ductal (45%) and mixed invasive ductal and cribriform (28%). Most tumors were of low histologic and nuclear grades (histologic grades: I, 17%; II, 50%; III, 33%; nuclear grade: I, 12%; II, 44%; III, 44%). Of those surgically staged, 22 patients (60%) were lymph node positive and 15 patients (40%) were node negative. Stage at presentation was higher than in women (0, 10%; 1, 17%; 2, 50%; 3, 13%; 4, 10%). The estrogen and progesterone receptor status was positive in 76% and 83% of tumors, respectively. Lymphatic vessel invasion (63%) and nipple involvement (48%) were also more common than in women. True Paget's disease of the nipple was not seen; all cases with nipple ulceration were the result of direct tumor extension to the epidermis. Of the 17 tumors tested, 41% were c-erbB-2 positive and 29% were p53 positive. Survival analysis was limited by the relatively small cohort size. Five- and 10-year adjusted overall survival rates for invasive tumors were 76 +/- 7% and 42 +/- 9%, respectively. Skin and nipple involvement (P = 0.03) and c-erbB-2-positivity (P = 0.03) were significant predictors of adverse survival. Male breast carcinoma presents in an advanced stage with less favorable survival, despite low histologic grade, high estrogen receptor content, and small size. Anatomic factors may have been responsible for the poor survival outcome (i.e., paucity of breast tissue and close tumor proximity to skin and nipple, facilitating dermal lymphatic spread and early regional and distant metastasis).

Selective ligand activity at Nur/retinoid X receptor complexes revealed by dimer-specific bioluminescence resonance energy transfer-based sensors

PubMed Central

Giner, Xavier C; Cotnoir-White, David; Mader, Sylvie; Lévesque, Daniel

2017-01-01

Retinoid X receptors (RXR) play a role as master regulators due to their capacity to form heterodimers with other nuclear receptors. Accordingly, retinoid signaling is involved in multiple biological processes, including development, cell differentiation, metabolism and cell death. However, the role and functions of RXR in different heterodimer complexes remain unsolved, mainly because most RXR drugs (called rexinoids) are not selective to specific heterodimer complexes. This also strongly limits the use of rexinoids for specific therapeutic approaches. In order to better characterize rexinoids at specific nuclear receptor complexes, we have developed and optimized luciferase protein complementation-based Bioluminescence Resonance Energy Transfer (BRET) assays, which can directly measure recruitment of a co-activator motif fused to yellow fluorescent protein (YFP) by specific nuclear receptor dimers. To validate the assays, we compared rexinoid modulation of co-activator recruitment by RXR homodimer, and heterodimers Nur77/RXR and Nurr1/RXR. Results reveal that some rexinoids display selective co-activator recruitment activities with homo- or hetero-dimer complexes. In particular, SR11237 (BMS649) has increased potency for recruitment of co-activator motif and transcriptional activity with the Nur77/RXR heterodimer compared to other complexes. This technology should prove useful to identify new compounds with specificity for individual dimeric species formed by nuclear receptors. PMID:26148973

Intracrine action of angiotensin II in mesangial cells: subcellular distribution of angiotensin II receptor subtypes AT1 and AT2.

PubMed

da Silva Novaes, Antônio; Ribeiro, Rosemara Silva; Pereira, Luciana Guilhermino; Borges, Fernanda Teixeira; Boim, Mirian Aparecida

2018-02-17

Biological effects of angiotensin II (AngII) such as regulation of AngII target genes may be triggered by interaction of AngII with intracellular AngII receptor types 1 and 2 (AT 1 and AT 2 ), defined as intracrine response. The aim of this study was to examine the presence of AT 1 and AT 2 receptors in nuclear membrane of human mesangial cells (HMCs) and evaluate the possible biological effects mediated by intracellular AT 1 through an intracrine mechanism. Subcellular distribution of AT 1 and AT 2 was evaluated by immunofluorescence and by western blot in isolated nuclear extract. Endogenous intracellular synthesis of AngII was stimulated by high glucose (HG). Effects of HG were analyzed in the presence of candesartan, which prevents AngII internalization. Both receptors were found in nuclear membrane. Fluorescein isothiocyanate (FITC)-labeled AngII added to isolated nuclei produced a fluorescence that was reduced in the presence of losartan or PD-123319 and quenched in the presence of both inhibitors simultaneously. HG induced overexpression of fibronectin and increased cell proliferation in the presence of candesartan, indicating an intracrine action of AngII induced by HG. Results showed the presence of nuclear receptors in HMCs that can be activated by AngII through an intracrine response independent of cytoplasmic membrane AngII receptors.

Dose-dependent difference of nuclear receptors involved in murine liver hypertrophy by piperonyl butoxide.

PubMed

Sakamoto, Yohei; Yoshida, Midori; Tamura, Kei; Takahashi, Miwa; Kodama, Yukio; Inoue, Kaoru

2015-12-01

Nuclear receptors play important roles in chemically induced liver hypertrophy in rodents. To clarify the involvement of constitutive androstane receptor (CAR) and other nuclear receptors in mouse liver hypertrophy induced by different doses of piperonyl butoxide (PBO), wild-type and CAR-knockout mice were administered PBO (200, 1,000, or 5,000 ppm) in the basal diet for 1 week. Increased liver weight and diffuse hepatocellular hypertrophy were observed at 5,000 ppm for both genotypes, accompanied by increased Cyp3a11 mRNA and CYP3A protein expression, suggesting that CAR-independent pathway, possibly pregnane X receptor (PXR), plays a major role in the induction of hypertrophy. Moreover, wild-type mice at 5,000 ppm showed enhanced hepatocellular hypertrophy and strong positive staining for CYP2B in the centrilobular area, suggesting the localized contribution of CAR. At 1,000 ppm, only wild-type mice showed liver weight increase and centrilobular hepatocellular hypertrophy concurrent with elevated Cyp2b10 mRNA expression and strong CYP2B staining, indicating that CAR was essential at 1,000 ppm. We concluded that high-dose PBO induced hypertrophy via CAR and another pathway, while lower dose of PBO induced a pathway mediated predominantly by CAR. The dose-responsiveness on liver hypertrophy is important for understanding the involvement of nuclear receptors.

Nuclear receptor coactivators: regulators of steroid action in brain and behaviour.

PubMed

Tetel, M J; Acharya, K D

2013-11-01

Steroid hormones act in specific regions of the brain to alter behaviour and physiology. Although it has been well established that the bioavailability of the steroid and the expression of its receptor is critical for understanding steroid action in the brain, the importance of nuclear receptor coactivators in the brain is becoming more apparent. The present review focuses on the function of the p160 family of coactivators, which includes steroid receptor coactivator-1 (SRC-1), SRC-2 and SRC-3, in steroid receptor action in the brain. The expression, regulation and function of these coactivators in steroid-dependent gene expression in both brain and behaviour are discussed. © 2013 British Society for Neuroendocrinology.

Utp22p acts in concert with Utp8p to channel aminoacyl-tRNA from the nucleolus to the nuclear tRNA export receptor Los1p but not Msn5p.

PubMed

Eswara, Manoja B K; Clayton, Ashley; Mangroo, Dev

2012-12-01

Utp8p is an essential nucleolar protein that channels aminoacyl-tRNAs from aminoacyl-tRNA synthetases in the nucleolus to the nuclear tRNA export receptors located in the nucleoplasm and nuclear pore complex in Saccharomyces cerevisiae. Utp8p is also part of the U3 snoRNA-associated protein complex involved in 18S rRNA biogenesis in the nucleolus. We report that Utp22p, which is another member of the U3 snoRNA-associated protein complex, is also an intranuclear component of the nuclear tRNA export machinery. Depletion of Utp22p results in nuclear retention of mature tRNAs derived from intron-containing and intronless precursors. Moreover, Utp22p copurifies with the nuclear tRNA export receptor Los1p, the aminoacyl-tRNA synthetase Tys1p and Utp8p, but not with the RanGTPase Gsp1p and the nuclear tRNA export receptor Msn5p. Utp22p interacts directly with Utp8p and Los1p in a tRNA-independent manner in vitro. Utp22p also interacts directly with Tys1p, but this binding is stimulated when Tys1p is bound to tRNA. However, Utp22p, unlike Utp8p, does not bind tRNA saturably. These data suggest that Utp22p recruits Utp8p to aminoacyl-tRNA synthetases in the nucleolus to collect aminoacyl-tRNA and then accompanies the Utp8p-tRNA complex to deliver the aminoacyl-tRNAs to Los1p but not Msn5p. It is possible that Nrap/Nol6, the mammalian orthologue of Utp22p, plays a role in channelling aminoacyl-tRNA to the nuclear tRNA export receptor exportin-t.

Membrane estrogen receptors - is it an alternative way of estrogen action?

PubMed

Soltysik, K; Czekaj, P

2013-04-01

The functions of estrogens are relatively well known, however the molecular mechanism of their action is not clear. The classical pathway of estrogen action is dependent on ERα and ERβ which act as transcription factors. The effects of this pathway occur within hours or days. In addition, so-called, non-classical mechanism of steroid action dependent on membrane estrogen receptors (mER) was described. In this mechanism the effects of estrogen action are observed in a much shorter time. Here we review the structure and cellular localization of mER, molecular basis of non-classical mER action, physiological role of mER as well as implications of mER action for cancer biology. Finally, some concerns about the new estrogen receptor - GPER and candidates for estrogen receptors - ER-X and ERx, are briefly discussed. It seems that mER is a complex containing signal proteins (signalosome), as IGF receptor, EGF receptor, Ras protein, adaptor protein Shc, non-receptor kinase c-Src and PI-3K, what rationalizes production of second messengers. Some features of membrane receptors are almost identical if compared to nuclear receptors. Probably, membrane and nuclear estrogen receptors are not separate units, but rather the components of a complex mechanism in which they both cooperate with each other. We conclude that the image of the estrogen receptor as a simple transcription factor is a far-reaching simplification. A better understanding of the mechanisms of estrogen action will help us to design more effective drugs affecting signal pathways depending on both membrane and nuclear receptors.

Purification and characterization of rat liver nuclear thyroid hormone receptors.

PubMed Central

Ichikawa, K; DeGroot, L J

1987-01-01

Nuclear thyroid hormone receptor was purified to 904 pmol of L-3,5,3'-triiodothyronine (T3) binding capacity per mg of protein with 2.5-5.2% recovery by sequentially using hydroxylapatite column chromatography, ammonium sulfate precipitation, Sephadex G-150 gel filtration, DNA-cellulose column chromatography, DEAE-Sephadex column chromatography, and heparin-Sepharose column chromatography. Assuming that one T3 molecule binds to the 49,000-Da unit of the receptor, we reproducibly obtained 6.4-14.7 micrograms of receptor protein with 4.2-4.9% purity from 4-5 kg of rat liver. Elution of receptor from the heparin-Sepharose column was performed using 10 mM pyridoxal 5'-phosphate, which was observed to diminish binding of receptor to heparin-Sepharose or DNA-cellulose. This effect was specific for pyridoxal 5'-phosphate, since related compounds were not effective. Purified receptor bound T3 with high affinity (6.0 X 10(9) liter/mol), and the order of affinity of iodothyronine analogues to purified receptor was identical to that observed with crude receptor preparations [3,5,3'-triiodothyroacetic acid greater than L-T3 greater than D-3,5,3'-triiodothyronine (D-T3) greater than L-thyroxine greater than D-thyroxine]. Purified receptor had a sedimentation coefficient of 3.4 S, Stokes radius of 34 A, and calculated molecular mass of 49,000. Among several bands identified by silver staining after electrophoresis in NaDodSO4/polyacrylamide gels, one 49,000-Da protein showed photoaffinity labeling with [125I]thyroxine that was displaceable with excess unlabeled T3. The tryptic fragment and endogenous proteinase-digested fragment of the affinity-labeled receptor showed saturable binding in 27,000-Da and 36,000-Da peptides, respectively. These molecular masses are in agreement with estimates from gel filtration and gradient sedimentation, indicating that affinity labeling occurred at the hormone binding domain of nuclear thyroid hormone receptor. This procedure reproducibly provides classical native rat liver T3 nuclear receptor in useful quantity and purity and of the highest specific activity so far reported. Images PMID:3472213

Steroid hormone receptor status defines the MMTV promoter chromatin structure in vivo.

PubMed

Archer, T K; Fryer, C J; Lee, H L; Zaniewski, E; Liang, T; Mymryk, J S

1995-06-01

The ability to respond to small signalling molecules such as steroid hormones is important for many physiological processes. Steroid hormones act through a group of high affinity receptors that regulate transcription by binding to hormone response elements (HREs) located within the promoters of target genes, which themselves are organized with nuclear proteins to form chromatin. To dissect the mechanisms(s) of steroid hormone action we have used the steroid inducible mouse mammary tumor virus (MMTV) promoter as a model system. The MMTV promoter is assembled into a phased array of nucleosomes that are specifically positioned in rodent cells. Induction of transcription by glucocorticoids is accompanied by the appearance of a hypersensitive region in the proximal promoter which allows the hormone dependent assembly of a preinitiation complex including transcription factors such as nuclear factor 1 (NF1) and the octamer transcription factor (OTF). Surprisingly, when introduced by transient transfection, the progesterone receptor (PR) is unable to activate this promoter in vivo, a finding that may result from its inability to alter MMTV promoter chromatin. In an attempt to investigate the failure of the PR to activate the promoter, we have stably introduced the MMTV promoter into human T47D breast cancer cells that express high levels of the PR. In contrast to what has been observed previously in rodent cells, the MMTV templates resident in human breast cancer cells adopt a novel and constitutively open chromatin structure. The constitutively open chromatin structure is accompanied by the hormone independent loading of transcription factors including the PR and NF1. In T47D cells that stably express the glucocorticoid receptor, the MMTV promoter responds to glucocorticoids, but not progestins, and displays glucocorticoid induced restriction enzyme hypersensitivity and transcription factor loading. These findings suggest that the organization of the MMTV chromatin structure is dependent upon the cell type and receptor status of the recipient cell into which the MMTV promoter is stably introduced.

Genomic characterization and regulation of CYP3a13: role of xenobiotics and nuclear receptors.

PubMed

Anakk, Sayeepriyadarshini; Kalsotra, Auinash; Shen, Qi; Vu, Mary T; Staudinger, Jeffrey L; Davies, Peter J A; Strobel, Henry W

2003-09-01

We report that CYP3a13 gene, located on mouse chromosome 5, spans 27.5 Kb and contains 13 exons. The transcription start site is 35 bp upstream of the coding region and results in a 109 bp 5' untranslated region. CYP3a13 promoter shows putative binding sites for retinoid X receptor, pregnane X receptor, and estrogen receptor. CYP3a13 shows a broad tissue distribution with predominant expression in liver. Although CYP3a13 shares 92% nucleotide identity with the female-specific rat CYP3A9, its expression does not exhibit sexual dimorphism. Ligand activation of peroxisomal proliferator-activated receptor-gamma and retinoid X receptor inhibit expression of CYP3a13 at the transcription level in a tissue-specific manner. Another novel finding is hepatic induction of CYP3a13 by dexamethasone occurring only in pregnane X receptor null mice. We also report that pregnane X receptor is essential to maintain robust in vivo basal levels of CYP3a13 in contrast to CYP3a11. CYP3a13 protein expressed in vitro can metabolize clinically active drugs ethylmorphine and erythromycin, as well as benzphetamine. We conclude that CYP3a13 is regulated differentially by various nuclear receptors. In humans this may lead to altered drug metabolism, as many of the newly synthesized ligands/drugs targeted toward these nuclear receptors could influence CYP3A gene expression.

Nuclear localisation of calreticulin in vivo is enhanced by its interaction with glucocorticoid receptors.

PubMed

Roderick, H L; Campbell, A K; Llewellyn, D H

1997-03-24

The multi-functional protein calreticulin (CRT) is normally found within the lumen of the endoplasmic reticulum (ER). However, some of its proposed functions require it to be located within the nucleus, where its presence is contentious. We have investigated this in live COS7, HeLa and LM(TK-) cells using green fluorescent protein (GFP)-fusion proteins. GFP-CRT, and GFP, with an ER signal peptide and a KDEL sequence (ER-GFP), were localised to the ER. In addition, GFP-CRT was located in the nucleus of all the cell types at low levels. The higher levels of nuclear fluorescence in LM(TK-) and HeLa cells suggested that glucocorticoid receptors might enhance nuclear localisation of calreticulin. Dexamethasone treatment of LM(TK-) cells doubled the amount of nuclear GFP-CRT, but did not affect the localisation of a GFP-CRT fusion in which the glucocorticoid receptor-binding N-domain of calreticulin had been deleted. Thus, despite ER targeting and retention signals, calreticulin is also located within the nucleus where its presence increases due to its interaction with glucocorticoid receptors.

Quantitative High-throughput Luciferase Screening in Identifying CAR Modulators

PubMed Central

Lynch, Caitlin; Zhao, Jinghua; Wang, Hongbing; Xia, Menghang

2017-01-01

Summary The constitutive androstane receptor (CAR, NR1I3) is responsible for the transcription of multiple drug metabolizing enzymes and transporters. There are two possible methods of activation for CAR, direct ligand binding and a ligand-independent method, which makes this a unique nuclear receptor. Both of these mechanisms require translocation of CAR from the cytoplasm into the nucleus. Interestingly, CAR is constitutively active in immortalized cell lines due to the basal nuclear location of this receptor. This creates an important challenge in most in vitro assay models because immortalized cells cannot be used without inhibiting the basal activity. In this book chapter, we go into detail of how to perform quantitative high-throughput screens to identify hCAR1 modulators through the employment of a double stable cell line. Using this line, we are able to identify activators, as well as deactivators, of the challenging nuclear receptor, CAR. PMID:27518621

Quantitative High-Throughput Luciferase Screening in Identifying CAR Modulators.

PubMed

Lynch, Caitlin; Zhao, Jinghua; Wang, Hongbing; Xia, Menghang

2016-01-01

The constitutive androstane receptor (CAR, NR1I3) is responsible for the transcription of multiple drug metabolizing enzymes and transporters. There are two possible methods of activation for CAR, direct ligand binding and a ligand-independent method, which makes this a unique nuclear receptor. Both of these mechanisms require translocation of CAR from the cytoplasm into the nucleus. Interestingly, CAR is constitutively active in immortalized cell lines due to the basal nuclear location of this receptor. This creates an important challenge in most in vitro assay models because immortalized cells cannot be used without inhibiting the high basal activity. In this book chapter, we go into detail of how to perform quantitative high-throughput screens to identify hCAR1 modulators through the employment of a double stable cell line. Using this line, we are able to identify activators, as well as deactivators, of the challenging nuclear receptor, CAR.

Huntingtin interacting protein 1 modulates the transcriptional activity of nuclear hormone receptors

PubMed Central

Mills, Ian G.; Gaughan, Luke; Robson, Craig; Ross, Theodora; McCracken, Stuart; Kelly, John; Neal, David E.

2005-01-01

Internalization of activated receptors regulates signaling, and endocytic adaptor proteins are well-characterized in clathrin-mediated uptake. One of these adaptor proteins, huntingtin interacting protein 1 (HIP1), induces cellular transformation and is overexpressed in some prostate cancers. We have discovered that HIP1 associates with the androgen receptor through a central coiled coil domain and is recruited to DNA response elements upon androgen stimulation. HIP1 is a novel androgen receptor regulator, significantly repressing transcription when knocked down using a silencing RNA approach and activating transcription when overexpressed. We have also identified a functional nuclear localization signal at the COOH terminus of HIP1, which contributes to the nuclear translocation of the protein. In conclusion, we have discovered that HIP1 is a nucleocytoplasmic protein capable of associating with membranes and DNA response elements and regulating transcription. PMID:16027218

Improving Mode of Action Analysis Using Transcript Profiling in Nullizygous Mouse Models

EPA Science Inventory

A number of nuclear receptors (NR) mediate transcriptional, hepatocyte growth and carcinogenic effects in the rodent liver after chemical exposure. These receptors include the constitutive activated/androstane receptor (CAR), pregnane X receptor (PXR), and peroxisome proliferator...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Yanbo; Thyagarajan, Narmadaa; Coady, Breanne M.

Highlights: • Lipoprotein hydrolysis products were produced by lipoprotein lipase. • Hydrolysis products lowers expression of macrophage cholesterol transporters. • Hydrolysis products reduces expression of select nuclear receptors. • Fatty acid products lowers cholesterol transporters and select nuclear receptors. • Fatty acid products reduces cholesterol efflux from macrophages. - Abstract: Lipoprotein lipase (LPL) is an extracellular lipase that primarily hydrolyzes triglycerides within circulating lipoproteins. Macrophage LPL contributes to atherogenesis, but the mechanisms behind it are poorly understood. We hypothesized that the products of lipoprotein hydrolysis generated by LPL promote atherogenesis by inhibiting the cholesterol efflux ability by macrophages. To testmore » this hypothesis, we treated human THP-1 macrophages with total lipoproteins that were hydrolyzed by LPL and we found significantly reduced transcript levels for the cholesterol transporters ATP binding cassette transporter A1 (ABCA1), ABCG1, and scavenger receptor BI. These decreases were likely due to significant reductions for the nuclear receptors liver-X-receptor-α, peroxisome proliferator activated receptor (PPAR)-α, and PPAR-γ. We prepared a mixture of free fatty acids (FFA) that represented the ratios of FFA species within lipoprotein hydrolysis products, and we found that the FFA mixture also significantly reduced cholesterol transporters and nuclear receptors. Finally, we tested the efflux of cholesterol from THP-1 macrophages to apolipoprotein A-I, and we found that the treatment of THP-1 macrophages with the FFA mixture significantly attenuated cholesterol efflux. Overall, these data show that the FFA component of lipoprotein hydrolysis products generated by LPL may promote atherogenesis by inhibiting cholesterol efflux, which partially explains the pro-atherogenic role of macrophage LPL.« less

Changes in amount and intracellular distribution of androgen receptor in human foreskin as a function of age.

PubMed Central

Roehrborn, C G; Lange, J L; George, F W; Wilson, J D

1987-01-01

To provide insight into the factors that control growth of the penis we measured the amount and intracellular distribution of specific high affinity androgen receptor in foreskins obtained at circumcision from 49 males varying in age from newborn to 59 yr. Total (cytosolic plus nuclear extract) androgen receptor decreased from approximately 40 fmol/g tissue weight in newborn foreskins to approximately 25 fmol/g by 1 yr of age. The amount of receptor rose in childhood to approximately 180 fmol/g in the late teenage years and fell thereafter to approximately 20-40 fmol/g in men older than 40 yr. The amount of receptor in the nuclear fraction increased at the time of puberty and subsequently decreased in parallel with the decline in total receptor level. These changes in androgen-receptor amount are similar when expressed per milligram DNA or per milligram protein. Images PMID:3491838

Transcriptional targets shared by estrogen receptor- related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta.

PubMed Central

Vanacker, J M; Pettersson, K; Gustafsson, J A; Laudet, V

1999-01-01

The physiological activities of estrogens are thought to be mediated by specific nuclear receptors, ERalpha and ERbeta. However, certain tissues, such as the bone, that are highly responsive to estrogens only express a low level of these receptors. Starting from this apparent contradiction, we have evaluated the potentials of two related receptors ERRalpha and ERRbeta to intervene in estrogen signaling. ERalpha, ERRalpha and ERRbeta bind to and activate transcription through both the classical estrogen response element (ERE) and the SF-1 response element (SFRE). In contrast, ERbeta DNA-binding and transcriptional activity is restricted to the ERE. Accordingly, the osteopontin gene promoter is stimulated through SFRE sequences, by ERRalpha as well as by ERalpha, but not by ERbeta. Analysis of the cross-talk within the ER/ERR subgroup of nuclear receptors thus revealed common targets but also functional differences between the two ERs. PMID:10428965

Structural Overview of the Nuclear Receptor Superfamily: Insights into Physiology and Therapeutics

PubMed Central

Huang, Pengxiang; Chandra, Vikas; Rastinejad, Fraydoon

2013-01-01

As ligand-regulated transcription factors, the nuclear hormone receptors are nearly ideal drug targets, with internal pockets that bind to hydrophobic, drug-like molecules and well-characterized ligand-induced conformational changes that recruit transcriptional coregulators to promoter elements. Yet, due to the multitude of genes under the control of a single receptor, the major challenge has been the identification of ligands with gene-selective actions, impacting disease outcomes through a narrow subset of target genes and not across their entire gene-regulatory repertoire. Here, we summarize the concepts and work to date underlying the development of steroidal and nonsteroidal receptor ligands, including the use of crystal structures, high-throughput screens, and rational design approaches for finding useful therapeutic molecules. Difficulties in finding selective receptor modulators require a more complete understanding of receptor interdomain communications, posttranslational modifications, and receptor-protein interactions that could be exploited for target gene selectivity. PMID:20148675

Transportin mediates nuclear entry of DNA in vertebrate systems.

PubMed

Lachish-Zalait, Aurelie; Lau, Corine K; Fichtman, Boris; Zimmerman, Ella; Harel, Amnon; Gaylord, Michelle R; Forbes, Douglass J; Elbaum, Michael

2009-10-01

Delivery of DNA to the cell nucleus is an essential step in many types of viral infection, transfection, gene transfer by the plant pathogen Agrobacterium tumefaciens and in strategies for gene therapy. Thus, the mechanism by which DNA crosses the nuclear pore complex (NPC) is of great interest. Using nuclei reconstituted in vitro in Xenopus egg extracts, we previously studied DNA passage through the nuclear pores using a single-molecule approach based on optical tweezers. Fluorescently labeled DNA molecules were also seen to accumulate within nuclei. Here we find that this import of DNA relies on a soluble protein receptor of the importin family. To identify this receptor, we used different pathway-specific cargoes in competition studies as well as pathway-specific dominant negative inhibitors derived from the nucleoporin Nup153. We found that inhibition of the receptor transportin suppresses DNA import. In contrast, inhibition of importin beta has little effect on the nuclear accumulation of DNA. The dependence on transportin was fully confirmed in assays using permeabilized HeLa cells and a mammalian cell extract. We conclude that the nuclear import of DNA observed in these different vertebrate systems is largely mediated by the receptor transportin. We further report that histones, a known cargo of transportin, can act as an adaptor for the binding of transportin to DNA.

Gene expression analyses of the small intestine of pigs in the ex-evacuation zone of the Fukushima Daiichi Nuclear Power Plant.

PubMed

Morimoto, Motoko; Kato, Ayaka; Kobayashi, Jin; Okuda, Kei; Kuwahara, Yoshikazu; Kino, Yasushi; Abe, Yasuyuki; Sekine, Tsutomu; Fukuda, Tomokazu; Isogai, Emiko; Fukumoto, Manabu

2017-11-15

After the accident at the Fukushima Daiichi Nuclear Power Plant, radioactive contaminants were released over a widespread area. Monitoring the biological effects of radiation exposure in animals in the ex-evacuation zone should be continued to understand the health effects of radiation exposure in humans. The present study aimed to clarify the effects of radiation by investigating whether there is any alteration in the morphology and gene expressions of immune molecules in the intestine of pigs and inobuta (wild boar and domestic pig hybrid) in the ex-evacuation zone in 2012. Gene expression analysis was performed in small intestine samples from pigs, which were collected from January to February 2012, in the ex-evacuation zone. Pigs lived freely in this zone, and their small intestine was considered to be affected by the dietary intake of radioactive contaminants. Several genes were selected by microarray analysis for further investigation using real-time polymerase chain reaction. IFN-γ, which is an important inflammatory cytokine, and TLR3, which is a pattern recognize receptor for innate immune system genes, were highly elevated in these pigs. The expressions of the genes of these proteins were associated with the radiation level in the muscles. We also examined the alteration of gene expressions in wild boars 5 years after the disaster. The expression of IFN-γ and TLR3 remained high, and that of Cyclin G1, which is important in the cell cycle, was elevated. We demonstrated that some changes in gene expression occurred in the small intestine of animals in the ex-evacuation zone after radiation. It is difficult to conclude that these alterations are caused by only artificial radionuclides from the Fukushima Daiichi Nuclear Power Plant. However, the animals in the ex-evacuation zone might have experienced some changes owing to radioactive materials, including contaminated soil, small animals, and insects. We need to continue monitoring the effects of long-term radiation exposure in living things.

Intracellular calcium: a prerequisite for aldosterone action.

PubMed

Schäfer, C; Shahin, V; Albermann, L; Schillers, H; Hug, M J; Oberleithner, H

2003-12-01

Transport of salt and water in various tissues is under control of the mineralocorticoid hormone aldosterone. As a liphophilic hormone, aldosterone diffuses through the plasma membrane and, then, binds to cytosolic mineralocorticoid receptors in the target cells. After binding to nuclear pore complexes, the activated receptor is translocated to the nucleus where transcription processes are initiated. After a lag period of about 20 minutes hormone-specific early mRNA transcripts leave the nucleus through nuclear pores. Some of the steps in this cascade can be followed by electrophysiology in Xenopus laevis oocyte nuclei. In addition to the genomic pathway, aldosterone exerts a rapid pre-genomic response that involves an increase in intracellular calcium. In this study, we tested for the potential role of Ca(2+) in the genomic response of the hormone. We measured the electrical resistance across the nuclear envelope in response to aldosterone, in presence and absence of intracellular Ca(2+). Nuclear envelope electrical resistance reflects receptor binding to the nuclear pore complexes ("early" resistance peak, 2 minutes after aldosterone), ongoing transcription ("transient" resistance drop, 5-15 minutes after aldosterone) and mRNA export ("late" resistance peak, 20 minutes after aldosterone). Pre-injection of the Ca(2+) chelator EGTA eliminated all electrical responses evoked by aldosterone. The transient resistance drop and the late resistance peak, induced by the hormone, were prevented by the transcription inhibitor actinomycin D, coinjected with aldosterone, while the early resistance peak remained unaffected. We conclude that (i). the presence of intracellular Ca(2+) is a prerequisite for the genomic action of aldosterone. (ii). Intracellular calcium plays a role early in the signaling cascade, either in agonist-receptor interaction, or receptor transport/docking to the nuclear pore complexes.

RANKL-induced DC-STAMP Is Essential for Osteoclastogenesis

PubMed Central

Kukita, Toshio; Wada, Naohisa; Kukita, Akiko; Kakimoto, Takashi; Sandra, Ferry; Toh, Kazuko; Nagata, Kengo; Iijima, Tadahiko; Horiuchi, Madoka; Matsusaki, Hiromi; Hieshima, Kunio; Yoshie, Osamu; Nomiyama, Hisayuki

2004-01-01

Osteoclasts are bone-resorbing, multinucleated giant cells that are essential for bone remodeling and are formed through cell fusion of mononuclear precursor cells. Although receptor activator of nuclear factor–κB ligand (RANKL) has been demonstrated to be an important osteoclastogenic cytokine, the cell surface molecules involved in osteoclastogenesis are mostly unknown. Here, we report that the seven-transmembrane receptor-like molecule, dendritic cell–specific transmembrane protein (DC-STAMP) is involved in osteoclastogenesis. Expression of DC-STAMP is rapidly induced in osteoclast precursor cells by RANKL and other osteoclastogenic stimulations. Targeted inhibition of DC-STAMP by small interfering RNAs and specific antibody markedly suppressed the formation of multinucleated osteoclast-like cells. Overexpression of DC-STAMP enhanced osteoclastogenesis in the presence of RANKL. Furthermore, DC-STAMP directly induced the expression of the osteoclast marker tartrate-resistant acid phosphatase. These data demonstrate for the first time that DC-STAMP has an essential role in osteoclastogenesis. PMID:15452179

A Novel 3-Hydroxysteroid Dehydrogenase That Regulates Reproductive Development and Longevity

PubMed Central

Wollam, Joshua; Magner, Daniel B.; Magomedova, Lilia; Rass, Elisabeth; Shen, Yidong; Rottiers, Veerle; Habermann, Bianca; Cummins, Carolyn L.; Antebi, Adam

2012-01-01

Endogenous small molecule metabolites that regulate animal longevity are emerging as a novel means to influence health and life span. In C. elegans, bile acid-like steroids called the dafachronic acids (DAs) regulate developmental timing and longevity through the conserved nuclear hormone receptor DAF-12, a homolog of mammalian sterol-regulated receptors LXR and FXR. Using metabolic genetics, mass spectrometry, and biochemical approaches, we identify new activities in DA biosynthesis and characterize an evolutionarily conserved short chain dehydrogenase, DHS-16, as a novel 3-hydroxysteroid dehydrogenase. Through regulation of DA production, DHS-16 controls DAF-12 activity governing longevity in response to signals from the gonad. Our elucidation of C. elegans bile acid biosynthetic pathways reveals the possibility of novel ligands as well as striking biochemical conservation to other animals, which could illuminate new targets for manipulating longevity in metazoans. PMID:22505847

MicroRNAs-Dependent Regulation of PPARs in Metabolic Diseases and Cancers

PubMed Central

Portius, Dorothea; Sobolewski, Cyril

2017-01-01

Peroxisome proliferator-activated receptors (PPARs) are a family of ligand-dependent nuclear receptors, which control the transcription of genes involved in energy homeostasis and inflammation and cell proliferation/differentiation. Alterations of PPARs' expression and/or activity are commonly associated with metabolic disorders occurring with obesity, type 2 diabetes, and fatty liver disease, as well as with inflammation and cancer. Emerging evidence now indicates that microRNAs (miRNAs), a family of small noncoding RNAs, which fine-tune gene expression, play a significant role in the pathophysiological mechanisms regulating the expression and activity of PPARs. Herein, the regulation of PPARs by miRNAs is reviewed in the context of metabolic disorders, inflammation, and cancer. The reciprocal control of miRNAs expression by PPARs, as well as the therapeutic potential of modulating PPAR expression/activity by pharmacological compounds targeting miRNA, is also discussed. PMID:28167956

[Nutrigenomics--bioactive dietary components].

PubMed

Gętek, Monika; Czech, Natalia; Fizia, Katarzyna; Białek-Dratwa, Agnieszka; Muc-Wierzgoń, Małgorzata; Kokot, Teresa; Nowakowska-Zajdel, Ewa

2013-04-05

Nutrigenomics analyzes relations between diet and genes, and identifies mechanisms in which food and nutrition affect health and lifestyles and noncommunicable diseases (R. Chadwick, 2004). Bioactive dietary components are signal molecules that carry information from the external environment and affect in terms of quantity and quality in the process of gene expression. The biological effect of bioactive dietary components depends on various of physiological processes that can occur within a few genes. Polymorphism of genes can change their function and physiological response of the body for nutrients. Bioactive dietary components work on at least two levels of the expression of genes as factors regulating chromatin structure and as factors directly regulate the activity of nuclear receptors. The processes of synthesis and DNA repair are regulated by some of vitamins, macro-and micro-elements. They provide, among others, cofactors of enzymes that catalyze the replication of DNA methylation and its repair. DNA methylation profile may change under the influence of diet, single nucleotide polymorphisms and environmental factors. Bioactive dietary components may directly affect the process of gene expression by acting as ligands for nuclear receptors. Sensitive to dietary group of nuclear receptors are sensory receptors. This group includes, among others receptor PPAR (peroxisome proliferator activated), responsible for energy metabolism and receptors LXR (liver X receptor), FXR (farnesoid X receptor) and RXR, which is responsible for the metabolism of cholesterol.

Exclusive nuclear location of estrogen receptors in Squalus testis.

PubMed Central

Callard, G V; Mak, P

1985-01-01

An estrogen (E)-binding molecule having both occupied and unoccupied sites is restricted to nuclear subfractions in the testis of the spiny dogfish (Squalus acanthias). We investigated the hypothesis that a species characterized by high body-fluid osmolarity (1010 mosM) has an estrogen receptor (ER) that binds to chromatin with high affinity and consequently resists redistribution during tissue processing. Although the steroid binding and sedimentation properties of the Squalus nuclear ER conformed to those of classical ER, its elution maximum from DNA-cellulose was unusually high (0.55 M NaCl). A tendency to adhere tightly to cell nuclei was reflected in the high salt concentration (0.43 M KCl) required to extract 50% of the receptors from the nuclear compartment during homogenization and in the stability of the nuclear ER population in the presence of high concentrations of a nonionic solute (urea) or increased buffer volume. Mixing and redistribution experiments showed that nuclear ER could be quantitatively and qualitatively measured in cytosolic extracts, ruling out the possibility that soluble receptors were being masked. Although Squalus oviduct ER was similar to that of testis, ER in the testis and liver of a related elasmobranch (Potamotrygon) that maintains osmotic equilibrium at 300 mosM more closely resembled mammalian ER in its elution maximum from DNA-cellulose (0.22 M NaCl) and cytosolic/nuclear ratios in low-salt buffers. We conclude that Squalus testis has a single ER pool located exclusively in the nuclear compartment. These observations support a revised concept of steroid action and further indicate that the chromatin affinity of the hormone-ER complex is an important factor in determining subfractional distribution during tissue processing. PMID:3856265

Role of RANKL in bone diseases.

PubMed

Anandarajah, Allen P

2009-03-01

Bone remodeling is a tightly regulated process of osteoclast-mediated bone resorption, balanced by osteoblast-mediated bone formation. Disruption of this balance can lead to increased bone turnover, resulting in excessive bone loss or extra bone formation and consequent skeletal disease. The receptor activator of nuclear factor kappaB ligand (RANKL) (along with its receptor), the receptor activator of nuclear factor kappaB and its natural decoy receptor, osteoprotegerin, are the final effector proteins of osteoclastic bone resorption. Here, I provide an overview of recent studies that highlight the key role of RANKL in the pathophysiology of several bone diseases and discuss the novel therapeutic approaches afforded by the modulation of RANKL.

The nuclear orphan receptors COUP-TF and ARP-1 positively regulate the trout estrogen receptor gene through enhancing autoregulation.

PubMed Central

Lazennec, G; Kern, L; Valotaire, Y; Salbert, G

1997-01-01

The rainbow trout estrogen receptor (rtER) is a positively autoregulated gene in liver cells. In a previous report, we showed that upregulation is mediated by an estrogen response element (ERE) located in the proximal promoter of the gene and that a half binding site for nuclear receptors (5'-TGACCT-3') located 15 bp upstream of the ERE is involved in the magnitude of the estrogen response. We now report that the human orphan receptor COUP-TF and a COUP-TF-like protein from trout liver are able to bind to the consensus half-site. When cotransfected with the rtER gene proximal promoter, COUP-TF had no regulatory functions on its own. Interestingly, COUP-TF enhanced rtER transactivation properties in the presence of estradiol in a dose-dependent manner when cotransfected with the rtER gene promoter. Unliganded retinoid receptor heterodimers had the same helper function as COUP-TF in the presence of estradiol but were switched to repressors when the ligand all-trans-retinoic acid was added. Mutation of the consensus half-site only slightly reduced COUP-TF helper function, suggesting that it actually results from a complex mechanism that probably involves both DNA binding of COUP-TF to the promoter and protein-protein interaction with another transcription factor bound to the promoter. Nevertheless, a DNA-binding-defective mutant of COUP-TF was also defective in ER helper function. Competition footprinting analysis suggested that COUP-TF actually establishes contacts with the consensus upstream half-site and the downstream ERE half-site that would form a DR-24-like response element. Interaction of COUP-TF with the DR-24 element was confirmed in footprinting assays by using nuclear extracts from Saccharomyces cerevisiae expressing COUP-TF. Finally, interaction of COUP-TF with mutants of the rtER gene promoter showed that COUP-TF recognizes the ERE when the upstream half-site is mutated. These data show that COUP-TF may activate transcription through interaction with other nuclear receptors. This cross-talk between liganded nuclear receptors and orphan receptors is likely to modulate the spectrum of action of a particular ligand-receptor complex and may participate in the cell-type specificity of the ligand effect. PMID:9271383

Body Mass Index Influences the Prognostic Impact of Combined Nuclear Insulin Receptor and Estrogen Receptor Expression in Primary Breast Cancer.

PubMed

Björner, Sofie; Rosendahl, Ann H; Simonsson, Maria; Markkula, Andrea; Jirström, Karin; Borgquist, Signe; Rose, Carsten; Ingvar, Christian; Jernström, Helena

2017-01-01

The prognostic importance of tumor-specific nuclear insulin receptor (InsR) expression in breast cancer is unclear, while membrane and cytoplasmic localization of InsR is better characterized. The insulin signaling network is influenced by obesity and may interact with the estrogen receptor α (ERα) signaling. The purpose was to investigate the interplay between nuclear InsR, ER, body mass index (BMI), and prognosis. Tumor-specific expression of nuclear InsR was evaluated by immunohistochemistry in tissue microarrays from 900 patients with primary invasive breast cancer without preoperative treatment, included in a population-based cohort in Sweden (2002-2012) in relation to prognosis. Patients were followed for up to 11 years during which 107 recurrences were observed. Nuclear InsR + expression was present in 214 patients (23.8%) and increased with longer time between surgery and staining ( P  < 0.001). There were significant effect modifications by ER status and BMI in relation to clinical outcomes. Nuclear InsR + conferred higher recurrence-risk in patients with ER + tumors, but lower risk in patients with ER - tumors ( P interaction  = 0.003). Normal-weight patients with nuclear InsR + tumors had higher recurrence-risk, while overweight or obese patients had half the recurrence-risk compared to patients with nuclear InsR - tumors ( P interaction  = 0.007). Normal-weight patients with a nuclear InsR - /ER + tumor had the lowest risk for recurrence compared to all other nuclear InsR/ER combinations [HR adj 0.50, 95% confidence interval (CI): 0.25-0.97], while overweight or obese patients with nuclear InsR - /ER - tumors had the worst prognosis (HR adj 7.75, 95% CI: 2.04-29.48). Nuclear InsR was more prognostic than ER among chemotherapy-treated patients. In summary, nuclear InsR may have prognostic impact among normal-weight patients with ER + tumors and in overweight or obese patients with ER - tumors. Normal-weight patients with nuclear InsR - /ER + tumors may benefit from less treatment than normal-weight patients with other nuclear InsR/ER combinations. Overweight or obese patients with nuclear InsR - /ER - tumors may benefit from more tailored treatment or weight management.

Isolation, characterization, and expression analyses of ecdysone receptor 1, ecdysone receptor 2 and ultraspiracle genes in varroa destructor mite

USDA-ARS?s Scientific Manuscript database

The varroa mite, Varroa destructor, is a honeybee ectoparasite considered the most important pest in apiaries throughout the US. Ecdysone receptor is a hormone secreted by the prothoracic gland of insects that controls ecdysis and stimulates metamorphosis. The ecdysone receptor is a nuclear receptor...

Featured Article: Nuclear export of opioid growth factor receptor is CRM1 dependent.

PubMed

Kren, Nancy P; Zagon, Ian S; McLaughlin, Patricia J

2016-02-01

Opioid growth factor receptor (OGFr) facilitates growth inhibition in the presence of its specific ligand opioid growth factor (OGF), chemically termed [Met(5)]-enkephalin. The function of the OGF-OGFr axis requires the receptor to translocate to the nucleus. However, the mechanism of nuclear export of OGFr is unknown. In this study, endogenous OGFr, as well as exogenously expressed OGFr-EGFP, demonstrated significant nuclear accumulation in response to leptomycin B (LMB), an inhibitor of CRM1-dependent nuclear export, suggesting that OGFr is exported in a CRM1-dependent manner. One consensus sequence for a nuclear export signal (NES) was identified. Mutation of the associated leucines, L217 L220 L223 and L225, to alanine resulted in decreased nuclear accumulation. NES-EGFP responded to LMB, indicating that this sequence is capable of functioning as an export signal in isolation. To determine why the sequence functions differently in isolation than as a full length protein, the localization of subNES was evaluated in the presence and absence of MG132, a potent inhibitor of proteosomal degradation. MG132 had no effect of subNES localization. The role of tandem repeats located at the C-terminus of OGFr was examined for their role in nuclear trafficking. Six of seven tandem repeats were removed to form deltaTR. DeltaTR localized exclusively to the nucleus indicating that the tandem repeats may contribute to the localization of the receptor. Similar to the loss of cellular proliferation activity (i.e. inhibition) recorded with subNES, deltaTR also demonstrated a significant loss of inhibitory activity indicating that the repeats may be integral to receptor function. These experiments reveal that OGFr contains one functional NES, L217 L220 L223 and L225 and can be exported from the nucleus in a CRM1-dependent manner. © 2015 by the Society for Experimental Biology and Medicine.

A century old renin-angiotensin system still grows with endless possibilities: AT1 receptor signaling cascades in cardiovascular physiopathology.

PubMed

Balakumar, Pitchai; Jagadeesh, Gowraganahalli

2014-10-01

Ang II, the primary effector pleiotropic hormone of the renin-angiotensin system (RAS) cascade, mediates physiological control of blood pressure and electrolyte balance through its action on vascular tone, aldosterone secretion, renal sodium absorption, water intake, sympathetic activity and vasopressin release. It affects the function of most of the organs far beyond blood pressure control including heart, blood vessels, kidney and brain, thus, causing both beneficial and deleterious effects. However, the protective axis of the RAS composed of ACE2, Ang (1-7), alamandine, and Mas and MargD receptors might oppose some harmful effects of Ang II and might promote beneficial cardiovascular effects. Newly identified RAS family peptides, Ang A and angioprotectin, further extend the complexities in understanding the cardiovascular physiopathology of RAS. Most of the diverse actions of Ang II are mediated by AT1 receptors, which couple to classical Gq/11 protein and activate multiple downstream signals, including PKC, ERK1/2, Raf, tyrosine kinases, receptor tyrosine kinases (EGFR, PDGF, insulin receptor), nuclear factor κB and reactive oxygen species (ROS). Receptor activation via G12/13 stimulates Rho-kinase, which causes vascular contraction and hypertrophy. The AT1 receptor activation also stimulates G protein-independent signaling pathways such as β-arrestin-mediated MAPK activation and Src-JAK/STAT. AT1 receptor-mediated activation of NADPH oxidase releases ROS, resulting in the activation of pro-inflammatory transcription factors and stimulation of small G proteins such as Ras, Rac and RhoA. The components of the RAS and the major Ang II-induced signaling cascades of AT1 receptors are reviewed. Copyright © 2014 Elsevier Inc. All rights reserved.

Structural basis of ligand binding modes at the neuropeptide Y Y1 receptor.

PubMed

Yang, Zhenlin; Han, Shuo; Keller, Max; Kaiser, Anette; Bender, Brian J; Bosse, Mathias; Burkert, Kerstin; Kögler, Lisa M; Wifling, David; Bernhardt, Guenther; Plank, Nicole; Littmann, Timo; Schmidt, Peter; Yi, Cuiying; Li, Beibei; Ye, Sheng; Zhang, Rongguang; Xu, Bo; Larhammar, Dan; Stevens, Raymond C; Huster, Daniel; Meiler, Jens; Zhao, Qiang; Beck-Sickinger, Annette G; Buschauer, Armin; Wu, Beili

2018-04-01

Neuropeptide Y (NPY) receptors belong to the G-protein-coupled receptor superfamily and have important roles in food intake, anxiety and cancer biology 1,2 . The NPY-Y receptor system has emerged as one of the most complex networks with three peptide ligands (NPY, peptide YY and pancreatic polypeptide) binding to four receptors in most mammals, namely the Y 1 , Y 2 , Y 4 and Y 5 receptors, with different affinity and selectivity 3 . NPY is the most powerful stimulant of food intake and this effect is primarily mediated by the Y 1 receptor (Y 1 R) 4 . A number of peptides and small-molecule compounds have been characterized as Y 1 R antagonists and have shown clinical potential in the treatment of obesity 4 , tumour 1 and bone loss 5 . However, their clinical usage has been hampered by low potency and selectivity, poor brain penetration ability or lack of oral bioavailability 6 . Here we report crystal structures of the human Y 1 R bound to the two selective antagonists UR-MK299 and BMS-193885 at 2.7 and 3.0 Å resolution, respectively. The structures combined with mutagenesis studies reveal the binding modes of Y 1 R to several structurally diverse antagonists and the determinants of ligand selectivity. The Y 1 R structure and molecular docking of the endogenous agonist NPY, together with nuclear magnetic resonance, photo-crosslinking and functional studies, provide insights into the binding behaviour of the agonist and for the first time, to our knowledge, determine the interaction of its N terminus with the receptor. These insights into Y 1 R can enable structure-based drug discovery that targets NPY receptors.

Molecular characterization of SMILE as a novel corepressor of nuclear receptors.

PubMed

Xie, Yuan-Bin; Nedumaran, Balachandar; Choi, Hueng-Sik

2009-07-01

SMILE (small heterodimer partner interacting leucine zipper protein) has been identified as a coregulator in ER signaling. In this study, we have examined the effects of SMILE on other NRs (nuclear receptors). SMILE inhibits GR, CAR and HNF4 alpha-mediated transactivation. Knockdown of SMILE gene expression increases the transactivation of the NRs. SMILE interacts with GR, CAR and HNF4 alpha in vitro and in vivo. SMILE and these NRs colocalize in the nucleus. SMILE binds to the ligand-binding domain or AF2 domain of the NRs. Competitions between SMILE and the coactivators GRIP1 or PGC-1 alpha have been demonstrated in vitro and in vivo. Furthermore, an intrinsic repressive activity of SMILE is observed in Gal4-fusion system, and the intrinsic repressive domain is mapped to the C-terminus of SMILE, spanning residues 203-354. Moreover, SMILE interacts with specific HDACs (histone deacetylases) and SMILE-mediated repression is released by HDAC inhibitor trichostatin A, in a NR-specific manner. Finally, ChIP (chromatin immunoprecipitation) assays reveal that SMILE associates with the NRs on the target gene promoters. Adenoviral overexpression of SMILE represses GR-, CAR- and HNF4 alpha-mediated target gene expression. Overall, these results suggest that SMILE functions as a novel corepressor of NRs via competition with coactivators and the recruitment of HDACs.

Novel Positive Regulatory Role for the SPL6 Transcription Factor in the N TIR-NB-LRR Receptor-Mediated Plant Innate Immunity

PubMed Central

Padmanabhan, Meenu S.; Ma, Shisong; Burch-Smith, Tessa M.; Czymmek, Kirk; Huijser, Peter; Dinesh-Kumar, Savithramma P.

2013-01-01

Following the recognition of pathogen-encoded effectors, plant TIR-NB-LRR immune receptors induce defense signaling by a largely unknown mechanism. We identify a novel and conserved role for the SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-domain transcription factor SPL6 in enabling the activation of the defense transcriptome following its association with a nuclear-localized immune receptor. During an active immune response, the Nicotiana TIR-NB-LRR N immune receptor associates with NbSPL6 within distinct nuclear compartments. NbSPL6 is essential for the N-mediated resistance to Tobacco mosaic virus. Similarly, the presumed Arabidopsis ortholog AtSPL6 is required for the resistance mediated by the TIR-NB-LRR RPS4 against Pseudomonas syringae carrying the avrRps4 effector. Transcriptome analysis indicates that AtSPL6 positively regulates a subset of defense genes. A pathogen-activated nuclear-localized TIR-NB-LRR like N can therefore regulate defense genes through SPL6 in a mechanism analogous to the induction of MHC genes by mammalian immune receptors like CIITA and NLRC5. PMID:23516366

Microsomal receptor for steroid hormones: functional implications for nuclear activity.

PubMed

Muldoon, T G; Watson, G H; Evans, A C; Steinsapir, J

1988-01-01

Target tissues for steroid hormones are responsive by virtue of and to the extent of their content of functional intracellular receptors. Recent years have seen a shift in considerations of the cellular dynamics and distribution of these receptors, with current views favoring predominant intranuclear localization in the intact cell. This paper summarizes our analyses of the microsomal estrogen and androgen binding capability of rat uterine and ventral prostate tissue, respectively; these studies have revealed a set of high affinity sites that may act as a conduit for estrogen traversing the cell en route to the nucleus. These sites have many properties in common with cytosolic receptors, with the salient difference of a failure to activate to a more avid DNA-binding form under conditions which permit such activation of cytosolic receptors. The microsomal estrogen-binding proteins also have appreciable affinity for progesterone, another distinction from other known cellular estrogen receptor species. Various experimental approaches were employed to demonstrate that the microsomal receptors were not simply cytosol contaminants; the most convincing evidence is the recent successful separation of the cytosolic and microsomal forms by differential ammonium sulfate precipitation. Discrete subfractionation of subcellular components on successive sucrose gradients, with simultaneous assessments of binding capability and marker enzyme concentrations, indicates that the major portion of the binding is localized within the vesicles of the endoplasmic reticulum free of significant plasma membrane contamination. The microsomal receptors are readily solubilized by extraction with high- or low-salt-containing buffers or with steroid. The residual microsomes following such extraction have the characteristics of saturable acceptor sites for cytosolic estrogen-receptor complexes. The extent to which these sites will accept the cytosolic complexes is equal to the concentration of microsomal binding sites extracted. These observations suggest three possible roles for the microsomal receptor-like proteins: (a) modulation of estrogen access to nuclear binding sites; (b) formation of functional complexes which diffuse to other extranuclear sites to alter non-genomic cellular processes; (c) regulation of nuclear concentration of estrogen-receptor complexes by virtue of producing microsomal acceptor sites for uptake of free or loosely associated nuclear complexes, previously thought to exist in the cytoplasm.

Vitamin D Alters Genes Involved in Follicular Development and Steroidogenesis in Human Cumulus Granulosa Cells

PubMed Central

Doswell, Angela; Krebs, Kendall; Cipolla, Marilyn

2014-01-01

Context: Vitamin D deficiency is common among reproductive-aged women and has a role in female reproduction. Objective: This study evaluated the role of 1,25-dihydroxyvitamin D3 (vit D3) in ovarian follicular development and steroidogenesis by using a human granulosa cell (GC) model. Design, Setting, and Participants: Fifty-four women who underwent in vitro fertilization were enrolled. Intervention: Follicular fluid (FF) and mural and cumulus GCs were collected from small and large follicles. In separate experiments, primary cumulus GCs were cultured with or without vit D3 followed by RT-PCR for mRNA expression levels. The effect of recombinant anti-Mullerian hormone (AMH) on nuclear localization of phospho-Smad 1/5/8 was evaluated in the presence or absence of vit D3 by using immunofluorescence. 25-Hydroxyvitamin D levels in FF as well as cell culture media AMH, progesterone, and estradiol (E2) concentrations were determined by ELISA and RIA. Main Outcome Measures: The following were measured: 1) mRNA expression levels; 2) 3β-hydroxysteroid dehydrogenase (3β-HSD) enzyme activity; 3) FSH-induced aromatase mRNA and E2 production; and 4) nuclear localization of phospho-Smad 1/5/8. Results: In a multivariate analysis, 25 OH-D levels in FF negatively correlated with AMH and AMH receptor (AMHR)-II mRNA levels in cumulus GCs of small follicles. Compared with women with replete 25-hydroxyvitamin D levels in FF, those with insufficient/deficient levels had a 2-fold increase in AMHR-II mRNA levels in cumulus GCs of small follicles (P = .02). Treatment with vit D3 caused a decrease in AMHR-II and FSH receptor mRNA but an increase in 3-βHSD mRNA levels compared with control (P < .05). Vit D3 enhanced 3-βHSD enzyme activity as assessed by increasing progesterone release; however, vit D3 did not affect FSH-induced aromatase mRNA and E2 production, but it decreased the phosphorylation of Smad 1/5/8 and its nuclear localization. Conclusion: These data suggest that vit D3 alters AMH signaling and steroidogenesis in human cumulus GCs, possibly reflecting a state of GC luteinization potentiation. PMID:24628555

The VPAC1 receptor: structure and function of a class B GPCR prototype

PubMed Central

Couvineau, A.; Ceraudo, E.; Tan, Y.-V.; Nicole, P.; Laburthe, M.

2012-01-01

The class B G protein-coupled receptors (GPCRs) represents a small sub-family encompassing 15 members, and are very promising targets for the development of drugs to treat many diseases such as chronic inflammation, neurodegeneration, diabetes, stress, and osteoporosis. The VPAC1 receptor which is an archetype of the class B GPCRs binds Vasoactive Intestinal Peptide (VIP), a neuropeptide widely distributed in central and peripheral nervous system modulating many physiological processes including regulation of exocrine secretions, hormone release, foetal development, immune response … VIP appears to exert beneficial effect in neurodegenerative and inflammatory diseases. This article reviews the current knowledge regarding the structure and molecular pharmacology of VPAC1 receptors. Over the past decade, structure–function relationship studies have demonstrated that the N-terminal ectodomain (N-ted) of VPAC1 plays a pivotal role in VIP recognition. The use of different approaches such as directed mutagenesis, photoaffinity labeling, Nuclear Magnetic Resonance (NMR), molecular modeling, and molecular dynamic simulation has led to demonstrate that: (1) the central and C-terminal part of the VIP molecule interacts with the N-ted of VPAC1 receptor which is itself structured as a « Sushi » domain; (2) the N-terminal end of the VIP molecule interacts with the first transmembrane domain of the receptor where three residues (K143, T144, and T147) play an important role in VPAC1 interaction with the first histidine residue of VIP. PMID:23162538

Nuclear Receptor Signaling Atlas: Opening Access to the Biology of Nuclear Receptor Signaling Pathways.

PubMed

Becnel, Lauren B; Darlington, Yolanda F; Ochsner, Scott A; Easton-Marks, Jeremy R; Watkins, Christopher M; McOwiti, Apollo; Kankanamge, Wasula H; Wise, Michael W; DeHart, Michael; Margolis, Ronald N; McKenna, Neil J

2015-01-01

Signaling pathways involving nuclear receptors (NRs), their ligands and coregulators, regulate tissue-specific transcriptomes in diverse processes, including development, metabolism, reproduction, the immune response and neuronal function, as well as in their associated pathologies. The Nuclear Receptor Signaling Atlas (NURSA) is a Consortium focused around a Hub website (www.nursa.org) that annotates and integrates diverse 'omics datasets originating from the published literature and NURSA-funded Data Source Projects (NDSPs). These datasets are then exposed to the scientific community on an Open Access basis through user-friendly data browsing and search interfaces. Here, we describe the redesign of the Hub, version 3.0, to deploy "Web 2.0" technologies and add richer, more diverse content. The Molecule Pages, which aggregate information relevant to NR signaling pathways from myriad external databases, have been enhanced to include resources for basic scientists, such as post-translational modification sites and targeting miRNAs, and for clinicians, such as clinical trials. A portal to NURSA's Open Access, PubMed-indexed journal Nuclear Receptor Signaling has been added to facilitate manuscript submissions. Datasets and information on reagents generated by NDSPs are available, as is information concerning periodic new NDSP funding solicitations. Finally, the new website integrates the Transcriptomine analysis tool, which allows for mining of millions of richly annotated public transcriptomic data points in the field, providing an environment for dataset re-use and citation, bench data validation and hypothesis generation. We anticipate that this new release of the NURSA database will have tangible, long term benefits for both basic and clinical research in this field.

Cyclopropanyldehydrocostunolide LJ attenuates high glucose-induced podocyte injury by suppressing RANKL/RANK-mediated NF-κB and MAPK signaling pathways.

PubMed

Chen, Xiao-Wen; Liu, Wen-Ting; Wang, Yu-Xian; Chen, Wen-Jing; Li, Hong-Yu; Chen, Yi-Hua; Du, Xiao-Yan; Peng, Fen-Fen; Zhou, Wei-Dong; Xu, Zhao-Zhong; Long, Hai-Bo

2016-07-01

The aim of this research was to investigate the effects of cyclopropanyldehydrocostunolide (also named LJ), a derivative of sesquiterpene lactones (SLs), on high glucose (HG)-induced podocyte injury and the associated molecular mechanisms. Differentiated mouse podocytes were incubated in different treatments. The migration and albumin filtration of podocytes were examined by Transwell filters. The protein and mRNA levels of MCP-1 were measured using enzyme-linked immunosorbent assay (ELISA) and quantitative real-time PCR (q-PCR). Protein expression and phosphorylation were detected by western blot, and the nuclear translocation of NF-κB was performed with a confocal microscope. The gene expression of the receptor activator for NF-κB (RANK) was silenced by small interfering RNA (siRNA). Our results showed that HG enhanced migration, albumin filtration and MCP-1 expression in podocytes. At the molecular level, HG promoted the phosphorylation of NF-κB/p65, IKKβ, IκBα, mitogen-activated protein kinase (MAPK) and the nuclear translocation of p65. LJ reversed the effects of HG in a dose-dependent manner. Furthermore, our data provided the first demonstration that the receptor activator for NF-κB ligand (RANKL) and its cognate receptor RANK were overexpressed in HG-induced podocytes and were downregulated by LJ. RANK siRNA also attenuated HG-induced podocyte injury and markedly inhibited the activation of NF-κB and MAPK signaling pathways. LJ attenuates HG-induced podocyte injury by suppressing RANKL/RANK-mediated NF-κB and MAPK signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

Immunostaining for peroxisome proliferator gamma distinguishes dedifferentiated liposarcoma from other retroperitoneal sarcomas.

PubMed

Horvai, Andrew E; Schaefer, Jochen T; Nakakura, Eric K; O'Donnell, Richard J

2008-05-01

Dedifferentiated liposarcoma can be readily diagnosed by the juxtaposition of a well-differentiated liposarcoma to a nonlipogenic sarcoma. However, if the lipogenic component is not abundant due to surgical sampling or small biopsy, dedifferentiated liposarcoma can be difficult to distinguish from other poorly different sarcomas. Peroxisome proliferator-activated receptor gamma (PPAR-gamma) is a nuclear hormone receptor that plays a critical role in adipocyte differentiation. Prior studies have not only demonstrated PPAR-gamma mRNA in various subtypes of liposarcoma but have also shown that adipocyte differentiation can be induced in some liposarcomas by a PPAR-gamma agonist. In the present study, we investigated whether immunostaining for PPAR-gamma can be used to distinguish dedifferentiated liposarcoma from other retroperitoneal sarcomas. We examined a series of 40 dedifferentiated liposarcoma and compared the staining for PPAR-gamma to a series of 24 retroperitoneal sarcomas that lacked lipogenic differentiation. A monoclonal antibody against PPAR-gamma was used to stain formalin-fixed paraffin-embedded tissue. Specific nuclear immunostaining was present in 37/40 (93%) of the dedifferentiated liposarcoma and 6/24 (25%) of the other sarcomas (two leiomyosarcomas and four undifferentiated sarcomas). Interestingly, immunostaining for CDK4 and/or MDM2 was identified in three of the four PPAR-gamma-positive undifferentiated sarcomas, raising the possibility that these may represent dedifferentiated liposarcoma. This is the first study demonstrating the utility of PPAR-gamma immunohistochemistry in the diagnosis of dedifferentiated liposarcoma in tissue sections. Although not completely specific, the presence of PPAR-gamma staining, in combination with histologic findings and other markers, can aid in the diagnosis of dedifferentiated liposarcoma, particularly on small biopsies that may not sample the well-differentiated component.

Reproductive factors, hormone use, estrogen receptor expression and risk of non small-cell lung cancer in women.

PubMed

Schwartz, Ann G; Wenzlaff, Angela S; Prysak, Geoffrey M; Murphy, Valerie; Cote, Michele L; Brooks, Sam C; Skafar, Debra F; Lonardo, Fulvio

2007-12-20

Estrogen receptor (ER) expression in lung tumors suggests that estrogens may play a role in the development of lung cancer. We evaluated the role of hormone-related factors in determining risk of non-small-cell lung cancer (NSCLC) in women. We also evaluated whether risk factors were differentially associated with cytoplasmic ER-alpha and/or nuclear ER-beta expression-defined NSCLC in postmenopausal women. Population-based participants included women aged 18 to 74 years diagnosed with NSCLC in metropolitan Detroit between November 1, 2001 and October 31, 2005. Population-based controls were identified through random digit dialing, matched to patient cases on race and 5-year age group. Interview data were analyzed for 488 patient cases (241 with tumor ER results) and 498 controls. Increased duration of hormone replacement therapy (HRT) use in quartiles was associated with decreased risk of NSCLC in postmenopausal women (odds ratio = 0.88; 95% CI, 0.78 to 1.00; P = .04), adjusting for age, race, pack-years, education, family history of lung cancer, current body mass index, years exposed to second-hand smoke in the workplace, and obstructive lung disease history. Among postmenopausal women, ever using HRT, increasing HRT duration of use in quartiles, and increasing quartiles of estrogen use were significant predictors of reduced risk of NSCLC characterized as ER-alpha and/or ER-beta positive. None of the hormone-related variables were associated with nuclear ER-alpha- or ER-beta-negative NSCLC. These findings suggest that postmenopausal hormone exposures are associated with reduced risk of ER-alpha- and ER-beta-expressing NSCLC. Understanding tumor characteristics may direct development of targeted treatment for this disease.

Metformin ameliorates IL-6-induced hepatic insulin resistance via induction of orphan nuclear receptor small heterodimer partner (SHP) in mouse models.

PubMed

Kim, Y D; Kim, Y H; Cho, Y M; Kim, D K; Ahn, S W; Lee, J M; Chanda, D; Shong, M; Lee, C H; Choi, H S

2012-05-01

IL-6 is a proinflammatory cytokine associated with the pathogenesis of hepatic diseases. Metformin is an anti-diabetic drug used for the treatment of type 2 diabetes, and orphan nuclear receptor small heterodimer partner (SHP, also known as NR0B2), a transcriptional co-repressor, plays an important role in maintaining metabolic homeostasis. Here, we demonstrate that metformin-mediated activation of AMP-activated protein kinase (AMPK) increases SHP protein production and regulates IL-6-induced hepatic insulin resistance. We investigated metformin-mediated SHP production improved insulin resistance through the regulation of an IL-6-dependent pathway (involving signal transducer and activator of transcription 3 [STAT3] and suppressor of cytokine signalling 3 [SOCS3]) in both Shp knockdown and Shp null mice. IL-6-induced STAT3 transactivation and SOCS3 production were significantly repressed by metformin, adenoviral constitutively active AMPK (Ad-CA-AMPK), and adenoviral SHP (Ad-SHP), but not in Shp knockdown, or with the adenoviral dominant negative form of AMPK (Ad-DN-AMPK). Chromatin immunoprecipitation (ChIP), co-immunoprecipitation (Co-IP) and protein localisation studies showed that SHP inhibits DNA binding of STAT3 on the Socs3 gene promoter via interaction and colocalisation within the nucleus. Upregulation of inflammatory genes and downregulation of hepatic insulin signalling by acute IL-6 treatment were observed in wild-type mice but not in Shp null mice. Finally, chronic IL-6 exposure caused hepatic insulin resistance, leading to impaired insulin tolerance and elevated gluconeogenesis, and these phenomena were aggravated in Shp null mice. Our results demonstrate that SHP upregulation by metformin may prevent hepatic disorders by regulating the IL-6-dependent pathway, and that this pathway can help to ameliorate the pathogenesis of cytokine-mediated metabolic dysfunction.

Orphan Nuclear Receptor Small Heterodimer Partner Negatively Regulates Growth Hormone-mediated Induction of Hepatic Gluconeogenesis through Inhibition of Signal Transducer and Activator of Transcription 5 (STAT5) Transactivation*

PubMed Central

Kim, Yong Deuk; Li, Tiangang; Ahn, Seung-Won; Kim, Don-Kyu; Lee, Ji-Min; Hwang, Seung-Lark; Kim, Yong-Hoon; Lee, Chul-Ho; Lee, In-Kyu; Chiang, John Y. L.; Choi, Hueng-Sik

2012-01-01

Growth hormone (GH) is a key metabolic regulator mediating glucose and lipid metabolism. Ataxia telangiectasia mutated (ATM) is a member of the phosphatidylinositol 3-kinase superfamily and regulates cell cycle progression. The orphan nuclear receptor small heterodimer partner (SHP: NR0B2) plays a pivotal role in regulating metabolic processes. Here, we studied the role of ATM on GH-dependent regulation of hepatic gluconeogenesis in the liver. GH induced phosphoenolpyruvate carboxykinase (PEPCK) and glucose 6-phosphatase gene expression in primary hepatocytes. GH treatment and adenovirus-mediated STAT5 overexpression in hepatocytes increased glucose production, which was blocked by a JAK2 inhibitor, AG490, dominant negative STAT5, and STAT5 knockdown. We identified a STAT5 binding site on the PEPCK gene promoter using reporter assays and point mutation analysis. Up-regulation of SHP by metformin-mediated activation of the ATM-AMP-activated protein kinase pathway led to inhibition of GH-mediated induction of hepatic gluconeogenesis, which was abolished by an ATM inhibitor, KU-55933. Immunoprecipitation studies showed that SHP physically interacted with STAT5 and inhibited STAT5 recruitment on the PEPCK gene promoter. GH-induced hepatic gluconeogenesis was decreased by either metformin or Ad-SHP, whereas the inhibition by metformin was abolished by SHP knockdown. Finally, the increase of hepatic gluconeogenesis following GH treatment was significantly higher in the liver of SHP null mice compared with that of wild-type mice. Overall, our results suggest that the ATM-AMP-activated protein kinase-SHP network, as a novel mechanism for regulating hepatic glucose homeostasis via a GH-dependent pathway, may be a potential therapeutic target for insulin resistance. PMID:22977252

DNA Methylation in the Neuropeptide S Receptor 1 (NPSR1) Promoter in Relation to Asthma and Environmental Factors

PubMed Central

Reinius, Lovisa E.; Gref, Anna; Sääf, Annika; Acevedo, Nathalie; Joerink, Maaike; Kupczyk, Maciej; D'Amato, Mauro; Bergström, Anna; Melén, Erik; Scheynius, Annika; Dahlén, Sven-Erik; Pershagen, Göran; Söderhäll, Cilla; Kere, Juha

2013-01-01

Asthma and allergy are complex disorders influenced by both inheritance and environment, a relationship that might be further clarified by epigenetics. Neuropeptide S Receptor 1 (NPSR1) has been associated with asthma and allergy and a study suggested modulation of the genetic risk by environmental factors. We aimed to study DNA methylation in the promoter region of NPSR1 in relation to asthma and environmental exposures. Electrophoretic Mobility Shift Assay (EMSA) was used to investigate potential functional roles of both genotypes and methylation status in the NPSR1 promoter. DNA methylation was analysed using EpiTYPER in blood samples from two well-characterized cohorts; the BIOAIR study of severe asthma in adults and the Swedish birth cohort BAMSE. We observed that DNA methylation and genetic variants in the promoter influenced the binding of nuclear proteins to DNA, suggesting functional relevance. Significant, although small, differences in methylation were related to both adult severe asthma (p = 0.0001) and childhood allergic asthma (p = 0.01). Furthermore, DNA methylation was associated with exposures such as current smoking in adults for two CpG sites (p = 0.005 and 0.04), parental smoking during infancy in the children (p = 0.02) and in which month the sample was taken (p = 0.01). In summary, DNA methylation levels in the promoter of NPSR1 showed small but significant associations with asthma, both in adults and in children, and to related traits such as allergy and certain environmental exposures. Both genetic variation and the methylated state of CpG sites seem to have an effect on the binding of nuclear proteins in the regulatory region of NPSR1 suggesting complex regulation of this gene in asthma and allergy. PMID:23372674

Nuclear Transcription Factors in the Mitochondria: A New Paradigm in Fine-Tuning Mitochondrial Metabolism.

PubMed

Sepuri, Naresh Babu V; Tammineni, Prasad; Mohammed, Fareed; Paripati, Arunkumar

2017-01-01

Noncanonical functions of several nuclear transcription factors in the mitochondria have been gaining exceptional traction over the years. These transcription factors include nuclear hormone receptors like estrogen, glucocorticoid, and thyroid hormone receptors: p53, IRF3, STAT3, STAT5, CREB, NF-kB, and MEF-2D. Mitochondria-localized nuclear transcription factors regulate mitochondrial processes like apoptosis, respiration and mitochondrial transcription albeit being nuclear in origin and having nuclear functions. Hence, the cell permits these multi-stationed transcription factors to orchestrate and fine-tune cellular metabolism at various levels of operation. Despite their ubiquitous distribution in different subcompartments of mitochondria, their targeting mechanism is poorly understood. Here, we review the current status of mitochondria-localized transcription factors and discuss the possible targeting mechanism besides the functional interplay between these factors.

Development of an image analysis screen for estrogen receptor alpha (ERα) ligands through measurement of nuclear translocation dynamics.

PubMed

Dull, Angie; Goncharova, Ekaterina; Hager, Gordon; McMahon, James B

2010-11-01

We have developed a robust high-content assay to screen for novel estrogen receptor alpha (ERα) agonists and antagonists by quantitation of cytoplasmic to nuclear translocation of an estrogen receptor chimera in 384-well plates. The screen utilizes a green fluorescent protein tagged-glucocorticoid/estrogen receptor (GFP-GRER) chimera which consisted of the N-terminus of the glucocorticoid receptor fused to the human ER ligand binding domain. The GFP-GRER exhibited cytoplasmic localization in the absence of ERα ligands, and translocated to the nucleus in response to stimulation with ERα agonists or antagonists. The BD Pathway 435 imaging system was used for image acquisition, analysis of translocation dynamics, and cytotoxicity measurements. The assay was validated with known ERα agonists and antagonists, and the Library of Pharmacologically Active Compounds (LOPAC 1280). Additionally, screening of crude natural product extracts demonstrated the robustness of the assay, and the ability to quantitate the effects of toxicity on nuclear translocation dynamics. The GFP-GRER nuclear translocation assay was very robust, with z' values >0.7, CVs <5%, and has been validated with known ER ligands, and inclusion of cytotoxicity filters will facilitate screening of natural product extracts. This assay has been developed for future primary screening of synthetic, pure natural products, and natural product extracts libraries available at the National Cancer Institute at Frederick. Copyright © 2010 Elsevier Ltd. All rights reserved.

Estrogen-related receptor alpha is critical for the growth of estrogen receptor-negative breast cancer

PubMed Central

Stein, Rebecca A.; Chang, Ching-yi; Kazmin, Dmitri A.; Way, James; Schroeder, Thies; Wergin, Melanie; Dewhirst, Mark W.; McDonnell, Donald P.

2009-01-01

Expression of estrogen-related receptor alpha (ERRα) has recently been shown to carry negative prognostic significance in breast and ovarian cancers. The specific role of this orphan nuclear receptor in tumor growth and progression, however, is yet to be fully understood. The significant homology between estrogen receptor alpha (ERα) and ERRα initially suggested that these receptors may have similar transcriptional targets. Using the well-characterized ERα-positive MCF-7 breast cancer cell line, we sought to gain a genome-wide picture of ERα-ERRα cross-talk using an unbiased microarray approach. In addition to generating a host of novel ERRα target genes, this study yielded the surprising result that most ERRα-regulated genes are unrelated to estrogen-signaling. The relatively small number of genes regulated by both ERα and ERRα led us to expand our study to the more aggressive and less clinically treatable ERα-negative class of breast cancers. In this setting we found that ERRα expression is required for the basal level of expression of many known and novel ERRα target genes. Introduction of an siRNA directed to ERRα into the highly aggressive breast carcinoma MDA-MB-231 cell line dramatically reduced the migratory potential of these cells. Although stable knockdown of ERRα expression in MDA-MB-231 cells had no impact on in vitro cell proliferation, a significant reduction of tumor growth rate was observed when these cells were implanted as xenografts. Our results confirm a role for ERRα in breast cancer growth and highlight it as a potential therapeutic target for estrogen receptor-negative breast cancer. PMID:18974123

Retinoic Acid Inducible Gene 1 Protein (RIG1)-like Receptor Pathway is Required for Efficient Nuclear Reprogramming

PubMed Central

Sayed, Nazish; Ospino, Frank; Himmati, Farhan; Lee, Jieun; Chanda, Palas; Mocarski, Edward S.; Cooke, John P.

2017-01-01

We have revealed a critical role for innate immune signaling in nuclear reprogramming to pluripotency, and in the nuclear reprogramming required for somatic cell transdifferentiation. Activation of innate immune signaling causes global changes in the expression and activity of epigenetic modifiers to promote epigenetic plasticity. In our previous papers, we focused on the role of toll-like receptor 3 (TLR3) in this signaling pathway. Here we define the role of another innate immunity pathway known to participate in the response to viral RNA, the retinoic acid-inducible gene 1 receptor (RIG-1)-like receptor (RLR) pathway. This pathway is represented by the sensors of viral RNA, RIG-1, LGP2 and MDA5. We first found that TLR3 deficiency only causes a partial inhibition of nuclear reprogramming to pluripotency in mouse tail-tip fibroblasts, which motivated us to determine the contribution of RLR. We found that knockdown of iPS-1, the common adaptor protein for the RLR family, substantially reduced nuclear reprogramming induced by retroviral or by mmRNA expression of Oct 4, Sox2, KLF4 and cMYC (OSKM). Importantly a double knockdown of both RLR and TLR3 pathway led to a further decrease in iPSC colonies suggesting an additive effect of both these pathways on nuclear reprogramming. Furthermore, in murine embryonic fibroblasts expressing a dox-inducible cassette of the genes encoding OSKM, an RLR agonist increased the yield of iPSCs. Similarly, the RLR agonist enhanced nuclear reprogramming by cell permeant peptides of the Yamanaka factors. Finally, in the dox-inducible system, RLR activation promotes activating histone marks in the promoter region of pluripotency genes. To conclude, innate immune signaling mediated by RLR plays a critical role in nuclear reprogramming. Manipulation of innate immune signaling may facilitate nuclear reprogramming to achieve pluripotency. PMID:28276156

Identification of DNA-PKcs as a primary resistance factor of TIC10 in hepatocellular carcinoma cells.

PubMed

Cheng, Long; Liu, Yuan-Yuan; Lu, Pei-Hua; Peng, Yi; Yuan, Qiang; Gu, Xin-Shi; Jin, Yong; Chen, Min-Bin; Bai, Xu-Ming

2017-04-25

The current study tested the anti-hepatocellular carcinoma (HCC) cell activity of TIC10, a first-in-class small-molecule tumor necrosis (TNF)-related apoptosis-inducing ligand (TRAIL) inducer. TIC10 exerted potent anti-proliferative and pro-apoptotic actions in primary and established human HCC cells. TIC10 blocked Akt-Erk activation, leading to Foxo3a nuclear translocation, as well as TRAIL and death receptor-5 (DR5) transcription in HCC cells. We propose that DNA-PKcs is a major resistance factor of TIC10 possibly via inhibiting Foxo3a nuclear translocation. DNA-PKcs inhibition, knockdown or mutation facilitated TIC10-induced Foxo3a nuclear translocation, TRAIL/DR5 expression and cell apoptosis. Reversely, exogenous DNA-PKcs over-expression inhibited above actions by TIC10. In vivo, oral administration of TIC10 significantly inhibited HepG2 tumor growth in nude mice, which was further potentiated with Nu7026 co-administration. Thus, TIC10 shows promising anti-HCC activity, alone or together with DNA-PKcs inhibitors.

Exploration of the conformational landscape in pregnane X receptor reveals a new binding pocket

PubMed Central

Chandran, Aneesh

2016-01-01

Abstract Ligand‐regulated pregnane X receptor (PXR), a member of the nuclear receptor superfamily, plays a central role in xenobiotic metabolism. Despite its critical role in drug metabolism, PXR activation can lead to adverse drug‐drug interactions and early stage metabolism of drugs. Activated PXR can induce cancer drug resistance and enhance the onset of malignancy. Since promiscuity in ligand binding makes it difficult to develop competitive inhibitors targeting PXR ligand binding pocket (LBP), it is essential to identify allosteric sites for effective PXR antagonism. Here, molecular dynamics (MD) simulation studies unravelled the existence of two different conformational states, namely “expanded” and “contracted”, in apo PXR ligand binding domain (LBD). Ligand binding events shifted this conformational equilibrium and locked the LBD in a single “ligand‐adaptable” conformational state. Ensemble‐based computational solvent mapping identified a transiently open potential small molecule binding pocket between α5 and α8 helices, named “α8 pocket”, whose opening‐closing mechanism directly correlated with the conformational shift in LBD. A virtual hit identified through structure‐based virtual screening against α8 pocket locks the pocket in its open conformation. MD simulations further revealed that the presence of small molecule at allosteric site disrupts the LBD dynamics and locks the LBD in a “tightly‐contracted” conformation. The molecular details provided here could guide new structural studies to understand PXR activation and antagonism. PMID:27515410

G-Protein-Coupled Estrogen Receptor Antagonist G15 Decreases Estrogen-Induced Development of Non-Small Cell Lung Cancer.

PubMed

Liu, Changyu; Liao, Yongde; Fan, Sheng; Fu, Xiangning; Xiong, Jing; Zhou, Sheng; Zou, Man; Wang, Jianmiao

2017-08-25

G-protein-coupled estrogen receptor (GPER) was found to promote Non-small cell lung cancer (NSCLC) by estrogen, indicating the potential necessity of inhibiting GPER by selective antagonist. This study was performed to elucidate the function of GPER selective inhibitor G15 in NSCLC development. Cytoplasmic GPER (cGPER) and nuclear GPER (nGPER) were detected by immunohistochemical analysis in NSCLC samples. The relation of GPER and estrogen receptor β (ERβ) expression and correlation between GPER, ERβ and clinical factors were analyzed. The effects of activating GPER and function of G15 were analyzed in proliferation of A549, H1793 cell lines and development of urethane-induced adenocarcinoma. Overexpression of cGPER and nGPER was detected in 80.49% (120/150) and 52.00% (78/150) of the NSCLC samples. High expression of GPER related with higher stages, poorer differentiation and high expression of ERβ. Protein level of GPER in A549 and H1793 cell lines increased by treatment of E2, G1 (GPER agonist) or Ful (fulvestrant, ERβ antagonist), and decreased by G15. Administration with G15 reversed the E2- or G1-induced cell growth by inhibiting GPER. In urethane-induced adenocarcinoma mice, number of tumor nodules and tumor index increased in E2 or G1 group and decreased by treatment of G15. These findings deomonstrate that using of G15 to block GPER signaling may be considered as a new therapeutic target in NSCLC.

DEPENDENCE OF PPAR LIGAND-INDUCED MAPK SIGNALING ON EPIDERMAL GROWTH FACTOR RECEPTOR TRANSACTIVATION HEPARIN-BINDING EGF CLEAVAGE MEDIATES ZINC-INDUCED EGF RECEPTOR PHOSPHORYLATION

EPA Science Inventory

Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that function as ligand-activated transcription factors regulating lipid metabolism and homeostasis. In addition to their ability to regulate PPAR-mediated gene transcription, PPARalpha and gamma li...

Review of the expression of Peroxisome Proliferator Activated Receptors alpha (PPARα), beta (PPAR β), and gamma (PPAR() in rodent and human development.

EPA Science Inventory

The peroxisome proliferator-activated receptors (PPAR) belong to the nuclear hormone receptor superfamily and there are three primary isotypes, PPARα, β, and (. These receptors regulate important physiological processes that impact lipid homeostasis, inflammation, adipogenesis, r...

Mode of action framework analysis for receptor-mediated toxicity: the Peroxisome Proliferator-Activated Receptor alpha (PPARα) as a case study

EPA Science Inventory

Therapeutic hypolipidemic agents and industrial chemicals that cause peroxisome proliferation and induce liver tumors in rodents activate the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARα). Research has elucidated the cellular and molecular events by w...

The RanGTP Pathway: From Nucleo-Cytoplasmic Transport to Spindle Assembly and Beyond

PubMed Central

Cavazza, Tommaso; Vernos, Isabelle

2016-01-01

The small GTPase Ran regulates the interaction of transport receptors with a number of cellular cargo proteins. The high affinity binding of the GTP-bound form of Ran to import receptors promotes cargo release, whereas its binding to export receptors stabilizes their interaction with the cargo. This basic mechanism linked to the asymmetric distribution of the two nucleotide-bound forms of Ran between the nucleus and the cytoplasm generates a switch like mechanism controlling nucleo-cytoplasmic transport. Since 1999, we have known that after nuclear envelope breakdown (NEBD) Ran and the above transport receptors also provide a local control over the activity of factors driving spindle assembly and regulating other aspects of cell division. The identification and functional characterization of RanGTP mitotic targets is providing novel insights into mechanisms essential for cell division. Here we review our current knowledge on the RanGTP system and its regulation and we focus on the recent advances made through the characterization of its mitotic targets. We then briefly review the novel functions of the pathway that were recently described. Altogether, the RanGTP system has moonlighting functions exerting a spatial control over protein interactions that drive specific functions depending on the cellular context. PMID:26793706

Enhanced thyroid hormone breakdown in hepatocytes by mutual induction of the constitutive androstane receptor (CAR, NR1I3) and arylhydrocarbon receptor by benzo[a]pyrene and phenobarbital.

PubMed

Schraplau, Anne; Schewe, Bettina; Neuschäfer-Rube, Frank; Ringel, Sebastian; Neuber, Corinna; Kleuser, Burkhard; Püschel, Gerhard P

2015-02-03

Xenobiotics may interfere with the hypothalamic-pituitary-thyroid endocrine axis by inducing enzymes that inactivate thyroid hormones and thereby reduce the metabolic rate. This induction results from an activation of xeno-sensing nuclear receptors. The current study shows that benzo[a]pyrene, a frequent contaminant of processed food and activator of the arylhydrocarbon receptor (AhR) activated the promoter and induced the transcription of the nuclear receptor constitutive androstane receptor (CAR, NR1I3) in rat hepatocytes. Likewise, phenobarbital induced the AhR transcription. This mutual induction of the nuclear receptors enhanced the phenobarbital-dependent induction of the prototypic CAR target gene Cyp2b1 as well as the AhR-dependent induction of UDP-glucuronosyltransferases. In both cases, the induction by the combination of both xenobiotics was more than the sum of the induction by either substance alone. By inducing the AhR, phenobarbital enhanced the benzo[a]pyrene-dependent reduction of thyroid hormone half-life and the benzo[a]pyrene-dependent increase in the rate of thyroid hormone glucuronide formation in hepatocyte cultures. CAR ligands might thus augment the endocrine disrupting potential of AhR activators by an induction of the AhR. Copyright © 2014. Published by Elsevier Ireland Ltd.

RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators

PubMed Central

Redfern, Andrew D.; Colley, Shane M.; Beveridge, Dianne J.; Ikeda, Naoya; Epis, Michael R.; Li, Xia; Foulds, Charles E.; Stuart, Lisa M.; Barker, Andrew; Russell, Victoria J.; Ramsay, Kerry; Kobelke, Simon J.; Li, Xiaotao; Hatchell, Esme C.; Payne, Christine; Giles, Keith M.; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B.; O’Malley, Bert W.; Leedman, Peter J.

2013-01-01

The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing. PMID:23550157

RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

PubMed

Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

2013-04-16

The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

p35 Regulates the CRM1-Dependent Nucleocytoplasmic Shuttling of Nuclear Hormone Receptor Coregulator-Interacting Factor 1 (NIF-1)

PubMed Central

Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W. Y.; Li, Zhen; Fu, Amy K. Y.; Ip, Nancy Y.

2014-01-01

Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators. PMID:25329792

p35 regulates the CRM1-dependent nucleocytoplasmic shuttling of nuclear hormone receptor coregulator-interacting factor 1 (NIF-1).

PubMed

Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W Y; Li, Zhen; Fu, Amy K Y; Ip, Nancy Y

2014-01-01

Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators.

Nuclear Import and Export of the Thyroid Hormone Receptor.

PubMed

Zhang, Jibo; Roggero, Vincent R; Allison, Lizabeth A

2018-01-01

The thyroid hormone receptors, TRα1 and TRβ1, are members of the nuclear receptor superfamily that forms one of the most abundant classes of transcription factors in multicellular organisms. Although primarily localized to the nucleus, TRα1 and TRβ1 shuttle rapidly between the nucleus and cytoplasm. The fine balance between nuclear import and export of TRs has emerged as a critical control point for modulating thyroid hormone-responsive gene expression. Mutagenesis studies have defined two nuclear localization signal (NLS) motifs that direct nuclear import of TRα1: NLS-1 in the hinge domain and NLS-2 in the N-terminal A/B domain. Three nuclear export signal (NES) motifs reside in the ligand-binding domain. A combined approach of shRNA-mediated knockdown and coimmunoprecipitation assays revealed that nuclear entry of TRα1 is facilitated by importin 7, likely through interactions with NLS-2, and importin β1 and the adapter importin α1 interacting with both NLS-1 and NLS-2. Interestingly, TRβ1 lacks NLS-2 and nuclear import depends solely on the importin α1/β1 heterodimer. Heterokaryon and fluorescence recovery after photobleaching shuttling assays identified multiple exportins that play a role in nuclear export of TRα1, including CRM1 (exportin 1), and exportins 4, 5, and 7. Even single amino acid changes in TRs dramatically alter their intracellular distribution patterns. We conclude that mutations within NLS and NES motifs affect nuclear shuttling activity, and propose that TR mislocalization contributes to the development of some types of cancer and Resistance to Thyroid Hormone syndrome. © 2018 Elsevier Inc. All rights reserved.

Mapping the nuclear localization signal in the matrix protein of potato yellow dwarf virus.

PubMed

Anderson, Gavin; Jang, Chanyong; Wang, Renyuan; Goodin, Michael

2018-05-01

The ability of the matrix (M) protein of potato yellow dwarf virus (PYDV) to remodel nuclear membranes is controlled by a di-leucine motif located at residues 223 and 224 of its primary structure. This function can be uncoupled from that of its nuclear localization signal (NLS), which is controlled primarily by lysine and arginine residues immediately downstream of the LL motif. In planta localization of green fluorescent protein fusions, bimolecular fluorescence complementation assays with nuclear import receptor importin-α1 and yeast-based nuclear import assays provided three independent experimental approaches to validate the authenticity of the M-NLS. The carboxy terminus of M is predicted to contain a nuclear export signal, which is belived to be functional, given the ability of M to bind the Arabidopsis nuclear export receptor 1 (XPO1). The nuclear shuttle activity of M has implications for the cell-to-cell movement of PYDV nucleocapsids, based upon its interaction with the N and Y proteins.

Dose-response approaches for nuclear receptor-mediated ...

EPA Pesticide Factsheets

A public workshop, organized by a Steering Committee of scientists from government, industry, universities, and research organizations, was held at the National Institute of Environmental Health Sciences (NIEHS) in September, 2010. The workshop explored the dose-response implications of toxicant modes of action (MOA) mediated by nuclear receptors. The dominant paradigm in human health risk assessment has been linear extrapolation without a threshold for cancer, and estimation of sub-threshold doses for non-cancer and (in appropriate cases) cancer endpoints. However, recent publications question the application of dose-response modeling approaches with a threshold. The growing body of molecular toxicology information and computational toxicology tools has allowed for exploration of the presence or absence of subthreshold doses for a number of receptor-mediated MOPs. The workshop explored the development of dose-response approaches for nuclear receptor-mediated liver cancer, within a MOA Human Relevance framework (HRF). Case studies addressed activation of the AHR; the CAR/PXR, and the PPARa. This paper describes the workshop process, key issues discussed, and conclusions. The value of an interactive workshop approach to apply current MOA/HRF frameworks was demonstrated. The results may help direct research on the MOA and dose-response of receptor-based toxicity, since there are commonalities for many receptors in the basic pathways involved for late steps in the

Crosstalk between ERK2 and RXR regulates nuclear import of transcription factor NGFI-B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jacobs, Chris M.; Paulsen, Ragnhild E.

2005-10-21

Transcription factor NGFI-B initiates apoptosis when allowed to translocate to mitochondria. Retinoid-X receptor (RXR), another member of the nuclear receptor family, regulates NGFI-B signaling through heterodimerization and nuclear export. Growth factor EGF activates ERK2, which phosphorylates NGFI-B and determines if NGFI-B is allowed to translocate to mitochondria. In the present study, EGF treatment resulted in an increased nuclear import of NGFI-B. Likewise, active ERK2 resulted in a preferential nuclear localization of NGFI-B. When coexpressed with RXR the nuclear import and nuclear localization induced by active ERK2 were strongly reduced. In the presence of its ligand 9-cis-retinoic acid, RXR no longermore » inhibited ERK2-induced nuclear import. Thus, RXR serves a permissive role for ERK2-mediated nuclear accumulation of NGFI-B. This finding represents a novel crosstalk between ERK2 and RXR signaling pathways, and explains how two independent inhibitors of apoptosis (EGF and 9-cis-retinoic acid) may cooperate to regulate nuclear targeting of apoptosis inducer NGFI-B.« less

Human peroxisome proliferator-activated receptor mRNA and protein expression during development

EPA Science Inventory

The peroxisome proliferator-activated receptors (PPAR) are nuclear hormone receptors that regulate lipid and glucose homeostasis and are important in reproduction and development. PPARs are targets ofpharmaceuticals and are also activated by environmental contaminants, including ...

Toll-like receptor 4 promotes proliferation and apoptosis resistance in human papillomavirus-related cervical cancer cells through the Toll-like receptor 4/nuclear factor-κB pathway.

PubMed

Jiang, Ninghong; Xie, Feng; Guo, Qisang; Li, Ming-Qing; Xiao, Jingjing; Sui, Long

2017-06-01

Toll-like receptor 4 is overexpressed in various tumors, including cervical carcinoma. However, the role of Toll-like receptor 4 in cervical cancer remains controversial, and the underlying mechanisms are largely elusive. Therefore, Toll-like receptor 4 in cervical cancer and related mechanisms were investigated in this study. Quantitative reverse transcription polymerase chain reaction and western blot analyses were used to detect messenger RNA and protein levels in HeLa, Caski, and C33A cells with different treatments. Proliferation was quantified using Cell Counting Kit-8. Cell cycle distribution and apoptosis were assessed by flow cytometry. Higher levels of Toll-like receptor 4 expression were found in human papillomavirus-positive cells compared to human papillomavirus-negative cells. Proliferation of HeLa and Caski cells was promoted in lipopolysaccharide-stimulated groups but suppressed in short hairpin RNA-transfected groups. Apoptosis rates were lower in lipopolysaccharide-stimulated groups relative to short hairpin RNA-transfected groups. In addition, G2-phase distribution was enhanced when Toll-like receptor 4 was downregulated. Moreover, the pNF-κBp65 level was positively correlated with the Toll-like receptor 4 level in HeLa and Caski cells, though when an nuclear factor-κB inhibitor was applied to lipopolysaccharide-stimulated groups, the patterns of proliferation and apoptosis were opposite to those of the lipopolysaccharide-stimulated groups without inhibitor treatment. In conclusion, these data suggest that Toll-like receptor 4 promotes proliferation and apoptosis resistance in human papillomavirus-related cervical cancer cells at least in part through the Toll-like receptor 4/nuclear factor-κB pathway, which may be correlated with the occurrence and development of cervical carcinoma.

The pure estrogen receptor antagonist ICI 182,780 promotes a novel interaction of estrogen receptor-alpha with the 3',5'-cyclic adenosine monophosphate response element-binding protein-binding protein/p300 coactivators.

PubMed

Jaber, Basem M; Gao, Tong; Huang, Luping; Karmakar, Sudipan; Smith, Carolyn L

2006-11-01

Estrogen receptor-alpha (ERalpha) is a member of the nuclear receptor superfamily of ligand-activated transcription factors. Abundant evidence demonstrates that ERalpha agonists promote, whereas antagonists inhibit, receptor binding to coactivators. In this report we demonstrate that binding of the ICI 182,780 (ICI) pure antiestrogen to ERalpha promotes its interaction with the cAMP response element-binding protein-binding protein (CBP)/p300 but not the p160 family of coactivators, demonstrating the specificity of this interaction. Amino acid mutations within the coactivator binding surface of the ERalpha ligand-binding domain revealed that CBP binds to this region of the ICI-liganded receptor. The carboxy-terminal cysteine-histidine rich domain 3 of CBP, rather than its amino-terminal nuclear interacting domain, shown previously to mediate agonist-dependent interactions of CBP with nuclear receptors, is required for binding to ICI-liganded ERalpha. Chromatin immunoprecipitation assays revealed that ICI but not the partial agonist/antagonist 4-hydroxytamoxifen is able to recruit CBP to the pS2 promoter, and this distinguishes ICI from this class of antiestrogens. Chromatin immunoprecipitation assays for pS2 and cytochrome P450 1B1 promoter regions revealed that ICI-dependent recruitment of CBP, but not receptor, to ERalpha targets is gene specific. ICI treatment did not recruit the steroid receptor coactivator 1 to the pS2 promoter, and it failed to induce the expression of this gene. Taken together, these data indicate that recruitment of the CBP coactivator/cointegrator without steroid receptor coactivator 1 to ERalpha is insufficient to promote transcription of ERalpha target genes.

Identification of Novel Small Molecule Activators of Nuclear Factor-κB With Neuroprotective Action Via High-Throughput Screening

PubMed Central

Manuvakhova, Marina S.; Johnson, Guyla G.; White, Misti C.; Ananthan, Subramaniam; Sosa, Melinda; Maddox, Clinton; McKellip, Sara; Rasmussen, Lynn; Wennerberg, Krister; Hobrath, Judith V.; White, E. Lucile; Maddry, Joseph A.; Grimaldi, Maurizio

2012-01-01

Neuronal noncytokine-dependent p50/p65 nuclear factor-κB (the primary NF-κB complex in the brain) activation has been shown to exert neuroprotective actions. Thus neuronal activation of NF-κB could represent a viable neuroprotective target. We have developed a cell-based assay able to detect NF-κB expression enhancement, and through its use we have identified small molecules able to up-regulate NF-κB expression and hence trigger its activation in neurons. We have successfully screened approximately 300,000 compounds and identified 1,647 active compounds. Cluster analysis of the structures within the hit population yielded 14 enriched chemical scaffolds. One high-potency and chemically attractive representative of each of these 14 scaffolds and four singleton structures were selected for follow-up. The experiments described here highlighted that seven compounds caused noncanonical long-lasting NF-κB activation in primary astrocytes. Molecular NF-κB docking experiments indicate that compounds could be modulating NF-κB-induced NF-κB expression via enhancement of NF-κB binding to its own promoter. Prototype compounds increased p65 expression in neurons and caused its nuclear translocation without affecting the inhibitor of NF-κB (I-κB). One of the prototypical compounds caused a large reduction of glutamate-induced neuronal death. In conclusion, we have provided evidence that we can use small molecules to activate p65 NF-κB expression in neurons in a cytokine receptor-independent manner, which results in both long-lasting p65 NF-κB translocation/activation and decreased glutamate neurotoxicity. PMID:21046675

Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts

EPA Science Inventory

Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts Katie B. Paul 1.2, Ruth Marfil-Vega 1 Marc A. Mills3, Steve 0. Simmons2, Vickie S. Wilson4, Kevin M. Crofton2 10ak Rid...

rigor mortis encodes a novel nuclear receptor interacting protein required for ecdysone signaling during Drosophila larval development.

PubMed

Gates, Julie; Lam, Geanette; Ortiz, José A; Losson, Régine; Thummel, Carl S

2004-01-01

Pulses of the steroid hormone ecdysone trigger the major developmental transitions in Drosophila, including molting and puparium formation. The ecdysone signal is transduced by the EcR/USP nuclear receptor heterodimer that binds to specific response elements in the genome and directly regulates target gene transcription. We describe a novel nuclear receptor interacting protein encoded by rigor mortis (rig) that is required for ecdysone responses during larval development. rig mutants display defects in molting, delayed larval development, larval lethality, duplicated mouth parts, and defects in puparium formation--phenotypes that resemble those seen in EcR, usp, E75A and betaFTZ-F1 mutants. Although the expression of these nuclear receptor genes is essentially normal in rig mutant larvae, the ecdysone-triggered switch in E74 isoform expression is defective. rig encodes a protein with multiple WD-40 repeats and an LXXLL motif, sequences that act as specific protein-protein interaction domains. Consistent with the presence of these elements and the lethal phenotypes of rig mutants, Rig protein interacts with several Drosophila nuclear receptors in GST pull-down experiments, including EcR, USP, DHR3, SVP and betaFTZ-F1. The ligand binding domain of betaFTZ-F1 is sufficient for this interaction, which can occur in an AF-2-independent manner. Antibody stains reveal that Rig protein is present in the brain and imaginal discs of second and third instar larvae, where it is restricted to the cytoplasm. In larval salivary gland and midgut cells, however, Rig shuttles between the cytoplasm and nucleus in a spatially and temporally regulated manner, at times that correlate with the major lethal phase of rig mutants and major switches in ecdysone-regulated gene expression. Taken together, these data indicate that rig exerts essential functions during larval development through gene-specific effects on ecdysone-regulated transcription, most likely as a cofactor for one or more nuclear receptors. Furthermore, the dynamic intracellular redistribution of Rig protein suggests that it may act to refine spatial and temporal responses to ecdysone during development.

Skeletal muscle and nuclear hormone receptors: implications for cardiovascular and metabolic disease.

PubMed

Smith, Aaron G; Muscat, George E O

2005-10-01

Skeletal muscle is a major mass peripheral tissue that accounts for approximately 40% of the total body mass and a major player in energy balance. It accounts for >30% of energy expenditure, is the primary tissue of insulin stimulated glucose uptake, disposal, and storage. Furthermore, it influences metabolism via modulation of circulating and stored lipid (and cholesterol) flux. Lipid catabolism supplies up to 70% of the energy requirements for resting muscle. However, initial aerobic exercise utilizes stored muscle glycogen but as exercise continues, glucose and stored muscle triglycerides become important energy substrates. Endurance exercise increasingly depends on fatty acid oxidation (and lipid mobilization from other tissues). This underscores the importance of lipid and glucose utilization as an energy source in muscle. Consequently skeletal muscle has a significant role in insulin sensitivity, the blood lipid profile, and obesity. Moreover, caloric excess, obesity and physical inactivity lead to skeletal muscle insulin resistance, a risk factor for the development of type II diabetes. In this context skeletal muscle is an important therapeutic target in the battle against cardiovascular disease, the worlds most serious public health threat. Major risk factors for cardiovascular disease include dyslipidemia, hypertension, obesity, sedentary lifestyle, and diabetes. These risk factors are directly influenced by diet, metabolism and physical activity. Metabolism is largely regulated by nuclear hormone receptors which function as hormone regulated transcription factors that bind DNA and mediate the patho-physiological regulation of gene expression. Metabolism and activity, which directly influence cardiovascular disease risk factors, are primarily driven by skeletal muscle. Recently, many nuclear receptors expressed in skeletal muscle have been shown to improve glucose tolerance, insulin resistance, and dyslipidemia. Skeletal muscle and nuclear receptors are rapidly emerging as critical targets in the battle against cardiovascular disease risk factors. Understanding the function of nuclear receptors in skeletal muscle has enormous pharmacological utility for the treatment of cardiovascular disease. This review focuses on the molecular regulation of metabolism by nuclear receptors in skeletal muscle in the context of dyslipidemia and cardiovascular disease.

A truncated human peroxisome proliferator-activated receptor alpha splice variant with dominant negative activity.

PubMed

Gervois, P; Torra, I P; Chinetti, G; Grötzinger, T; Dubois, G; Fruchart, J C; Fruchart-Najib, J; Leitersdorf, E; Staels, B

1999-09-01

The peroxisome proliferator-activated receptor alpha (PPARalpha) plays a key role in lipid and lipoprotein metabolism. However, important inter- and intraspecies differences exist in the response to PPARalpha activators. This incited us to screen for PPARalpha variants with different signaling functions. In the present study, using a RT-PCR approach a variant human PPARalpha mRNA species was identified, which lacks the entire exon 6 due to alternative splicing. This deletion leads to the introduction of a premature stop codon, resulting in the formation of a truncated PPARalpha protein (PPARalphatr) lacking part of the hinge region and the entire ligand-binding domain. RNase protection analysis demonstrated that PPARalphatr mRNA is expressed in several human tissues and cells, representing between 20-50% of total PPARalpha mRNA. By contrast, PPARalphatr mRNA could not be detected in rodent tissues. Western blot analysis using PPARalpha-specific antibodies demonstrated the presence of an immunoreactive protein migrating at the size of in vitro produced PPARalphatr protein both in human hepatoma HepG2 cells and in human hepatocytes. Both in the presence or absence of 9-cis-retinoic acid receptor, PPARalphatr did not bind to DNA in gel shift assays. Immunocytochemical analysis of transfected CV-1 cells indicated that, whereas transfected PPARalphawt was mainly nuclear localized, the majority of PPARalphatr resided in the cytoplasm, with presence in the nucleus depending on cell culture conditions. Whereas a chimeric PPARalphatr protein containing a nuclear localization signal cloned at its N-terminal localized into the nucleus and exhibited strong negative activity on PPARalphawt transactivation function, PPARalphatr interfered with PPARalphatr transactivation function only under culture conditions inducing its nuclear localization. Cotransfection of the coactivator CREB-binding protein relieved the transcriptional repression of PPARalphawt by PPARalphatr, suggesting that the dominant negative effect of PPARalphatr might occur through competition for essential coactivators. In addition, PPARalphatr interfered with transcriptional activity of other nuclear receptors such as PPARgamma, hepatic nuclear factor-4, and glucocorticoid receptor-alpha, which share CREB-binding protein/p300 as a coactivator. Thus, we have identified a human PPARalpha splice variant that may negatively interfere with PPARalphawt function. Factors regulating either the ratio of PPARalphawt vs. PPARalphatr mRNA or the nuclear entry of PPARalphatr protein should therefore lead to altered signaling via the PPARalpha and, possibly also, other nuclear receptor pathways.

A calreticulin-dependent nuclear export signal is involved in the regulation of liver receptor homologue-1 protein folding.

PubMed

Yang, Feng-Ming; Feng, Shan-Jung; Lai, Tsai-Chun; Hu, Meng-Chun

2015-10-15

As an orphan member of the nuclear receptor family, liver receptor homologue-1 (LRH-1) controls a tremendous range of transcriptional programmes that are essential for metabolism and hormone synthesis. Our previous studies have shown that nuclear localization of the LRH-1 protein is mediated by two nuclear localization signals (NLSs) that are karyopherin/importin-dependent. It is unclear whether LRH-1 can be actively exported from the nucleus to the cytoplasm. In the present study, we describe a nuclear export domain containing two leucine-rich motifs [named nuclear export signal (NES)1 and NES2] within the ligand-binding domain (LBD). Mutation of leucine residues in NES1 or NES2 abolished nuclear export, indicating that both NES1 and NES2 motifs are essential for full nuclear export activity. This NES-mediated nuclear export was insensitive to the chromosomal region maintenance 1 (CRM1) inhibitor leptomycin B (LMB) or to CRM1 knockdown. However, knockdown of calreticulin (CRT) prevented NES-mediated nuclear export. Furthermore, our data show that CRT interacts with LRH-1 and is involved in the nuclear export of LRH-1. With full-length LRH-1, mutation of NES1 led to perinuclear accumulation of the mutant protein. Immunofluorescence analysis showed that these perinuclear aggregates were co-localized with the centrosome marker, microtubule-associated protein 1 light chain 3 (LC3), ubiquitin and heat shock protein 70 (Hsp70), indicating that the mutant was misfolded and sequestered into aggresome-like structures via the autophagic clearance pathway. Our study demonstrates for the first time that LRH-1 has a CRT-dependent NES which is not only required for cytoplasmic trafficking, but also essential for correct protein folding to avoid misfolding-induced aggregation. © 2015 Authors; published by Portland Press Limited.

Molecular and Structural Traits of Insulin Receptor Substrate 1/LC3 Nuclear Structures and Their Role in Autophagy Control and Tumor Cell Survival.

PubMed

Lassak, Adam; Dean, Mathew; Wyczechowska, Dorota; Wilk, Anna; Marrero, Luis; Trillo-Tinoco, Jimena; Boulares, A Hamid; Sarkaria, Jann N; Del Valle, Luis; Peruzzi, Francesca; Ochoa, Augusto; Reiss, Krzysztof

2018-05-15

Insulin receptor substrate 1 (IRS-1) is a common cytosolic adaptor molecule involved in signal transduction from insulin and insulin-like growth factor I (IGF-I) receptors. IRS-1 can also be found in the nucleus. We report here a new finding of unique IRS-1 nuclear structures, which we observed initially in glioblastoma biopsy specimens and glioblastoma xenografts. These nuclear structures can be reproduced in vitro by the ectopic expression of IRS-1 cDNA cloned in frame with the nuclear localization signal (NLS-IRS-1). In these structures, IRS-1 localizes at the periphery, while the center harbors a key autophagy protein, LC3. These new nuclear structures are highly dynamic, rapidly exchange IRS-1 molecules with the surrounding nucleoplasm, disassemble during mitosis, and require a growth stimulus for their reassembly and maintenance. In tumor cells engineered to express NLS-IRS-1, the IRS-1/LC3 nuclear structures repress autophagy induced by either amino acid starvation or rapamycin treatment. In this process, IRS-1 nuclear structures sequester LC3 inside the nucleus, possibly preventing its cytosolic translocation and the formation of new autophagosomes. This novel mechanism provides a quick and reversible way of inhibiting autophagy, which could counteract autophagy-induced cancer cell death under severe stress, including anticancer therapies. Copyright © 2018 American Society for Microbiology.

Trichoplax adhaerens reveals a network of nuclear receptors sensitive to 9-cis-retinoic acid at the base of metazoan evolution

PubMed Central

Novotný, Jan Philipp; Chughtai, Ahmed Ali; Kostrouchová, Markéta; Kostrouchová, Veronika; Kostrouch, David; Kaššák, Filip; Kaňa, Radek; Schierwater, Bernd; Kostrouchová, Marta

2017-01-01

Trichoplax adhaerens, the only known species of Placozoa is likely to be closely related to an early metazoan that preceded branching of Cnidaria and Bilateria. This animal species is surprisingly well adapted to free life in the World Ocean inhabiting tidal costal zones of oceans and seas with warm to moderate temperatures and shallow waters. The genome of T. adhaerens (sp. Grell) includes four nuclear receptors, namely orthologue of RXR (NR2B), HNF4 (NR2A), COUP-TF (NR2F) and ERR (NR3B) that show a high degree of similarity with human orthologues. In the case of RXR, the sequence identity to human RXR alpha reaches 81% in the DNA binding domain and 70% in the ligand binding domain. We show that T. adhaerens RXR (TaRXR) binds 9-cis retinoic acid (9-cis-RA) with high affinity, as well as high specificity and that exposure of T. adhaerens to 9-cis-RA regulates the expression of the putative T. adhaerens orthologue of vertebrate L-malate-NADP+ oxidoreductase (EC 1.1.1.40) which in vertebrates is regulated by a heterodimer of RXR and thyroid hormone receptor. Treatment by 9-cis-RA alters the relative expression profile of T. adhaerens nuclear receptors, suggesting the existence of natural ligands. Keeping with this, algal food composition has a profound effect on T. adhaerens growth and appearance. We show that nanomolar concentrations of 9-cis-RA interfere with T. adhaerens growth response to specific algal food and causes growth arrest. Our results uncover an endocrine-like network of nuclear receptors sensitive to 9-cis-RA in T. adhaerens and support the existence of a ligand-sensitive network of nuclear receptors at the base of metazoan evolution. PMID:28975052

Retrieval of estradiol receptor in paraffin sections of resting porcine uteri by microwave treatment. Immunostaining patterns obtained with different primary antibodies.

PubMed

Sierralta, W D; Thole, H H

1996-05-01

The unmasking of estradiol receptor in paraffin sections of Bouin's-fixed uterine tissue from ovariectomized gilts was attained with microwave treatment. Immunocytochemistry of the receptor was performed using a polyclonal or five monoclonal antibodies, two of which are commercially available, reacting with different domains of the protein and an amplified-peroxidase system for detection. With five of the antibodies, a predominance of nuclear staining was observed in cells of endometrial glands, while one monoclonal antibody (13H2), reacting with the receptor's domain E, showed a preference for the cytoplasmic receptor. In stroma, all antibodies detected more receptor in nuclei than in cytoplasm. In epithelium, the commercially available antibody H222, our monoclonals 13H2 and HT65, and the polyclonal antibody 402 demonstrated more receptor in cytoplasmic than in nuclear areas. In myometrium, the nuclei from longitudinal and ring muscles were definitely stained with the antibodies. We conclude that the accessibilities of the antibody epitopes of the receptor differ according to the functional uterine cell type.

Expression profiling of nuclear receptors in breast cancer identifies TLX as a mediator of growth and invasion in triple-negative breast cancer.

PubMed

Lin, Meng-Lay; Patel, Hetal; Remenyi, Judit; Banerji, Christopher R S; Lai, Chun-Fui; Periyasamy, Manikandan; Lombardo, Ylenia; Busonero, Claudia; Ottaviani, Silvia; Passey, Alun; Quinlan, Philip R; Purdie, Colin A; Jordan, Lee B; Thompson, Alastair M; Finn, Richard S; Rueda, Oscar M; Caldas, Carlos; Gil, Jesus; Coombes, R Charles; Fuller-Pace, Frances V; Teschendorff, Andrew E; Buluwela, Laki; Ali, Simak

2015-08-28

The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other NR and there is evidence that ERα function may be recapitulated by other NRs in ERα-negative breast cancer. In order to examine the inter-relationships between nuclear receptors, and to obtain evidence for previously unsuspected roles for any NRs, we undertook quantitative RT-PCR and bioinformatics analysis to examine their expression in breast cancer. While most NRs were expressed, bioinformatic analyses differentiated tumours into distinct prognostic groups that were validated by analyzing public microarray data sets. Although ERα and progesterone receptor were dominant in distinguishing prognostic groups, other NR strengthened these groups. Clustering analysis identified several family members with potential importance in breast cancer. Specifically, RORγ is identified as being co-expressed with ERα, whilst several NRs are preferentially expressed in ERα-negative disease, with TLX expression being prognostic in this subtype. Functional studies demonstrated the importance of TLX in regulating growth and invasion in ERα-negative breast cancer cells.

Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection

PubMed Central

Johnson, Howard M.; Noon-Song, Ezra; Ahmed, Chulbul M.

2011-01-01

The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation. PMID:22924155

Controlling Nuclear Jaks and Stats for Specific Gene Activation by Ifn γ and Other Cytokines: A Possible Steroid-like Connection.

PubMed

Johnson, Howard M; Noon-Song, Ezra; Ahmed, Chulbul M

2011-09-03

The mechanism of specific gene activation by cytokines that use JAK/STAT signalling pathway is unknown. There are four different types of JAKs and seven different types of STATs. In the classical model of signaling, ligand interacts solely with the receptor extracellular domain, which triggers JAK activation at the receptor cytoplasmic domain. Activated STATs are then said to carry out nuclear events of specific gene activation, including associated epigenetic changes that cause heterochromatin destabilization. Ligand, receptor, and JAKs play no further role in the classical model. Given the limited number of STATs and the activation of the same STATs by cytokines with different functions, the mechanism of the specificity of their signalling is not obvious. Focusing on gamma interferon (IFNγ), we have shown that ligand, receptor, and activated JAKs are involved in nuclear events that are associated with specific gene activation. In this model, receptor subunit IFNGR1 functions as a transcription/cotranscription factor and the JAKs are involved in key epigenetic events that are required for specific gene activation. The model has implications for gene activation in cancer as well as stem cell differentiation.

Glucocorticoid receptor interacts with PNRC2 in a ligand-dependent manner to recruit UPF1 for rapid mRNA degradation.

PubMed

Cho, Hana; Park, Ok Hyun; Park, Joori; Ryu, Incheol; Kim, Jeonghan; Ko, Jesang; Kim, Yoon Ki

2015-03-31

Glucocorticoid receptor (GR), which was originally known to function as a nuclear receptor, plays a role in rapid mRNA degradation by acting as an RNA-binding protein. The mechanism by which this process occurs remains unknown. Here, we demonstrate that GR, preloaded onto the 5'UTR of a target mRNA, recruits UPF1 through proline-rich nuclear receptor coregulatory protein 2 (PNRC2) in a ligand-dependent manner, so as to elicit rapid mRNA degradation. We call this process GR-mediated mRNA decay (GMD). Although GMD, nonsense-mediated mRNA decay (NMD), and staufen-mediated mRNA decay (SMD) share upstream frameshift 1 (UPF1) and PNRC2, we find that GMD is mechanistically distinct from NMD and SMD. We also identify de novo cellular GMD substrates using microarray analysis. Intriguingly, GMD functions in the chemotaxis of human monocytes by targeting chemokine (C-C motif) ligand 2 (CCL2) mRNA. Thus, our data provide molecular evidence of a posttranscriptional role of the well-studied nuclear hormone receptor, GR, which is traditionally considered a transcription factor.

Nutrient-sensing nuclear receptors PPARα and FXR control liver energy balance.

PubMed

Preidis, Geoffrey A; Kim, Kang Ho; Moore, David D

2017-04-03

The nuclear receptors PPARα (encoded by NR1C1) and farnesoid X receptor (FXR, encoded by NR1H4) are activated in the liver in the fasted and fed state, respectively. PPARα activation induces fatty acid oxidation, while FXR controls bile acid homeostasis, but both nuclear receptors also regulate numerous other metabolic pathways relevant to liver energy balance. Here we review evidence that they function coordinately to control key nutrient pathways, including fatty acid oxidation and gluconeogenesis in the fasted state and lipogenesis and glycolysis in the fed state. We have also recently reported that these receptors have mutually antagonistic impacts on autophagy, which is induced by PPARα but suppressed by FXR. Secretion of multiple blood proteins is a major drain on liver energy and nutrient resources, and we present preliminary evidence that the liver secretome may be directly suppressed by PPARα, but induced by FXR. Finally, previous studies demonstrated a striking deficiency in bile acid levels in malnourished mice that is consistent with results in malnourished children. We present evidence that hepatic targets of PPARα and FXR are dysregulated in chronic undernutrition. We conclude that PPARα and FXR function coordinately to integrate liver energy balance.

Nuclear Receptor Signaling Atlas: Opening Access to the Biology of Nuclear Receptor Signaling Pathways

PubMed Central

Becnel, Lauren B.; Darlington, Yolanda F.; Ochsner, Scott A.; Easton-Marks, Jeremy R.; Watkins, Christopher M.; McOwiti, Apollo; Kankanamge, Wasula H.; Wise, Michael W.; DeHart, Michael; Margolis, Ronald N.; McKenna, Neil J.

2015-01-01

Signaling pathways involving nuclear receptors (NRs), their ligands and coregulators, regulate tissue-specific transcriptomes in diverse processes, including development, metabolism, reproduction, the immune response and neuronal function, as well as in their associated pathologies. The Nuclear Receptor Signaling Atlas (NURSA) is a Consortium focused around a Hub website (www.nursa.org) that annotates and integrates diverse ‘omics datasets originating from the published literature and NURSA-funded Data Source Projects (NDSPs). These datasets are then exposed to the scientific community on an Open Access basis through user-friendly data browsing and search interfaces. Here, we describe the redesign of the Hub, version 3.0, to deploy “Web 2.0” technologies and add richer, more diverse content. The Molecule Pages, which aggregate information relevant to NR signaling pathways from myriad external databases, have been enhanced to include resources for basic scientists, such as post-translational modification sites and targeting miRNAs, and for clinicians, such as clinical trials. A portal to NURSA’s Open Access, PubMed-indexed journal Nuclear Receptor Signaling has been added to facilitate manuscript submissions. Datasets and information on reagents generated by NDSPs are available, as is information concerning periodic new NDSP funding solicitations. Finally, the new website integrates the Transcriptomine analysis tool, which allows for mining of millions of richly annotated public transcriptomic data points in the field, providing an environment for dataset re-use and citation, bench data validation and hypothesis generation. We anticipate that this new release of the NURSA database will have tangible, long term benefits for both basic and clinical research in this field. PMID:26325041

Rho-kinase signaling controls nucleocytoplasmic shuttling of class IIa Histone Deacetylase (HDAC7) and transcriptional activation of orphan nuclear receptor NR4A1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania

2015-04-03

Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin–myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify amore » new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK. - Highlights: • ROCK regulates nucleocytoplasmic shuttling of HDAC7 via phosphorylation of MYPT1. • Nuclear export of HDAC7 and upregulation of NR4A1 occurs with low ROCK activity. • High levels of ROCK activity due to OPHN1 loss of function downregulate NR4A1.« less

Surface localization of the nuclear receptor CAR in influenza A virus-infected cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Tadanobu; Department of Biochemistry, School of Pharmaceutical Sciences, University of Shizuoka, CREST, JST, and COE Program in the 21st Century, Shizuoka 422-8526; Moriyama, Yusuke

Constitutive active/androstane receptor CAR is a member of the nuclear receptors which regulate transcription of xenobiotic metabolism enzymes. CAR is usually localized in the cytosol and nucleus. Here, we found that CAR was localized at the cell surface of influenza A virus (IAV)-infected cells. Additionally, we demonstrated that expression of a viral envelope glycoprotein, either hemagglutinin (HA) or neuraminidase (NA), but not viral nucleoprotein (NP), was responsible for this localization. This report is the first demonstration of CAR at the surface of tissue culture cells, and suggests that CAR may exert the IAV infection mechanism.

Nuclear Receptor Rev-erb Alpha (Nr1d1) Functions in Concert with Nr2e3 to Regulate Transcriptional Networks in the Retina

PubMed Central

Mollema, Nissa J.; Yuan, Yang; Jelcick, Austin S.; Sachs, Andrew J.; von Alpen, Désirée; Schorderet, Daniel; Escher, Pascal; Haider, Neena B.

2011-01-01

The majority of diseases in the retina are caused by genetic mutations affecting the development and function of photoreceptor cells. The transcriptional networks directing these processes are regulated by genes such as nuclear hormone receptors. The nuclear hormone receptor gene Rev-erb alpha/Nr1d1 has been widely studied for its role in the circadian cycle and cell metabolism, however its role in the retina is unknown. In order to understand the role of Rev-erb alpha/Nr1d1 in the retina, we evaluated the effects of loss of Nr1d1 to the developing retina and its co-regulation with the photoreceptor-specific nuclear receptor gene Nr2e3 in the developing and mature retina. Knock-down of Nr1d1 expression in the developing retina results in pan-retinal spotting and reduced retinal function by electroretinogram. Our studies show that NR1D1 protein is co-expressed with NR2E3 in the outer neuroblastic layer of the developing mouse retina. In the adult retina, NR1D1 is expressed in the ganglion cell layer and is co-expressed with NR2E3 in the outer nuclear layer, within rods and cones. Several genes co-targeted by NR2E3 and NR1D1 were identified that include: Nr2c1, Recoverin, Rgr, Rarres2, Pde8a, and Nupr1. We examined the cyclic expression of Nr1d1 and Nr2e3 over a twenty-four hour period and observed that both nuclear receptors cycle in a similar manner. Taken together, these studies reveal a novel role for Nr1d1, in conjunction with its cofactor Nr2e3, in regulating transcriptional networks critical for photoreceptor development and function. PMID:21408158

Retinoid Pathway and Cancer Therapeutics

PubMed Central

Bushue, Nathan; Wan, Yu-Jui Yvonne

2010-01-01

The retinoids are a class of compounds that are structurally related to vitamin A. Retinoic acid, which is the active metabolite of retinol, regulates a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids exert their effects through a variety of binding proteins including cellular retinol binding protein (CRBP), retinol-binding proteins (RBP), cellular retinoic acid-binding protein (CRABP), and nuclear receptors i.e. retinoic acid receptor (RAR) and retinoid × receptor (RXR). Because of the pleiotropic effects of retinoids, understanding the function of these binding proteins and nuclear receptors assists us in developing compounds that have specific effects. This review summarizes our current understanding of how retinoids are processed and act with the emphasis on the application of retinoids in cancer treatment and prevention. PMID:20654663

A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects.

PubMed

Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L; Busby, Scott A; Griffin, Patrick R; Pathak, Manish C; Ortlund, Eric A; Moore, David D

2011-05-25

Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine (DLPC)) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver-specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signalling pathway that regulates bile acid metabolism and glucose homeostasis.

Inducible nuclear translocation of a STAT protein in Dictyostelium prespore cells: implications for morphogenesis and cell-type regulation.

PubMed

Dormann, D; Abe, T; Weijer, C J; Williams, J

2001-04-01

Dd-STATa, the Dictyostelium STAT (signal transducer and activator of transcription) protein, is selectively localised in the nuclei of a small subset of prestalk cells located in the slug tip. Injection of cAMP into the extracellular spaces in the rear of the slug induces rapid nuclear translocation of a Dd-GFP:STATa fusion protein in prespore cells surrounding the site of injection. This suggests that cAMP signals that emanate from the tip direct the localised nuclear accumulation of Dd-STATa. It also shows that prespore cells are competent to respond to cAMP, by Dd-STATa activation, and it implies that cAMP signalling is in some way limiting in the rear of the slug. Co-injection of a specific inhibitor of the cAR1 serpentine cAMP receptor almost completely prevents the cAMP-induced nuclear translocation, showing that most or all of the cAMP signal is transduced by cAR1. Dd-GFP:STATa also rapidly translocates into the nuclei of cells adjoining the front and back cut edges when a slug is bisected. Less severe mechanical disturbances, such as pricking the rear of a slug with an unfilled micropipette, also cause a more limited nuclear translocation of Dd-GFP:STATa. We propose that these signalling events form part of a repair mechanism that is activated when the migrating slug suffers mechanical damage.

A Multi-Receptor and Multi-Species Assay for Potential Endocrine Disruptor Targets (SLAS meeting)

EPA Science Inventory

Screening methods for detecting potential endocrine disrupting chemicals rely chiefly on transactivation assays targeting nuclear receptors such as the estrogen (ER) and androgen receptors (AR). These assays are predominately human-based; yet environmental exposure can affect div...

The antidepressant fluoxetine normalizes the nuclear glucocorticoid receptor evoked by psychosocial stress

NASA Astrophysics Data System (ADS)

Mitić, M.; Simić, I.; Djordjević, J.; Radojčić, M. B.; Adžić, M.

2011-12-01

Dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis has been implicated in the pathophysiology of depression and stress disorders. Glucocorticoids, key regulators of the stress response, exert diverse effects on cellular processes in the hippocampus. Beside non-genomic pathways, glucocorticoid effects are mediated through activation of the glucocorticoid receptor (GR), a ligand activated transcriptional factor that belongs to the nuclear hormone receptor superfamily. We analysed the GR protein levels both in the cytoplasmic and nuclear compartments of the hippocampus of Wistar rats exposed to chronic psychosocial isolation stress upon chronic fluoxetine (FLU) treatment. Under chronic stress, corticosterone levels (CORT) were decreased compared to the control, and treatment with FLU did not change its level in the stressed rats. At the molecular level, FLU normalized the level of nuclear GR protein in the hippocampus of the stressed rats. Discrepancy between normalization of nuclear GR in the hippocampus and lack of normalization of HPA axis activity judged by CORT, suggests that other brain structures such as the amygdale and prefrontal cortex that also regulate HPA axis activity, seem not to be normalized by the FLU treatment used in our study.

Nebraska Prostate Cancer Research Program

DTIC Science & Technology

2012-05-01

Powell. (2012). Dioxin exposure enhances nuclear localization of androgen receptor. The 8th Annual National Symposium on Prostate Cancer by CCRTD...cholesterol. Mol . Cellu. Endo. 295:115-120. 2. Siegel, R., Naishadham, D., and Jemal, A. (2012). Cancer Statistics, 2012. CA Cancer J Clin 62: 10-29...Ul DIOXIN J!1XPOSURE EN CES NUCLEAR LOCALIZATION OF ANDROGEN RECEPTOR\\~f..aTayia Aaron, nd Joann Powell, Center for Cancer Research and Therapeutic

Targeting Nuclear EGFR: Strategies for Improving Cetuximab Therapy in Lung Cancer

DTIC Science & Technology

2014-09-01

Triple - negative breast cancer Mol Cancer Ther. 2014 May;13(5):1356-68. PMID: 24634415, PMCID: PMC4013210 6. Brand, TM, Iida, M...Receptor Is a Functional Molecular Target in Triple - Negative Breast Cancer . Molecular cancer therapeutics (2014). 11 26. Iida, M., Brand, T.M...2014). Brand, T.M., et al. Nuclear epidermal growth factor receptor is a functional molecular target in triple - negative breast cancer .

Role of osteoprotegerin/receptor activator of nuclear factor kappa B/receptor activator of nuclear factor kappa B ligand axis in nonalcoholic fatty liver disease.

PubMed

Pacifico, Lucia; Andreoli, Gian Marco; D'Avanzo, Miriam; De Mitri, Delia; Pierimarchi, Pasquale

2018-05-21

Concomitantly with the increase in the prevalences of overweight/obesity, nonalcoholic fatty liver disease (NAFLD) has worldwide become the main cause of chronic liver disease in both adults and children. Patients with fatty liver display features of metabolic syndrome (MetS), like insulin resistance (IR), glucose intolerance, hypertension and dyslipidemia. Recently, epidemiological studies have linked obesity, MetS, and NAFLD to decreased bone mineral density and osteoporosis, highlighting an intricate interplay among bone, adipose tissue, and liver. Osteoprotegerin (OPG), an important symbol of the receptor activator of nuclear factor-B ligand/receptor activator of nuclear factor kappa B/OPG system activation, typically considered for its role in bone metabolism, may also play critical roles in the initiation and perpetuation of obesity-related comorbidities. Clinical data have indicated that OPG concentrations are associated with hypertension, left ventricular hypertrophy, vascular calcification, endothelial dysfunction, and severity of liver damage in chronic hepatitis C. Nonetheless, the relationship between circulating OPG and IR as a key feature of MetS as well as between OPG and NAFLD remains uncertain. Thus, the aims of the present review are to provide the existent knowledge on these associations and to discuss briefly the underlying mechanisms linking OPG and NAFLD.

Nuclear hormone receptor NHR-49 controls fat consumption and fatty acid composition in C. elegans.

PubMed

Van Gilst, Marc R; Hadjivassiliou, Haralambos; Jolly, Amber; Yamamoto, Keith R

2005-02-01

Mammalian nuclear hormone receptors (NHRs), such as liver X receptor, farnesoid X receptor, and peroxisome proliferator-activated receptors (PPARs), precisely control energy metabolism. Consequently, these receptors are important targets for the treatment of metabolic diseases, including diabetes and obesity. A thorough understanding of NHR fat regulatory networks has been limited, however, by a lack of genetically tractable experimental systems. Here we show that deletion of the Caenorhabditis elegans NHR gene nhr-49 yielded worms with elevated fat content and shortened life span. Employing a quantitative RT-PCR screen, we found that nhr-49 influenced the expression of 13 genes involved in energy metabolism. Indeed, nhr-49 served as a key regulator of fat usage, modulating pathways that control the consumption of fat and maintain a normal balance of fatty acid saturation. We found that the two phenotypes of the nhr-49 knockout were linked to distinct pathways and were separable: The high-fat phenotype was due to reduced expression of enzymes in fatty acid beta-oxidation, and the shortened adult life span resulted from impaired expression of a stearoyl-CoA desaturase. Despite its sequence relationship with the mammalian hepatocyte nuclear factor 4 receptor, the biological activities of nhr-49 were most similar to those of the mammalian PPARs, implying an evolutionarily conserved role for NHRs in modulating fat consumption and composition. Our findings in C. elegans provide novel insights into how NHR regulatory networks are coordinated to govern fat metabolism.

Cardiomyocyte-expressed farnesoid-X-receptor is a novel apoptosis mediator and contributes to myocardial ischaemia/reperfusion injury

PubMed Central

Pu, Jun; Yuan, Ancai; Shan, Peiren; Gao, Erhe; Wang, Xiaoliang; Wang, Yajing; Lau, Wayne Bond; Koch, Walter; Ma, Xin-Liang; He, Ben

2013-01-01

Aims Emerging evidence indicates that nuclear receptors play a critical regulatory role in cardiovascular physiology/pathology. Recently, farnesoid-X-receptor (FXR), a member of the metabolic nuclear receptor superfamily, has been demonstrated to be expressed in vascular cells, with important roles in vascular physiology/pathology. However, the potential cardiac function of FXR remains unclear. We investigated the cardiac expression and biological function of FXR. Methods and results Farnesoid-X-receptor was detected in both isolated neonatal rat cardiac myocytes and fibroblasts. Natural and synthetic FXR agonists upregulated cardiac FXR expression, stimulated myocyte apoptosis, and reduced myocyte viability dose- and time-dependently. Mechanistic studies demonstrated that FXR agonists disrupted mitochondria, characterized by mitochondrial permeability transition pores activation, mitochondrial potential dissipation, cytochrome c release, and both caspase-9 and -3 activation. Such mitochondrial apoptotic responses were abolished by siRNA-mediated silencing of endogenous FXR or pharmacological inhibition of mitochondrial death signalling. Furthermore, low levels of FXR were detected in the adult mouse heart, with significant (∼2.0-fold) upregulation after myocardial ischaemia/reperfusion (MI/R). Pharmacological inhibition or genetic ablation of FXR significantly reduced myocardial apoptosis by 29.0–53.4%, decreased infarct size by 23.4–49.7%, and improved cardiac function in ischaemic/reperfused myocardium. Conclusion These results demonstrate that nuclear receptor FXR acts as a novel functional receptor in cardiac tissue, regulates apoptosis in cardiomyocytes, and contributes to MI/R injury. PMID:22307460

Characterization of Peroxisome Proliferator-Activated Receptor a (PPARa) -Independent Effects of PPARa Activators in the Rodent Liver: Di-(2-ethylhexyl) phthalate Also Activates the Constitutive Activated Receptor

EPA Science Inventory

Peroxisome proliferator chemicals (PPC) are thought to mediate their effects in rodents on hepatocyte growth and liver cancer through the nuclear receptor peroxisome proliferatoractivated receptor alpha (PPARa). Recent studies indicate that one such PPC, the plasticizer di2- et...

Characterization of peroxisome proliferator-activiated receptor alpha (PPARalpha)-independent effects of PPARalpha activators in the rodent liver: Di(2-ethylehexyl) phthalate activates the constitutive activated receptor

EPA Science Inventory

Peroxisome proliferator chemicals (PPC) are thought to mediate their effects in rodents on hepatocyte growth and liver cancer through the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha). Recent studies indicate that the plasticizer di-2-ethylhexyl ph...

Estrogen receptor ligands: a patent review update.

PubMed

Paterni, Ilaria; Bertini, Simone; Granchi, Carlotta; Macchia, Marco; Minutolo, Filippo

2013-10-01

The role of estrogens is mostly mediated by two nuclear receptors (ERα and ERβ) and a membrane-associated G-protein (GPR30 or GPER), and it is not limited to reproduction, but it extends to the skeletal, cardiovascular and central nervous systems. Various pathologies such as cancer, inflammatory, neurodegenerative and metabolic diseases are often associated with dysfunctions of the estrogenic system. Therapeutic interventions by agents that affect the estrogenic signaling pathway might be useful in the treatment of many dissimilar diseases. The massive chemodiversity of ER ligands, limited to patented small molecules, is herein reviewed. The reported compounds are classified on the basis of their chemical structures. Non-steroidal derivatives, which mostly consist of diphenolic compounds, are further segregated into chemical classes based on their central scaffold. Estrogens have been used for almost a century and their earlier applications have concerned interventions in the female reproductive functions, as well as the treatment of some estrogen-dependent cancers and osteoporosis. Since the discovery of ERβ in 1996, the patent literature has started to pay a progressively increasing attention to this newer receptor subtype, which holds promise as a target for new indications, most of which still need to be clinically validated.

Modification on ursodeoxycholic acid (UDCA) scaffold. discovery of bile acid derivatives as selective agonists of cell-surface G-protein coupled bile acid receptor 1 (GP-BAR1).

PubMed

Sepe, Valentina; Renga, Barbara; Festa, Carmen; D'Amore, Claudio; Masullo, Dario; Cipriani, Sabrina; Di Leva, Francesco Saverio; Monti, Maria Chiara; Novellino, Ettore; Limongelli, Vittorio; Zampella, Angela; Fiorucci, Stefano

2014-09-25

Bile acids are signaling molecules interacting with the nuclear receptor FXR and the G-protein coupled receptor 1 (GP-BAR1/TGR5). GP-BAR1 is a promising pharmacological target for the treatment of steatohepatitis, type 2 diabetes, and obesity. Endogenous bile acids and currently available semisynthetic bile acids are poorly selective toward GP-BAR1 and FXR. Thus, in the present study we have investigated around the structure of UDCA, a clinically used bile acid devoid of FXR agonist activity, to develop a large family of side chain modified 3α,7β-dihydroxyl cholanoids that selectively activate GP-BAR1. In vivo and in vitro pharmacological evaluation demonstrated that administration of compound 16 selectively increases the expression of pro-glucagon 1, a GP-BAR1 target, in the small intestine, while it had no effect on FXR target genes in the liver. Further, compound 16 results in a significant reshaping of bile acid pool in a rodent model of cholestasis. These data demonstrate that UDCA is a useful scaffold to generate novel and selective steroidal ligands for GP-BAR1.

Nuclear Receptors in Drug Metabolism, Drug Response and Drug Interactions

PubMed Central

Prakash, Chandra; Zuniga, Baltazar; Song, Chung Seog; Jiang, Shoulei; Cropper, Jodie; Park, Sulgi; Chatterjee, Bandana

2016-01-01

Orally delivered small-molecule therapeutics are metabolized in the liver and intestine by phase I and phase II drug-metabolizing enzymes (DMEs), and transport proteins coordinate drug influx (phase 0) and drug/drug-metabolite efflux (phase III). Genes involved in drug metabolism and disposition are induced by xenobiotic-activated nuclear receptors (NRs), i.e. PXR (pregnane X receptor) and CAR (constitutive androstane receptor), and by the 1α, 25-dihydroxy vitamin D3-activated vitamin D receptor (VDR), due to transactivation of xenobiotic-response elements (XREs) present in phase 0-III genes. Additional NRs, like HNF4-α, FXR, LXR-α play important roles in drug metabolism in certain settings, such as in relation to cholesterol and bile acid metabolism. The phase I enzymes CYP3A4/A5, CYP2D6, CYP2B6, CYP2C9, CYP2C19, CYP1A2, CYP2C8, CYP2A6, CYP2J2, and CYP2E1 metabolize >90% of all prescription drugs, and phase II conjugation of hydrophilic functional groups (with/without phase I modification) facilitates drug clearance. The conjugation step is mediated by broad-specificity transferases like UGTs, SULTs, GSTs. This review delves into our current understanding of PXR/CAR/VDR-mediated regulation of DME and transporter expression, as well as effects of single nucleotide polymorphism (SNP) and epigenome (specified by promoter methylation, histone modification, microRNAs, long non coding RNAs) on the expression of PXR/CAR/VDR and phase 0-III mediators, and their impacts on variable drug response. Therapeutic agents that target epigenetic regulation and the molecular basis and consequences (overdosing, underdosing, or beneficial outcome) of drug-drug/drug-food/drug-herb interactions are also discussed. Precision medicine requires understanding of a drug’s impact on DME and transporter activity and their NR-regulated expression in order to achieve optimal drug efficacy without adverse drug reactions. In future drug screening, new tools such as humanized mouse models and microfluidic organs-on-chips, which mimic the physiology of a multicellular environment, will likely replace the current cell-based workflow. PMID:27478824

Screening the 10K Tox21 chemical library for thyroid hormone receptor modulators

EPA Science Inventory

Few ligands for the thyroid hormone receptor (TR) have been identified outside of endogenous ligands and pharmaceuticals, which suggests that TR is a very selective nuclear receptor (NR). However, large and diverse chemical libraries, particularly of environmental chemicals, have...

EPI-001, a compound active against castration-resistant prostate cancer, targets transactivation unit 5 of the androgen receptor

PubMed Central

De Mol, Eva; Fenwick, R. Bryn; Phang, Christopher T. W.; Buzón, Victor; Szulc, Elzbieta; de la Fuente, Alex; Escobedo, Albert; García, Jesús; Bertoncini, Carlos W.; Estébanez-Perpiñá, Eva; McEwan, Iain J.; Riera, Antoni; Salvatella, Xavier

2016-01-01

Castration-resistant prostate cancer is the lethal condition suffered by prostate cancer patients that become refractory to androgen deprivation therapy. EPI-001 is a recently identified compound active against this condition that modulates the activity of the androgen receptor, a nuclear receptor that is essential for disease progression. The mechanism by which this compound exerts its inhibitory activity is however not yet fully understood. Here we show, by using high resolution solution nuclear magnetic resonance spectroscopy, that EPI-001 selectively interacts with a partially folded region of the transactivation domain of the androgen receptor, known as transactivation unit 5, that is key for the ability of prostate cells to proliferate in the absence of androgens, a distinctive feature of castration-resistant prostate cancer. Our results can contribute to the development of more potent and less toxic novel androgen receptor antagonists for treating this disease. PMID:27356095

Independent Activation of Hepatitis B Virus Biosynthesis by Retinoids, Peroxisome Proliferators, and Bile Acids

PubMed Central

Reese, Vanessa C.; Oropeza, Claudia E.

2013-01-01

In the human hepatoma cell line HepG2, retinoic acid, clofibric acid, and bile acid treatment can only modestly increase hepatitis B virus (HBV) biosynthesis. Utilizing the human embryonic kidney cell line 293T, it was possible to demonstrate that the retinoid X receptor α (RXRα) plus its ligand can support viral biosynthesis independently of additional nuclear receptors. In addition, RXRα/peroxisome proliferator-activated receptor α (PPARα) and RXRα/farnesoid X receptor α (FXRα) heterodimeric nuclear receptors can also mediate ligand-dependent HBV transcription and replication when activated by clofibric acid and bile acid, respectively, independently of a requirement for the ligand-dependent activation of RXRα. These observations indicate that there are at least three possible modes of ligand-mediated activation of HBV transcription and replication existing within hepatocytes, suggesting that multiple independent mechanisms control viral production in the livers of infected individuals. PMID:23135717

Identification of SR1078, a synthetic agonist for the orphan nuclear receptors RORα and RORγ.

PubMed

Wang, Yongjun; Kumar, Naresh; Nuhant, Philippe; Cameron, Michael D; Istrate, Monica A; Roush, William R; Griffin, Patrick R; Burris, Thomas P

2010-11-19

The retinoic acid receptor-related receptors (RORs) are members of the nuclear receptor (NR) superfamily of transcription factors. Several NRs are still characterized as orphan receptors because ligands have not yet been identified for these proteins. Here, we describe the identification of a synthetic RORα/RORγ ligand, SR1078. SR1078 modulates the conformation of RORγ in a biochemical assay and activates RORα and RORγ driven transcription. Furthermore, SR1078 stimulates expression of endogenous ROR target genes in HepG2 cells that express both RORα and RORγ. Pharmacokinetic studies indicate that SR1078 displays reasonable exposure following injection into mice, and consistent with SR1078 functioning as a RORα/RORγ agonist, expression of two ROR target genes, glucose-6-phosphatase and fibroblast growth factor 21, were stimulated in the liver. Thus, we have identified the first synthetic RORα/γ agonist, and this compound can be utilized as a chemical tool to probe the function of these receptors both in vitro and in vivo.

Identification of a Synthetic Agonist for the Orphan Nuclear Receptors RORα and RORγ, SR1078

PubMed Central

Wang, Yongjun; Kumar, Naresh; Nuhant, Philippe; Cameron, Michael D.; Istrate, Monica A.; Roush, William R.; Griffin, Patrick R.; Burris, Thomas P.

2010-01-01

The retinoic acid receptor-related receptors (RORs) are members of the nuclear receptor (NR) superfamily of transcription factors. Several NRs are still characterized as orphan receptors since ligands have not yet been identified for these proteins. Here, we describe the identification of a synthetic RORα/RORγ ligand, SR1078. SR1078 modulates the conformation of RORγ in a biochemical assay and activates RORα and RORγ driven transcription. Furthermore, SR1078 stimulates expression of endogenous ROR target genes in HepG2 cells that express both RORα and RORγ. Pharmacokinetic studies indicate that SR1078 displays reasonable exposure following injection into mice and consistent with SR1078 functioning as a RORα/RORγ agonist, expression of two ROR target genes, glucose-6-phosphatase and fibroblast growth factor 21, were stimulated in the liver. Thus, we have identified the first synthetic RORα/γ agonist and this compound can be utilized as a chemical tool to probe the function of these receptors both in vitro and in vivo. PMID:20735016

The morphological and chemical characteristics of striatal neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the rat.

PubMed

Waldvogel, H J; Kubota, Y; Trevallyan, S C; Kawaguchi, Y; Fritschy, J M; Mohler, H; Faull, R L

1997-10-01

The distribution, morphology and chemical characteristics of neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the striatum of the basal ganglia in the rat brain were investigated at the light, confocal and electron microscope levels using single, double and triple immunohistochemical labelling techniques. The results showed that alpha1-subunit immunoreactive neurons were sparsely distributed throughout the rat striatum. Double and triple labelling results showed that all the alpha1-subunit-immunoreactive neurons were positive for glutamate decarboxylase and immunoreactive for the beta2,3 and gamma2 subunits of the GABA(A) receptor. Three types of alpha1-subunit-immunoreactive neurons were identified in the striatum on the basis of cellular morphology and chemical characteristics. The most numerous alpha1-subunit-immunoreactive neurons were medium-sized, aspiny neurons with a widely branching dendritic tree. They were parvalbumin-negative and were located mainly in the dorsolateral regions of the striatum. Electron microscopy showed that these neurons had an indented nuclear membrane, typical of striatal interneurons, and were surrounded by small numbers of axon terminals which established alpha1-subunit-immunoreactive synaptic contacts with the soma and dendrites. These cells were classified as type 1 alpha1-subunit-immunoreactive neurons and comprised 75% of the total population of alpha1-subunit-immunoreactive neurons in the striatum. The remaining alpha1-subunit-immunoreactive neurons comprised of a heterogeneous population of large-sized neurons localized in the ventral and medial regions of the striatum. The most numerous large-sized cells were parvalbumin-negative, had two to three relatively short branching dendrites and were designated type 2 alpha1-subunit-immunoreactive neurons. Electron microscopy showed that the type 2 neurons were characterized by a highly convoluted nuclear membrane and were sparsely covered with small axon terminals. The type 2 neurons comprised 20% of the total population of alpha1-subunit-immunoreactive neurons. The remaining large-sized alpha1-immunoreactive cells were designated type 3 cells; they were positive for parvalbumin and were distinguished by long branching dendrites extending dorsally for 600-800 microm into the striatum. These neurons comprised 5% of the total population of alpha1-subunit-immunoreactive neurons and were surrounded by enkephalin-immunoreactive terminals. Electron microscopy showed that the alpha1-subunit type 3 neurons had an indented nuclear membrane and were densely covered with small axon terminals which established alpha1-subunit-immunoreactive symmetrical synaptic contacts with the soma and dendrites. These results provide a detailed characterization of the distribution, morphology and chemical characteristics of the alpha1-subunit-immunoreactive neurons in the rat striatum and suggest that the type 1 and type 2 neurons comprise of separate populations of striatal interneurons while the type 3 neurons may represent the large striatonigral projection neurons described by Bolam et al. [Bolam J. P., Somogyi P., Totterdell S. and Smith A. D. (1981) Neuroscience 6, 2141-2157.].

Molecular basis for repression of liver X receptor-mediated gene transcription by receptor-interacting protein 140

PubMed Central

Jakobsson, Tomas; Osman, Waffa; Gustafsson, Jan-Åke; Zilliacus, Johanna; Wärnmark, Anette

2007-01-01

Similarities in physiological roles of LXR (liver X receptors) and co-repressor RIP140 (receptor-interacting protein 140) in regulating energy homoeostasis and lipid and glucose metabolism suggest that the effects of LXR could at least partly be mediated by recruitment of the co-repressor RIP140. In the present study, we have elucidated the molecular basis for regulation of LXR transcriptional activity by RIP140. LXR is evenly localized in the nucleus and neither the N-terminal domain nor the LBD (ligand-binding domain) is necessary for nuclear localization. Both LXR subtypes, LXRα and LXRβ, interact with RIP140 and co-localize in diffuse large nuclear domains. Interaction and co-localization are dependent on the LBD of the receptor. The C-terminal domain of RIP140 is sufficient for full repressive effect. None of the C-terminal NR (nuclear receptor)-boxes is required for the co-repressor activity, whereas the NR-box-like motif as well as additional elements in the C-terminal region are required for full repressive function. The C-terminal NR-box-like motif is necessary for interaction with LXRβ, whereas additional elements are needed for strong interaction with LXRα. In conclusion, our results suggest that co-repression of LXR activity by RIP140 involves an atypical binding mode of RIP140 and a repression element in the RIP140 C-terminus. PMID:17391100

Activation of orphan nuclear constitutive androstane receptor requires subnuclear targeting by peroxisome proliferator-activated receptor gamma coactivator-1 alpha. A possible link between xenobiotic response and nutritional state.

PubMed

Shiraki, Takuma; Sakai, Noriko; Kanaya, Eiko; Jingami, Hisato

2003-03-28

In contrast to the classical nuclear receptors, the constitutive androstane receptor (CAR) is transcriptionally active in the absence of ligand. In the course of searching for the mediator of CAR activation, we found that ligand-independent activation of CAR was achieved in cooperation with the peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1 alpha). PGC-1 beta, a PGC-1 alpha homologue, also activated CAR to less of an extent than PGC-1 alpha. Coexpression of the ligand-binding domain of a heterodimerization partner, retinoid X receptor alpha, enhanced the PGC-1 alpha-mediated activation of CAR, although it had a weak effect on the basal activity of CAR in the absence of PGC-1 alpha. Both the N-terminal region, with the LXXLL motif, and the C-terminal region, with a serine/arginine-rich domain (RS domain), in PGC-1 alpha were required for full activation of CAR. Pull-down experiments using recombinant proteins revealed that CAR directly interacted with both the LXXLL motif and the RS domain. Furthermore, we demonstrated that the RS domain of PGC-1 alpha was required for CAR localization at nuclear speckles. These results indicate that PGC-1 alpha mediates the ligand-independent activation of CAR by means of subnuclear targeting through the RS domain of PGC-1 alpha.

Methylglyoxal, a reactive glucose metabolite, increases renin angiotensin aldosterone and blood pressure in male Sprague-Dawley rats.

PubMed

Dhar, Indu; Dhar, Arti; Wu, Lingyun; Desai, Kaushik M

2014-03-01

The majority of people with diabetes develop hypertension along with increased activity of the renin-angiotensin system. Methylglyoxal, a reactive glucose metabolite, is elevated in diabetic patients. We investigated the effects of methylglyoxal on the renin-angiotensin system and blood pressure. Male Sprague-Dawley rats were treated with a continuous infusion of methylglyoxal with a minipump for 4 weeks. Organs/tissues and cultured vascular smooth muscle cells (VSMCs) were used for molecular studies. High-performance liquid chromatography, Western blotting, and quantitative real-time polymerase chain reaction were used to measure methylglyoxal, proteins, and mRNA, respectively. Small interfering RNA for angiotensinogen and the receptor for advanced glycation endproducts (RAGE) were used to study mechanisms. Methylglyoxal-treated rats developed a significant increase in blood pressure and plasma levels of aldosterone, renin, angiotensin, and catecholamines. Methylglyoxal level and protein and mRNA for angiotensin, AT1 receptor, adrenergic α1D receptor, and renin were significantly increased in the aorta and/or kidney of methylglyoxal-treated rats, a novel finding. Alagebrium attenuated the above effects of methylgloyxal. Treatment of cultured VSMCs with methylglyoxal or high glucose (25 mM) significantly increased cellular methylglyoxal and protein and mRNA for nuclear factor kappa B (NF-κB), angiotensin, AT1 receptor, and α1D receptor, which were prevented by inhibition of NF-κB, and by alagebrium. Silencing of mRNA for RAGE prevented the increase in NF-kB induced by methylglyoxal. Silencing of mRNA for angiotensinogen prevented the increase in NF-κB, angiotensin, AT1 receptor, and α1D receptor. Methylglyoxal activates NF-κB through RAGE and thereby increases renin-angiotensin levels, a novel finding, and a probable mechanism of increase in blood pressure.

Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp; Inajima, Jun; Kato, Sayaka

The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6more » but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR.« less

Epithelial proliferation in small ducts of salivary cystadenoma resembling atypical ductal hyperplasia of breast.

PubMed

Fahim, Lisa; Weinreb, Ilan; Alexander, Cherupushpam; Perez Ordoñez, Bayardo

2008-09-01

Salivary gland cystadenomas are cystic neoplasms with diverse architecture and cytology. Cystadenomas may have a considerable intracystic epithelial component, but an epithelial proliferation in small ducts and cysts resembling atypical ductal hyperplasia of breast has not been documented. The patient was a 68-year-old man with a slow growing right submandibular mass. He has no recurrence 13 months after resection. The tumor was polycystic and measured 3.0 x 2.5 x 2.5 cm. The epithelium of the larger cysts was composed of flat, cuboidal, columnar, and apocrine-like cells. Many of the larger cysts showed "Roman bridges", epithelial tufting, and papillae. The smaller cysts and ducts had apocrine-like cells forming secondary glandular lumens. The ductal cells were surrounded by clear myoepithelial cells. Nuclear pleomorphism and hyperchromasia was seen in the apocrine-like cells. Adjacent to the larger cysts, there was an adenomatoid proliferation of small ducts surrounded by myoepithelial cells. No mitotic activity, necrosis, or stromal invasion was identified. The ductal cells were diffusely positive for keratin 7 and androgen receptors with focal expression of keratin 19 and high-molecular weight keratin. S-100, estrogen and progesterone receptors, and BRST-2 were negative in the ductal cells. Recognition of a prominent intraductal epithelial component in cystadenomas is important to avoid a misdiagnosis of cystadenocarcinoma or low-grade salivary duct carcinoma. Cystadenomas join the list of salivary gland lesions with microscopic similarities to primary lesions of the breast.

Hormonally active phytochemicals from macroalgae: A largely untapped source of ligands to deorphanize nuclear receptors in emerging marine animal models.

PubMed

Markov, Gabriel V; Girard, Jean; Laudet, Vincent; Leblanc, Catherine

2018-06-15

Hormonally active phytochemicals (HAPs) are signaling molecules produced by plants that alter hormonal signaling in animals, due to consumption or environmental exposure. To date, HAPs have been investigated mainly in terrestrial ecosystems. To gain a full understanding of the origin and evolution of plant-animal interactions, it is necessary also to study these interactions in the marine environment, where the major photosynthetic lineages are very distant from the terrestrial plants. Here we focus on chemicals from red and brown macroalgae and point out their potential role as modulators of the endocrine system of aquatic animals through nuclear hormone receptors. We show that, regarding steroids and oxylipins, there are already some candidates available for further functional investigations of ligand-receptor interactions. Furthermore, several carotenoids, produced by cyanobacteria provide candidates that could be investigated with respect to their presence in macroalgae. Finally, regarding halogenated compounds, it is not clear yet which molecules could bridge the gap to explain the transition from lipid sensing to thyroid hormone high affinity binding among nuclear receptors. Copyright © 2018 Elsevier Inc. All rights reserved.

Regulation of hepatic energy metabolism by the nuclear receptor PXR.

PubMed

Hakkola, Jukka; Rysä, Jaana; Hukkanen, Janne

2016-09-01

The pregnane X receptor (PXR) is a nuclear receptor that is traditionally thought to be specialized for sensing xenobiotic exposure. In concurrence with this feature PXR was originally identified to regulate drug-metabolizing enzymes and transporters. During the last ten years it has become clear that PXR harbors broader functions. Evidence obtained both in experimental animals and humans indicate that ligand-activated PXR regulates hepatic glucose and lipid metabolism and affects whole body metabolic homeostasis. Currently, the consequences of PXR activation on overall metabolic health are not yet fully understood and varying results on the effect of PXR activation or knockout on metabolic disorders and weight gain have been published in mouse models. Rifampicin and St. John's wort, the prototypical human PXR agonists, impair glucose tolerance in healthy volunteers. Chronic exposure to PXR agonists could potentially represent a risk factor for diabetes and metabolic syndrome. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. Copyright © 2016 Elsevier B.V. All rights reserved.

Transcription control and neuronal differentiation by agents that activate the LXR nuclear receptor family.

PubMed

Schmidt, A; Vogel, R; Holloway, M K; Rutledge, S J; Friedman, O; Yang, Z; Rodan, G A; Friedman, E

1999-09-10

LXR and PPAR receptors belong to the nuclear receptor superfamily of transcriptional activating factors. Using ligand-dependent transcription assays, we found that 5-tetradecyloxy-2-furancarboxylic acid (TOFA) transactivates chimeric receptors composed of the glucocorticoid receptor DNA binding domain and the ligand binding regions of PPARalpha, PPARbeta (NUC-1) and LXRbeta (NER) receptors. In the same assays, ligands for PPARs (oleic acid, WY-14643 and L-631,033) and LXRs (hydroxycholesterols) maintain their respective receptor selectivity. TOFA and hydroxycholesterols also stimulate transcription from a minimal fibrinogen promoter that is under the control of AP-1 or NF-kappaB transcription factor binding sites. In addition to their effects on transcription, these LXRbeta activators induce neuronal differentiation in rat pheochromocytoma cells. TOFA and the natural LXR agonist, 22 (R)-hydroxycholesterol, stimulate neurite outgrowth in 55 and 28% of cells, respectively. No neurite outgrowth was induced by the related 22(S)-hydroxycholesterol, which does not activate the LXR family. These results suggest that the hydroxycholesterol signaling pathway has a complex effect on transcription that mediates the activity of TOFA and hydroxycholesterol on neuronal differentiation in pheochromocytoma cells.

Modulation of PPAR activity via phosphorylation

PubMed Central

Burns, Katherine A.; Vanden Heuvel, John P.

2009-01-01

Peroxisome proliferator-activated receptors (PPARs) are members of the nuclear receptor superfamily of transcription factors that respond to specific ligands by altering gene expression in a cell-, developmental- and sex-specific manner. Three subtypes of this receptor have been discovered (PPARα, β and γ), each apparently evolving to fulfill different biological niches. PPARs control a variety of target genes involved in lipid homeostasis, diabetes and cancer. Similar to other nuclear receptors, the PPARs are phosphoproteins and their transcriptional activity is affected by cross-talk with kinases and phosphatases. Phosphorylation by the mitogen-activated protein kinases (ERK- and p38-MAPK), Protein Kinase A and C (PKA, PKC), AMP Kinase (AMPK) and glycogen synthase kinase-3 (GSK3) affect their activity in a ligand-dependent or -independent manner. The effects of phosphorylation depend on the cellular context, receptor subtype and residue metabolized which can be manifested at several steps in the PPAR activation sequence including ligand affinity, DNA binding, coactivator recruitment and proteasomal degradation. The review will summarize the known PPAR kinases that directly act on these receptors, the sites affected and the result of this modification on receptor activity. PMID:17560826

AtPAP2 modulates the import of the small subunit of Rubisco into chloroplasts.

PubMed

Zhang, Renshan; Guan, Xiaoqian; Law, Yee-Song; Sun, Feng; Chen, Shuai; Wong, Kam Bo; Lim, Boon Leong

2016-10-02

Arabidopsis thaliana purple acid phosphatase 2 (AtPAP2) is the only phosphatase that is dual-targeted to both chloroplasts and mitochondria. Like Toc33/34 of the TOC and Tom 20 of the TOM, AtPAP2 is anchored to the outer membranes of chloroplasts and mitochondria via a hydrophobic C-terminal motif. AtPAP2 on the mitochondria was previously shown to recognize the presequences of several nuclear-encoded mitochondrial proteins and modulate the import of pMORF3 into the mitochondria. Here we show that AtPAP2 binds to the small subunit of Rubisco (pSSU) and that chloroplast import experiments demonstrated that pSSU was imported less efficiently into pap2 chloroplasts than into wild-type chloroplasts. We propose that AtPAP2 is an outer membrane-bound phosphatase receptor that facilitates the import of selected proteins into chloroplasts.

Mitochondrial Effects of PGC-1alpha Silencing in MPP+ Treated Human SH-SY5Y Neuroblastoma Cells

PubMed Central

Ye, Qinyong; Chen, Chun; Si, Erwang; Cai, Yousheng; Wang, Juhua; Huang, Wanling; Li, Dongzhu; Wang, Yingqing; Chen, Xiaochun

2017-01-01

The dopaminergic neuron degeneration and loss that occurs in Parkinson’s disease (PD) has been tightly linked to mitochondrial dysfunction. Although the aged-related cause of the mitochondrial defect observed in PD patients remains unclear, nuclear genes are of potential importance to mitochondrial function. Human peroxisome proliferator-activated receptor γ coactivator-1alpha (PGC-1α) is a multi-functional transcription factor that tightly regulates mitochondrial biogenesis and oxidative capacity. The goal of the present study was to explore the potential pathogenic effects of interference by the PGC-1α gene on N-methyl-4-phenylpyridinium ion (MPP+)-induced SH-SY5Y cells. We utilized RNA interference (RNAi) technology to probe the pathogenic consequences of inhibiting PGC-1α in the SH-SY5Y cell line. Remarkably, a reduction in PGC-1α resulted in the reduction of mitochondrial membrane potential, intracellular ATP content and intracellular H2O2 generation, leading to the translocation of cytochrome c (cyt c) to the cytoplasm in the MPP+-induced PD cell model. The expression of related proteins in the signaling pathway (e.g., estrogen-related receptor α (ERRα), nuclear respiratory factor 1 (NRF-1), NRF-2 and Peroxisome proliferator-activated receptor γ (PPARγ)) also decreased. Our finding indicates that small interfering RNA (siRNA) interference targeting the PGC-1α gene could inhibit the function of mitochondria in several capacities and that the PGC-1α gene may modulate mitochondrial function by regulating the expression of ERRα, NRF-1, NRF-2 and PPARγ. Thus, PGC-1α can be considered a potential therapeutic target for PD. PMID:28611589

Antidiabetic actions of a phosphatidylcholine ligand for nuclear receptor LRH-1

PubMed Central

Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L.; Busby, Scott A.; Griffin, Patrick R.; Pathak, Manish C.; Ortlund, Eric A.; Moore, David D.

2011-01-01

Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (NR5A2) regulates bile acid biosynthesis1,2. Structural studies have identified phospholipids as potential LRH-1 ligands3–5, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine, DLPC) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signaling pathway that regulates bile acid metabolism and glucose homeostasis. PMID:21614002

A direct molecular link between the autism candidate gene RORa and the schizophrenia candidate MIR137

NASA Astrophysics Data System (ADS)

Devanna, Paolo; Vernes, Sonja C.

2014-02-01

Retinoic acid-related orphan receptor alpha gene (RORa) and the microRNA MIR137 have both recently been identified as novel candidate genes for neuropsychiatric disorders. RORa encodes a ligand-dependent orphan nuclear receptor that acts as a transcriptional regulator and miR-137 is a brain enriched small non-coding RNA that interacts with gene transcripts to control protein levels. Given the mounting evidence for RORa in autism spectrum disorders (ASD) and MIR137 in schizophrenia and ASD, we investigated if there was a functional biological relationship between these two genes. Herein, we demonstrate that miR-137 targets the 3'UTR of RORa in a site specific manner. We also provide further support for MIR137 as an autism candidate by showing that a large number of previously implicated autism genes are also putatively targeted by miR-137. This work supports the role of MIR137 as an ASD candidate and demonstrates a direct biological link between these previously unrelated autism candidate genes.

20180311 - Screening the 10K Tox21 chemical library for thyroid hormone receptor modulators (SOT)

EPA Science Inventory

Few ligands for the thyroid hormone receptor (TR) have been identified outside of endogenous ligands and pharmaceuticals, which suggests that TR is a very selective nuclear receptor (NR). However, large and diverse chemical libraries, particularly of environmental chemicals, have...

Regulation of Proteome Maintenance Gene Expression by Activators of Peroxisome Proliferator-Activated Receptor a (PPARa)

EPA Science Inventory

The nuclear receptor peroxisome proliferator-activated receptor alpha (PPARa) is activated by a large number of xenobiotic and hypolipidemic compounds called peroxisome proliferator chemicals (PPC). One agonist of PPARa (WY-14,643) regulates responses in the mouse liver to chemic...

T-cell receptor signaling enhances transcriptional elongation from latent HIV proviruses by activating P-TEFb through an ERK-dependent pathway.

PubMed

Kim, Young Kyeung; Mbonye, Uri; Hokello, Joseph; Karn, Jonathan

2011-07-29

Latent human immunodeficiency virus (HIV) proviruses are thought to be primarily reactivated in vivo through stimulation of the T-cell receptor (TCR). Activation of the TCR induces multiple signal transduction pathways, leading to the ordered nuclear migration of the HIV transcription initiation factors NF-κB (nuclear factor κB) and NFAT (nuclear factor of activated T-cells), as well as potential effects on HIV transcriptional elongation. We have monitored the kinetics of proviral reactivation using chromatin immunoprecipitation assays to measure changes in the distribution of RNA polymerase II in the HIV provirus. Surprisingly, in contrast to TNF-α (tumor necrosis factor α) activation, where early transcription elongation is highly restricted due to rate-limiting concentrations of Tat, efficient and sustained HIV elongation and positive transcription elongation factor b (P-TEFb) recruitment are detected immediately after the activation of latent proviruses through the TCR. Inhibition of NFAT activation by cyclosporine had no effect on either HIV transcription initiation or elongation. However, examination of P-TEFb complexes by gel-filtration chromatography showed that TCR signaling led to the rapid dissociation of the large inactive P-TEFb:7SK RNP (small nuclear RNA 7SK ribonucleoprotein) complex and the release of active low-molecular-weight P-TEFb complexes. Both P-TEFb recruitment to the HIV long terminal repeat and enhanced HIV processivity were blocked by the ERK (extracellular-signal-regulated kinase) inhibitor U0126, but not by AKT (serine/threonine protein kinase Akt) and PI3K (phosphatidylinositol 3-kinase) inhibitors. In contrast to treatment with HMBA (hexamethylene bisacetamide) and DRB (5,6-dichlorobenzimidazole 1-β-ribofuranoside), which disrupt the large 7SK RNP complex but do not stimulate early HIV elongation, TCR signaling provides the first example of a physiological pathway that can shift the balance between the inactive P-TEFb pool and the active P-TEFb pool and thereby stimulate proviral reactivation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Regulation of NT-PGC-1alpha subcellular localization and function by protein kinase A-dependent modulation of nuclear export by CRM1.

PubMed

Chang, Ji Suk; Huypens, Peter; Zhang, Yubin; Black, Chelsea; Kralli, Anastasia; Gettys, Thomas W

2010-06-04

Peroxisome proliferator-activated receptor gamma co-activator-1alpha (PGC-1alpha) plays a central role in the regulation of cellular energy metabolism and metabolic adaptation to environmental and nutritional stimuli. We recently described a novel, biologically active splice variant of PGC-1alpha (NT-PGC-1alpha, amino acids 1-270) that retains the ability to interact with and transactivate nuclear hormone receptors through its N-terminal transactivation domain. Whereas PGC-1alpha is an unstable nuclear protein sensitive to ubiquitin-mediated targeting to the proteasome, NT-PGC-1alpha is relatively stable and predominantly cytoplasmic, suggesting that its ability to interact with and activate nuclear receptors and transcription factors is dependent upon regulated access to the nucleus. We provide evidence that NT-PGC-1alpha interacts with the nuclear exportin, CRM1, through a specific leucine-rich domain (nuclear export sequence) that regulates its export to the cytoplasm. The nuclear export of NT-PGC-1alpha is inhibited by protein kinase A-dependent phosphorylation of Ser-194, Ser-241, and Thr-256 on NT-PGC-1alpha, which effectively increases its nuclear concentration. Using site-directed mutagenesis to prevent or mimic phosphorylation at these sites, we show that the transcriptional activity of NT-PGC-1alpha is regulated in part through regulation of its subcellular localization. These findings suggest that the function of NT-PGC-1alpha as a transcriptional co-activator is regulated by protein kinase A-dependent inhibition of CRM1-mediated export from the nucleus.

A Review About Lycopene-Induced Nuclear Hormone Receptor Signalling in Inflammation and Lipid Metabolism via still Unknown Endogenous Apo-10´-Lycopenoids.

PubMed

Caris-Veyrat, Catherine; Garcia, Ada L; Reynaud, Eric; Lucas, Renata; Aydemir, Gamze; Rühl, Ralph

2017-10-20

Lycopene is the red pigment in tomatoes and tomato products and is an important dietary carotenoid found in the human organism. Lycopene-isomers, oxidative lycopene metabolites and apo-lycopenoids are found in the food matrix. Lycopene intake derived from tomato consumption is associated with alteration of lipid metabolism and a lower incidence of cardiovascular diseases (CVD). Lycopene is mainly described as a potent antioxidant but novel studies are shifting towards its metabolites and their capacity to mediate nuclear receptor signalling. Di-/tetra-hydro-derivatives of apo-10´-lycopenoic acid and apo-15´-lycopenoic acids are potential novel endogenous mammalian lycopene metabolites which may act as ligands for nuclear hormone mediated activation and signalling. In this review, we postulate that complex lycopene metabolism results in various lycopene metabolites which have the ability to mediate transactivation of various nuclear hormone receptors like RARs, RXRs and PPARs. A new mechanistic explanation of how tomato consumption could positively modulate inflammation and lipid metabolism is discussed.

Morphological study of the prostate gland in viscacha (Lagostomus maximus maximus) during periods of maximal and minimal reproductive activity.

PubMed

Chaves, Maximiliano; Aguilera-Merlo, Claudia; Cruceño, Albana; Fogal, Teresa; Mohamed, Fabian

2015-11-01

The viscacha (Lagostomus maximus maximus) is a rodent with photoperiod-dependent seasonal reproduction. The aim of this work was to study the morphological variations of the prostate during periods of maximal (summer, long photoperiod) and minimal (winter, short photoperiod) reproductive activity. Prostates of adult male viscachas were studied by light and electron microscopy, immunohistochemistry for androgen receptor, and morphometric analysis. The prostate consisted of two regions: peripheral and central. The peripheral zone exhibited large adenomeres with a small number of folds and lined with a pseudostratified epithelium. The central zone had small adenomeres with pseudostratified epithelium and the mucosa showed numerous folds. The morphology of both zones showed variations during periods of maximal and minimal reproductive activity. The prostate weight, prostate-somatic index, luminal diameter of adenomeres, epithelial height and major nuclear diameter decreased during the period of minimal reproductive activity. Principal cells showed variations in their shape, size and ultrastructural characteristics during the period of minimal reproductive activity in comparison with the active period. The androgen receptor expression in epithelial and fibromuscular stromal cells was different between the studied periods. Our results suggest a reduced secretory activity of viscacha prostate during the period of minimal reproductive activity. Thus, the morphological variations observed in both the central and peripheral zones of the viscacha prostate agree with the results previously obtained in the gonads of this rodent of photoperiod-dependent reproduction. Additionally, the variations observed in the androgen receptors suggest a direct effect of the circulating testosterone on the gland. © 2015 Wiley Periodicals, Inc.

Knowledge-Based Methods To Train and Optimize Virtual Screening Ensembles

PubMed Central

2016-01-01

Ensemble docking can be a successful virtual screening technique that addresses the innate conformational heterogeneity of macromolecular drug targets. Yet, lacking a method to identify a subset of conformational states that effectively segregates active and inactive small molecules, ensemble docking may result in the recommendation of a large number of false positives. Here, three knowledge-based methods that construct structural ensembles for virtual screening are presented. Each method selects ensembles by optimizing an objective function calculated using the receiver operating characteristic (ROC) curve: either the area under the ROC curve (AUC) or a ROC enrichment factor (EF). As the number of receptor conformations, N, becomes large, the methods differ in their asymptotic scaling. Given a set of small molecules with known activities and a collection of target conformations, the most resource intense method is guaranteed to find the optimal ensemble but scales as O(2N). A recursive approximation to the optimal solution scales as O(N2), and a more severe approximation leads to a faster method that scales linearly, O(N). The techniques are generally applicable to any system, and we demonstrate their effectiveness on the androgen nuclear hormone receptor (AR), cyclin-dependent kinase 2 (CDK2), and the peroxisome proliferator-activated receptor δ (PPAR-δ) drug targets. Conformations that consisted of a crystal structure and molecular dynamics simulation cluster centroids were used to form AR and CDK2 ensembles. Multiple available crystal structures were used to form PPAR-δ ensembles. For each target, we show that the three methods perform similarly to one another on both the training and test sets. PMID:27097522

Therapeutic androgen receptor ligands

PubMed Central

Allan, George F.; Sui, Zhihua

2003-01-01

In the past several years, the concept of tissue-selective nuclear receptor ligands has emerged. This concept has come to fruition with estrogens, with the successful marketing of drugs such as raloxifene. The discovery of raloxifene and other selective estrogen receptor modulators (SERMs) has raised the possibility of generating selective compounds for other pathways, including androgens (that is, selective androgen receptor modulators, or SARMs). PMID:16604181

Computer-Aided Drug Design (CADD): Methodological Aspects and Practical Applications in Cancer Research

NASA Astrophysics Data System (ADS)

Gianti, Eleonora

Computer-Aided Drug Design (CADD) has deservedly gained increasing popularity in modern drug discovery (Schneider, G.; Fechner, U. 2005), whether applied to academic basic research or the pharmaceutical industry pipeline. In this work, after reviewing theoretical advancements in CADD, we integrated novel and stateof- the-art methods to assist in the design of small-molecule inhibitors of current cancer drug targets, specifically: Androgen Receptor (AR), a nuclear hormone receptor required for carcinogenesis of Prostate Cancer (PCa); Signal Transducer and Activator of Transcription 5 (STAT5), implicated in PCa progression; and Epstein-Barr Nuclear Antigen-1 (EBNA1), essential to the Epstein Barr Virus (EBV) during latent infections. Androgen Receptor. With the aim of generating binding mode hypotheses for a class (Handratta, V.D. et al. 2005) of dual AR/CYP17 inhibitors (CYP17 is a key enzyme for androgens biosynthesis and therefore implicated in PCa development), we successfully implemented a receptor-based computational strategy based on flexible receptor docking (Gianti, E.; Zauhar, R.J. 2012). Then, with the ultimate goal of identifying novel AR binders, we performed Virtual Screening (VS) by Fragment-Based Shape Signatures, an improved version of the original method developed in our Laboratory (Zauhar, R.J. et al. 2003), and we used the results to fully assess the high-level performance of this innovative tool in computational chemistry. STAT5. The SRC Homology 2 (SH2) domain of STAT5 is responsible for phospho-peptide recognition and activation. As a keystone of Structure-Based Drug Design (SBDD), we characterized key residues responsible for binding. We also generated a model of STAT5 receptor bound to a phospho-peptide ligand, which was validated by docking publicly known STAT5 inhibitors. Then, we performed Shape Signatures- and docking-based VS of the ZINC database (zinc.docking.org), followed by Molecular Mechanics Generalized Born Surface Area (MMGBSA) simulations, paired with Principal Component Analysis (PCA) of top-scoring hits to identify novel lead molecules likely to be active against STAT5. EBNA1 is the only viral protein consistently expressed in the many EBV-associated tumors, and is required for viral genome maintenance during latent infection. To immediately assist SBDD, we computationally identified "druggable" binding sites of EBNA1, and our predictions were later confirmed by experimental evidence (The Wistar Institute proprietary data).

Expression profiling of nuclear receptors in breast cancer identifies TLX as a mediator of growth and invasion in triple-negative breast cancer

PubMed Central

Remenyi, Judit; Banerji, Christopher R.S.; Lai, Chun-Fui; Periyasamy, Manikandan; Lombardo, Ylenia; Busonero, Claudia; Ottaviani, Silvia; Passey, Alun; Quinlan, Philip R.; Purdie, Colin A.; Jordan, Lee B.; Thompson, Alastair M.; Finn, Richard S.; Rueda, Oscar M.; Caldas, Carlos; Gil, Jesus; Coombes, R. Charles; Fuller-Pace, Frances V.; Teschendorff, Andrew E.; Buluwela, Laki; Ali, Simak

2015-01-01

The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other NR and there is evidence that ERα function may be recapitulated by other NRs in ERα-negative breast cancer. In order to examine the inter-relationships between nuclear receptors, and to obtain evidence for previously unsuspected roles for any NRs, we undertook quantitative RT-PCR and bioinformatics analysis to examine their expression in breast cancer. While most NRs were expressed, bioinformatic analyses differentiated tumours into distinct prognostic groups that were validated by analyzing public microarray data sets. Although ERα and progesterone receptor were dominant in distinguishing prognostic groups, other NR strengthened these groups. Clustering analysis identified several family members with potential importance in breast cancer. Specifically, RORγ is identified as being co-expressed with ERα, whilst several NRs are preferentially expressed in ERα-negative disease, with TLX expression being prognostic in this subtype. Functional studies demonstrated the importance of TLX in regulating growth and invasion in ERα-negative breast cancer cells. PMID:26280373

Novel protective role of the circadian nuclear receptor retinoic acid-related orphan receptor-α in diabetic cardiomyopathy.

PubMed

Zhao, Yichao; Xu, Longwei; Ding, Song; Lin, Nan; Ji, Qingqi; Gao, Lingchen; Su, Yuanyuan; He, Ben; Pu, Jun

2017-04-01

Diabetic cardiomyopathy is a major complication that significantly contributes to morbidity and mortality in diabetics with few therapies. Moreover, antidiabetic drugs reported inconsistent or even adverse cardiovascular effects, suggesting that it is important to exploit novel therapeutic targets against diabetic cardiomyopathy. Here, we observed that the nuclear melatonin receptor, the retinoic acid-related orphan receptor-α (RORα), was downregulated in diabetic hearts. By utilizing a mouse line with RORα disruption, we demonstrated that RORα deficiency led to significantly augmented diastolic dysfunction and cardiac remodeling induced by diabetes. Microscopic and molecular analyses further indicated that the detrimental effects of RORα deficiency were associated with aggravated myocardial apoptosis, autophagy dysfunction, and oxidative stress by disrupting antioxidant gene expression. By contrast, restoration of cardiac RORα levels in transgenic mice significantly improved cardiac functional and structural parameters at 8 weeks after diabetes induction. Consistent with genetic manipulation, pharmacological activation of RORα by melatonin and SR1078 (a synthetic agonist) showed beneficial effects against diabetic cardiomyopathy, while the RORα inhibitor SR3335 significantly exacerbated cardiac impairments in diabetic mice. Collectively, these findings suggest that cardiac-targeted manipulation of nuclear melatonin receptor RORα may hold promise for delaying diabetic cardiomyopathy development. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Characterization of karyopherins in androgen receptor intracellular trafficking in the yeast model

PubMed Central

Nguyen, Minh M; Harmon, Robert M; Wang, Zhou

2014-01-01

Background: Mechanisms regulating androgen receptor (AR) subcellular localization represent an essential component of AR signaling. Karyopherins are a family of nucleocytoplasmic trafficking factors. In this paper, we used the yeast model to study the effects of karyopherins on the subcellular localization of the AR. Methods: Yeast mutants deficient in different nuclear transport factors were transformed with various AR based, GFP tagged constructs and their localization was monitored using microscopy. Results: We showed that yeast can mediate androgen-induced AR nuclear localization and that in addition to the import factor, Importinα/β, this process required the import karyopherin Sxm1. We also showed that a previously identified nuclear export sequence (NESAR) in the ligand binding domain of AR does not appear to rely on karyopherins for cytoplasmic localization. Conclusions: These results suggest that while AR nuclear import relies on karyopherin activity, AR nuclear export and/or cytoplasmic localization may require other undefined mechanisms. PMID:25031696

PEROXISOME-PROLIFERATOR ACTIVATED RECEPTORS AS A MACROMOLECULAR TARGET FOR CHEMICAL TOXICITY: MODELS OF THE INTERACTIONS OF PPARS WITH PERFLUORINATED ORGANIC COMPOUNDS.

EPA Science Inventory

The Peroxisome Proliferator Activated Receptors (PPARs), a class of nuclear receptors that modulate both transcription and metabolic processes, are implicated in a variety of metabolic disorders linked to lipidogenesis, adipose tissue accumulation, fatty-acid oxidation pathways, ...

Regulation of subcellular localization of the Aryl Hydrocarbon Receptor (AhR)

USGS Publications Warehouse

Richter, Catherine A.; Tillitt, Donald E.; Hannink, Mark

2001-01-01

The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that mediates the toxicity of dioxin and other xenobiotics. In the absence of exogenous ligand, AhR is cytosolic. We investigated how AhR is retained in the cytosol and how dioxin induces AhR to move to the nucleus. Disruption of nuclear export of AhR by the nuclear export inhibitor leptomycin B (LMB) or by mutation of the AhR nuclear export signal resulted in nuclear accumulation of AhR in the absence of exogenous ligand. Mutation of the AhR nuclear localization signal resulted in defects in nuclear import of AhR in both the presence and the absence of exogenous ligand. Dioxin treatment caused a more rapid accumulation of AhR in the nucleus than LMB treatment. In the presence of both dioxin and LMB, nuclear accumulation of AhR was more rapid than in the presence of dioxin alone. Our results show that AhR shuttles between the nucleus and the cytosol in the absence of exogenous ligand. Binding of ligand induces an increase in the rate of nuclear import of AhR but does not eliminate nuclear export of AhR.

Detection of pAkt protein in imprint cytology of invasive breast cancer: Correlation with HER2/neu, hormone receptors, and other clinicopathological variables.

PubMed

Vasou, Olympia; Skagias, Lazaros; Anastasia, Margariti; Paulina, Athanasiadou; Patsouris, Efstratios; Politi, Ekaterini

2015-01-01

Akt is a serine/threonine protein kinase and has emerged as a crucial regulator of widely divergent cellular processes, including apoptosis, proliferation, differentiation, and metabolism. Activation of Akt/protein kinase B has been positively associated with human epidermal growth-factor receptor 2 (HER2)/neu overexpression in breast carcinoma and a worse outcome among endocrine treated patients. The Akt signaling pathway currently attracts considerable attention as a new target for effective therapeutic strategies. We therefore investigated the relationship between activation of Akt and clinicopathologic variables including hormone receptor and HER2/neu status. Archival tumor tissues from 100 patients with invasive breast carcinoma were analyzed by immunocytochemistry. This study describes the results of immunocytochemical pAkt expression in breast carcinoma imprints, prepared from cut surfaces of freshly removed tumors. Both nuclear and cytoplasmic expressions were evaluated for pAkt. Nuclear and cytoplasmic positive scores of 72% (72/100) and 42% (42/100), respectively, were found. Coexistence of nuclear and cytoplasmic staining was observed in 32 cases (32/100). Nuclear positive staining correlated with HER2/neu overexpression (P = 0.043) and was significantly associated with positive involvement of axillary lymph nodes (P = 0.013). No correlation was found between cytoplasmic pAkt rate and clinicopathological parameters, estrogen receptor, progesterone receptor or HER2/neu expression. pAkt expression can be evaluated in cytological material and may add valuable information to current prognostic models for breast cancer. pAkt overexpression appears to be linked with potentially aggressive tumor phenotype in invasive breast carcinoma.

Transactivation Assays that Identify Indirect and Direct Activators of Human Pregnane X Receptor (PXR, NR1I2) and Constitutive Androstane Receptor (CAR, NR1I3).

PubMed

Pinne, Marija; Ponce, Elsa; Raucy, Judy L

2017-01-01

Nuclear Receptors (NRs), including PXR and CAR, are presumed to be ligand-dependent transcription factors, but ligand binding is not an absolute requirement for activation. Indeed, many compounds activate PXR and CAR by indirect mechanisms. Detecting these indirect activators of specific nuclear receptors in vitro has been difficult. As NR activation of either or both PXR and CAR can lead to drug-drug interactions and adverse drug effects, false negatives obtained with screening tools incapable of detecting indirect activators could present liabilities. The aim of this study was to establish assays that identify indirect activators of human PXR and CAR. Commercially available human PXR and CAR transactivation assays were used for analyses. We show that transactivation assays containing full-length nuclear receptors with native promoters can identify indirect activators of human CAR and PXRwhen compared to those of commercially available assays containing only the LBD of PXR and CAR. Of these two assay systems, only human PXR and CAR1 assays with full-length receptors and native promoters are capable of detecting indirect and ligand activators. With this capability, several kinase inhibitors were identified that activate PXR and CAR by indirect mechanisms. Furthermore by using both the LBD and full-length receptors, phenobarbital and midostaurin were found to be direct and indirect activators of PXR while human CAR activation by phenobarbital occurs by indirect mechanisms only. Cell based transactivation assays employing the full-length receptors and native promoters identify both direct and indirect activators of either or both human PXR and CAR. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The export receptor Crm1 forms a dimer to promote nuclear export of HIV RNA.

PubMed

Booth, David S; Cheng, Yifan; Frankel, Alan D

2014-12-08

The HIV Rev protein routes viral RNAs containing the Rev Response Element (RRE) through the Crm1 nuclear export pathway to the cytoplasm where viral proteins are expressed and genomic RNA is delivered to assembling virions. The RRE assembles a Rev oligomer that displays nuclear export sequences (NESs) for recognition by the Crm1-Ran(GTP) nuclear receptor complex. Here we provide the first view of an assembled HIV-host nuclear export complex using single-particle electron microscopy. Unexpectedly, Crm1 forms a dimer with an extensive interface that enhances association with Rev-RRE and poises NES binding sites to interact with a Rev oligomer. The interface between Crm1 monomers explains differences between Crm1 orthologs that alter nuclear export and determine cellular tropism for viral replication. The arrangement of the export complex identifies a novel binding surface to possibly target an HIV inhibitor and may point to a broader role for Crm1 dimerization in regulating host gene expression.

Retinoic acid induces nuclear accumulation of Raf1 during differentiation of HL-60 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, James; Bunaciu, Rodica P.; Reiterer, Gudrun

All trans-retinoic acid (RA) is a standard therapeutic agent used in differentiation induction therapy treatment of acute promyelocytic leukemia (APL). RA and its metabolites use a diverse set of signal transduction pathways during the differentiation program. In addition to the direct transcriptional targets of the nuclear RAR and RXR receptors, signals derived from membrane receptors and the Raf-MEK-ERK pathway are required. Raf1 phosphorylation and the prolonged activation of Raf1 persisting during the entire differentiation process are required for RA-dependent differentiation of HL-60 cells. Here we identify a nuclear redistribution of Raf1 during the RA-induced differentiation of HL-60 cells. In addition,more » the nuclear accumulation of Raf1 correlates with an increase in Raf1 phosphorylated at serine 621. The serine 621 phosphorylated Raf1 is predominantly localized in the nucleus. The RA-dependent nuclear accumulation of Raf1 suggests a novel nuclear role for Raf1 during the differentiation process.« less

β-Carotene-9′,10′-Oxygenase Status Modulates the Impact of Dietary Tomato and Lycopene on Hepatic Nuclear Receptor–, Stress-, and Metabolism-Related Gene Expression in Mice123

PubMed Central

Tan, Hsueh-Li; Moran, Nancy E.; Cichon, Morgan J.; Riedl, Ken M.; Schwartz, Steven J.; Erdman, John W.; Pearl, Dennis K.; Thomas-Ahner, Jennifer M.; Clinton, Steven K.

2014-01-01

Tomato and lycopene (ψ, ψ-carotene) consumption is hypothesized to protect against nonalcoholic steatohepatitis and hepatocarcinogenesis, processes that may depend upon diet and gene interactions. To investigate the interaction of tomato or lycopene feeding with β-carotene-9′,10′-monooxygenase (Bco2) on hepatic metabolic and signaling pathways, male wild-type (WT) and Bco2−/− mice (3-wk-old; n = 36) were fed semi-purified control, 10% tomato powder–containing, or 0.25% lycopene beadlet–containing diets for 3 wk. Serum lycopene concentrations were higher in lycopene- and tomato-fed Bco2−/− mice compared with WT (P = 0.03). Tomato- and lycopene-fed mice had detectable hepatic apolipoprotein (apo)-6′-, apo-8′-, and apo-12′-lycopenal concentrations. Hepatic expression of β-carotene-15,15’-monooxygenase was increased in Bco2−/− mice compared with WT (P = 0.02), but not affected by diet. Evaluation of hepatic gene expression by focused quantitative reverse transcriptase-polymerase chain reaction arrays for nuclear receptors and coregulators (84 genes) and stress and metabolism (82 genes) genes indicates that tomato feeding affected 31 genes (≥1.5-fold, P < 0.05) and lycopene feeding affected 19 genes, 16 of which were affected by both diets. Lycopene down-regulation of 7 nuclear receptors and coregulators, estrogen-related receptor-α, histone deacetylase 3, nuclear receptor coactivator 4, RevErbA-β, glucocorticoid receptor, peroxisome proliferator-activated receptor (PPAR)-α, and PPAR-γ, coactivator 1 β was dependent upon interaction with Bco2 status. Lycopene and tomato feeding induced gene expression patterns consistent with decreased lipid uptake, decreased cell proliferation and mitosis, down-regulated aryl hydrocarbon receptor signaling, and decreased expression of genes involved in retinoid X receptor heterodimer activation. Tomato feeding also caused expression changes consistent with down-regulation of DNA synthesis and terpenoid metabolism. These data suggest tomato components, particularly lycopene, affect hepatic gene expression, potentially affecting hepatic responses to metabolic, infectious, or chemical stress. PMID:24553694

Retinal dehydrogenase gene expression in stomach and small intestine of rats during postnatal development and in vitamin A deficiency.

PubMed

Bhat, P V

1998-04-17

Retinal dehydrogenase (RALDH) catalyzes the oxidation of retinal to all-trans and 9-cis retinoic acid, which function as ligands controlling RAR and RXR nuclear receptor-signaling pathways. We have recently shown the expression of RALDH transcript in the stomach and small intestine by reverse transcription polymerase chain reaction [Bhat, P.V., Labrecque J., Dumas, F., Lacroix, A. and Yoshida, A. (1995) Gene 166, 303-306]. We have examined RALDH expression in the stomach and small intestine before and during postnatal development and in vitamin A deficiency by assaying for mRNA levels and protein as well as for enzyme activity. In -2 day fetuses, RALDH expression was high in the small intestine, whereas RALDH protein was not detectable in the stomach. However, expression of RALDH was seen in the stomach after birth, and gradually increased with age and reached the highest level at postnatal day 42. In the intestine, RALDH expression decreased postnatally. Vitamin A deficiency up-regulated RALDH expression in the stomach and small intestine, and administration of retinoids down-regulated the RALDH expression in these tissues. These results show the differential expression of RALDH in the stomach and small intestine during postnatal development, and that vitamin A status regulates the expression of RALDH gene in these tissues.

Nuclear receptor co-activators and HER-2/neu are upregulated in breast cancer patients during neo-adjuvant treatment with aromatase inhibitors

PubMed Central

Flågeng, M Hauglid; Haugan Moi, L L; Dixon, J M; Geisler, J; Lien, E A; Miller, W R; Lønning, P E; Mellgren, G

2009-01-01

Background: Acquired resistance to endocrine therapy in breast cancer is poorly understood. Characterisation of the molecular response to aromatase inhibitors in breast cancer tissue may provide important information regarding development of oestrogen hypersensitivity. Methods: We examined the expression levels of nuclear receptor co-regulators, the orphan nuclear receptor liver receptor homologue-1 and HER-2/neu growth factor receptor using real-time RT-PCR before and after 13–16 weeks of primary medical treatment with the aromatase inhibitors anastrozole or letrozole. Results: mRNA expression of the steroid receptor co-activator 1 (SRC-1) and peroxisome-proliferator-activated receptor γ co-activator-1α (PGC-1α) was correlated (P=0.002), and both co-activators increased during treatment in the patient group as a whole (P=0.008 and P=0.032, respectively), as well as in the subgroup of patients achieving an objective treatment response (P=0.002 and P=0.006). Although we recorded no significant change in SRC-3/amplified in breast cancer 1 level, the expression correlated positively to the change of SRC-1 (P=0.002). Notably, we recorded an increase in HER-2/neu levels during therapy in the total patient group (18 out of 26; P=0.016), but in particular among responders (15 out of 21; P=0.008). Conclusion: Our results show an upregulation of co-activator mRNA and HER-2/neu during treatment with aromatase inhibitors. These mechanisms may represent an early adaption of the breast cancer cells to oestrogen deprivation in vivo. PMID:19755984

Systematic analysis of barrier-forming FG hydrogels from Xenopus nuclear pore complexes

PubMed Central

Labokha, Aksana A; Gradmann, Sabine; Frey, Steffen; Hülsmann, Bastian B; Urlaub, Henning; Baldus, Marc; Görlich, Dirk

2013-01-01

Nuclear pore complexes (NPCs) control the traffic between cell nucleus and cytoplasm. While facilitating translocation of nuclear transport receptors (NTRs) and NTR·cargo complexes, they suppress passive passage of macromolecules ⩾30 kDa. Previously, we reconstituted the NPC barrier as hydrogels comprising S. cerevisiae FG domains. We now studied FG domains from 10 Xenopus nucleoporins and found that all of them form hydrogels. Related domains with low FG motif density also substantially contribute to the NPC's hydrogel mass. We characterized all these hydrogels and observed the strictest sieving effect for the Nup98-derived hydrogel. It fully blocks entry of GFP-sized inert objects, permits facilitated entry of the small NTR NTF2, but arrests importin β-type NTRs at its surface. O-GlcNAc modification of the Nup98 FG domain prevented this arrest and allowed also large NTR·cargo complexes to enter. Solid-state NMR spectroscopy revealed that the O-GlcNAc-modified Nup98 gel lacks amyloid-like β-structures that dominate the rigid regions in the S. cerevisiae Nsp1 FG hydrogel. This suggests that FG hydrogels can assemble through different structural principles and yet acquire the same NPC-like permeability. PMID:23202855

CORTICOSTEROIDS AND MUSCLE WASTING ROLE OF TRANSCRIPTION FACTORS, NUCLEAR COFACTORS, AND HYPERACETYLATION

PubMed Central

Hasselgren, Per-Olof; Alamdari, Nima; Aversa, Zaira; Gonnella, Patricia; Smith, Ira J; Tizio, Steven

2010-01-01

Purpose of review The purpose of this review is to discuss novel insight into mechanisms of glucocorticoid-regulated muscle wasting, in particular the role of transcription factors and nuclear cofactors. In addition, novel strategies that may become useful in the treatment or prevention of glucocorticoid-induced muscle wasting are reviewed. Recent findings Studies suggest that glucocorticoid-induced upregulation of the transcription factors FOXO1 and C/EBPβ and downregulation of MyoD and myogenin are involved in glucocorticoid-induced muscle wasting. In addition, glucocorticoid-induced hyperacetylation caused by increased expression of the nuclear cofactor p300 and its histone acetyl transferase activity and decreased expression and activity of histone deacetylases (HDACs) plays an important role in glucocorticoid-induced muscle proteolysis and wasting. Other mechanisms may also be involved in glucocorticoid-induced muscle wasting, including insulin resistance and store-operated calcium entry. Novel potential strategies to prevent or treat glucocorticoid-induced muscle wasting include the use of small molecule HDAC activators, dissociated glucocorticoid receptor agonists, and 11β-hydroxysteroid dehydrogenase type 1 inhibitors. Summary An increased understanding of molecular mechanisms regulating glucocorticoid-induced muscle wasting will help develop new strategies to prevent and treat this debilitating condition. PMID:20473154

The Hsp90 Inhibitor, 17-AAG, Prevents the Ligand-Independent Nuclear Localization of Androgen Receptor in Refractory Prostate Cancer Cells

PubMed Central

Saporita, Anthony J.; Ai, Junkui; Wang, Zhou

2010-01-01

BACKGROUND Androgen receptor (AR) is the key molecule in androgen-refractory prostate cancer. Despite androgen ablative conditions, AR remains active and is necessary for the growth of androgen-refractory prostate cancer cells. Nuclear localization of AR is a prerequisite for its transcriptional activation. We examined AR localization in androgen-dependent and androgen-refractory prostate cancer cells. METHODS AND RESULTS We demonstrate increased nuclear localization of a GFP-tagged AR in the absence of hormone in androgen-refractory C4-2 cells compared to parental androgen-sensitive human prostate cancer LNCaP cells. Analysis of AR mutants impaired in ligand-binding indicates that the nuclear localization of AR in C4-2 cells is truly androgen-independent. The hsp90 inhibitor, 17-allylamino-17-demethoxygeldanamycin (17-AAG), inhibits basal PSA expression and disrupts the ligand-independent nuclear localization of AR at doses much lower than required to inhibit androgen-induced nuclear import. CONCLUSIONS Hsp90 is a key regulator of ligand-independent nuclear localization and activation of AR in androgen-refractory prostate cancer cells. PMID:17221841

The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

PubMed

Magna, Melinda; Pisetsky, David S

2016-05-01

The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

Molecular targets for small-molecule modulators of circadian clocks

PubMed Central

He, Baokun; Chen, Zheng

2016-01-01

Background Circadian clocks are endogenous timing systems that regulate various aspects of mammalian metabolism, physiology and behavior. Traditional chronotherapy refers to the administration of drugs in a defined circadian time window to achieve optimal pharmacokinetic and therapeutic efficacies. In recent years, substantial efforts have been dedicated to developing novel small-molecule modulators of circadian clocks. Methods Here, we review the recent progress in the identification of molecular targets of small-molecule clock modulators and their efficacies in clock-related disorders. Specifically, we examine the clock components and regulatory factors as possible molecular targets of small molecules, and we review several key clock-related disorders as promising venues for testing the preventive/therapeutic efficacies of these small molecules. Finally, we also discuss circadian regulation of drug metabolism. Results Small molecules can modulate the period, phase and/or amplitude of the circadian cycle. Core clock proteins, nuclear hormone receptors, and clock-related kinases and other epigenetic regulators are promising molecular targets for small molecules. Through these targets small molecules exert protective effects against clock-related disorders including the metabolic syndrome, immune disorders, sleep disorders and cancer. Small molecules can also modulate circadian drug metabolism and response to existing therapeutics. Conclusion Small-molecule clock modulators target clock components or diverse cellular pathways that functionally impinge upon the clock. Target identification of new small-molecule modulators will deepen our understanding of key regulatory nodes in the circadian network. Studies of clock modulators will facilitate their therapeutic applications, alone or in combination, for clock-related diseases. PMID:26750111

Signaling in Parasitic Nematodes: Physicochemical Communication Between Host and Parasite and Endogenous Molecular Transduction Pathways Governing Worm Development and Survival.

PubMed

Lok, James B

2016-12-01

Signaling or communication between host and parasite may occur over relatively long ranges to enable host finding and acquisition by infective parasitic nematode larvae. Innate behaviors in infective larvae transmitted from the soil that enhance the likelihood of host contact, such as negative geotaxis and hypermotility, are likely mediated by mechanoreception and neuromuscular signaling. Host cues such as vibration of the substratum, elevated temperature, exhaled CO 2 , and other volatile odorants are perceived by mechanosensory and chemosensory neurons of the amphidial complex. Beyond this, the molecular systems that transduce these external cues within the worm are unknown at this time. Overall, the signal transduction mechanisms that regulate switching between dauer and continuous reproductive development in Caenorhabditis elegans , and doubtless other free-living nematodes, have provided a useful framework for testing hypotheses about how the morphogenesis and development of infective parasitic nematode larvae and the lifespan of adult parasites are regulated. In C. elegans , four major signal transduction pathways, G protein-coupled receptor signaling, insulin/insulin-like growth factor signaling, TGFβ-like signaling and steroid-nuclear hormone receptor signaling govern the switch between dauer and continuous development and regulate adult lifespan. Parasitic nematodes appear to have conserved the functions of G-protein-coupled signaling, insulin-like signaling and steroid-nuclear hormone receptor signaling to regulate larval development before and during the infective process. By contrast, TGFβ-like signaling appears to have been adapted for some other function, perhaps modulation of the host immune response. Of the three signal transduction pathways that appear to regulate development in parasitic nematodes, steroid-nuclear hormone signaling is the most straightforward to manipulate with administered small molecules and may form the basis of new chemotherapeutic strategies. Signaling between parasites and their hosts' immune systems also occurs and serves to modulate these responses to allow chronic infection and down regulate acute inflammatory responses. Knowledge of the precise nature of this signaling may form the basis of immunological interventions to protect against parasitism or related lesions and to alleviate inflammatory diseases of various etiologies.

Utilization of DR1 as true RARE in regulating the Ssm, a novel retinoic acid-target gene in the mouse testis.

PubMed

Han, Kyuyong; Song, Haengseok; Moon, Irene; Augustin, Robert; Moley, Kelle; Rogers, Melissa; Lim, Hyunjung

2007-03-01

Various nuclear receptors form dimers to activate target genes via specific response elements located within promoters or enhancers. Retinoid X receptor (RXR) serves as a dimerization partner for many nuclear receptors including retinoic acid receptor (RAR) and peroxisome proliferator-activated receptor (PPAR). Dimers show differential preference towards directly repeated response elements with 1-5 nucleotide spacing, and direct repeat 1 (DR1) is a promiscuous element which recruits RAR/RXR, RXR/RXR, and PPAR/RXR in vitro. In the present investigation, we report identification of a novel RAR/RXR target gene which is regulated by DR1s in the promoter region. This gene, namely spermatocyte-specific marker (Ssm), recruits all the three combinations of nuclear receptors in vitro, but in vivo regulation is observed by trans-retinoic acid-activated RAR/RXR dimer. Indeed, chromatin immunoprecipitation experiment demonstrates binding of RARbeta and RXRalpha in the promoter region of the Ssm. Interestingly, expression of Ssm is almost exclusively observed in spermatocytes in the adult mouse testis, where RA signaling is known to regulate developmental program of male germ cells. The results show that Ssm is a RAR/RXR target gene uniquely using DR1 and exhibits stage-specific expression in the mouse testis with potential function in later stages of spermatogenesis. This finding exemplifies usage of DR1s as retinoic acid response element (RARE) under a specific in vivo context.

Molecular Determinants of Magnolol Targeting Both RXRα and PPARγ

PubMed Central

Chen, Lili; Chen, Jing; Hu, Lihong; Jiang, Hualiang; Shen, Xu

2011-01-01

Nuclear receptors retinoic X receptor α (RXRα) and peroxisome proliferator activated receptor γ (PPARγ) function potently in metabolic diseases, and are both important targets for anti-diabetic drugs. Coactivation of RXRα and PPARγ is believed to synergize their effects on glucose and lipid metabolism. Here we identify the natural product magnolol as a dual agonist targeting both RXRα and PPARγ. Magnolol was previously reported to enhance adipocyte differentiation and glucose uptake, ameliorate blood glucose level and prevent development of diabetic nephropathy. Although magnolol can bind and activate both of these two nuclear receptors, the transactivation assays indicate that magnolol exhibits biased agonism on the transcription of PPAR-response element (PPRE) mediated by RXRα:PPARγ heterodimer, instead of RXR-response element (RXRE) mediated by RXRα:RXRα homodimer. To further elucidate the molecular basis for magnolol agonism, we determine both the co-crystal structures of RXRα and PPARγ ligand-binding domains (LBDs) with magnolol. Structural analyses reveal that magnolol adopts its two 5-allyl-2-hydroxyphenyl moieties occupying the acidic and hydrophobic cavities of RXRα L-shaped ligand-binding pocket, respectively. While, two magnolol molecules cooperatively accommodate into PPARγ Y-shaped ligand-binding pocket. Based on these two complex structures, the key interactions for magnolol activating RXRα and PPARγ are determined. As the first report on the dual agonist targeting RXRα and PPARγ with receptor-ligand complex structures, our results are thus expected to help inspect the potential pharmacological mechanism for magnolol functions, and supply useful hits for nuclear receptor multi-target ligand design. PMID:22140563

Involvement of the orphan nuclear estrogen receptor-related receptor α in osteoclast adhesion and transmigration

PubMed Central

Bonnelye, Edith; Saltel, Frédéric; Chabadel, Anne; Zirngibl, Ralph A; Aubin, Jane E; Jurdic, Pierre

2010-01-01

The orphan nuclear receptor, estrogen receptor-related receptor α (ERRα) is expressed in osteoblasts and osteoclasts (OCs) and has been proposed to be a modulator of estrogen signaling. To determine the role of ERRα in OC biology, we knocked down ERRα activity by transient transfection of an siRNA directed against ERRα in the RAW264.7 monocyte–macrophage cell line that differentiates into OCs in the presence of receptor activator of nuclear factor κB-ligands and macrophage colony-stimulating factor. In parallel, stable RAW cell lines expressing a dominant-negative form of ERRα and green fluorescent protein (RAW-GFP-ERRαΔAF2) were used. Expression of OC markers was assessed by real-time PCR, and adhesion and transmigration tests were performed. Actin cytoskeletal organization was visualized using confocal microscopy. We found that RAW264.7 cells expressing siRNA directed against ERRα and RAW-GFP-ERRαΔAF2 OCs displayed abnormal spreading, and decreased osteopontin and β3 integrin subunit expression compared with the corresponding control cells. Decreased adhesion and the absence of podosome belts concomitant with abnormal localization of c-src were also observed in RAW-GFP-ERRαΔAF2-derived OCs. In addition, RAW-GFP-ERRαΔAF2-derived OCs failed to transmigrate through osteoblast cell layers. Our data show that the impairment of ERRα function does not alter OC precursor proliferation and differentiation but does alter the adhesion/spreading and migration capacities of mature OCs. PMID:20841427

Nuclear receptor co-regulator Kruppel-like factor 9 and prohibitin 2 expression in estrogen-induced epithelial cell proliferation in the mouse uterus

USDA-ARS?s Scientific Manuscript database

Estrogen, acting through its cognate receptor estrogen receptor-' (ESR1), is a critical regulator of uterine endometrial epithelial proliferation. Although the dynamic communication between endometrial stromal (ST) and epithelial cells is considered to be an important component in this process, key ...

Identifying Environmental Chemicals as Agonists of the Androgen Receptor by Applying a Quantitative High-throughput Screening Platform

EPA Science Inventory

Background: The androgen receptor (AR, NR3C4) is a nuclear receptor whose main function is acting as a transcription factor regulating gene expression for male sexual development and maintaining accessory sexual organ function. It is also a necessary component of female fertility...

Fatty Acid-binding Proteins 1 and 2 Differentially Modulate the Activation of Peroxisome Proliferator-activated Receptor α in a Ligand-selective Manner*

PubMed Central

Hughes, Maria L. R.; Liu, Bonan; Halls, Michelle L.; Wagstaff, Kylie M.; Patil, Rahul; Velkov, Tony; Jans, David A.; Bunnett, Nigel W.; Scanlon, Martin J.; Porter, Christopher J. H.

2015-01-01

Nuclear hormone receptors (NHRs) regulate the expression of proteins that control aspects of reproduction, development and metabolism, and are major therapeutic targets. However, NHRs are ubiquitous and participate in multiple physiological processes. Drugs that act at NHRs are therefore commonly restricted by toxicity, often at nontarget organs. For endogenous NHR ligands, intracellular lipid-binding proteins, including the fatty acid-binding proteins (FABPs), can chaperone ligands to the nucleus and promote NHR activation. Drugs also bind FABPs, raising the possibility that FABPs similarly regulate drug activity at the NHRs. Here, we investigate the ability of FABP1 and FABP2 (intracellular lipid-binding proteins that are highly expressed in tissues involved in lipid metabolism, including the liver and intestine) to influence drug-mediated activation of the lipid regulator peroxisome proliferator-activated receptor (PPAR) α. We show by quantitative fluorescence imaging and gene reporter assays that drug binding to FABP1 and FABP2 promotes nuclear localization and PPARα activation in a drug- and FABP-dependent manner. We further show that nuclear accumulation of FABP1 and FABP2 is dependent on the presence of PPARα. Nuclear accumulation of FABP on drug binding is driven largely by reduced nuclear egress rather than an increased rate of nuclear entry. Importin binding assays indicate that nuclear access occurs via an importin-independent mechanism. Together, the data suggest that specific drug-FABP complexes can interact with PPARα to effect nuclear accumulation of FABP and NHR activation. Because FABPs are expressed in a regionally selective manner, this may provide a means to tailor the patterns of NHR drug activation in a tissue-specific manner. PMID:25847235

Fatty Acid-binding Proteins 1 and 2 Differentially Modulate the Activation of Peroxisome Proliferator-activated Receptor α in a Ligand-selective Manner.

PubMed

Hughes, Maria L R; Liu, Bonan; Halls, Michelle L; Wagstaff, Kylie M; Patil, Rahul; Velkov, Tony; Jans, David A; Bunnett, Nigel W; Scanlon, Martin J; Porter, Christopher J H

2015-05-29

Nuclear hormone receptors (NHRs) regulate the expression of proteins that control aspects of reproduction, development and metabolism, and are major therapeutic targets. However, NHRs are ubiquitous and participate in multiple physiological processes. Drugs that act at NHRs are therefore commonly restricted by toxicity, often at nontarget organs. For endogenous NHR ligands, intracellular lipid-binding proteins, including the fatty acid-binding proteins (FABPs), can chaperone ligands to the nucleus and promote NHR activation. Drugs also bind FABPs, raising the possibility that FABPs similarly regulate drug activity at the NHRs. Here, we investigate the ability of FABP1 and FABP2 (intracellular lipid-binding proteins that are highly expressed in tissues involved in lipid metabolism, including the liver and intestine) to influence drug-mediated activation of the lipid regulator peroxisome proliferator-activated receptor (PPAR) α. We show by quantitative fluorescence imaging and gene reporter assays that drug binding to FABP1 and FABP2 promotes nuclear localization and PPARα activation in a drug- and FABP-dependent manner. We further show that nuclear accumulation of FABP1 and FABP2 is dependent on the presence of PPARα. Nuclear accumulation of FABP on drug binding is driven largely by reduced nuclear egress rather than an increased rate of nuclear entry. Importin binding assays indicate that nuclear access occurs via an importin-independent mechanism. Together, the data suggest that specific drug-FABP complexes can interact with PPARα to effect nuclear accumulation of FABP and NHR activation. Because FABPs are expressed in a regionally selective manner, this may provide a means to tailor the patterns of NHR drug activation in a tissue-specific manner. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Liver X receptor alpha regulates fatty acid synthase expression in chicken.

PubMed

Demeure, O; Duby, C; Desert, C; Assaf, S; Hazard, D; Guillou, H; Lagarrigue, S

2009-12-01

Liver X receptor alpha (LXRalpha), also referred to as nuclear receptor subfamily 1, group H, member 3 is a member of the nuclear hormone receptor superfamily, and has recently been shown to act as a master transcription factor governing hepatic lipogenesis in mammals. Liver X receptor alpha directly regulates both the expression of other lipogenic transcription factors and the expression of lipogenic enzymes, thereby enhancing hepatic fatty acid synthesis (FASN). In birds, like in humans, fatty acid synthesis primarily occurs in the liver. Whether LXRalpha is involved in hepatic regulation of lipogenic genes remained to be investigated in this species. Here we show that fatty acid synthase and the expression of other lipogenic genes (sterol regulatory element binding protein 1 and steroyl coenzyme A desaturase 1) are induced in chicken hepatoma cells in response to a pharmacological liver X receptor agonist, T0901317. A detailed analysis of the chicken FASN promoter revealed a functional liver X response element. These data define the chicken FASN gene as a direct target of LXRalpha and further expand the role of LXRalpha as a regulator of lipid metabolism in this species.

Progesterone receptors in the female lower urinary tract

DOE Office of Scientific and Technical Information (OSTI.GOV)

Batra, S.C.; Iosif, C.S.

1987-11-01

When female estrogenized rabbits were injected i.v. with /sup 3/H-progesterone, the tritium concentration determined after one hour was about two to three times higher in urethra, urinary bladder and vagina than in the heart. High affinity progesterone receptors (KD = 1-2 nM) could be demonstrated in both cytoplasmic and nuclear fractions prepared from estrogenized rabbit urethra, bladder and vagina. The cytosolic receptor concentration in both urethra and bladder was about half of that in the vagina. The concentration of nuclear receptors in urethra was not significantly different from that in the vagina, but in the bladder the concentration was onlymore » about one fourth of that in the vagina or urethra. The mean KD of cytosolic receptors from bladder was significantly higher than the corresponding values in urethra and vagina. Progesterone binding sites in the bladder had a broader hormonal specificity than those in the urethra or vagina. The present demonstration of specific progesterone receptors in the female urethra might provide a possible link between estrogen progesterone interaction and the appearance of urinary incontinence during pregnancy in women.« less

Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M.

The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast,more » amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.« less

Pilot Comparison of ⁶⁸Ga-RM2 PET and ⁶⁸Ga-PSMA-11 PET in Patients with Biochemically Recurrent Prostate Cancer.

PubMed

Minamimoto, Ryogo; Hancock, Steven; Schneider, Bernadette; Chin, Frederick T; Jamali, Mehran; Loening, Andreas; Vasanawala, Shreyas; Gambhir, Sanjiv Sam; Iagaru, Andrei

2016-04-01

Glu-NH-CO-NH-Lys-(Ahx)-[(68)Ga(HBED-CC)] ((68)Ga-PSMA-11) is a PET tracer that can detect prostate cancer relapses and metastases by binding to the extracellular domain of PSMA. (68)Ga-labeled DOTA-4-amino-1-carboxymethyl-piperidine-D-Phe-Gln-Trp-Ala-Val-Gly-His-Sta-Leu-NH2 ((68)Ga-RM2) is a synthetic bombesin receptor antagonist that targets gastrin-releasing peptide receptors. We present pilot data on the biodistribution of these PET tracers in a small cohort of patients with biochemically recurrent prostate cancer. Seven men (mean age ± SD, 74.3 ± 5.9 y) with biochemically recurrent prostate cancer underwent both (68)Ga-PSMA-11 PET/CT and (68)Ga-RM2 PET/MRI scans. SUVmax and SUVmean were recorded for normal tissues and areas of uptake outside the expected physiologic biodistribution. All patients had a rising level of prostate-specific antigen (mean ± SD, 13.5 ± 11.5) and noncontributory results on conventional imaging. (68)Ga-PSMA-11 had the highest physiologic uptake in the salivary glands and small bowel, with hepatobiliary and renal clearance noted, whereas (68)Ga-RM2 had the highest physiologic uptake in the pancreas, with renal clearance noted. Uptake outside the expected physiologic biodistribution did not significantly differ between (68)Ga-PSMA-11 and (68)Ga-RM2; however, (68)Ga-PSMA-11 localized in a lymph node and seminal vesicle in a patient with no abnormal (68)Ga-RM2 uptake. Abdominal periaortic lymph nodes were more easily visualized by(68)Ga-RM2 in two patients because of lack of interference by radioactivity in the small intestine. (68)Ga-PSMA-11 and (68)Ga-RM2 had distinct biodistributions in this small cohort of patients with biochemically recurrent prostate cancer. Additional work is needed to understand the expression of PSMA and gastrin-releasing peptide receptors in different types of prostate cancer. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

Quantification of transcription factor-DNA binding affinity in a living cell

PubMed Central

Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

2016-01-01

The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

Targeting of the Nuclear Receptor Coactivator Isoform DELTA3AIB1 in Breast Cancer

DTIC Science & Technology

2007-03-01

lab showed that the downregulation of overall levels of AIB1 plus ∆3AIB1, using a regulatable AIB1 directed ribozyme , resulted in reduced tumor...overall levels of AIB1 plus ∆3AIB1, using a regulatable AIB1 directed ribozyme , resulted in reduced tumor growth in vivo. Overall, these data indicate a...Reiter R, Powers C, Wellstein A, Riegel AT. Ribozyme targeting shows that the nuclear receptor coactivator AIB1 is a rate-limiting factor for estrogen

Nuclear hormone receptors in parasitic helminths

PubMed Central

Wu, Wenjie; LoVerde, Philip T

2010-01-01

Nuclear receptors (NRs) belong to a large protein superfamily that are important transcriptional modulators in metazoans. Parasitic helminths include parasitic worms from the Lophotrochozoa (Platyhelminths) and Ecdysozoa (Nematoda). NRs in parasitic helminths diverged into two different evolutionary lineages. NRs in parasitic Platyhelminths have orthologues in Deuterostomes, in arthropods or both with a feature of extensive gene loss and gene duplication within different gene groups. NRs in parasitic Nematoda follow the nematode evolutionary lineage with a feature of multiple duplication of SupNRs and gene loss. PMID:20600585

Changes in nuclear receptor corepressor RIP140 do not influence mitochondrial content in the cortex.

PubMed

Herbst, Eric A F; Bonen, Arend; Holloway, Graham P

2015-10-01

Changes in nuclear receptor interacting protein 140 (RIP140) influences mitochondrial content in skeletal muscle; however, the translation of these findings to the brain has not been investigated. The present study examined the impact of overexpressing and ablating RIP140 on mitochondrial content in muscle and the cortex through examining mRNA, mtDNA, and mitochondrial protein content. Our results show that changes in RIP140 expression significantly alters markers of mitochondrial content in skeletal muscle but not the brain.

Regulation of ERRα Gene Expression by Estrogen Receptor Agonists and Antagonists in SKBR3 Breast Cancer Cells: Differential Molecular Mechanisms Mediated by G Protein-Coupled Receptor GPR30/GPER-1

PubMed Central

Li, Yin; Birnbaumer, Lutz; Teng, Christina T.

2010-01-01

In selected tissues and cell lines, 17β-estradiol (E2) regulates the expression of estrogen-related receptor α (ERRα), a member of the orphan nuclear receptor family. This effect is thought to be mediated by the estrogen receptor α (ERα). However in the ERα- and ERβ-negative SKBR3 breast cancer cell line, physiological levels of E2 also stimulate ERRα expression. Here, we explored the molecular mechanism that mediates estrogen action in ER-negative breast cancer cells. We observed that E2, the ERα agonist, as well as the ERα antagonists ICI 182,780 and tamoxifen (TAM), a selective ER modulator, stimulate the transcriptional activity of the ERRα gene and increase the production of ERRα protein in SKBR3 cells. Moreover, the ERRα downstream target genes expression and cellular proliferation are also increased. We show further that the G protein-coupled receptor GPR30/GPER-1 (GPER-1) mediates these effects. The GPER-1 specific ligand G-1 mimics the actions of E2, ICI 182,780, and TAM on ERRα expression, and changing the levels of GPER-1 mRNA by overexpression or small interfering RNA knockdown affected the expression of ERRα accordingly. Utilizing inhibitors, we delineate a different downstream pathway for ER agonist and ER antagonist-triggered signaling through GPER-1. We also find differential histone acetylation and transcription factor recruitment at distinct nucleosomes of the ERRα promoter, depending on whether the cells are activated with E2 or with ER antagonists. These findings provide insight into the molecular mechanisms of GPER-1/ERRα-mediated signaling and may be relevant to what happens in breast cancer cells escaping inhibitory control by TAM. PMID:20211987

Estrogen Receptor-Related Receptor α Mediates Up-Regulation of Aromatase Expression by Prostaglandin E2 in Prostate Stromal Cells

PubMed Central

Miao, Lin; Shi, Jiandang; Wang, Chun-Yu; Zhu, Yan; Du, Xiaoling; Jiao, Hongli; Mo, Zengnan; Klocker, Helmut; Lee, Chung; Zhang, Ju

2010-01-01

Estrogen receptor-related receptor α (ERRα) is an orphan member of the nuclear receptor superfamily of transcription factors. ERRα is highly expressed in the prostate, especially in prostate stromal cells. However, little is known about the regulation and function of ERRα, which may contribute to the progression of prostatic diseases. We previously found that prostaglandin E2 (PGE2) up-regulated the expression of aromatase in prostate stromal cells. Here we show that PGE2 also up-regulates the expression of ERRα, which, as a transcription factor, further mediates the regulatory effects of PGE2 on the expression of aromatase. ERRα expression was up-regulated by PGE2 in prostate stromal cell line WPMY-1, which was mediated mainly through the protein kinase A signaling pathway by PGE2 receptor EP2. Suppression of ERRα activity by chlordane (an antagonist of ERRα) or small interfering RNA knockdown of ERRα blocked the increase of expression and promoter activity of aromatase induced by PGE2. Overexpression of ERRα significantly increased aromatase expression and promoter activity, which were further augmented by PGE2. Chromatin immunoprecipitation assay demonstrated that ERRα directly bound to the aromatase promoter in vivo, and PGE2 enhanced the recruitment of ERRα and promoted transcriptional regulatory effects on aromatase expression in WPMY-1. 17β-Estradiol concentration in WPMY-1 medium was up-regulated by ERRα expression, and that was further increased by PGE2. Our results provided evidence that ERRα contributed to local estrogen production by up-regulating aromatase expression in response to PGE2 and provided further insights into the potential role of ERRα in estrogen-related prostatic diseases. PMID:20351196

Structural basis for corepressor assembly by the orphan nuclear receptor TLX

PubMed Central

Zhou, X. Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten

2015-01-01

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. PMID:25691470

Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

PubMed

Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

2007-08-01

Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

Abnormal XPD-induced nuclear receptor transactivation in DNA repair disorders: trichothiodystrophy and xeroderma pigmentosum.

PubMed

Zhou, Xiaolong; Khan, Sikandar G; Tamura, Deborah; Ueda, Takahiro; Boyle, Jennifer; Compe, Emmanuel; Egly, Jean-Marc; DiGiovanna, John J; Kraemer, Kenneth H

2013-08-01

XPD (ERCC2) is a DNA helicase involved in nucleotide excision repair and in transcription as a structural bridge tying the transcription factor IIH (TFIIH) core with the cdk-activating kinase complex, which phosphorylates nuclear receptors. Mutations in XPD are associated with several different phenotypes, including trichothiodystrophy (TTD), with sulfur-deficient brittle hair, bone defects, and developmental abnormalities without skin cancer, xeroderma pigmentosum (XP), with pigmentary abnormalities and increased skin cancer, or XP/TTD with combined features, including skin cancer. We describe the varied clinical features and mutations in nine patients examined at the National Institutes of Health who were compound heterozygotes for XPD mutations but had different clinical phenotypes: four TTD, three XP, and two combined XP/TTD. We studied TFIIH-dependent transactivation by nuclear receptor for vitamin D (VDR) and thyroid in cells from these patients. The vitamin D stimulation ratio of CYP24 and osteopontin was associated with specific pairs of mutations (reduced in 5, elevated in 1) but not correlated with distinct clinical phenotypes. Thyroid receptor stimulation ratio for KLF9 was not significantly different from normal. XPD mutations frequently were associated with abnormal VDR stimulation in compound heterozygote patients with TTD, XP, or XP/TTD.

Structural basis for corepressor assembly by the orphan nuclear receptor TLX

DOE PAGES

Zhi, Xiaoyong; Zhou, X. Edward; He, Yuanzheng; ...

2015-02-15

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conservedmore » ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression.« less

The role of interleukin-8 (IL-8) and IL-8 receptors in platinum response in high grade serous ovarian carcinoma

PubMed Central

Stronach, Euan A.; Cunnea, Paula; Turner, Christina; Guney, Tankut; Aiyappa, Radhika; Jeyapalan, Senthuran; de Sousa, Camila H.; Browne, Alacoque; Magdy, Nesreen; Studd, James B.; Sriraksa, Ruethairat; Gabra, Hani; El-Bahrawy, Mona

2015-01-01

Platinum based drugs are the cornerstone of chemotherapy for ovarian cancer, however the development of chemoresistance hinders its success. IL-8 is involved in regulating several pro-survival pathways in cancer. We studied the expression of IL-8 and IL-8 receptors in platinum sensitive and resistant cell lines. Using qRT-PCR and immunohistochemistry, both platinum sensitive (PEA1, PEO14) and resistant (PEA2, PEO23) show increased expression of IL-8 and IL-8 receptors. IL-8RA shows nuclear and cytoplasmic expression, whilst IL-8RB is present solely in the cytoplasm. Knockdown of IL-8 increased sensitivity to cisplatin in platinum sensitive and reversed platinum resistance in resistant cell lines, decreased the expression of anti-apoptotic Bcl-2 and decreased inhibitory phosphorylation of pro-apoptotic Bad. IL-8 receptor antagonist treatment also enhanced platinum sensitivity. Nuclear localisation of IL-8RA was only detected in platinum resistant tumours. Inhibition of IL-8 signalling can enhance response in platinum sensitive and resistant disease. Nuclear IL-8RA may have potential as a biomarker of resistant disease. PMID:26267317

The role of interleukin-8 (IL-8) and IL-8 receptors in platinum response in high grade serous ovarian carcinoma.

PubMed

Stronach, Euan A; Cunnea, Paula; Turner, Christina; Guney, Tankut; Aiyappa, Radhika; Jeyapalan, Senthuran; de Sousa, Camila H; Browne, Alacoque; Magdy, Nesreen; Studd, James B; Sriraksa, Ruethairat; Gabra, Hani; El-Bahrawy, Mona

2015-10-13

Platinum based drugs are the cornerstone of chemotherapy for ovarian cancer, however the development of chemoresistance hinders its success. IL-8 is involved in regulating several pro-survival pathways in cancer. We studied the expression of IL-8 and IL-8 receptors in platinum sensitive and resistant cell lines. Using qRT-PCR and immunohistochemistry, both platinum sensitive (PEA1, PEO14) and resistant (PEA2, PEO23) show increased expression of IL-8 and IL-8 receptors. IL-8RA shows nuclear and cytoplasmic expression, whilst IL-8RB is present solely in the cytoplasm. Knockdown of IL-8 increased sensitivity to cisplatin in platinum sensitive and reversed platinum resistance in resistant cell lines, decreased the expression of anti-apoptotic Bcl-2 and decreased inhibitory phosphorylation of pro-apoptotic Bad. IL-8 receptor antagonist treatment also enhanced platinum sensitivity. Nuclear localisation of IL-8RA was only detected in platinum resistant tumours. Inhibition of IL-8 signalling can enhance response in platinum sensitive and resistant disease. Nuclear IL-8RA may have potential as a biomarker of resistant disease.

Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

PubMed Central

Pikler, G M; Webster, R A; Spelsberg, T C

1976-01-01

Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

In Vitro Evaluation of Molecular Tumor Targets in Nuclear Medicine: Immunohistochemistry Is One Option, but Under Which Conditions?

PubMed

Reubi, Jean Claude

2017-12-01

The identification of new molecular targets for diagnostic and therapeutic applications using in vitro methods is an important challenge in nuclear medicine. One such method is immunohistochemistry, increasingly popular because it is easy to perform. This review presents the case for conducting receptor immunohistochemistry to evaluate potential molecular targets in human tumor tissue sections. The focus is on the immunohistochemistry of G-protein-coupled receptors, one of the largest families of cell surface proteins, representing a major class of drug targets and thus playing an important role in nuclear medicine. This review identifies common pitfalls and challenges and provides guidelines on performing such immunohistochemical studies. An appropriate validation of the target is a prerequisite for developing robust and informative new molecular probes. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

Detection of pAkt protein in imprint cytology of invasive breast cancer: Correlation with HER2/neu, hormone receptors, and other clinicopathological variables

PubMed Central

Vasou, Olympia; Skagias, Lazaros; Anastasia, Margariti; Paulina, Athanasiadou; Patsouris, Efstratios; Politi, Ekaterini

2015-01-01

Purpose: Akt is a serine/threonine protein kinase and has emerged as a crucial regulator of widely divergent cellular processes, including apoptosis, proliferation, differentiation, and metabolism. Activation of Akt/protein kinase B has been positively associated with human epidermal growth-factor receptor 2 (HER2)/neu overexpression in breast carcinoma and a worse outcome among endocrine treated patients. The Akt signaling pathway currently attracts considerable attention as a new target for effective therapeutic strategies. We therefore investigated the relationship between activation of Akt and clinicopathologic variables including hormone receptor and HER2/neu status. Methods: Archival tumor tissues from 100 patients with invasive breast carcinoma were analyzed by immunocytochemistry. This study describes the results of immunocytochemical pAkt expression in breast carcinoma imprints, prepared from cut surfaces of freshly removed tumors. Both nuclear and cytoplasmic expressions were evaluated for pAkt. Results: Nuclear and cytoplasmic positive scores of 72% (72/100) and 42% (42/100), respectively, were found. Coexistence of nuclear and cytoplasmic staining was observed in 32 cases (32/100). Nuclear positive staining correlated with HER2/neu overexpression (P = 0.043) and was significantly associated with positive involvement of axillary lymph nodes (P = 0.013). No correlation was found between cytoplasmic pAkt rate and clinicopathological parameters, estrogen receptor, progesterone receptor or HER2/neu expression. Conclusions: pAkt expression can be evaluated in cytological material and may add valuable information to current prognostic models for breast cancer. pAkt overexpression appears to be linked with potentially aggressive tumor phenotype in invasive breast carcinoma. PMID:25838835

Molecular mechanism of peroxisome proliferator-activated receptor α activation by WY14643: a new mode of ligand recognition and receptor stabilization.

PubMed

Bernardes, Amanda; Souza, Paulo C T; Muniz, João R C; Ricci, Clarisse G; Ayers, Stephen D; Parekh, Nili M; Godoy, André S; Trivella, Daniela B B; Reinach, Peter; Webb, Paul; Skaf, Munir S; Polikarpov, Igor

2013-08-23

Peroxisome proliferator-activated receptors (PPARs) are members of a superfamily of nuclear transcription factors. They are involved in mediating numerous physiological effects in humans, including glucose and lipid metabolism. PPARα ligands effectively treat dyslipidemia and have significant antiinflammatory and anti-atherosclerotic activities. These effects and their ligand-dependent activity make nuclear receptors obvious targets for drug design. Here, we present the structure of the human PPARα in complex with WY14643, a member of fibrate class of drug, and a widely used PPAR activator. The crystal structure of this complex suggests that WY14643 induces activation of PPARα in an unusual bipartite mechanism involving conventional direct helix 12 stabilization and an alternative mode that involves a second ligand in the pocket. We present structural observations, molecular dynamics and activity assays that support the importance of the second site in WY14643 action. The unique binding mode of WY14643 reveals a new pattern of nuclear receptor ligand recognition and suggests a novel basis for ligand design, offering clues for improving the binding affinity and selectivity of ligand. We show that binding of WY14643 to PPARα was associated with antiinflammatory disease in a human corneal cell model, suggesting possible applications for PPARα ligands. Copyright © 2013 Elsevier Ltd. All rights reserved.

Metabotropic glutamate receptor 5 mediates phosphorylation of vascular endothelial cadherin and nuclear localization of β-catenin in response to homocysteine.

PubMed

Beard, Richard S; Reynolds, Jason J; Bearden, Shawn E

2012-01-01

Elevated plasma homocysteine (Hcy) is an independent risk factor for vascular disease and stroke in part by causing generalized endothelial dysfunction. A receptor that is sensitive to Hcy and its intracellular signaling systems has not been identified. β-catenin is a pleiotropic regulator of transcription and cell function. Using a brain microvascular endothelial cell line (bEnd.3), we tested the hypothesis that Hcy causes receptor-dependent nuclear translocation of β-catenin. Hcy increased phosphorylation of Y731 on vascular endothelial cadherin (VE-cadherin), a site involved in coupling β-catenin to VE-cadherin. This was blocked by inhibition of either metabotropic glutamate receptor 5 (mGluR5) or ionotropic glutamate receptor (NMDAr) and by shRNA knockdown of mGluR5. Expression of these receptors was confirmed by flow cytometry, immunohistochemistry, and western blotting. Directed pharmacology with specific agonists elucidated a signaling cascade where Hcy activates mGluR5 which activates NMDAr with subsequent PKC activation and uncoupling of the VE-cadherin/β-catenin complex. Moreover, Hcy caused a shift in localization of β-catenin from membrane-bound VE-cadherin to the cell nucleus, where it bound DNA, including a regulatory region of the gene for claudin-5, leading to reduced expression of claudin-5. Nuclear localization, DNA binding of β-catenin, and reduced claudin-5 expression were blocked by inhibition of mGluR5. Knockdown of mGluR5 expression with shRNA also rescued claudin-5 expression from the effects of Hcy treatment. These data uniquely identify mGluR5 as a master switch that drives β-catenin nuclear localization in vascular endothelium and regulates cell-cell coupling in response to elevated Hcy levels. These studies dissect a pharmacological opportunity for developing new therapeutic strategies in HHcy. Copyright © 2012 Elsevier Inc. All rights reserved.

Diagnostic utility of NCOA2 fluorescence in situ hybridization and Stat6 immunohistochemistry staining for soft tissue angiofibroma and morphologically similar fibrovascular tumors.

PubMed

Sugita, Shintaro; Aoyama, Tomoyuki; Kondo, Kei; Keira, Yoshiko; Ogino, Jiro; Nakanishi, Katsuya; Kaya, Mitsunori; Emori, Makoto; Tsukahara, Tomohide; Nakajima, Hisaya; Takagi, Masayuki; Hasegawa, Tadashi

2014-08-01

Soft tissue angiofibroma (STA), a recently suggested new histologic entity, is a benign fibrovascular soft tissue tumor composed of bland spindle-shaped tumor cells with abundant collagenous to myxoid stroma and branching small vessels. The lesion has a characteristic AHRR-NCOA2 fusion gene derived from chromosomal translocation of t(5;8)(p15;q13). However, morphologically similar tumors containing abundant fibrovascular and myxoid stroma can complicate diagnosis. We designed an original DNA probe for detecting NCOA2 split signals on fluorescence in situ hybridization (FISH) and estimated its utility with 20 fibrovascular tumors: 4 each of STAs, solitary fibrous tumors (SFTs), and cellular angiofibromas and 3 each of low-grade myxofibrosarcomas, myxoid liposarcomas, and low-grade fibromyxoid sarcomas. We also performed FISH for 13q14 deletion and immunohistochemistry (IHC) staining for estrogen receptor, progesterone receptor, retinoblastoma protein, and MUC-4 expression. Furthermore, IHC for Stat6 was conducted in the 20 cases analyzed by FISH and in an additional 26 SFTs. We found moderate to strong nuclear Stat6 expression in all SFTs but no expression in the other tumors. Both estrogen receptor and progesterone receptor expressions were observed in STAs, SFTs, and cellular angiofibromas. Expression of retinoblastoma protein was found in less than 10% of cells in all tumor types except myxoid liposarcoma. The low-grade fibromyxoid sarcomas were strongly positive for MUC-4. All STAs showed NCOA2 split signals on FISH. All tumors, regardless of histologic type, had 13q14 deletion. The NCOA2 FISH technique is a practical method for confirming STA diagnosis. The combination of NCOA2 FISH and Stat6 IHC proved effective for the differential diagnosis of STA, even when using small biopsy specimens. Copyright © 2014 Elsevier Inc. All rights reserved.

Calmodulin Lobes Facilitate Dimerization and Activation of Estrogen Receptor-α*

PubMed Central

Li, Zhigang; Zhang, Yonghong; Hedman, Andrew C.; Ames, James B.

2017-01-01

Estrogen receptor α (ER-α) is a nuclear hormone receptor that controls selected genes, thereby regulating proliferation and differentiation of target tissues, such as breast. Gene expression controlled by ER-α is modulated by Ca2+ via calmodulin (CaM). Here we present the NMR structure of Ca2+-CaM bound to two molecules of ER-α (residues 287–305). The two lobes of CaM bind to the same site on two separate ER-α molecules (residues 292, 296, 299, 302, and 303), which explains why CaM binds two molecules of ER-α in a 1:2 complex and stabilizes ER-α dimerization. Exposed glutamate residues in CaM (Glu-11, Glu-14, Glu-84, and Glu-87) form salt bridges with key lysine residues in ER-α (Lys-299, Lys-302, and Lys-303), which is likely to prevent ubiquitination at these sites and inhibit degradation of ER-α. Transfection of cells with full-length CaM slightly increased the ability of estrogen to enhance transcriptional activation by ER-α of endogenous estrogen-responsive genes. By contrast, expression of either the N- or C-lobe of CaM abrogated estrogen-stimulated transcription of the estrogen responsive genes pS2 and progesterone receptor. These data suggest that CaM-induced dimerization of ER-α is required for estrogen-stimulated transcriptional activation by the receptor. In light of the critical role of ER-α in breast carcinoma, our data suggest that small molecules that selectively disrupt the interaction of ER-α with CaM may be useful in the therapy of breast carcinoma. PMID:28174300

Stimulating the GPR30 estrogen receptor with a novel tamoxifen analogue activates SF-1 and promotes endometrial cell proliferation.

PubMed

Lin, Benjamin C; Suzawa, Miyuki; Blind, Raymond D; Tobias, Sandra C; Bulun, Serdar E; Scanlan, Thomas S; Ingraham, Holly A

2009-07-01

Estrogens and selective estrogen receptor (ER) modulators such as tamoxifen are known to increase uterine cell proliferation. Mounting evidence suggests that estrogen signaling is mediated not only by ERalpha and ERbeta nuclear receptors, but also by GPR30 (GPER), a seven transmembrane (7TM) receptor. Here, we report that primary human endometriotic H-38 cells express high levels of GPR30 with no detectable ERalpha or ERbeta. Using a novel tamoxifen analogue, STX, which activates GPR30 but not ERs, significant stimulation of the phosphatidylinositol 3-kinase (PI3K) and mitogen-activated protein kinase (MAPK) pathways was observed in H-38 cells and in Ishikawa endometrial cancer cells expressing GPR30; a similar effect was observed in JEG3 choriocarcinoma cells. STX treatment also increased cellular pools of phosphatidylinositol (3,4,5) triphosphate, a proposed ligand for the nuclear hormone receptor SF-1 (NR5A1). Consistent with these findings, STX, tamoxifen, and the phytoestrogen genistein were able to increase SF-1 transcription, promote Ishikawa cell proliferation, and induce the SF-1 target gene aromatase in a GPR30-dependent manner. Our findings suggest a novel signaling paradigm that is initiated by estrogen activation of the 7TM receptor GPR30, with signal transduction cascades (PI3K and MAPK) converging on nuclear hormone receptors (SF-1/LRH-1) to modulate their transcriptional output. We propose that this novel GPR30/SF-1 pathway increases local concentrations of estrogen, and together with classic ER signaling, mediate the proliferative effects of synthetic estrogens such as tamoxifen, in promoting endometriosis and endometrial cancers.

Molecular characterization of human thyroid hormone receptor β isoform 4.

PubMed

Moriyama, Kenji; Yamamoto, Hiroyuki; Futawaka, Kumi; Atake, Asami; Kasahara, Masato; Tagami, Tetsuya

2016-01-01

Thyroid hormone exerts a pleiotropic effect on development, differentiation, and metabolism through thyroid hormone receptor (TR). A novel thyroid hormone receptor β isoform (TRβ4) was cloned using PCR from a human pituitary cDNA library as a template. We report here the characterization of TRβ4 from a molecular basis. Temporal expression of TRβ4 during the fetal period is abundant in the brain and kidney, comparable with the adult pattern. Western blot analysis revealed that TRs are ubiquitination labile proteins, while TRβ1 is potentially stable. TRβ1, peroxisome proliferator-activated receptors (PPAR), and vitamin D receptor (VDR), which belong to class II transcription factors that function via the formation of heterodimeric complexes with retinoid X receptor (RXR), were suppressed by TRβ4 in a dose-dependent manner. Thus, TRβ4 exhibits ligand-independent transcriptional silencing, possibly as a substitute for dimerized RXR. In this study, TRβ1 and TRβ4 transcripts were detected in several cell lines. Quantitative RT-PCR assay showed that the expression of TRβ4 in human embryonic carcinoma cells of the testis was suppressed by sex hormone in a reciprocal manner to TRβ1. In contrast, TRβ4 was expressed under a high dose of triiodothyronine (T3) in a reciprocal manner to TRβ1. Finally, in transiently transfected NIH-3T3 cells, green fluorescence protein (GFP)-tagged TRβ4 was mostly nuclear in both the absence and the presence of T3. By mutating defined regions of both TRβs, we found that both TRβ1 and TRβ4 had altered nuclear/cytoplasmic distribution as compared with wild-type, and different to T3 and the nuclear receptor corepressor (NCoR). Thus, site-specific DNA binding is not essential for maintaining TRβs within the nucleus.

The Orphan Nuclear Receptor TLX Is an Enhancer of STAT1-Mediated Transcription and Immunity to Toxoplasma gondii.

PubMed

Beiting, Daniel P; Hidano, Shinya; Baggs, Julie E; Geskes, Jeanne M; Fang, Qun; Wherry, E John; Hunter, Christopher A; Roos, David S; Cherry, Sara

2015-07-01

The protozoan parasite, Toxoplasma, like many intracellular pathogens, suppresses interferon gamma (IFN-γ)-induced signal transducer and activator of transcription 1 (STAT1) activity. We exploited this well-defined host-pathogen interaction as the basis for a high-throughput screen, identifying nine transcription factors that enhance STAT1 function in the nucleus, including the orphan nuclear hormone receptor TLX. Expression profiling revealed that upon IFN-γ treatment TLX enhances the output of a subset of IFN-γ target genes, which we found is dependent on TLX binding at those loci. Moreover, infection of TLX deficient mice with the intracellular parasite Toxoplasma results in impaired production of the STAT1-dependent cytokine interleukin-12 by dendritic cells and increased parasite burden in the brain during chronic infection. These results demonstrate a previously unrecognized role for this orphan nuclear hormone receptor in regulating STAT1 signaling and host defense and reveal that STAT1 activity can be modulated in a context-specific manner by such "modifiers."

Importance of the pharmacological profile of the bound ligand in enrichment on nuclear receptors: toward the use of experimentally validated decoy ligands.

PubMed

Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu

2014-10-27

The evaluation of virtual ligand screening methods is of major importance to ensure their reliability. Taking into account the agonist/antagonist pharmacological profile should improve the quality of the benchmarking data sets since ligand binding can induce conformational changes in the nuclear receptor structure and such changes may vary according to the agonist/antagonist ligand profile. We indeed found that splitting the agonist and antagonist ligands into two separate data sets for a given nuclear receptor target significantly enhances the quality of the evaluation. The pharmacological profile of the ligand bound in the binding site of the target structure was also found to be an additional critical parameter. We also illustrate that active compound data sets for a given pharmacological activity can be used as a set of experimentally validated decoy ligands for another pharmacological activity to ensure a reliable and challenging evaluation of virtual screening methods.

Dioxin Toxicity In Vivo Results from an Increase in the Dioxin-Independent Transcriptional Activity of the Aryl Hydrocarbon Receptor

PubMed Central

Céspedes, Miguel Angel; Galindo, Maximo Ibo; Couso, Juan Pablo

2010-01-01

The Aryl hydrocarbon receptor (Ahr) is the nuclear receptor mediating the toxicity of dioxins -widespread and persistent pollutants whose toxic effects include tumor promotion, teratogenesis, wasting syndrome and chloracne. Elimination of Ahr in mice eliminates dioxin toxicity but also produces adverse effects, some seemingly unrelated to dioxin. Thus the relationship between the toxic and dioxin-independent functions of Ahr is not clear, which hampers understanding and treatment of dioxin toxicity. Here we develop a Drosophila model to show that dioxin actually increases the in vivo dioxin-independent activity of Ahr. This hyperactivation resembles the effects caused by an increase in the amount of its dimerisation partner Ahr nuclear translocator (Arnt) and entails an increased transcriptional potency of Ahr, in addition to the previously described effect on nuclear translocation. Thus the two apparently different functions of Ahr, dioxin-mediated and dioxin-independent, are in fact two different levels (hyperactivated and basal, respectively) of a single function. PMID:21079739

Transcriptional regulation of human Paraoxonase 1 by nuclear receptors.

PubMed

Ponce-Ruiz, N; Murillo-González, F E; Rojas-García, A E; Mackness, Mike; Bernal-Hernández, Y Y; Barrón-Vivanco, B S; González-Arias, C A; Medina-Díaz, I M

2017-04-25

Paraoxonase 1 (PON1) is a calcium-dependent lactonase synthesized primarily in the liver and secreted into the plasma, where it is associates with high density lipoproteins (HDL). PON1 acts as antioxidant preventing low-density lipoprotein (LDL) oxidation, a process considered critical in the initiation and progression of atherosclerosis. Additionally, PON1 hydrolyzes and detoxifies some toxic metabolites of organophosphorus compounds (OPs). Thus, PON1 activity and expression levels are important for determining susceptibility to OPs intoxication and risk of developing diseases related to inflammation and oxidative stress. Increasing evidence has demonstrated the modulation of PON1 expression by many factors is due to interaction with nuclear receptors (NRs). Here, we briefly review the studies in this area and discuss the role of nuclear receptors in the regulation of PON1 expression, as well as how understanding these mechanisms may allow us to manipulate PON1 levels to improve drug efficacy and treat disease. Copyright © 2017 Elsevier B.V. All rights reserved.

Smad Signaling Dynamics: Insights from a Parsimonious Model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiley, H. S.; Shankaran, Harish

2008-09-09

The molecular mechanisms that transmit information from cell surface receptors to the nucleus are exceedingly complex; thus, much effort has been expended in developing computational models to understand these processes. A recent study on modeling the nuclear-cytoplasmic shuttling of Smad2-Smad4 complexes in response to transforming growth factor β (TGF-β) receptor activation has provided substantial insight into how this signaling network translates the degree of TGF-β receptor activation (input) into the amount of nuclear Smad2-Smad4 complexes (output). The study addressed this question by combining a simple, mechanistic model with targeted experiments, an approach that proved particularly powerful for exploring the fundamentalmore » properties of a complex signaling network. The mathematical model revealed that Smad nuclear-cytoplasmic dynamics enables a proportional, but time-delayed coupling between the input and the output. As a result, the output can faithfully track gradual changes in the input, while the rapid input fluctuations that constitute signaling noise are dampened out.« less

Orphan nuclear receptor TR3 acts in autophagic cell death via mitochondrial signaling pathway.

PubMed

Wang, Wei-jia; Wang, Yuan; Chen, Hang-zi; Xing, Yong-zhen; Li, Feng-wei; Zhang, Qian; Zhou, Bo; Zhang, Hong-kui; Zhang, Jie; Bian, Xue-li; Li, Li; Liu, Yuan; Zhao, Bi-xing; Chen, Yan; Wu, Rong; Li, An-zhong; Yao, Lu-ming; Chen, Ping; Zhang, Yi; Tian, Xu-yang; Beermann, Friedrich; Wu, Mian; Han, Jiahuai; Huang, Pei-qiang; Lin, Tianwei; Wu, Qiao

2014-02-01

Autophagy is linked to cell death, yet the associated mechanisms are largely undercharacterized. We discovered that melanoma, which is generally resistant to drug-induced apoptosis, can undergo autophagic cell death with the participation of orphan nuclear receptor TR3. A sequence of molecular events leading to cellular demise is launched by a specific chemical compound, 1-(3,4,5-trihydroxyphenyl)nonan-1-one, newly acquired from screening a library of TR3-targeting compounds. The autophagic cascade comprises TR3 translocation to mitochondria through interaction with the mitochondrial outer membrane protein Nix, crossing into the mitochondrial inner membrane through Tom40 and Tom70 channel proteins, dissipation of mitochondrial membrane potential by the permeability transition pore complex ANT1-VDAC1 and induction of autophagy. This process leads to excessive mitochondria clearance and irreversible cell death. It implicates a new approach to melanoma therapy through activation of a mitochondrial signaling pathway that integrates a nuclear receptor with autophagy for cell death.

Arabidopsis thaliana DM2h (R8) within the Landsberg RPP1-like Resistance Locus Underlies Three Different Cases of EDS1-Conditioned Autoimmunity

PubMed Central

Garcia, Ana V.; Wagner, Christine; Choudhury, Sayan R.; Wang, Yiming; James, Geo Velikkakam; Griebel, Thomas; Alcázar, Ruben; Tsuda, Kenichi; Schneeberger, Korbinian; Parker, Jane E.

2016-01-01

Plants have a large panel of nucleotide-binding/leucine rich repeat (NLR) immune receptors which monitor host interference by diverse pathogen molecules (effectors) and trigger disease resistance pathways. NLR receptor systems are necessarily under tight control to mitigate the trade-off between induced defenses and growth. Hence, mis-regulated NLRs often cause autoimmunity associated with stunting and, in severe cases, necrosis. Nucleocytoplasmic ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1) is indispensable for effector-triggered and autoimmune responses governed by a family of Toll-Interleukin1-Receptor-related NLR receptors (TNLs). EDS1 operates coincidently or immediately downstream of TNL activation to transcriptionally reprogram cells for defense. We show here that low levels of nuclear-enforced EDS1 are sufficient for pathogen resistance in Arabidopsis thaliana, without causing negative effects. Plants expressing higher nuclear EDS1 amounts have the genetic, phenotypic and transcriptional hallmarks of TNL autoimmunity. In a screen for genetic suppressors of nuclear EDS1 autoimmunity, we map multiple, independent mutations to one gene, DM2h, lying within the polymorphic DANGEROUS MIX2 cluster of TNL RPP1-like genes from A. thaliana accession Landsberg erecta (Ler). The DM2 locus is a known hotspot for deleterious epistatic interactions leading to immune-related incompatibilities between A. thaliana natural accessions. We find that DM2hLer underlies two further genetic incompatibilities involving the RPP1-likeLer locus and EDS1. We conclude that the DM2hLer TNL protein and nuclear EDS1 cooperate, directly or indirectly, to drive cells into an immune response at the expense of growth. A further conclusion is that regulating the available EDS1 nuclear pool is fundamental for maintaining homeostatic control of TNL immune pathways. PMID:27082651

Intracellular colocalization of HAP1/STBs with steroid hormone receptors and its enhancement by a proteasome inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujinaga, Ryutaro; Takeshita, Yukio; Yoshioka, Kazuhiro

2011-07-15

The stigmoid body (STB) is a cytoplasmic inclusion containing huntingtin-associated protein 1 (HAP1), and HAP1/STB formation is induced by transfection of the HAP1 gene into cultured cells. In the present study, we examined the intracellular colocalization of HAP1/STBs with steroid hormone receptors (SHRs), including the androgen receptor (AR), estrogen receptor, glucocorticoid receptor (GR), and mineralocorticoid receptor, in COS-7 cells cotransfected with HAP1 and each receptor. We found that C-terminal ligand-binding domains of all SHRs had potential for colocalization with HAP1/STBs, whereas only AR and GR were clearly colocalized with HAP1/STBs when each full-length SHR was coexpressed with HAP1. In addition,more » it appeared that HAP1/STBs did not disrupt GR and AR functions because the receptors on HAP1/STBs maintained nuclear translocation activity in response to their specific ligands. When the cells were treated with a proteasome inhibitor, GR and AR localized outside HAP1/STBs translocated into the nucleus, whereas the receptors colocalized with HAP1/STBs persisted in their colocalization even after treatment with their ligands. Therefore, HAP1/STBs may be involved in cytoplasmic modifications of the nuclear translocation of GR and AR in a ubiquitin-proteasome system.« less

Nuclear receptors and pathogenesis of pancreatic cancer

PubMed Central

Polvani, Simone; Tarocchi, Mirko; Tempesti, Sara; Galli, Andrea

2014-01-01

Pancreatic ductal adenocarcinoma (PDAC) is a devastating disease with a median overall survival time of 5 mo and the five years survival less than 5%, a rate essentially unchanged over the course of the years. A well defined progression model of accumulation of genetic alterations ranging from single point mutations to gross chromosomal abnormalities has been introduced to describe the origin of this disease. However, due to the its subtle nature and concurring events PDAC cure remains elusive. Nuclear receptors (NR) are members of a large superfamily of evolutionarily conserved ligand-regulated DNA-binding transcription factors functionally involved in important cellular functions ranging from regulation of metabolism, to growth and development. Given the nature of their ligands, NR are very tempting drug targets and their pharmacological modulation has been widely exploited for the treatment of metabolic and inflammatory diseases. There are now clear evidences that both classical ligand-activated and orphan NR are involved in the pathogenesis of PDAC from its very early stages; nonetheless many aspects of their role are not fully understood. The purpose of this review is to highlight the striking connections that link peroxisome proliferator activated receptors, retinoic acid receptors, retinoid X receptor, androgen receptor, estrogen receptors and the orphan NR Nur, chicken ovalbumin upstream promoter transcription factor II and the liver receptor homologue-1 receptor to PDAC development, connections that could lead to the identification of novel therapies for this disease. PMID:25232244

Selective regulation of nuclear orphan receptors 4A by adenosine receptor subtypes in human mast cells

PubMed Central

Zhang, Li; Paine, Catherine

2010-01-01

Nuclear orphan receptors 4A (NR4A) are early responsive genes that belong to the superfamily of hormone receptors and comprise NR4A1, NR4A2 and NR4A3. They have been associated to transcriptional activation of multiple genes involved in inflammation, apoptosis and cell cycle control. Here, we establish a link between NR4As and adenosine, a paradoxical inflammatory molecule that can contribute to persistence of inflammation or mediate inflammatory shutdown. Transcriptomics screening of the human mast cell-line HMC-1 revealed a sharp induction of transcriptionally active NR4A2 and NR4A3 by the adenosine analogue NECA. The concomitant treatment of NECA and the adenosine receptor A2A (A2AAR) selective antagonist SCH-58261 exaggerated this effect, suggesting that upregulation of these factors in mast cells is mediated by other AR subtypes (A2B and A3) and that A2AAR activation counteracts NR4A2 and NR4A3 induction. In agreement with this, A2AAR-silencing amplified NR4A induction by NECA. Interestingly, a similar A2AAR modulatory effect was observed on ERK1/2 phosphorylation because A2AAR blockage exacerbated NECA-mediated phosphorylation of ERK1/2. In addition, PKC or MEK1/2 inhibition prevented ERK1/2 phosphorylation and antagonized AR-mediated induction of NR4A2 and NR4A3, suggesting the involvement of these kinases in AR to NR4A signaling. Finally, we observed that selective A2AAR activation with CGS-21680 blocked PMA-induced ERK1/2 phosphorylation and modulated the overexpression of functional nuclear orphan receptors 4A. Taken together, these results establish a novel PKC/ERK/nuclear orphan receptors 4A axis for adenosinergic signaling in mast cells, which can be modulated by A2AAR activation, not only in the context of adenosine but of other mast cell activating stimuli as well. PMID:21234122

Characterization of the Binding of a Potent Synthetic Androgen, Methyltrienolone, to Human Tissues

PubMed Central

Menon, Mani; Tananis, Catherine E.; Hicks, L. Louise; Hawkins, Edward F.; McLoughlin, Martin G.; Walsh, Patrick C.

1978-01-01

The potent synthetic androgen methytrienolone (R 1881), which does not bind to serum proteins, was utilized to characterize binding to receptors in human androgen responsive tissues. Cytosol extracts prepared from hypertrophic prostates (BPH) were utilized as the source of receptor for the initial studies. High affinity binding was detected in the cytosol of 29 of 30 samples of BPH (average number of binding sites, 45.8±4.7 fmol/mg of protein; dissociation constant, 0.9±0.2 nM). This binding had the characteristics of a receptor: heat lability, precipitability by 0-33% ammonium sulfate and by protamine sulfate, and 8S sedimentation coefficient. High affinity binding was also detected in cytosol prepared from seminal vesicle, epididymis, and genital skin but not in non-genital skin or muscle. However, similar binding was demonstrated in the cytosol of human uterus. The steroid specificities of binding to the cytosol of male tissues of accessory reproduction and of uterus were similar in that progestational agents were more effective competitors than natural androgens. Binding specificities in cytosol prepared from genital skin were distinctly different and were similar to those of ventral prostate from the castrated rat in that dihydrotestosterone was much more potent than progestins in competition. Thus binding of R 1881 to the cytosol of prostate, epididymis, and seminal vesicle has some characteristics of binding to a progesterone receptor. When the nuclear extract from BPH was analyzed, high affinity binding was demonstrated that conformed to the specificities of binding to an androgen receptor. Here dihydrotestosterone was a more potent competitor than progestational agents. Similar patterns of binding were detected in the crude nuclear extracts from seminal vesicle, epididymis, and genital skin but not in uterus, muscle, or non-genital skin. We conclude that the androgen receptor is not demonstrable in the cytosol of prostate, epididymis, or seminal vesicle of non-castrated men but can be measured in the cytosol of genital skin and the nuclear extracts of androgen responsive tissues. Because steroid hormones exert their major influence within the nucleus of target tissues, the measurement of nuclear receptor may provide valuable insight into the regulation of growth of target tissues. PMID:73547

Development of a Systems Computational Model to Investigate Early Biological Events in Hepatic Activation of Constitutive Androstane Receptor (CAR) by Phenobarbital

EPA Science Inventory

Activation of the nuclear receptor CAR (constitutive active/androstane receptor) is implicated in the control several key biological events such as metabolic pathways. Here, we combined data from literature with information obtained from in vitro assays in the US EPA ToxCast dat...

Kruppel-like Factor 9 is a Negative Regulator of Ligand-dependent Estrogen Receptor Alpha Signaling in Ishikawa Endometrial Adenocarcinoma Cells

USDA-ARS?s Scientific Manuscript database

Estrogen (E) and progesterone (P), acting through their respective receptors and other nuclear proteins, exhibit opposing activities in target cells. We previously reported that Krüppel-like factor 9 (KLF9) cooperates with progesterone receptor (PR) to facilitate P-dependent gene transcription in ut...

Ultraviolet radiation-induced interleukin 6 release in HeLa cells is mediated via membrane events in a DNA damage-independent way.

PubMed

Kulms, D; Pöppelmann, B; Schwarz, T

2000-05-19

Evidence exists that ultraviolet radiation (UV) affects molecular targets in the nucleus or at the cell membrane. UV-induced apoptosis was found to be mediated via DNA damage and activation of death receptors, suggesting that nuclear and membrane effects are not mutually exclusive. To determine whether participation of nuclear and membrane components is also essential for other UV responses, we studied the induction of interleukin-6 (IL-6) by UV. Exposing HeLa cells to UV at 4 degrees C, which inhibits activation of surface receptors, almost completely prevented IL-6 release. Enhanced repair of UV-mediated DNA damage by addition of the DNA repair enzyme photolyase did not affect UV-induced IL-6 production, suggesting that in this case membrane events predominant over nuclear effects. UV-induced IL-6 release is mediated via NFkappaB since the NFkappaB inhibitor MG132 or transfection of cells with a super-repressor form of the NFkappaB inhibitor IkappaB reduced IL-6 release. Transfection with a dominant negative mutant of the signaling protein TRAF-2 reduced IL-6 release upon exposure to UV, indicating that UV-induced IL-6 release is mediated by activation of the tumor necrosis factor receptor-1. These data demonstrate that UV can exert biological effects mainly by affecting cell surface receptors and that this is independent of its ability to induce nuclear DNA damage.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Sangkyu, E-mail: 49park@cku.ac.kr; Lee, Yoo Jeong; Ko, Eun Hee

Glucose metabolism is balanced by glycolysis and gluconeogenesis with precise control in the liver. The expression of genes related to glucose metabolism is regulated primarily by glucose and insulin at transcriptional level. Nuclear receptors play important roles in regulating the gene expression of glucose metabolism at transcriptional level. Some of these nuclear receptors form heterodimers with RXRs to bind to their specific regulatory elements on the target promoters. To date, three isotypes of RXRs have been identified; RXRα, RXRβ and RXRγ. However, their involvement in the interactions with other nuclear receptors in the liver remains unclear. In this study, wemore » found RXRγ is rapidly induced after feeding in the mouse liver, indicating a potential role of RXRγ in controlling glucose or lipid metabolism in the fasting–feeding cycle. In addition, RXRγ expression was upregulated by glucose in primary hepatocytes. This implies that glucose metabolism governed by RXRγ in conjunction with other nuclear receptors. The luciferase reporter assay showed that RXRγ as well as RXRα increased SREBP-1c promoter activity in hepatocytes. These results suggest that RXRγ may play an important role in tight control of glucose metabolism in the fasting–feeding cycle. - Highlights: • Refeeding increases the RXRγ expression level in mouse liver. • RXRγ expression is induced by high glucose condition in primary hepatocytes. • RXRγ and LXRα have synergistic effect on SREBP-1c promoter activity. • RXRγ binds to LXRE(-299/-280) located within SREBP-1c promoter region and interacts with LXRα.« less

Nuclear Membranes ETB Receptors Mediate ET-1-induced Increase of Nuclear Calcium in Human Left Ventricular Endocardial Endothelial Cells.

PubMed

Jules, Farah; Avedanian, Levon; Al-Khoury, Johny; Keita, Ramatoulaye; Normand, Alexandre; Bkaily, Ghassan; Jacques, Danielle

2015-07-01

In fetal human left ventricular endocardial endothelial cells (EECLs), both plasma membrane (PM) ET(A)R and ET(B)R were reported to mediate ET-1-induced increase of intracellular calcium [Ca](i); however, this effect was mediated by ET(A)R in right EECs (EECRs). In this study, we verified whether, as for the PM, nuclear membranes (NMs) ET-1 receptors activation in EECLs and EECRs induce an increase of nuclear calcium ([Ca](n)) and if this effect is mediated through the same receptor type as in PM. Using a plasmalemma-perforated technique and 3D confocal microscopy, our results showed that, as in PM intact cells, superfusion of nuclei of both cell types with cytosolic ET-1 induced a concentration-dependent sustained increase of [Ca](n). In EECRs, the ET(A)R antagonist prevented the effect of ET-1 on [Ca](n) without affecting EECLs. However, in both cell types, the effect of cytosolic ET-1 on [Ca](n) was prevented by the ETBR antagonist. In conclusion, both NMs' ET(A)R and ET(B)R mediated the effect of cytosolic ET-1 on [Ca](n) in EECRs. In contrast, only NMs' ET(B)R activation mediated the effect of cytosolic ET-1 in EECLs. Hence, the type of NMs' receptors mediating the effect of ET-1 on [Ca](n) are different from those of PM mediating the increase in [Ca](i).

Inhibition of Smooth Muscle Proliferation by Urea-Based Alkanoic Acids via Peroxisome Proliferator-Activated Receptor α–Dependent Repression of Cyclin D1

PubMed Central

Ng, Valerie Y.; Morisseau, Christophe; Falck, John R.; Hammock, Bruce D.; Kroetz, Deanna L.

2007-01-01

Objective Proliferation of smooth muscle cells is implicated in cardiovascular complications. Previously, a urea-based soluble epoxide hydrolase inhibitor was shown to attenuate smooth muscle cell proliferation. We examined the possibility that urea-based alkanoic acids activate the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) and the role of PPARα in smooth muscle cell proliferation. Methods and Results Alkanoic acids transactivated PPARα, induced binding of PPARα to its response element, and significantly induced the expression of PPARα-responsive genes, showing their function as PPARα agonists. Furthermore, the alkanoic acids attenuated platelet-derived growth factor–induced smooth muscle cell proliferation via repression of cyclin D1 expression. Using small interfering RNA to decrease endogenous PPARα expression, it was determined that PPARα was partially involved in the cyclin D1 repression. The antiproliferative effects of alkanoic acids may also be attributed to their inhibitory effects on soluble epoxide hydrolase, because epoxyeicosatrienoic acids alone inhibited smooth muscle cell proliferation. Conclusions These results show that attenuation of smooth muscle cell proliferation by urea-based alkanoic acids is mediated, in part, by the activation of PPARα. These acids may be useful for designing therapeutics to treat diseases characterized by excessive smooth muscle cell proliferation. PMID:16917105

O-GlcNAcylation of Orphan Nuclear Receptor Estrogen-Related Receptor γ Promotes Hepatic Gluconeogenesis.

PubMed

Misra, Jagannath; Kim, Don-Kyu; Jung, Yoon Seok; Kim, Han Byeol; Kim, Yong-Hoon; Yoo, Eun-Kyung; Kim, Byung Gyu; Kim, Sunghoon; Lee, In-Kyu; Harris, Robert A; Kim, Jeong-Sun; Lee, Chul-Ho; Cho, Jin Won; Choi, Hueng-Sik

2016-10-01

Estrogen-related receptor γ (ERRγ) is a major positive regulator of hepatic gluconeogenesis. Its transcriptional activity is suppressed by phosphorylation signaled by insulin in the fed state, but whether posttranslational modification alters its gluconeogenic activity in the fasted state is not known. Metabolically active hepatocytes direct a small amount of glucose into the hexosamine biosynthetic pathway, leading to protein O-GlcNAcylation. In this study, we demonstrate that ERRγ is O-GlcNAcylated by O-GlcNAc transferase in the fasted state. This stabilizes the protein by inhibiting proteasome-mediated protein degradation, increasing ERRγ recruitment to gluconeogenic gene promoters. Mass spectrometry identifies two serine residues (S317, S319) present in the ERRγ ligand-binding domain that are O-GlcNAcylated. Mutation of these residues destabilizes ERRγ protein and blocks the ability of ERRγ to induce gluconeogenesis in vivo. The impact of this pathway on gluconeogenesis in vivo was confirmed by the observation that decreasing the amount of O-GlcNAcylated ERRγ by overexpressing the deglycosylating enzyme O-GlcNAcase decreases ERRγ-dependent glucose production in fasted mice. We conclude that O-GlcNAcylation of ERRγ serves as a major signal to promote hepatic gluconeogenesis. © 2016 by the American Diabetes Association.

Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

PubMed Central

Velkov, Tony

2013-01-01

Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paterson, Carolyn P.; Ayalew, Lisanework E.; Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK S7N 5E3 S7N 5B4 Canada

The L1 region of bovine adenovirus (BAdV)-3 encodes a non-structural protein designated 52K. Anti-52K serum detected a protein of 40 kDa, which localized to the nucleus but not to the nucleolus in BAdV-3-infected or transfected cells. Analysis of mutant 52K proteins suggested that three basic residues ({sup 105}RKR{sup 107}) of the identified domain (amino acids {sup 102}GMPRKRVLT{sup 110}) are essential for nuclear localization of 52K. The nuclear import of a GST-52K fusion protein utilizes the classical importin {alpha}/{beta}-dependent nuclear transport pathway. The 52K protein is preferentially bound to the cellular nuclear import receptor importin {alpha}3. Although deletion of amino acidmore » 102-110 is sufficient to abrogate the nuclear localization of 52K, amino acid 90-133 are required for interaction with importin-{alpha}3 and localizing a cytoplasmic protein to the nucleus. These results suggest that 52K contains a bipartite NLS, which preferentially utilize an importin {alpha}3 nuclear import receptor-mediated pathway to transport 52K to the nucleus.« less

Nuclear Function of Smad7 Promotes Myogenesis▿

PubMed Central

Miyake, Tetsuaki; Alli, Nezeka S.; McDermott, John C.

2010-01-01

In the “canonical” view of transforming growth factor β (TGF-β) signaling, Smad7 plays an inhibitory role. While Smad7 represses Smad3 activation by TGF-β, it does not reverse the inhibitory effect of TGF-β on myogenesis, suggesting a different function in myogenic cells. We previously reported a promyogenic role of Smad7 mediated by an interaction with MyoD. Based on this association, we hypothesized a possible nuclear function of Smad7 independent of its role at the level of the receptor. We therefore engineered a chimera of Smad7 with a nuclear localization signal (NLS), which serves to prevent and therefore bypass binding to the TGF-β receptor while concomitantly constitutively localizing Smad7 to the nucleus. This Smad7-NLS did not repress Smad3 activation by TGF-β but did retain its ability to enhance myogenic gene activation and phenotypic myogenesis, indicating that the nuclear, receptor-independent function of Smad7 is sufficient to promote myogenesis. Furthermore, Smad7 physically interacts with MyoD and antagonizes the repressive effects of active MEK on MyoD. Reporter and myogenic conversion assays indicate a pivotal regulation of MyoD transcriptional properties by the balance between Smad7 and active MEK. Thus, Smad7 has a nuclear coactivator function that is independent of TGF-β signaling and necessary to promote myogenic differentiation. PMID:19995910

A synthetic peptide derived from A1 module in CRD4 of human TNF receptor-1 inhibits binding and proinflammatory effect of human TNF-alpha.

PubMed

Cao, Yingnan; Wang, Zhaohe; Bu, Xianzhang; Tang, Shu; Mei, Zhengrong; Liu, Peiqing

2009-06-01

Tumour necrosis factor alpha (TNF-alpha) is a proinflammatory cytokine, which has been shown to be a causative factor in rheumatoid arthritis, inflammatory bowel disease and septic shock. Proinflammatory effect of TNF-alpha is activated mainly through human TNF receptor-1 (TNF-R1). However, the role of the fourth cystein-rich domain (CRD4) of TNF-R1 extracellular portion in the interaction of TNF-alpha with TNF-R1 is still unclear. In the present study, binding activity of TNF-alpha to TNF-R1 and protein levels of IkappaB-alpha and nuclear transcription factor kappa B (NF-kappaB) p65 subunit in HeLa cells were measured using enzyme-linked immunosorbent assay (ELISA) and western-blot analysis. Pep 3 (LRENECVS) which was derived from the hydrophilic region of A1 module in CRD4 remarkably inhibited the binding of TNF-alpha to TNF-R1, and also reversed TNF-alpha-induced degradation of IkappaB-alpha and nuclear translocation of NF-kappaB p65 subunit in HeLa cells. Our results confirmed that the hydrophilic region of A1 module in CRD4 participated in the interaction of TNF-alpha with TNF-R1, and demonstrated the potential of small-molecule TNF-alpha extracellular inhibitors targeting at A1 module in CRD4 of TNF-R1 in suppressing proinflammatory effect of TNF-alpha.

Fatty acid amide hydrolase (FAAH) inhibition enhances memory acquisition through activation of PPAR-α nuclear receptors

PubMed Central

Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil

2009-01-01

Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB1-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for α-type peroxisome proliferator-activated nuclear receptors, PPAR-α) when and where they are naturally released in the brain. Using a passive-avoidance task in rats, we found that memory acquisition was enhanced by the FAAH inhibitor URB597 or by the PPAR-α agonist WY14643, and these enhancements were blocked by the PPAR-α antagonist MK886. These findings demonstrate novel mechanisms for memory enhancement by activation of PPAR-α, either directly by administering a PPAR-α agonist or indirectly by administering a FAAH inhibitor. PMID:19403796

Nuclear receptor TLX inhibits TGF-β signaling in glioblastoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johansson, Erik; Zhai, Qiwei; Zeng, Zhao-jun

TLX (also called NR2E1) is an orphan nuclear receptor that maintains stemness of neuronal stem cells. TLX is highly expressed in the most malignant form of glioma, glioblastoma multiforme (GBM), and is important for the proliferation and maintenance of the stem/progenitor cells of the tumor. Transforming Growth Factor-β (TGF-β) is a cytokine regulating many different cellular processes such as differentiation, migration, adhesion, cell death and proliferation. TGF-β has an important function in cancer where it can work as either a tumor suppressor or oncogene, depending on the cancer type and stage of tumor development. Since glioblastoma often have dysfunctional TGF-βmore » signaling we wanted to find out if there is any interaction between TLX and TGF-β in glioblastoma cells. We demonstrate that knockdown of TLX enhances the canonical TGF-β signaling response in glioblastoma cell lines. TLX physically interacts with and stabilizes Smurf1, which can ubiquitinate and target TGF-β receptor II for degradation, whereas knockdown of TLX leads to stabilization of TGF-β receptor II, increased nuclear translocation of Smad2/3 and enhanced expression of TGF-β target genes. The interaction between TLX and TGF-β may play an important role in the regulation of proliferation and tumor-initiating properties of glioblastoma cells. - Highlights: • TLX knockdown enhances TGF-β dependent Smad signaling in glioblastoma cells • TLX knockdown increases the protein level of TGF-β receptor II. • TLX stabilizes and retains Smurf1 in the cytoplasm. • TLX enhances Smurf1-dependent ubiquitination and degradation of TGF-β receptor II.« less

Gene and protein expression of oestrogen-β and progesterone receptors in facial melasma and adjacent healthy skin in women.

PubMed

Tamega, A de A; Miot, H A; Moço, N P; Silva, M G; Marques, M E A; Miot, L D B

2015-04-01

Compare gene and protein expression for oestrogen receptor-β (ER-β) and progesterone receptor (PR) in facial melasma and adjacent healthy skin. A cross-sectional study including 42 women with facial melasma, conducted at the Dermatology Service of Botucatu Medical School of São Paulo State University, Brazil. Biopsies of the melasma skin were performed, together with healthy surrounding skin. The gene expression (real-time PCR) of the hormone receptors in the tissue was evaluated. Subsequently, skin fragments were immunostained for nuclear ER-β and PR, evaluated according to their HSCORE (epidermis) and percentage of staining per microscopic field (dermis). Messenger RNA tissue expression for ER-β and PR showed no difference between melasma-affected skin fragments and the healthy perilesional areas (P > 0.2). Median nuclear epithelial expression for ER-β and PR was higher in lesioned skin (HSCORE 157 and 58) than in the healthy perilesional skin (HSCORE 97 and 19; P < 0.01), with no difference in dermal immunostaining. Nuclear histological expression for ER-β was associated to sun-induced melasma and negative familiar background; PR expression was associated to sun-induced melasma and darker phototypes. No difference was observed in gene expression for oestrogen-β and progesterone receptors in melasma-affected skin compared with adjacent healthy skin. However, the higher protein expression of these receptors in melasma-affected epithelia suggests hormonal participation in the pathogenesis of this disease. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Small heterodimer partner overexpression partially protects against liver tumor development in farnesoid X receptor knockout mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Guodong; Kong, Bo; Zhu, Yan

2013-10-15

Farnesoid X receptor (FXR, Nr1h4) and small heterodimer partner (SHP, Nr0b2) are nuclear receptors that are critical to liver homeostasis. Induction of SHP serves as a major mechanism of FXR in suppressing gene expression. Both FXR{sup −/−} and SHP{sup −/−} mice develop spontaneous hepatocellular carcinoma (HCC). SHP is one of the most strongly induced genes by FXR in the liver and is a tumor suppressor, therefore, we hypothesized that deficiency of SHP contributes to HCC development in the livers of FXR{sup −/−} mice and therefore, increased SHP expression in FXR{sup −/−} mice reduces liver tumorigenesis. To test this hypothesis, wemore » generated FXR{sup −/−} mice with overexpression of SHP in hepatocytes (FXR{sup −/−}/SHP{sup Tg}) and determined the contribution of SHP in HCC development in FXR{sup −/−} mice. Hepatocyte-specific SHP overexpression did not affect liver tumor incidence or size in FXR{sup −/−} mice. However, SHP overexpression led to a lower grade of dysplasia, reduced indicator cell proliferation and increased apoptosis. All tumor-bearing mice had increased serum bile acid levels and IL-6 levels, which was associated with activation of hepatic STAT3. In conclusion, SHP partially protects FXR{sup −/−} mice from HCC formation by reducing tumor malignancy. However, disrupted bile acid homeostasis by FXR deficiency leads to inflammation and injury, which ultimately results in uncontrolled cell proliferation and tumorigenesis in the liver. - Highlights: • SHP does not prevent HCC incidence nor size in FXR KO mice but reduces malignancy. • Increased SHP promotes apoptosis. • Bile acids and inflammation maybe critical for HCC formation with FXR deficiency.« less

Cex1p is a novel cytoplasmic component of the Saccharomyces cerevisiae nuclear tRNA export machinery.

PubMed

McGuire, Andrew T; Mangroo, Dev

2007-01-24

The Saccharomyces cerevisiae Yor112wp, which we named Cex1p, was identified using a yeast tRNA three-hybrid interaction approach and an in vivo nuclear tRNA export assay as a cytoplasmic component of the nuclear tRNA export machinery. Cex1p binds tRNA saturably, and associates with the nuclear pore complex by interacting directly with Nup116p. Cex1p co-purifies with the nuclear tRNA export receptors Los1p and Msn5p, the eukaryotic elongation factor eEF-1A, which delivers aminoacylated tRNAs to the ribosome, and the RanGTPase Gsp1p, but not with Cca1p, a tRNA maturation enzyme that facilitates translocation of non-aminoacylated tRNAs across the nuclear pore complex. Depletion of Cex1p and eEF-1A or Los1p significantly reduced the efficiency of nuclear tRNA export. Cex1p interacts with Los1p but not with eEF-1A in vitro. These findings suggest that Cex1p is a component of the nuclear aminoacylation-dependent tRNA export pathway in S. cerevisiae. They also suggest that Cex1p collects aminoacyl-tRNAs from the nuclear export receptors at the cytoplasmic side of the nuclear pore complex, and transfers them to eEF-1A using a channelling mechanism.

Growth hormone-specific induction of the nuclear localization of porcine growth hormone receptor in porcine hepatocytes.

PubMed

Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X

2017-10-01

The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.

P2X1 receptor-mediated inhibition of the proliferation of human coronary smooth muscle cells involving the transcription factor NR4A1.

PubMed

Hinze, Annette Viktoria; Mayer, Peter; Harst, Anja; von Kügelgen, Ivar

2013-12-01

Adenine nucleotides acting at P2X1 receptors are potent vasoconstrictors. Recently, we demonstrated that activation of adenosine A2B receptors on human coronary smooth muscle cells inhibits cell proliferation by the induction of the nuclear receptor subfamily 4, group A, member 1 (NR4A1; alternative notation Nur77). In the present study, we searched for long-term effects mediated by P2X1 receptors by analyzing receptor-mediated changes in cell proliferation and in the expression of NR4A1. Cultured human coronary smooth muscle cells were treated with selective receptor ligands. Effects on proliferation were determined by counting cells and measuring changes in impedance. The induction of transcription factors was assessed by qPCR. The P2X receptor agonist α,β-methylene-ATP and its analog β,γ-methylene-ATP inhibited cell proliferation by about 50 % after 5 days in culture with half-maximal concentrations of 0.3 and 0.08 μM, respectively. The effects were abolished or markedly attenuated by the P2X1 receptor antagonist NF449 (carbonylbis-imino-benzene-triylbis-(carbonylimino)tetrakis-benzene-1,3-disulfonic acid; 100 nM and 1 μM). α,β-methylene-ATP and β,γ-methylene-ATP applied for 30 min to 4 h increased the expression of NR4A1; NF449 blocked or attenuated this effect. Small interfering RNA directed against NR4A1 diminished the antiproliferative effects of α,β-methylene-ATP and β,γ-methylene-ATP. α,β-methylene-ATP (0.1 to 30 μM) decreased migration of cultured human coronary smooth muscle cells in a chamber measuring changes in impedance; NF449 blocked the effect. In conclusion, our results demonstrate for the first time that adenine nucleotides acting at P2X1 receptors inhibit the proliferation of human coronary smooth muscle cells via the induction of the early gene NR4A1.

Nuclear uptake and dosimetry of 64Cu-labeled chelator somatostatin conjugates in an SSTr2-transfected human tumor cell line.

PubMed

Eiblmaier, Martin; Andrews, Rebecca; Laforest, Richard; Rogers, Buck E; Anderson, Carolyn J

2007-08-01

64Cu radiopharmaceuticals have shown tumor growth inhibition in tumor-bearing animal models with a relatively low radiation dose that may be related to nuclear localization of the 64Cu in tumor cells. Here we address whether the nuclear localization of 64Cu from a 64Cu-labeled chelator-somatostatin conjugate is related to the dissociation of the radio-copper from its chelator. The 64Cu complex of 1,4,8,11-tetraazacyclotetradecane-1,4,8,11-tetraacetic acid (TETA) has demonstrated instability in vivo, whereas 64Cu-CB-TE2A (CB-TE2A is 4,11-bis(carboxymethyl)-1,4,8,11-tetraazabicyclo[6.6.2]hexadecane) was highly stable. Receptor binding, nuclear uptake, internalization, and efflux assays were performed to characterize the interaction with the somatostatin receptor and the intracellular fate of 64Cu-labeled chelator-peptide conjugates in A427-7 cells. From these data, the absorbed dose to cells was calculated. 64Cu-TETA-Y3-TATE (64Cu-[1]) and 64Cu-CB-TE2A-Y3-TATE (64Cu-[2]) had high affinity for somatostatin receptor subtype 2 (SSTr2) in A427-7 cells. After 3 h, 64Cu-[2] showed greater internalization (>30%) compared with 64Cu-[1] (approximately 15%). There was uptake of 64Cu-[1] in nuclei of 427-7 cells (9.4% +/- 1.7% at 24 h), whereas 64Cu-[2] showed minimal nuclear accumulation out to 24 h (1.3% +/- 0.1%). A427-7 cells were exposed to 0.40 Gy from 64Cu-[1] and exposed to 1.06 Gy from 64Cu-[2]. External beam irradiation of A427-7 cells showed <20% cell killing at 1 Gy. These results are consistent with our hypothesis that dissociation of 64Cu from TETA leads to nuclear localization. Dosimetry calculations indicated that the nuclear localization of 64Cu-[1] was not significant enough to increase the absorbed dose to the nuclei of A427-7 cells. These studies show that 64Cu localization to cell nuclei from internalizing, receptor-targeted radiopharmaceuticals is related to chelate stability.

Beyond small molecule SAR – using the dopamine D3 receptor crystal structure to guide drug design

PubMed Central

Keck, Thomas M.; Burzynski, Caitlin; Shi, Lei; Newman, Amy Hauck

2016-01-01

The dopamine D3 receptor is a target of pharmacotherapeutic interest in a variety of neurological disorders including schizophrenia, restless leg syndrome, and drug addiction. The high protein sequence homology between the D3 and D2 receptors has posed a challenge to developing D3 receptor-selective ligands whose behavioral actions can be attributed to D3 receptor engagement, in vivo. However, through primarily small molecule structure-activity relationship (SAR) studies, a variety of chemical scaffolds have been discovered over the past two decades that have resulted in several D3 receptor-selective ligands with high affinity and in vivo activity. Nevertheless, viable clinical candidates remain limited. The recent determination of the high-resolution crystal structure of the D3 receptor has invigorated structure-based drug design, providing refinements to the molecular dynamic models and testable predictions about receptor-ligand interactions. This review will highlight recent preclinical and clinical studies demonstrating potential utility of D3 receptor-selective ligands in the treatment of addiction. In addition, new structure-based rational drug design strategies for D3 receptor-selective ligands that complement traditional small molecule SAR to improve the selectivity and directed efficacy profiles are examined. PMID:24484980

The cannabinoid receptor CB1 modulates the signaling properties of the lysophosphatidylinositol receptor GPR55.

PubMed

Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P; Brown, Andrew J; Heinemann, Akos; Waldhoer, Maria

2012-12-28

The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors.

The Cannabinoid Receptor CB1 Modulates the Signaling Properties of the Lysophosphatidylinositol Receptor GPR55*

PubMed Central

Kargl, Julia; Balenga, Nariman; Parzmair, Gerald P.; Brown, Andrew J.; Heinemann, Akos; Waldhoer, Maria

2012-01-01

The G protein-coupled receptor (GPCR) 55 (GPR55) and the cannabinoid receptor 1 (CB1R) are co-expressed in many tissues, predominantly in the central nervous system. Seven transmembrane spanning (7TM) receptors/GPCRs can form homo- and heteromers and initiate distinct signaling pathways. Recently, several synthetic CB1 receptor inverse agonists/antagonists, such as SR141716A, AM251, and AM281, were reported to activate GPR55. Of these, SR141716A was marketed as a promising anti-obesity drug, but was withdrawn from the market because of severe side effects. Here, we tested whether GPR55 and CB1 receptors are capable of (i) forming heteromers and (ii) whether such heteromers could exhibit novel signaling patterns. We show that GPR55 and CB1 receptors alter each others signaling properties in human embryonic kidney (HEK293) cells. We demonstrate that the co-expression of FLAG-CB1 receptors in cells stably expressing HA-GPR55 specifically inhibits GPR55-mediated transcription factor activation, such as nuclear factor of activated T-cells and serum response element, as well as extracellular signal-regulated kinases (ERK1/2) activation. GPR55 and CB1 receptors can form heteromers, but the internalization of both receptors is not affected. In addition, we observe that the presence of GPR55 enhances CB1R-mediated ERK1/2 and nuclear factor of activated T-cell activation. Our data provide the first evidence that GPR55 can form heteromers with another 7TM/GPCR and that this interaction with the CB1 receptor has functional consequences in vitro. The GPR55-CB1R heteromer may play an important physiological and/or pathophysiological role in tissues endogenously co-expressing both receptors. PMID:23161546

Expression and potential role of the peptide orexin-A in prostate cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valiante, Salvatore; Liguori, Giovanna; Tafuri, Simona

The peptides orexin-A and orexin-B and their G protein-coupled OX1 and OX2 receptors are involved in multiple physiological processes in the central nervous system and peripheral organs. Altered expression or signaling dysregulation of orexins and their receptors have been associated with a wide range of human diseases including narcolepsy, obesity, drug addiction, and cancer. Although orexin-A, its precursor molecule prepro-orexin and OX1 receptor have been detected in the human normal and hyperplastic prostate tissues, their expression and function in the prostate cancer (PCa) remains to be addressed. Here, we demonstrate for the first time the immunohistochemical localization of orexin-A inmore » human PCa specimens, and the expression of prepro-orexin and OX1 receptor at both protein and mRNA levels in these tissues. Orexin-A administration to the human androgen-dependent prostate carcinoma cells LNCaP up-regulates OX1 receptor expression resulting in a decrease of cell survival. Noteworthy, nanomolar concentrations of the peptide counteract the testosterone-induced nuclear translocation of the androgen receptor in the cells: the orexin-A action is prevented by the addition of the OX1 receptor antagonist SB-408124 to the test system. These findings indicate that orexin-A/OX1 receptor interaction interferes with the activity of the androgen receptor which regulates PCa onset and progression, thus suggesting that orexin-A and its receptor might represent novel therapeutic targets to challenge this aggressive cancer. - Highlights: • Orexin-A and OX1 receptor are present in human cancer prostate tissues. • Orexin-A up-regulates OX1 receptor expression in LNCaP cells. • Orexin-A inhibits testosterone-induced nuclear translocation of androgen receptor.« less

[Roles of G protein-coupled estrogen receptor in the male reproductive system].

PubMed

Chen, Kai-hong; Zhang, Xian; Jiang, Xue-wu

2016-02-01

The G protein-coupled estrogen receptor (GPER), also known as G protein-coupled receptor 30 (GPR30), was identified in the recent years as a functional membrane receptor different from the classical nuclear estrogen receptors. This receptor is widely expressed in the cortex, cerebellum, hippocampus, heart, lung, liver, skeletal muscle, and the urogenital system. It is responsible for the mediation of nongenomic effects associated with estrogen and its derivatives, participating in the physiological activities of the body. The present study reviews the molecular structure, subcellular localization, signaling pathways, distribution, and function of GPER in the male reproductive system.

Control of energy balance by hypothalamic gene circuitry involving two nuclear receptors, neuron-derived orphan receptor 1 and glucocorticoid receptor.

PubMed

Kim, Sun-Gyun; Lee, Bora; Kim, Dae-Hwan; Kim, Juhee; Lee, Seunghee; Lee, Soo-Kyung; Lee, Jae W

2013-10-01

Nuclear receptors (NRs) regulate diverse physiological processes, including the central nervous system control of energy balance. However, the molecular mechanisms for the central actions of NRs in energy balance remain relatively poorly defined. Here we report a hypothalamic gene network involving two NRs, neuron-derived orphan receptor 1 (NOR1) and glucocorticoid receptor (GR), which directs the regulated expression of orexigenic neuropeptides agouti-related peptide (AgRP) and neuropeptide Y (NPY) in response to peripheral signals. Our results suggest that the anorexigenic signal leptin induces NOR1 expression likely via the transcription factor cyclic AMP response element-binding protein (CREB), while the orexigenic signal glucocorticoid mobilizes GR to inhibit NOR1 expression by antagonizing the action of CREB. Also, NOR1 suppresses glucocorticoid-dependent expression of AgRP and NPY. Consistently, relative to wild-type mice, NOR1-null mice showed significantly higher levels of AgRP and NPY and were less responsive to leptin in decreasing the expression of AgRP and NPY. These results identify mutual antagonism between NOR1 and GR to be a key rheostat for peripheral metabolic signals to centrally control energy balance.

Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor.

PubMed Central

Göttlicher, M; Widmark, E; Li, Q; Gustafsson, J A

1992-01-01

Peroxisome proliferators such as clofibric acid, nafenopin, and WY-14,643 have been shown to activate PPAR (peroxisome proliferator-activated receptor), a member of the steroid nuclear receptor superfamily. We have cloned the cDNA from the rat that is homologous to that from the mouse [Issemann, I. & Green, S. (1990) Nature (London) 347, 645-650], which encodes a 97% similar protein with a particularly well-conserved putative ligand-binding domain. To search for physiologically occurring activators, we established a transcriptional transactivation assay by stably expressing in CHO cells a chimera of rat PPAR and the human glucocorticoid receptor that activates expression of the placental alkaline phosphatase reporter gene under the control of the mouse mammary tumor virus promoter. Testing of compounds related to lipid metabolism or peroxisomal proliferation revealed that 150 microM concentrations of arachidonic or linoleic acid but not of dehydroepiandrosterone, cholesterol, or 25-hydroxy-cholesterol, activate the receptor chimera. In addition, saturated fatty acids induce the reporter gene. Shortening the chain length to n = 6 or introduction of an omega-terminal carboxylic group abolished the activation potential of the fatty acid. In conclusion, the present results indicate that fatty acids can regulate gene expression mediated by a member of the steroid nuclear receptor superfamily. Images PMID:1316614

Reengineering ribosome export.

PubMed

Lo, Kai-Yin; Johnson, Arlen W

2009-03-01

Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.

Reengineering Ribosome Export

PubMed Central

Lo, Kai-Yin

2009-01-01

Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820

Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense.

PubMed

Wirthmueller, Lennart; Zhang, Yan; Jones, Jonathan D G; Parker, Jane E

2007-12-04

Recognition of specific pathogen molecules inside the cell by nucleotide-binding domain and leucine-rich repeat (NB-LRR) receptors constitutes an important layer of innate immunity in plants. Receptor activation triggers host cellular reprogramming involving transcriptional potentiation of basal defenses and localized programmed cell death. The sites and modes of action of NB-LRR receptors are, however, poorly understood. Arabidopsis Toll/Interleukin-1 (TIR) type NB-LRR receptor RPS4 recognizes the bacterial type III effector AvrRps4. We show that epitope-tagged RPS4 expressed under its native regulatory sequences distributes between endomembranes and nuclei in healthy and AvrRps4-triggered tissues. RPS4 accumulation in the nucleus, mediated by a bipartite nuclear localization sequence (NLS) at its C terminus, is necessary for triggering immunity through authentic activation by AvrRps4 in Arabidopsis or as an effector-independent "deregulated" receptor in tobacco. A strikingly conserved feature of TIR-NB-LRR receptors is their recruitment of the nucleocytoplasmic basal-defense regulator EDS1 in resistance to diverse pathogens. We find that EDS1 is an indispensable component of RPS4 signaling and that it functions downstream of RPS4 activation but upstream of RPS4-mediated transcriptional reprogramming in the nucleus.

Peroxisome proliferator-activated receptor (PPAR)-binding protein (PBP) but not PPAR-interacting protein (PRIP) is required for nuclear translocation of constitutive androstane receptor in mouse liver.

PubMed

Guo, Dongsheng; Sarkar, Joy; Ahmed, Mohamed R; Viswakarma, Navin; Jia, Yuzhi; Yu, Songtao; Sambasiva Rao, M; Reddy, Janardan K

2006-08-25

The constitutive androstane receptor (CAR) regulates transcription of phenobarbital-inducible genes that encode xenobiotic-metabolizing enzymes in liver. CAR is localized to the hepatocyte cytoplasm but to be functional, it translocates into the nucleus in the presence of phenobarbital-like CAR ligands. We now demonstrate that adenovirally driven EGFP-CAR, as expected, translocates into the nucleus of normal wild-type hepatocytes following phenobarbital treatment under both in vivo and in vitro conditions. Using this approach we investigated the role of transcription coactivators PBP and PRIP in the translocation of EGFP-CAR into the nucleus of PBP and PRIP liver conditional null mouse hepatocytes. We show that coactivator PBP is essential for nuclear translocation of CAR but not PRIP. Adenoviral expression of both PBP and EGFP-CAR restored phenobarbital-mediated nuclear translocation of exogenously expressed CAR in PBP null livers in vivo and in PBP null primary hepatocytes in vitro. CAR translocation into the nucleus of PRIP null livers resulted in the induction of CAR target genes such as CYP2B10, necessary for the conversion of acetaminophen to its hepatotoxic intermediate metabolite, N-acetyl-p-benzoquinone imine. As a consequence, PRIP-deficiency in liver did not protect from acetaminophen-induced hepatic necrosis, unlike that exerted by PBP deficiency. These results establish that transcription coactivator PBP plays a pivotal role in nuclear localization of CAR, that it is likely that PBP either enhances nuclear import or nuclear retention of CAR in hepatocytes, and that PRIP is redundant for CAR function.

Quantitative High-Throughput Screening and Orthogonal Assays to Identify Modulators of the Vitamin D Receptor (SETAC)

EPA Science Inventory

The Vitamin D nuclear receptor (VDR) is a selective, ligand-inducible transcription factor involved in numerous biological processes such as cell proliferation, differentiation, detoxification, calcium homeostasis, neurodevelopment, immune system regulation, cardiovascular functi...

PPARs and Xenobiotic-Induced Adverse Effects:Relevance to Human Health

EPA Science Inventory

The peroxisome proliferator-activated receptors (PPARs) are members of the nuclear receptor superfamily that act as transcription factors and play important roles in the regulation ofa variety of biological processes, such as adipocyte proliferation and differentiation, glucose h...

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

ROS enhance angiogenic properties via regulation of NRF2 in tumor endothelial cells

PubMed Central

Towfik, Alam Mohammad; Akiyama, Kosuke; Ohga, Noritaka; Shindoh, Masanobu; Hida, Yasuhiro; Minowa, Kazuyuki; Fujisawa, Toshiaki; Hida, Kyoko

2017-01-01

Reactive oxygen species (ROS) are unstable molecules that activate oxidative stress. Because of the insufficient blood flow in tumors, the tumor microenvironment is often exposed to hypoxic condition and nutrient deprivation, which induces ROS accumulation. We isolated tumor endothelial cells (TECs) and found that they have various abnormalities, although the underlying mechanisms are not fully understood. Here we showed that ROS were accumulated in tumor blood vessels and ROS enhanced TEC migration with upregulation of several angiogenesis related gene expressions. It was also demonstrated that these genes were upregulated by regulation of Nuclear factor erythroid 2-related factor 2 (NRF2). Among these genes, we focused on Biglycan, a small leucine-rich proteoglycan. Inhibition of Toll-like receptors 2 and 4, known BIGLYCAN (BGN) receptors, cancelled the TEC motility stimulated by ROS. ROS inhibited NRF2 expression in TECs but not in NECs, and NRF2 inhibited phosphorylation of SMAD2/3, which activates transcription of BGN. These results indicated that ROS-induced BGN caused the pro-angiogenic phenotype in TECs via NRF2 dysregulation. PMID:28525375

Nuclear receptor TLX inhibits TGF-β signaling in glioblastoma.

PubMed

Johansson, Erik; Zhai, Qiwei; Zeng, Zhao-Jun; Yoshida, Takeshi; Funa, Keiko

2016-05-01

TLX (also called NR2E1) is an orphan nuclear receptor that maintains stemness of neuronal stem cells. TLX is highly expressed in the most malignant form of glioma, glioblastoma multiforme (GBM), and is important for the proliferation and maintenance of the stem/progenitor cells of the tumor. Transforming Growth Factor-β (TGF-β) is a cytokine regulating many different cellular processes such as differentiation, migration, adhesion, cell death and proliferation. TGF-β has an important function in cancer where it can work as either a tumor suppressor or oncogene, depending on the cancer type and stage of tumor development. Since glioblastoma often have dysfunctional TGF-β signaling we wanted to find out if there is any interaction between TLX and TGF-β in glioblastoma cells. We demonstrate that knockdown of TLX enhances the canonical TGF-β signaling response in glioblastoma cell lines. TLX physically interacts with and stabilizes Smurf1, which can ubiquitinate and target TGF-β receptor II for degradation, whereas knockdown of TLX leads to stabilization of TGF-β receptor II, increased nuclear translocation of Smad2/3 and enhanced expression of TGF-β target genes. The interaction between TLX and TGF-β may play an important role in the regulation of proliferation and tumor-initiating properties of glioblastoma cells. Copyright © 2016. Published by Elsevier Inc.

Structural basis for corepressor assembly by the orphan nuclear receptor TLX.

PubMed

Zhi, Xiaoyong; Zhou, X Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten; Xu, H Eric

2015-02-15

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX-Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. © 2015 Zhi et al.; Published by Cold Spring Harbor Laboratory Press.

Use of High Throughput Screening Data in IARC Monograph ...

EPA Pesticide Factsheets

Purpose: Evaluation of carcinogenic mechanisms serves a critical role in IARC monograph evaluations, and can lead to “upgrade” or “downgrade” of the carcinogenicity conclusions based on human and animal evidence alone. Three recent IARC monograph Working Groups (110, 112, and 113) pioneered analysis of high throughput in vitro screening data from the U.S. Environmental Protection Agency’s ToxCast program in evaluations of carcinogenic mechanisms. Methods: For monograph 110, ToxCast assay data across multiple nuclear receptors were used to test the hypothesis that PFOA acts exclusively through the PPAR family of receptors, with activity profiles compared to several prototypical nuclear receptor-activating compounds. For monographs 112 and 113, ToxCast assays were systematically evaluated and used as an additional data stream in the overall evaluation of the mechanistic evidence. Specifically, ToxCast assays were mapped to 10 “key characteristics of carcinogens” recently identified by an IARC expert group, and chemicals’ bioactivity profiles were evaluated both in absolute terms (number of relevant assays positive for bioactivity) and relative terms (ranking with respect to other compounds evaluated by IARC, using the ToxPi methodology). Results: PFOA activates multiple nuclear receptors in addition to the PPAR family in the ToxCast assays. ToxCast assays offered substantial coverage for 5 of the 10 “key characteristics,” with the greates

Abnormal XPD-induced nuclear receptor transactivation in DNA repair disorders: trichothiodystrophy and xeroderma pigmentosum

PubMed Central

Zhou, Xiaolong; Khan, Sikandar G; Tamura, Deborah; Ueda, Takahiro; Boyle, Jennifer; Compe, Emmanuel; Egly, Jean-Marc; DiGiovanna, John J; Kraemer, Kenneth H

2013-01-01

XPD (ERCC2) is a DNA helicase involved in nucleotide excision repair and in transcription as a structural bridge tying the transcription factor IIH (TFIIH) core with the cdk-activating kinase complex, which phosphorylates nuclear receptors. Mutations in XPD are associated with several different phenotypes, including trichothiodystrophy (TTD), with sulfur-deficient brittle hair, bone defects, and developmental abnormalities without skin cancer, xeroderma pigmentosum (XP), with pigmentary abnormalities and increased skin cancer, or XP/TTD with combined features, including skin cancer. We describe the varied clinical features and mutations in nine patients examined at the National Institutes of Health who were compound heterozygotes for XPD mutations but had different clinical phenotypes: four TTD, three XP, and two combined XP/TTD. We studied TFIIH-dependent transactivation by nuclear receptor for vitamin D (VDR) and thyroid in cells from these patients. The vitamin D stimulation ratio of CYP24 and osteopontin was associated with specific pairs of mutations (reduced in 5, elevated in 1) but not correlated with distinct clinical phenotypes. Thyroid receptor stimulation ratio for KLF9 was not significantly different from normal. XPD mutations frequently were associated with abnormal VDR stimulation in compound heterozygote patients with TTD, XP, or XP/TTD. PMID:23232694

Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto

2009-12-18

The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins aremore » known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.« less

Structural and functional evidences for the interactions between nuclear hormone receptors and endocrine disruptors at low doses.

PubMed

Balaguer, Patrick; Delfosse, Vanessa; Grimaldi, Marina; Bourguet, William

Endocrine-disrupting chemicals (EDCs) represent a broad class of exogenous substances that cause adverse effects in the endocrine system mainly by interacting with nuclear hormone receptors (NRs). Humans are generally exposed to low doses of pollutants, and current researches aim at deciphering the mechanisms accounting for the health impact of EDCs at environmental concentrations. Our correlative analysis of structural, interaction and cell-based data has revealed a variety of, sometimes unexpected, binding modes, reflecting a wide range of EDC affinities and specificities. Here, we present a few representative examples to illustrate various means by which EDCs achieve high-affinity binding to NRs. These examples include the binding of the mycoestrogen α-zearalanol to estrogen receptors, the covalent interaction of organotins with the retinoid X- and peroxisome proliferator-activated receptors, and the cooperative binding of two chemicals to the pregnane X receptor. We also discuss some hypotheses that could further explain low-concentration effects of EDCs with weaker affinity towards NRs. Copyright © 2017. Published by Elsevier Masson SAS.

Identification of isosilybin a from milk thistle seeds as an agonist of peroxisome proliferator-activated receptor gamma.

PubMed

Pferschy-Wenzig, Eva-Maria; Atanasov, Atanas G; Malainer, Clemens; Noha, Stefan M; Kunert, Olaf; Schuster, Daniela; Heiss, Elke H; Oberlies, Nicholas H; Wagner, Hildebert; Bauer, Rudolf; Dirsch, Verena M

2014-04-25

Peroxisome proliferator-activated receptor gamma (PPARγ) is a key regulator of glucose and lipid metabolism. Agonists of this nuclear receptor are used in the treatment of type 2 diabetes and are also studied as a potential treatment of other metabolic diseases, including nonalcoholic fatty liver disease. Silymarin, a concentrated phenolic mixture from milk thistle (Silybum marianum) seeds, is used widely as a supportive agent in the treatment of a variety of liver diseases. In this study, the PPARγ activation potential of silymarin and its main constituents was investigated. Isosilybin A (3) caused transactivation of a PPARγ-dependent luciferase reporter in a concentration-dependent manner. This effect could be reversed upon co-treatment with the PPARγ antagonist T0070907. In silico docking studies suggested a binding mode for 3 distinct from that of the inactive silymarin constituents, with one additional hydrogen bond to Ser342 in the entrance region of the ligand-binding domain of the receptor. Hence, isosilybin A (3) has been identified as the first flavonolignan PPARγ agonist, suggesting its further investigation as a modulator of this nuclear receptor.

A comprehensive data mining study shows that most nuclear receptors act as newly proposed homeostasis-associated molecular pattern receptors.

PubMed

Wang, Luqiao; Nanayakkara, Gayani; Yang, Qian; Tan, Hongmei; Drummer, Charles; Sun, Yu; Shao, Ying; Fu, Hangfei; Cueto, Ramon; Shan, Huimin; Bottiglieri, Teodoro; Li, Ya-Feng; Johnson, Candice; Yang, William Y; Yang, Fan; Xu, Yanjie; Xi, Hang; Liu, Weiqing; Yu, Jun; Choi, Eric T; Cheng, Xiaoshu; Wang, Hong; Yang, Xiaofeng

2017-10-24

Nuclear receptors (NRs) can regulate gene expression; therefore, they are classified as transcription factors. Despite the extensive research carried out on NRs, still several issues including (1) the expression profile of NRs in human tissues, (2) how the NR expression is modulated during atherosclerosis and metabolic diseases, and (3) the overview of the role of NRs in inflammatory conditions are not fully understood. To determine whether and how the expression of NRs are regulated in physiological/pathological conditions, we took an experimental database analysis to determine expression of all 48 known NRs in 21 human and 17 murine tissues as well as in pathological conditions. We made the following significant findings: (1) NRs are differentially expressed in tissues, which may be under regulation by oxygen sensors, angiogenesis pathway, stem cell master regulators, inflammasomes, and tissue hypo-/hypermethylation indexes; (2) NR sequence mutations are associated with increased risks for development of cancers and metabolic, cardiovascular, and autoimmune diseases; (3) NRs have less tendency to be upregulated than downregulated in cancers, and autoimmune and metabolic diseases, which may be regulated by inflammation pathways and mitochondrial energy enzymes; and (4) the innate immune sensor inflammasome/caspase-1 pathway regulates the expression of most NRs. Based on our findings, we propose a new paradigm that most nuclear receptors are anti-inflammatory homeostasis-associated molecular pattern receptors (HAMPRs). Our results have provided a novel insight on NRs as therapeutic targets in metabolic diseases, inflammations, and malignancies.

The Drosophila Juvenile Hormone Receptor Candidates Methoprene-tolerant (MET) and Germ Cell-expressed (GCE) Utilize a Conserved LIXXL Motif to Bind the FTZ-F1 Nuclear Receptor*

PubMed Central

Bernardo, Travis J.; Dubrovsky, Edward B.

2012-01-01

Juvenile hormone (JH) has been implicated in many developmental processes in holometabolous insects, but its mechanism of signaling remains controversial. We previously found that in Drosophila Schneider 2 cells, the nuclear receptor FTZ-F1 is required for activation of the E75A gene by JH. Here, we utilized insect two-hybrid assays to show that FTZ-F1 interacts with two JH receptor candidates, the bHLH-PAS paralogs MET and GCE, in a JH-dependent manner. These interactions are severely reduced when helix 12 of the FTZ-F1 activation function 2 (AF2) is removed, implicating AF2 as an interacting site. Through homology modeling, we found that MET and GCE possess a C-terminal α-helix featuring a conserved motif LIXXL that represents a novel nuclear receptor (NR) box. Docking simulations supported by two-hybrid experiments revealed that FTZ-F1·MET and FTZ-F1·GCE heterodimer formation involves a typical NR box-AF2 interaction but does not require the canonical charge clamp residues of FTZ-F1 and relies primarily on hydrophobic contacts, including a unique interaction with helix 4. Moreover, we identified paralog-specific features, including a secondary interaction site found only in MET. Our findings suggest that a novel NR box enables MET and GCE to interact JH-dependently with the AF2 of FTZ-F1. PMID:22249180

Nuclear Receptors in Bone Physiology and Diseases

PubMed Central

Youn, Min-Young; Inoue, Kazuki; Takada, Ichiro; Kouzmenko, Alexander; Kato, Shigeaki

2013-01-01

During the last decade, our view on the skeleton as a mere solid physical support structure has been transformed, as bone emerged as a dynamic, constantly remodeling tissue with systemic regulatory functions including those of an endocrine organ. Reflecting this remarkable functional complexity, distinct classes of humoral and intracellular regulatory factors have been shown to control vital processes in the bone. Among these regulators, nuclear receptors (NRs) play fundamental roles in bone development, growth, and maintenance. NRs are DNA-binding transcription factors that act as intracellular transducers of the respective ligand signaling pathways through modulation of expression of specific sets of cognate target genes. Aberrant NR signaling caused by receptor or ligand deficiency may profoundly affect bone health and compromise skeletal functions. Ligand dependency of NR action underlies a major strategy of therapeutic intervention to correct aberrant NR signaling, and significant efforts have been made to design novel synthetic NR ligands with enhanced beneficial properties and reduced potential negative side effects. As an example, estrogen deficiency causes bone loss and leads to development of osteoporosis, the most prevalent skeletal disorder in postmenopausal women. Since administration of natural estrogens for the treatment of osteoporosis often associates with undesirable side effects, several synthetic estrogen receptor ligands have been developed with higher therapeutic efficacy and specificity. This review presents current progress in our understanding of the roles of various nuclear receptor-mediated signaling pathways in bone physiology and disease, and in development of advanced NR ligands for treatment of common skeletal disorders. PMID:23589826

Mechanisms of action of nonpeptide hormones on resveratrol-induced antiproliferation of cancer cells.

PubMed

Lin, Hung-Yun; Hsieh, Meng-Ti; Cheng, Guei-Yun; Lai, Hsuan-Yu; Chin, Yu-Tang; Shih, Ya-Jung; Nana, André Wendindondé; Lin, Shin-Ying; Yang, Yu-Chen S H; Tang, Heng-Yuan; Chiang, I-Jen; Wang, Kuan

2017-09-01

Nonpeptide hormones, such as thyroid hormone, dihydrotestosterone, and estrogen, have been shown to stimulate cancer proliferation via different mechanisms. Aside from their cytosolic or membrane-bound receptors, there are receptors on integrin α v β 3 for nonpeptide hormones. Interaction between hormones and integrin α v β 3 can induce signal transduction and eventually stimulate cancer cell proliferation. Resveratrol induces inducible COX-2-dependent antiproliferation via integrin α v β 3 . Resveratrol and hormone-induced signals are both transduced by activated extracellular-regulated kinases 1 and 2 (ERK1/2); however, hormones promote cell proliferation, while resveratrol induces antiproliferation in cancer cells. Hormones inhibit resveratrol-stimulated phosphorylation of p53 on Ser15, resveratrol-induced nuclear COX-2 accumulation, and formation of p53-COX-2 nuclear complexes. Subsequently, hormones impair resveratrol-induced COX-2-/p53-dependent gene expression. The inhibitory effects of hormones on resveratrol action can be blocked by different antagonists of specific nonpeptide hormone receptors but not integrin α v β 3 blockers. Results suggest that nonpeptide hormones inhibit resveratrol-induced antiproliferation in cancer cells downstream of the interaction between ligand and receptor and ERK1/2 activation to interfere with nuclear COX-2 accumulation. Thus, the surface receptor sites for resveratrol and nonpeptide hormones are distinct and can induce discrete ERK1/2-dependent downstream antiproliferation biological activities. It also indicates the complex pathways by which antiproliferation is induced by resveratrol in various physiological hormonal environments. . © 2017 New York Academy of Sciences.

Folding propensity of intrinsically disordered proteins by osmotic stress

DOE PAGES

Mansouri, Amanda L.; Grese, Laura N.; Rowe, Erica L.; ...

2016-10-11

Proteins imparted with intrinsic disorder conduct a range of essential cellular functions. To better understand the folding and hydration properties of intrinsically disordered proteins (IDPs), we used osmotic stress to induce conformational changes in nuclear co-activator binding domain (NCBD) and activator for thyroid hormone and retinoid receptor (ACTR). Osmotic stress was applied by the addition of small and polymeric osmolytes, where we discovered that water contributions to NCBD folding always exceeded those for ACTR. Both NCBD and ACTR were found to gain a-helical structure with increasing osmotic stress, consistent with their folding upon NCBD/ACTR complex formation. Using small-angle neutron scatteringmore » (SANS), we further characterized NCBD structural changes with the osmolyte ethylene glycol. Here a large reduction in overall size initially occurred before substantial secondary structural change. In conclusion, by focusing on folding propensity, and linked hydration changes, we uncover new insights that may be important for how IDP folding contributes to binding.« less

Folding propensity of intrinsically disordered proteins by osmotic stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mansouri, Amanda L.; Grese, Laura N.; Rowe, Erica L.

Proteins imparted with intrinsic disorder conduct a range of essential cellular functions. To better understand the folding and hydration properties of intrinsically disordered proteins (IDPs), we used osmotic stress to induce conformational changes in nuclear co-activator binding domain (NCBD) and activator for thyroid hormone and retinoid receptor (ACTR). Osmotic stress was applied by the addition of small and polymeric osmolytes, where we discovered that water contributions to NCBD folding always exceeded those for ACTR. Both NCBD and ACTR were found to gain a-helical structure with increasing osmotic stress, consistent with their folding upon NCBD/ACTR complex formation. Using small-angle neutron scatteringmore » (SANS), we further characterized NCBD structural changes with the osmolyte ethylene glycol. Here a large reduction in overall size initially occurred before substantial secondary structural change. In conclusion, by focusing on folding propensity, and linked hydration changes, we uncover new insights that may be important for how IDP folding contributes to binding.« less

Human Freud-2/CC2D1B: a novel repressor of postsynaptic serotonin-1A receptor expression.

PubMed

Hadjighassem, Mahmoud R; Austin, Mark C; Szewczyk, Bernadeta; Daigle, Mireille; Stockmeier, Craig A; Albert, Paul R

2009-08-01

Altered expression of serotonin-1A (5-HT1A) receptors, both presynaptic in the raphe nuclei and post-synaptic in limbic and cortical target areas, has been implicated in mood disorders such as major depression and anxiety. Within the 5-HT1A receptor gene, a powerful dual repressor element (DRE) is regulated by two protein complexes: Freud-1/CC2D1A and a second, unknown repressor. Here we identify human Freud-2/CC2D1B, a Freud-1 homologue, as the second repressor. Freud-2 distribution was examined with Northern and Western blot, reverse transcriptase polymerase chain reaction, and immunohistochemistry/immunofluorescence; Freud-2 function was examined by electrophoretic mobility shift, reporter assay, and Western blot. Freud-2 RNA was widely distributed in brain and peripheral tissues. Freud-2 protein was enriched in the nuclear fraction of human prefrontal cortex and hippocampus but was weakly expressed in the dorsal raphe nucleus. Freud-2 immunostaining was co-localized with 5-HT1A receptors, neuronal and glial markers. In prefrontal cortex, Freud-2 was expressed at similar levels in control and depressed male subjects. Recombinant hFreud-2 protein bound specifically to 5' or 3' human DRE adjacent to the Freud-1 site. Human Freud-2 showed strong repressor activity at the human 5-HT1A or heterologous promoter in human HEK-293 5-HT1A-negative cells and neuronal SK-N-SH cells, a model of postsynaptic 5-HT1A receptor-positive cells. Furthermore, small interfering RNA knockdown of endogenous hFreud-2 expression de-repressed 5-HT1A promoter activity and increased levels of 5-HT1A receptor protein in SK-N-SH cells. Human Freud-2 binds to the 5-HT1A DRE and represses the human 5-HT1A receptor gene to regulate its expression in non-serotonergic cells and neurons.

Small-molecule agonists for the glucagon-like peptide 1 receptor

PubMed Central

Knudsen, Lotte Bjerre; Kiel, Dan; Teng, Min; Behrens, Carsten; Bhumralkar, Dilip; Kodra, János T.; Holst, Jens J.; Jeppesen, Claus B.; Johnson, Michael D.; de Jong, Johannes Cornelis; Jorgensen, Anker Steen; Kercher, Tim; Kostrowicki, Jarek; Madsen, Peter; Olesen, Preben H.; Petersen, Jacob S.; Poulsen, Fritz; Sidelmann, Ulla G.; Sturis, Jeppe; Truesdale, Larry; May, John; Lau, Jesper

2007-01-01

The peptide hormone glucagon-like peptide (GLP)-1 has important actions resulting in glucose lowering along with weight loss in patients with type 2 diabetes. As a peptide hormone, GLP-1 has to be administered by injection. Only a few small-molecule agonists to peptide hormone receptors have been described and none in the B family of the G protein coupled receptors to which the GLP-1 receptor belongs. We have discovered a series of small molecules known as ago-allosteric modulators selective for the human GLP-1 receptor. These compounds act as both allosteric activators of the receptor and independent agonists. Potency of GLP-1 was not changed by the allosteric agonists, but affinity of GLP-1 for the receptor was increased. The most potent compound identified stimulates glucose-dependent insulin release from normal mouse islets but, importantly, not from GLP-1 receptor knockout mice. Also, the compound stimulates insulin release from perfused rat pancreas in a manner additive with GLP-1 itself. These compounds may lead to the identification or design of orally active GLP-1 agonists. PMID:17213325

Importance of extranuclear estrogen receptor-alpha and membrane G protein-coupled estrogen receptor in pancreatic islet survival.

PubMed

Liu, Suhuan; Le May, Cedric; Wong, Winifred P S; Ward, Robert D; Clegg, Deborah J; Marcelli, Marco; Korach, Kenneth S; Mauvais-Jarvis, Franck

2009-10-01

We showed that 17beta-estradiol (E(2)) favors pancreatic beta-cell survival via the estrogen receptor-alpha (ERalpha) in mice. E(2) activates nuclear estrogen receptors via an estrogen response element (ERE). E(2) also activates nongenomic signals via an extranuclear form of ERalpha and the G protein-coupled estrogen receptor (GPER). We studied the contribution of estrogen receptors to islet survival. We used mice and islets deficient in estrogen receptor-alpha (alphaERKO(-/-)), estrogen receptor-beta (betaERKO(-/-)), estrogen receptor-alpha and estrogen receptor-beta (alphabetaERKO(-/-)), and GPER (GPERKO(-/-)); a mouse lacking ERalpha binding to the ERE; and human islets. These mice and islets were studied in combination with receptor-specific pharmacological probes. We show that ERalpha protection of islet survival is ERE independent and that E(2) favors islet survival through extranuclear and membrane estrogen receptor signaling. We show that ERbeta plays a minor cytoprotective role compared to ERalpha. Accordingly, betaERKO(-/-) mice are mildly predisposed to streptozotocin-induced islet apoptosis. However, combined elimination of ERalpha and ERbeta in mice does not synergize to provoke islet apoptosis. In alphabetaERKO(-/-) mice and their islets, E(2) partially prevents apoptosis suggesting that an alternative pathway compensates for ERalpha/ERbeta deficiency. We find that E(2) protection of islet survival is reproduced by a membrane-impermeant E(2) formulation and a selective GPER agonist. Accordingly, GPERKO(-/-) mice are susceptible to streptozotocin-induced insulin deficiency. E(2) protects beta-cell survival through ERalpha and ERbeta via ERE-independent, extra-nuclear mechanisms, as well as GPER-dependent mechanisms. The present study adds a novel dimension to estrogen biology in beta-cells and identifies GPER as a target to protect islet survival.

International Union of Basic and Clinical Pharmacology. XCVII. G Protein–Coupled Estrogen Receptor and Its Pharmacologic Modulators

PubMed Central

2015-01-01

Estrogens are critical mediators of multiple and diverse physiologic effects throughout the body in both sexes, including the reproductive, cardiovascular, endocrine, nervous, and immune systems. As such, alterations in estrogen function play important roles in many diseases and pathophysiological conditions (including cancer), exemplified by the lower prevalence of many diseases in premenopausal women. Estrogens mediate their effects through multiple cellular receptors, including the nuclear receptor family (ERα and ERβ) and the G protein–coupled receptor (GPCR) family (GPR30/G protein–coupled estrogen receptor [GPER]). Although both receptor families can initiate rapid cell signaling and transcriptional regulation, the nuclear receptors are traditionally associated with regulating gene expression, whereas GPCRs are recognized as mediating rapid cellular signaling. Estrogen-activated pathways are not only the target of multiple therapeutic agents (e.g., tamoxifen, fulvestrant, raloxifene, and aromatase inhibitors) but are also affected by a plethora of phyto- and xeno-estrogens (e.g., genistein, coumestrol, bisphenol A, dichlorodiphenyltrichloroethane). Because of the existence of multiple estrogen receptors with overlapping ligand specificities, expression patterns, and signaling pathways, the roles of the individual receptors with respect to the diverse array of endogenous and exogenous ligands have been challenging to ascertain. The identification of GPER-selective ligands however has led to a much greater understanding of the roles of this receptor in normal physiology and disease as well as its interactions with the classic estrogen receptors ERα and ERβ and their signaling pathways. In this review, we describe the history and characterization of GPER over the past 15 years focusing on the pharmacology of steroidal and nonsteroidal compounds that have been employed to unravel the biology of this most recently recognized estrogen receptor. PMID:26023144

International Union of Basic and Clinical Pharmacology. XCVII. G Protein-Coupled Estrogen Receptor and Its Pharmacologic Modulators.

PubMed

Prossnitz, Eric R; Arterburn, Jeffrey B

2015-07-01

Estrogens are critical mediators of multiple and diverse physiologic effects throughout the body in both sexes, including the reproductive, cardiovascular, endocrine, nervous, and immune systems. As such, alterations in estrogen function play important roles in many diseases and pathophysiological conditions (including cancer), exemplified by the lower prevalence of many diseases in premenopausal women. Estrogens mediate their effects through multiple cellular receptors, including the nuclear receptor family (ERα and ERβ) and the G protein-coupled receptor (GPCR) family (GPR30/G protein-coupled estrogen receptor [GPER]). Although both receptor families can initiate rapid cell signaling and transcriptional regulation, the nuclear receptors are traditionally associated with regulating gene expression, whereas GPCRs are recognized as mediating rapid cellular signaling. Estrogen-activated pathways are not only the target of multiple therapeutic agents (e.g., tamoxifen, fulvestrant, raloxifene, and aromatase inhibitors) but are also affected by a plethora of phyto- and xeno-estrogens (e.g., genistein, coumestrol, bisphenol A, dichlorodiphenyltrichloroethane). Because of the existence of multiple estrogen receptors with overlapping ligand specificities, expression patterns, and signaling pathways, the roles of the individual receptors with respect to the diverse array of endogenous and exogenous ligands have been challenging to ascertain. The identification of GPER-selective ligands however has led to a much greater understanding of the roles of this receptor in normal physiology and disease as well as its interactions with the classic estrogen receptors ERα and ERβ and their signaling pathways. In this review, we describe the history and characterization of GPER over the past 15 years focusing on the pharmacology of steroidal and nonsteroidal compounds that have been employed to unravel the biology of this most recently recognized estrogen receptor. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Synthesis of new C-25 and C-26 steroidal acids as potential ligands of the nuclear receptors DAF-12, LXR and GR.

PubMed

Dansey, María V; Del Fueyo, María C; Veleiro, Adriana S; Di Chenna, Pablo H

2017-05-01

A new methodology to obtain C-25 and C-26 steroidal acids starting from pregnenolone is described. Construction of the side chain was achieved by applying the Mukaiyama aldol reaction with a non-hydrolytic work-up to isolate the trapped silyl enol ether with higher yields. Using this methodology we synthesized three new steroidal acids as potential ligands of DAF-12, Liver X and Glucocorticoid nuclear receptors and studied their activity in reporter gene assays. Our results show that replacement of the 21-CH 3 by a 20-keto group in the side chains of the cholestane scaffold of DAF-12 or Liver X receptors ligands causes the loss of the activity. Copyright © 2017 Elsevier Inc. All rights reserved.

Innate scavenger receptor-A regulates adaptive T helper cell responses to pathogen infection

PubMed Central

Xu, Zhipeng; Xu, Lei; Li, Wei; Jin, Xin; Song, Xian; Chen, Xiaojun; Zhu, Jifeng; Zhou, Sha; Li, Yong; Zhang, Weiwei; Dong, Xiaoxiao; Yang, Xiaowei; Liu, Feng; Bai, Hui; Chen, Qi; Su, Chuan

2017-01-01

The pattern recognition receptor (PRR) scavenger receptor class A (SR-A) has an important function in the pathogenesis of non-infectious diseases and in innate immune responses to pathogen infections. However, little is known about the role of SR-A in the host adaptive immune responses to pathogen infection. Here we show with mouse models of helminth Schistosoma japonicum infection and heat-inactivated Mycobacterium tuberculosis stimulation that SR-A is regulated by pathogens and suppresses IRF5 nuclear translocation by direct interaction. Reduced abundance of nuclear IRF5 shifts macrophage polarization from M1 towards M2, which subsequently switches T-helper responses from type 1 to type 2. Our study identifies a role for SR-A as an innate PRR in regulating adaptive immune responses. PMID:28695899

A Novel Cytosolic Isoform of Mitochondrial Trans-2-Enoyl-CoA Reductase Enhances Peroxisome Proliferator-Activated Receptor α Activity.

PubMed

Kim, Dong-Gyu; Yoo, Jae Cheal; Kim, Eunju; Lee, Young-Sun; Yarishkin, Oleg V; Lee, Da Yong; Lee, Kun Ho; Hong, Seong-Geun; Hwang, Eun Mi; Park, Jae-Yong

2014-06-01

Mitochondrial trans-2-enoyl-CoA reductase (MECR) is involved in mitochondrial synthesis of fatty acids and is highly expressed in mitochondria. MECR is also known as nuclear receptor binding factor-1, which was originally reported with yeast two-hybrid screening as a binding protein of the nuclear hormone receptor peroxisome proliferator-activated receptor α (PPARα). However, MECR and PPARα are localized at different compartment, mitochondria, and the nucleus, respectively. Therefore, the presence of a cytosolic or nuclear isoform of MECR is necessary for functional interaction between MECR and PPARα. To identify the expression pattern of MECR and the cytosolic form of MECR (cMECR), we performed reverse transcription polymerase chain reaction (RT-PCR) with various tissue samples from Sprague-Dawley rats. To confirm the interaction between cMECR and PPARα, we performed several binding assays such as yeast two-hybrid, coimmunoprecipitation, and bimolecular fluorescence complementation. To observe subcellular localization of these proteins, immunocytochemistry was performed. A luciferase assay was used to measure PPARα activity. We provide evidence of an alternatively spliced variant of the rat MECR gene that yields cMECR. The cMECR lacks the N-terminal 76 amino acids of MECR and shows uniform distribution in the cytoplasm and nucleus of HeLa cells. cMECR directly bound PPARα in the nucleus and increased PPARα-dependent luciferase activity in HeLa cells. We found the cytosolic form of MECR (cMECR) was expressed in the cytosolic and/or nuclear region, directly binds with PPARα, and enhances PPARα activity.

Spatial distribution of the messenger ribonucleic acid and protein of the nuclear receptor coactivator, amplified in breast cancer-3, in mice.

PubMed

Zhang, Hao; Liao, Lan; Kuang, Shao-Qing; Xu, Jianming

2003-04-01

Transcriptional activities of nuclear receptors are modulated by coactivators and corepressors. The amplified in breast cancer-3 protein (AIB3, also known as ASC-2, RAP250, PRIP, TRBP, and NCR) is a newly identified nuclear receptor coactivator that is amplified and overexpressed in breast cancers. This study aims to investigate the spatial expression of AIB3 mRNA and protein in various murine tissues. Quantitative measurements revealed that the concentrations of AIB3 mRNA differ substantially in different tissues in a descending order from the following: testis, brain, thymus, white fat, pituitary, ovary, adrenal gland, lung, uterus, kidney, heart, skeletal muscle, liver, and virgin mammary gland. The AIB3 mRNA level in the testis is 165-fold higher than that in the virgin mammary gland. Specific antiserum was generated and used to map the distribution of AIB3 protein by immunohistochemistry. Although AIB3 protein was detected in many tissues, the AIB3 immunoreactivities varied significantly from cell type to cell type. High levels of AIB3 immunoreactivity were observed in hormone target cells including the testicular Sertoli cells, follicular granulosa cells, and epithelial cells of the prostate, uterus, mammary gland, and kidney tubules. Medium and low levels of AIB3 immunoreactivities were also detected in a variety of other cell types. These results demonstrate that AIB3 mRNA and protein are preferentially expressed in specific cell types, suggesting that AIB3 may support the function of nuclear receptors in a cell type-specific manner.

Proliferation of Small Nuclear Forces.

DTIC Science & Technology

1983-04-30

character of conflict, arm control issues, conventional arms competition and U.S. forces; 3) Assess how new nuclear powers will behave and how their...neighbors 0and other nuclear powers will react; "--- 5) Identify the likely patterns and outcars of nuclear and other military interaction, including...Regional Nuclear Powers , 1990-2010 A small nuclear force (SNF) would comprise at a minimum from 5 to 10 deliverable and militarily serviceable fission

The Drosophila FTZ-F1 Nuclear Receptor Mediates Juvenile Hormone Activation of E75A Gene Expression through an Intracellular Pathway*

PubMed Central

Dubrovsky, Edward B.; Dubrovskaya, Veronica A.; Bernardo, Travis; Otte, Valerie; DiFilippo, Robert; Bryan, Heather

2011-01-01

Juvenile hormone (JH) regulates a wide variety of biological activities in holometabolous insects, ranging from vitellogenesis and caste determination in adults to the timing of metamorphosis in larvae. The mechanism of JH signaling in such a diverse array of processes remains either unknown or contentious. We previously found that the nuclear receptor gene E75A is activated in S2 cells as a primary response to JH. Here, by expressing an intracellular form of JH esterase, we demonstrate that JH must enter the cell in order to activate E75A. To find intracellular receptors involved in the JH response, we performed an RNAi screen against nuclear receptor genes expressed in this cell line and identified the orphan receptor FTZ-F1. Removal of FTZ-F1 prevents JH activation of E75A, whereas overexpression enhances activation, implicating FTZ-F1 as a critical component of the JH response. FTZ-F1 is bound in vivo to multiple enhancers upstream of E75A, suggesting that it participates in direct JH-mediated gene activation. To better define the role of FTZ-F1 in JH signaling, we investigated interactions with candidate JH receptors and found that the bHLH-PAS proteins MET and GCE both interact with FTZ-F1 and can activate transcription through the FTZ-F1 response element. Removal of endogenous GCE, but not MET, prevents JH activation of E75A. We propose that FTZ-F1 functions as a competence factor by loading JH signaling components to the promoter, thus facilitating the direct regulation of E75A gene expression by JH. PMID:21832074

Combined therapeutic potential of nuclear receptors with receptor tyrosine kinase inhibitors in lung cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wairagu, Peninah M.; Institute of Lifestyle Medicine, Wonju College of Medicine, Yonsei University, Wonju, Gangwon-do 220-701; Nuclear Receptor Research Consortium, Wonju College of Medicine, Yonsei University, Wonju, Gangwon-do 220-701

2014-05-09

Highlights: • The 48 NR genes and 48 biological anti-cancer targets are profiled in paired-cells. • Growth inhibition by NR ligands or TKIs is target receptor level-dependent. • T0901317 with gefitinib/PHA665752 shows additive growth inhibition in lung cells. - Abstract: Cancer heterogeneity is a big hurdle in achieving complete cancer treatment, which has led to the emergence of combinational therapy. In this study, we investigated the potential use of nuclear receptor (NR) ligands for combinational therapy with other anti-cancer drugs. We first profiled all 48 NRs and 48 biological anti-cancer targets in four pairs of lung cell lines, where eachmore » pair was obtained from the same patient. Two sets of cell lines were normal and the corresponding tumor cell lines while the other two sets consisted of primary versus metastatic tumor cell lines. Analysis of the expression profile revealed 11 NRs and 15 cancer targets from the two pairs of normal versus tumor cell lines, and 9 NRs and 9 cancer targets from the primary versus metastatic tumor cell lines had distinct expression patterns in each category. Finally, the evaluation of nuclear receptor ligand T0901317 for liver X receptor (LXR) demonstrated its combined therapeutic potential with tyrosine kinase inhibitors. The combined treatment of cMET inhibitor PHA665752 or EGFR inhibitor gefitinib with T0901317 showed additive growth inhibition in both H2073 and H1993 cells. Mechanistically, the combined treatment suppressed cell cycle progression by inhibiting cyclinD1 and cyclinB expression. Taken together, this study provides insight into the potential use of NR ligands in combined therapeutics with other biological anti-cancer drugs.« less

Nuclear accumulation of epidermal growth factor receptor and acceleration of G1/S stage by Epstein-Barr-encoded oncoprotein latent membrane protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tao Yongguang; Song Xing; Deng Xiyun

Epstein-Barr virus (EBV)-encoded latent membrane protein 1 (LMP1) is considered to be the major oncogenic protein of EBV-encoded proteins and has always been the core of the oncogenic mechanism of EBV. Advanced studies on nuclear translocation of the epidermal growth factor receptor (EGFR) family have greatly improved our knowledge of the biological function of cell surface receptors. In this study, we used the Tet-on LMP1 HNE2 cell line as a cell model, which is a dual-stable LMP1-integrated nasopharyngeal carcinoma (NPC) cell line and the expression of LMP1 which could be regulated by the Tet system. We found that LMP1 couldmore » regulate the nuclear accumulation of EGFR in a dose-dependent manner quantitatively and qualitatively. We also demonstrated that the nuclear localization sequence of EGFR played some roles in the location of the protein within the nucleus under LMP1 regulation and EGFR in the nucleus could bind to the promoters of cyclinD1 and cyclinE, respectively. We further demonstrated that EGFR is involved in the acceleration of the G1/S phase transition by LMP1 through binding to cyclinD1 and cyclinE directly. These findings provided a novel view that the acceleration of LMP1 on the G1/S transition via the nuclear accumulation of EGFR was critical in the process of nasopharyngeal carcinoma.« less

One motif to bind them: A small-XXX-small motif affects transmembrane domain 1 oligomerization, function, localization, and cross-talk between two yeast GPCRs.

PubMed

Lock, Antonia; Forfar, Rachel; Weston, Cathryn; Bowsher, Leo; Upton, Graham J G; Reynolds, Christopher A; Ladds, Graham; Dixon, Ann M

2014-12-01

G protein-coupled receptors (GPCRs) are the largest family of cell-surface receptors in mammals and facilitate a range of physiological responses triggered by a variety of ligands. GPCRs were thought to function as monomers, however it is now accepted that GPCR homo- and hetero-oligomers also exist and influence receptor properties. The Schizosaccharomyces pombe GPCR Mam2 is a pheromone-sensing receptor involved in mating and has previously been shown to form oligomers in vivo. The first transmembrane domain (TMD) of Mam2 contains a small-XXX-small motif, overrepresented in membrane proteins and well-known for promoting helix-helix interactions. An ortholog of Mam2 in Saccharomyces cerevisiae, Ste2, contains an analogous small-XXX-small motif which has been shown to contribute to receptor homo-oligomerization, localization and function. Here we have used experimental and computational techniques to characterize the role of the small-XXX-small motif in function and assembly of Mam2 for the first time. We find that disruption of the motif via mutagenesis leads to reduction of Mam2 TMD1 homo-oligomerization and pheromone-responsive cellular signaling of the full-length protein. It also impairs correct targeting to the plasma membrane. Mutation of the analogous motif in Ste2 yielded similar results, suggesting a conserved mechanism for assembly. Using co-expression of the two fungal receptors in conjunction with computational models, we demonstrate a functional change in G protein specificity and propose that this is brought about through hetero-dimeric interactions of Mam2 with Ste2 via the complementary small-XXX-small motifs. This highlights the potential of these motifs to affect a range of properties that can be investigated in other GPCRs. Copyright © 2014. Published by Elsevier B.V.

A novel point mutation of the human glucocorticoid receptor gene causes primary generalized glucocorticoid resistance through impaired interaction with the LXXLL motif of the p160 coactivators: dissociation of the transactivating and transreppressive activities.

PubMed

Nicolaides, Nicolas C; Roberts, Michael L; Kino, Tomoshige; Braatvedt, Geoffrey; Hurt, Darrell E; Katsantoni, Eleni; Sertedaki, Amalia; Chrousos, George P; Charmandari, Evangelia

2014-05-01

Primary generalized glucocorticoid resistance is a rare genetic disorder characterized by generalized, partial, target-tissue insensitivity to glucocorticoids. The molecular basis of the condition has been ascribed to inactivating mutations in the human glucocorticoid receptor (hGR) gene. The objective of the study was to present three new cases caused by a novel mutation in the hGR gene and to delineate the molecular mechanisms through which the mutant receptor impairs glucocorticoid signal transduction. The index case (father) and his two daughters presented with increased urinary free cortisol excretion and resistance of the hypothalamic-pituitary-adrenal axis to dexamethasone suppression in the absence of clinical manifestations suggestive of Cushing syndrome. All subjects harbored a novel, heterozygous, point mutation (T→G) at nucleotide position 1724 of the hGR gene, which resulted in substitution of valine by glycine at amino acid 575 of the receptor. Compared with the wild-type receptor, the hGRαV575G demonstrated a significant (33%) reduction in its ability to transactivate the mouse mammary tumor virus promoter in response to dexamethasone, a 50% decrease in its affinity for the ligand, and a 2.5-fold delay in nuclear translocation. Although it did not exert a dominant negative effect on the wild-type receptor and preserved its ability to bind to DNA, hGRαV575G displayed significantly enhanced (∼80%) ability to transrepress the nuclear factor-κΒ signaling pathway. Finally, the mutant receptor hGRαV575G demonstrated impaired interaction with the LXXLL motif of the glucocorticoid receptor-interacting protein 1 coactivator in vitro and in computer-based structural simulation via its defective activation function-2 (AF-2) domain. The natural mutant receptor hGRαV575G causes primary generalized glucocorticoid resistance by affecting multiple steps in the glucocorticoid signaling cascade, including the affinity for the ligand, the time required for nuclear translocation, and the interaction with the glucocorticoid-interacting protein-1 coactivator.

The Orphan Nuclear Receptor TLX Is an Enhancer of STAT1-Mediated Transcription and Immunity to Toxoplasma gondii

PubMed Central

Beiting, Daniel P.; Hidano, Shinya; Baggs, Julie E.; Geskes, Jeanne M.; Fang, Qun; Wherry, E. John; Hunter, Christopher A.; Roos, David S.; Cherry, Sara

2015-01-01

The protozoan parasite, Toxoplasma, like many intracellular pathogens, suppresses interferon gamma (IFN-γ)-induced signal transducer and activator of transcription 1 (STAT1) activity. We exploited this well-defined host–pathogen interaction as the basis for a high-throughput screen, identifying nine transcription factors that enhance STAT1 function in the nucleus, including the orphan nuclear hormone receptor TLX. Expression profiling revealed that upon IFN-γ treatment TLX enhances the output of a subset of IFN-γ target genes, which we found is dependent on TLX binding at those loci. Moreover, infection of TLX deficient mice with the intracellular parasite Toxoplasma results in impaired production of the STAT1-dependent cytokine interleukin-12 by dendritic cells and increased parasite burden in the brain during chronic infection. These results demonstrate a previously unrecognized role for this orphan nuclear hormone receptor in regulating STAT1 signaling and host defense and reveal that STAT1 activity can be modulated in a context-specific manner by such “modifiers.” PMID:26196739

Nuclear receptor TLX prevents retinal dystrophy and recruits the corepressor atrophin1.

PubMed

Zhang, Chun-Li; Zou, Yuhua; Yu, Ruth T; Gage, Fred H; Evans, Ronald M

2006-05-15

During mammalian embryogenesis, precise coordination of progenitor cell proliferation and differentiation is essential for proper organ size and function. The involvement of TLX (NR2E1), an orphan nuclear receptor, has been implicated in ocular development, as Tlx-/- mice exhibit visual impairment. Using genetic and biochemical approaches, we show that TLX modulates retinal progenitor cell proliferation and cell cycle re-entry by directly regulating the expression of Pten and its target cyclin D1. Additionally, TLX finely tunes the progenitor differentiation program by modulating the phospholipase C and mitogen-activated protein kinase (MAPK) pathways and the expression of an array of cell type-specific transcriptional regulators. Consequently, Tlx-/- mice have a dramatic reduction in retina thickness and enhanced generation of S-cones, and develop severe early onset retinal dystrophy. Furthermore, TLX interacts with atrophin1 (Atn1), a corepressor that is involved in human neurodegenerative dentatorubral-pallidoluysian atrophy (DRPLA) and that is essential for development of multiple tissues. Together, these results reveal a molecular strategy by which an orphan nuclear receptor can precisely orchestrate tissue-specific proliferation and differentiation programs to prevent retinal malformation and degeneration.

Regulation of C. elegans fat uptake and storage by acyl-CoA synthase-3 is dependent on NR5A family nuclear hormone receptor nhr-25

PubMed Central

Mullaney, Brendan; Ashrafi, Kaveh

2010-01-01

Summary Acyl-CoA synthases are important for lipid synthesis and breakdown, generation of signaling molecules and lipid modification of proteins, highlighting the challenge of understanding metabolic pathways within intact organisms. From a C. elegans mutagenesis screen, we found that loss of ACS-3, a long-chain acyl-CoA synthase, causes enhanced intestinal lipid uptake, de novo fat synthesis, and accumulation of enlarged, neutral lipid rich intestinal depots. Here, we show that ACS-3 functions in seam cells, epidermal cells anatomically distinct from sites of fat uptake and storage, and that acs-3 mutant phenotypes require the nuclear hormone receptor NHR-25, a key regulator of C. elegans molting. Our findings suggest that ACS-3 derived long chain fatty acyl-CoAs, perhaps incorporated into complex ligands such as phosphoinositides, modulate NHR-25 function, which in turn regulates an endocrine program of lipid uptake and synthesis. These results reveal a link between acyl-CoA synthase function and an NR5A family nuclear receptor in C. elegans. PMID:20889131

Hepatic Deletion of SIRT1 Decreases Hepatocyte Nuclear Factor 1α/Farnesoid X Receptor Signaling and Induces Formation of Cholesterol Gallstones in Mice

PubMed Central

Purushotham, Aparna; Xu, Qing; Lu, Jing; Foley, Julie F.; Yan, Xingjian; Kim, Dong-Hyun; Kemper, Jongsook Kim

2012-01-01

SIRT1, a highly conserved NAD+-dependent protein deacetylase, is a key metabolic sensor that directly links nutrient signals to animal metabolic homeostasis. Although SIRT1 has been implicated in a number of hepatic metabolic processes, the mechanisms by which hepatic SIRT1 modulates bile acid metabolism are still not well understood. Here we report that deletion of hepatic SIRT1 reduces the expression of farnesoid X receptor (FXR), a nuclear receptor that regulates bile acid homeostasis. We provide evidence that SIRT1 regulates the expression of FXR through hepatocyte nuclear factor 1α (HNF1α). SIRT1 deficiency in hepatocytes leads to decreased binding of HNF1α to the FXR promoter. Furthermore, we show that hepatocyte-specific deletion of SIRT1 leads to derangements in bile acid metabolism, predisposing the mice to development of cholesterol gallstones on a lithogenic diet. Taken together, our findings indicate that SIRT1 plays a vital role in the regulation of hepatic bile acid homeostasis through the HNF1α/FXR signaling pathway. PMID:22290433

Cex1p is a novel cytoplasmic component of the Saccharomyces cerevisiae nuclear tRNA export machinery

PubMed Central

McGuire, Andrew T; Mangroo, Dev

2007-01-01

The Saccharomyces cerevisiae Yor112wp, which we named Cex1p, was identified using a yeast tRNA three-hybrid interaction approach and an in vivo nuclear tRNA export assay as a cytoplasmic component of the nuclear tRNA export machinery. Cex1p binds tRNA saturably, and associates with the nuclear pore complex by interacting directly with Nup116p. Cex1p co-purifies with the nuclear tRNA export receptors Los1p and Msn5p, the eukaryotic elongation factor eEF-1A, which delivers aminoacylated tRNAs to the ribosome, and the RanGTPase Gsp1p, but not with Cca1p, a tRNA maturation enzyme that facilitates translocation of non-aminoacylated tRNAs across the nuclear pore complex. Depletion of Cex1p and eEF-1A or Los1p significantly reduced the efficiency of nuclear tRNA export. Cex1p interacts with Los1p but not with eEF-1A in vitro. These findings suggest that Cex1p is a component of the nuclear aminoacylation-dependent tRNA export pathway in S. cerevisiae. They also suggest that Cex1p collects aminoacyl-tRNAs from the nuclear export receptors at the cytoplasmic side of the nuclear pore complex, and transfers them to eEF-1A using a channelling mechanism. PMID:17203074

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piccioli, Zachary; McKee, Courtney H.; Leszczynski, Anna

We investigated the nuclear import of low risk HPV11 E7 protein using 1) transfection assays in HeLa cells with EGFP fusion plasmids containing 11E7 and its domains and 2) nuclear import assays in digitonin-permeabilized HeLa cells with GST fusion proteins containing 11E7 and its domains. The EGFP-11E7 and EGFP-11cE7{sub 39-98} localized mostly to the nucleus. The GST-11E7 and GST-11cE7{sub 39-98} were imported into the nuclei in the presence of either Ran-GDP or RanG19V-GTP mutant and in the absence of nuclear import receptors. This suggests that 11E7 enters the nucleus via a Ran-dependent pathway, independent of nuclear import receptors, mediated bymore » a nuclear localization signal located in its C-terminal domain (cNLS). This cNLS contains the zinc binding domain consisting of two copies of Cys-X-X-Cys motif. Mutagenesis of Cys residues in these motifs changed the localization of the EGFP-11cE7/-11E7 mutants to cytoplasmic, suggesting that the zinc binding domain is essential for nuclear localization of 11E7.« less

Optical microwell assay of membrane transport kinetics.

PubMed

Kiskin, Nikolai I; Siebrasse, Jan P; Peters, Reiner

2003-10-01

In optical single transporter recording, membranes are firmly attached to flat solid substrates containing small wells or test compartments (TC). Transport of fluorescent molecules through TC-spanning membrane patches is induced by solution change and recorded by confocal microscopy. Previously, track-etched membrane filters were used to create solid substrates containing populations of randomly distributed TCs. In this study the possibilities offered by orderly TC arrays as created by laser microdrilling were explored. A theoretical framework was developed taking the convolution of membrane transport, solution change, and diffusion into account. The optical properties of orderly TC arrays were studied and the kinetics of solution change measured. Export and import through the nuclear pore complex (NPC) was analyzed in isolated envelopes of Xenopus oocyte nuclei. In accordance with previous reports nuclear transport receptor NTF2, which binds directly to NPC proteins, was found to be translocated much faster than "inert" molecules of similar size. Unexpectedly, NXT1, a homolog of NTF2 reportedly unable to bind to NPC proteins directly, was translocated as fast as NTF2. Thus, microstructured TC arrays were shown to provide optical single transporter recording with a new basis.

Design and Nuclear Magnetic Resonance (NMR) Structure Determination of the Second Extracellular Immunoglobulin Tyrosine Kinase A (TrkAIg2) Domain Construct for Binding Site Elucidation in Drug Discovery

PubMed Central

2014-01-01

The tyrosine kinase A (TrkA) receptor is a validated therapeutic intervention point for a wide range of conditions. TrkA activation by nerve growth factor (NGF) binding the second extracellular immunoglobulin (TrkAIg2) domain triggers intracellular signaling cascades. In the periphery, this promotes the pain phenotype and, in the brain, cell survival or differentiation. Reproducible structural information and detailed validation of protein–ligand interactions aid drug discovery. However, the isolated TrkAIg2 domain crystallizes as a β-strand-swapped dimer in the absence of NGF, occluding the binding surface. Here we report the design and structural validation by nuclear magnetic resonance spectroscopy of the first stable, biologically active construct of the TrkAIg2 domain for binding site confirmation. Our structure closely mimics the wild-type fold of TrkAIg2 in complex with NGF (1WWW.pdb), and the 1H–15N correlation spectra confirm that both NGF and a competing small molecule interact at the known binding interface in solution. PMID:25454499

Leukemia-Associated Nup214 Fusion Proteins Disturb the XPO1-Mediated Nuclear-Cytoplasmic Transport Pathway and Thereby the NF-κB Signaling Pathway.

PubMed

Saito, Shoko; Cigdem, Sadik; Okuwaki, Mitsuru; Nagata, Kyosuke

2016-07-01

Nuclear-cytoplasmic transport through nuclear pore complexes is mediated by nuclear transport receptors. Previous reports have suggested that aberrant nuclear-cytoplasmic transport due to mutations or overexpression of nuclear pore complexes and nuclear transport receptors is closely linked to diseases. Nup214, a component of nuclear pore complexes, has been found as chimeric fusion proteins in leukemia. Among various Nup214 fusion proteins, SET-Nup214 and DEK-Nup214 have been shown to be engaged in tumorigenesis, but their oncogenic mechanisms remain unclear. In this study, we examined the functions of the Nup214 fusion proteins by focusing on their effects on nuclear-cytoplasmic transport. We found that SET-Nup214 and DEK-Nup214 interact with exportin-1 (XPO1)/CRM1 and nuclear RNA export factor 1 (NXF1)/TAP, which mediate leucine-rich nuclear export signal (NES)-dependent protein export and mRNA export, respectively. SET-Nup214 and DEK-Nup214 decreased the XPO1-mediated nuclear export of NES proteins such as cyclin B and proteins involved in the NF-κB signaling pathway by tethering XPO1 onto nuclear dots where Nup214 fusion proteins are localized. We also demonstrated that SET-Nup214 and DEK-Nup214 expression inhibited NF-κB-mediated transcription by abnormal tethering of the complex containing p65 and its inhibitor, IκB, in the nucleus. These results suggest that SET-Nup214 and DEK-Nup214 perturb the regulation of gene expression through alteration of the nuclear-cytoplasmic transport system. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

AOP description: Androgen receptor agonism leading to reproductive dysfunction (in fish)

EPA Science Inventory

This adverse outcome pathway details the linkage between binding and activation of androgen receptor as a nuclear transcription factor in females and the adverse effect of reduced cumulative fecundity in repeat-spawning fish species. Cumulative fecundity is the most apical endpoi...

The PPARα-dependent rodent liver tumor response is not relevant to humans: Addressing misconceptions

EPA Science Inventory

A number of industrial chemicals and therapeutic agents cause liver tumors in rats and mice by activating the nuclear receptor peroxisome proliferator-activated receptor α (PPARα). The molecular and cellular events by which PPARα activators induce rodent hepatoc...

Cloning and initial characterization of nuclear and four membrane progesterone receptors in the fathead minnow(Pimephales promelas)

EPA Science Inventory

Both native progestagens and synthetic progestins have important effects on reproduction that are mediated through progesterone receptors (PRs). Progestagens regulate gamete maturation in vertebrates, are critical regulators of placental mammal pregnancy, and act as reproductive ...