Proteomic analysis of bovine nucleolus.

PubMed

Patel, Amrutlal K; Olson, Doug; Tikoo, Suresh K

2010-09-01

Nucleolus is the most prominent subnuclear structure, which performs a wide variety of functions in the eukaryotic cellular processes. In order to understand the structural and functional role of the nucleoli in bovine cells, we analyzed the proteomic composition of the bovine nucleoli. The nucleoli were isolated from Madin Darby bovine kidney cells and subjected to proteomic analysis by LC-MS/MS after fractionation by SDS-PAGE and strong cation exchange chromatography. Analysis of the data using the Mascot database search and the GPM database search identified 311 proteins in the bovine nucleoli, which contained 22 proteins previously not identified in the proteomic analysis of human nucleoli. Analysis of the identified proteins using the GoMiner software suggested that the bovine nucleoli contained proteins involved in ribosomal biogenesis, cell cycle control, transcriptional, translational and post-translational regulation, transport, and structural organization. Copyright © 2010 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.

Formation of nucleoli in interspecies nuclear transfer embryos derived from bovine, porcine, and rabbit oocytes and nuclear donor cells of various species.

PubMed

Lagutina, Irina; Zakhartchenko, Valeri; Fulka, Helena; Colleoni, Silvia; Wolf, Eckhard; Fulka, Josef; Lazzari, Giovanna; Galli, Cesare

2011-04-01

The most successful development of interspecies somatic cell nuclear transfer (iSCNT) embryos has been achieved in closely related species. The analyses of embryonic gene activity in iSCNT embryos of different species combinations have revealed the existence of significant aberrations in expression of housekeeping genes and genes dependent on the major embryonic genome activation (EGA). However, there are many studies with successful blastocyst (BL) development of iSCNT embryos derived from donor cells and oocytes of animal species with distant taxonomical relations (inter-family/inter-class) that should indicate proper EGA at least in terms of RNA polymerase I activation, nucleoli formation, and activation of genes engaged in morula and BL formation. We investigated the ability of bovine, porcine, and rabbit oocytes to activate embryonic nucleoli formation in the nuclei of somatic cells of different mammalian species. In iSCNT embryos, nucleoli precursor bodies originate from the oocyte, while most proteins engaged in the formation of mature nucleoli should be transcribed from genes de novo in the donor nucleus at the time of EGA. Thus, the success of nucleoli formation depends on species compatibility of many components of this complex process. We demonstrate that the time and cell stage of nucleoli formation are under the control of recipient ooplasm. Oocytes of the studied species possess different abilities to support nucleoli formation. Formation of nucleoli, which is a complex but small part of the whole process of EGA, is essential but not absolutely sufficient for the development of iSCNT embryos to the morula and BL stages.

Biological and Computational Modeling of Mammographic Density and Stromal Patterning

DTIC Science & Technology

2010-07-01

clumping Score Monolayer Absent Many Absent Absent Absent 1 Nucl. overlap Mild Moderate Mild Micro- nucleoli Rare 2 Clustering Moderate...Few Moderate Micro- nucleoli Occasional 3 Loss cohesion Conspicuous Absent Frequent Macro- nucleoli Frequent 4 We performed serial RPFNA

De novo formation of nucleoli in developing mouse embryos originating from enucleolated zygotes.

PubMed

Kyogoku, Hirohisa; Fulka, Josef; Wakayama, Teruhiko; Miyano, Takashi

2014-06-01

The large, compact oocyte nucleoli, sometimes referred to as nucleolus precursor bodies (NPBs), are essential for embryonic development in mammals; in their absence, the oocytes complete maturation and can be fertilized, but no nucleoli are formed in the zygote or embryo, leading to developmental failure. It has been convincingly documented that zygotes inherit the oocyte nucleolar material and form NPBs again in pronuclei. It is commonly accepted that during early embryonic development, the original compact zygote NPBs gradually transform into reticulated nucleoli of somatic cells. Here, we show that zygote NPBs are not required for embryonic and full-term development in the mouse. When NPBs were removed from late-stage zygotes by micromanipulation, the enucleolated zygotes developed to the blastocyst stage and, after transfer to recipients, live pups were obtained. We also describe de novo formation of nucleoli in developing embryos. After removal of NPBs from zygotes, they formed new nucleoli after several divisions. These results indicate that the zygote NPBs are not used in embryonic development and that the nucleoli in developing embryos originate from de novo synthesized materials. © 2014. Published by The Company of Biologists Ltd.

Positioning of the NOR-bearing chromosomes in relation to nucleoli in daughter cells after mitosis.

PubMed

Kalmárová, M; Smirnov, E; Kovácik, L; Popov, A; Raska, I

2008-01-01

It is known that chromosomes occupy non-random positions in the cell nucleus. However, it is not clear to what extent their nuclear positions, together with their neighborhood, are conserved in daughter cells. To address specific aspects of this problem, we used the model of the chromosomes carrying ribosomal genes that are organized in clusters termed Nucleolus Organizer Regions (NORs). We compared the association of chosen NOR-bearing chromosomes (NOR-chromosomes) with nucleoli, as well as the numbers of nucleoli, in the pairs of daughter cells, and established how frequently the daughter cells had equal numbers of the homologs of certain NOR-chromosomes associated with individual nucleoli. The daughter cells typically had different numbers of nucleoli. At the same time, using immuno-FISH with probes for chromosomes 14 and 15 in HeLa cells, we found that the cell pairs with identical combinations appeared significantly more frequently than predicted by the random model. Thus, although the total number of chromosomes associated with nucleoli is variable, our data indicate that the position of the NOR-bearing chromosomes in relation to nucleoli is partly conserved through mitosis.

Positioning of the NOR-Bearing Chromosomes in Relation to Nucleoli in Daughter Cells after Mitosis

PubMed Central

KALMÁROVÁ, M.; SMIRNOV, E.; KOVÁČIK, L.; POPOV, A.; RAŠKA, I.

2008-01-01

Summary It is known that chromosomes occupy non-random positions in the cell nucleus. However, it is not clear to what extent their nuclear positions, together with their neighborhood, are conserved in daughter cells. To address specific aspects of this problem, we used the model of the chromosomes carrying ribosomal genes that are organized in clusters termed Nucleolus Organizer Regions (NORs). We compared the association of chosen NOR-bearing chromosomes (NOR-chromosomes) with nucleoli, as well as the numbers of nucleoli, in the pairs of daughter cells, and established how frequently the daughter cells had equal numbers of the homologs of certain NOR-chromosomes associated with individual nucleoli. The daughter cells typically had different numbers of nucleoli. At the same time, using immuno-FISH with probes for chromosomes 14 and 15 in HeLa cells, we found that the cell pairs with identical combinations appeared significantly more frequently than predicted by the random model. Thus, although the total number of chromosomes associated with nucleoli is variable, our data indicate that the position of the NOR-bearing chromosomes in relation to nucleoli is partly conserved through mitosis. PMID:18597585

The liquid drop nature of nucleoli.

PubMed

Marko, John F

2012-03-01

Nucleoli are prominent subnuclear organelles, and are known to be hubs of ribosome synthesis. A recent study of Brangwynne et al. reports that the nucleoli of Xenopus oocytes display "liquid drop" behavior, suggesting that nucleolar structure may be driven by rather simple physical principles.

Automated image based prominent nucleoli detection

PubMed Central

Yap, Choon K.; Kalaw, Emarene M.; Singh, Malay; Chong, Kian T.; Giron, Danilo M.; Huang, Chao-Hui; Cheng, Li; Law, Yan N.; Lee, Hwee Kuan

2015-01-01

Introduction: Nucleolar changes in cancer cells are one of the cytologic features important to the tumor pathologist in cancer assessments of tissue biopsies. However, inter-observer variability and the manual approach to this work hamper the accuracy of the assessment by pathologists. In this paper, we propose a computational method for prominent nucleoli pattern detection. Materials and Methods: Thirty-five hematoxylin and eosin stained images were acquired from prostate cancer, breast cancer, renal clear cell cancer and renal papillary cell cancer tissues. Prostate cancer images were used for the development of a computer-based automated prominent nucleoli pattern detector built on a cascade farm. An ensemble of approximately 1000 cascades was constructed by permuting different combinations of classifiers such as support vector machines, eXclusive component analysis, boosting, and logistic regression. The output of cascades was then combined using the RankBoost algorithm. The output of our prominent nucleoli pattern detector is a ranked set of detected image patches of patterns of prominent nucleoli. Results: The mean number of detected prominent nucleoli patterns in the top 100 ranked detected objects was 58 in the prostate cancer dataset, 68 in the breast cancer dataset, 86 in the renal clear cell cancer dataset, and 76 in the renal papillary cell cancer dataset. The proposed cascade farm performs twice as good as the use of a single cascade proposed in the seminal paper by Viola and Jones. For comparison, a naive algorithm that randomly chooses a pixel as a nucleoli pattern would detect five correct patterns in the first 100 ranked objects. Conclusions: Detection of sparse nucleoli patterns in a large background of highly variable tissue patterns is a difficult challenge our method has overcome. This study developed an accurate prominent nucleoli pattern detector with the potential to be used in the clinical settings. PMID:26167383

Automated image based prominent nucleoli detection.

PubMed

Yap, Choon K; Kalaw, Emarene M; Singh, Malay; Chong, Kian T; Giron, Danilo M; Huang, Chao-Hui; Cheng, Li; Law, Yan N; Lee, Hwee Kuan

2015-01-01

Nucleolar changes in cancer cells are one of the cytologic features important to the tumor pathologist in cancer assessments of tissue biopsies. However, inter-observer variability and the manual approach to this work hamper the accuracy of the assessment by pathologists. In this paper, we propose a computational method for prominent nucleoli pattern detection. Thirty-five hematoxylin and eosin stained images were acquired from prostate cancer, breast cancer, renal clear cell cancer and renal papillary cell cancer tissues. Prostate cancer images were used for the development of a computer-based automated prominent nucleoli pattern detector built on a cascade farm. An ensemble of approximately 1000 cascades was constructed by permuting different combinations of classifiers such as support vector machines, eXclusive component analysis, boosting, and logistic regression. The output of cascades was then combined using the RankBoost algorithm. The output of our prominent nucleoli pattern detector is a ranked set of detected image patches of patterns of prominent nucleoli. The mean number of detected prominent nucleoli patterns in the top 100 ranked detected objects was 58 in the prostate cancer dataset, 68 in the breast cancer dataset, 86 in the renal clear cell cancer dataset, and 76 in the renal papillary cell cancer dataset. The proposed cascade farm performs twice as good as the use of a single cascade proposed in the seminal paper by Viola and Jones. For comparison, a naive algorithm that randomly chooses a pixel as a nucleoli pattern would detect five correct patterns in the first 100 ranked objects. Detection of sparse nucleoli patterns in a large background of highly variable tissue patterns is a difficult challenge our method has overcome. This study developed an accurate prominent nucleoli pattern detector with the potential to be used in the clinical settings.

The reaction of Lupinus angustifolius L. root meristematic cell nucleoli to lead.

PubMed

Balcerzak, Lucja; Glińska, Sława; Godlewski, Mirosław

2011-04-01

The effect of 2-48 h treatment of Lupinus angustifolius L. roots with lead nitrate at the concentration of 10(-4) M on the nucleoli in meristematic cells was investigated. In the lead presence the number of ring-shaped as well as segregated nucleoli increased especially after 12-48 h of treatment, while spindle-shaped nucleoli appeared after 24 h and 48 h. Lead presence also increased the frequency of cells with silver-stained particles in the nucleus and the number of these particles especially from the 12th hour of treatment. It was accompanied by significant decline of nucleolar area. Analysis of these cells in transmission electron microscope confirmed the presence of ring-shaped and segregated nucleoli. Moreover, electron microscopy revealed compact structure nucleoli without granular component. Additionally, one to three oval-shaped fibrillar structures attached to nucleolus or lying free in the nucleoplasm were visible. The possible mechanism of lead toxicity to the nucleolus is briefly discussed.

[Some morphometric parameters of nucleoli and nuclei in invasive ductal breast carcinomas in women].

PubMed

Karpinska-Kaczmarczyk, Katarzyna

2009-01-01

The purpose of this study was to correlate seven morphometric parameters of nucleoli and nuclei of invasive ductal cancer cells with some clinico-pathological factors such as age, tumor size, axillary lymph node status, MIB-1 proliferation index, and estrogen receptor expression in tumor cells. Methyl green-pyronin Y (MG-PY) was used for simultaneous staining of nuclei and nucleoli in histological sections of 150 invasive ductal breast carcinomas. Next, morphometric parameters of nucleoli and nuclei of tumor cells were measured with computerized image analysis. Nuclear area and number of nucleoli in breast tumor cells were greater in younger axillary node-negative patients. The number of nucleoli and nucleolar shape polymorphism were reduced in tumors measuring 20 mm or less or with lower histological grade. Nuclear area, nucleolar number, and nucleolar polymorphism in carcinomas with low proliferation index and estrogen receptor expression were smaller than in carcinomas with high proliferation index and no estrogen receptor expression. Nucleolar area in primary tumors without axillary node involvement was greater than in tumors with more than three axillary nodes positive. MG-PY selectively and simultaneously stains nucleoli and nuclei of tumor cells enabling standardized and reproducible examination of these structures with computerized image analysis. Univariate statistical analysis disclosed that some morphometric parameters of nucleoli and nuclei of tumor cells correlated with several established clinico-pathological prognostic factors. Therefore, the prognostic significance of these parameters should be studied in a larger group of patients with invasive ductal breast carcinomas.

Immunodetection of nucleolar proteins and ultrastructure of nucleoli of soybean root meristematic cells treated with chilling stress and after recovery.

PubMed

Stepiński, Dariusz

2009-03-01

The nucleolar proteins, fibrillarin and nucleophosmin, have been identified immunofluorescently in the root meristematic cells of soybean seedlings under varying experimental conditions: at 25 degrees C (control), chilling at 10 degrees C for 3 h and 4 days and recovery from the chilling stress at 25 degrees C. In each experimental variant, the immunofluorescence signals were present solely at the nucleolar territories. Fluorescent staining for both proteins was mainly in the shape of circular domains that are assumed to correspond to the dense fibrillar component of the nucleoli. The fewest fluorescent domains were observed in the nucleoli of chilled plants, and the highest number was observed in the plants recovered after chilling. This difference in the number of circular domains in the nucleoli of each variant may indicate various levels of these proteins in each variant. Both the number of circular domains and the level of these nucleolar proteins changed with changes in the transcriptional activity of the nucleoli, with the more metabolically active cell having higher numbers of active areas in the nucleolus and higher levels of nucleolar proteins, and conversely. Electron microscopic studies revealed differences in the ultrastructure of the nucleoli in all experimental variants and confirmed that the number of fibrillar centres surrounded by dense fibrillar component was the lowest in the nucleoli of chilled plants, and the highest in the nucleoli of recovered seedlings.

Nucleoli from growing oocytes inhibit the maturation of enucleolated, full-grown oocytes in the pig.

PubMed

Kyogoku, Hirohisa; Ogushi, Sugako; Miyano, Takashi; Fulka, Josef

2011-06-01

In mammals, the nucleolus of full-grown oocyte is essential for embryonic development but not for oocyte maturation. In our study, the role of the growing oocyte nucleolus in oocyte maturation was examined by nucleolus removal and/or transfer into previously enucleolated, growing (around 100 µm in diameter) or full-grown (120 µm) pig oocytes. In the first experiment, the nucleoli were aspirated from growing oocytes whose nucleoli had been compacted by actinomycin D treatment, and the enucleolated oocytes were matured in vitro. Most of non-treated or actinomycin D-treated oocytes did not undergo germinal vesicle breakdown (GVBD; 13% and 12%, respectively). However, the GVBD rate of enucleolated, growing oocytes significantly increased to 46%. The low GVBD rate of enucleolated, growing oocytes was restored again by the re-injection of nucleoli from growing oocytes (23%), but not when nucleoli from full-grown oocytes were re-injected into enucleolated, growing oocytes (49%). When enucleolated, full-grown oocytes were injected with nucleoli from growing or full-grown oocytes, the nucleolus in the germinal vesicle was reassembled (73% and 60%, respectively). After maturation, the enucleolated, full-grown oocytes injected with nucleoli from full-grown oocytes matured to metaphase II (56%), whereas injection with growing-oocyte nucleoli reduced this maturation to 21%. These results suggest that the growing-oocyte nucleolus is involved in the oocyte's meiotic arrest, and that the full-grown oocyte nucleolus has lost the ability. Copyright © 2011 Wiley-Liss, Inc.

A karyometric note on nucleoli in human early granulocytic precursors.

PubMed

Smetana, K; Mikulenková, D; Jirásková, I; Klamová, H

2006-01-01

The diameter of nucleoli was measured in human bone marrow early granulocytic precursors after visualization by a simple cytochemical method for demonstration of RNA. Such method facilitated to clearly see nucleolar bodies without perinucleolar chromatin, including those of micronucleoli. The bone marrow of patients suffering from chronic myeloid leukaemia (untreated with cytostatics) provided a satisfactory number of both myeloblasts and promyelocytes for nucleolar measurements because of prevailing granulopoiesis. The direct nucleolar measurement was carried out on digitized and processed images on the screen at magnification 4,300x. It seems to be likely that the nucleolar size is directly related to the number of nucleoli per cell. The largest nucleoli were present in both myeloblasts and promyelocytes that possessed a single nucleolus. In contrast, the nucleolar diameter was significantly smaller in cells with multiple nucleoli. However, in cells with small multiple nucleoli, one of them was always larger and dominant with a large number of AgNORs. Such large nucleoli are possibly visible in specimens stained with panoptic procedures or methods staining nuclear chromatin or DNA. It should also be mentioned that both myeloblasts and promyelocytes mostly possessed two nucleoli with the mean diameter close to 1.5 microm. The incidence of early granulocytic precursors classified according to the nucleolar number and size strongly suggested that the various nucleolar number and nucleolar size in these cells might be related to the different stage of the cell cycle and might also explain their heterogeneity.

Biologic and Computational Modeling of Mammographic Density and Stromal Patterning

DTIC Science & Technology

2008-07-01

Moderate Mild Micro- nucleoli Rare 2 Clustering Moderate Few Moderate Micro- nucleoli Occasional 3 Loss cohesion Conspicuous Absent Frequent Macro... nucleoli Frequent 4 M asood scores: 6-10 Normal; 11-13 Hyperplasia; 14-15 Atypia; 16-17 High-grade atypia; >17 Suspicious for cancer. 4 We

Can Nucleoli Be Markers of Developmental Potential in Human Zygotes?

PubMed

Fulka, Helena; Kyogoku, Hirohisa; Zatsepina, Olga; Langerova, Alena; Fulka, Josef

2015-11-01

In 1999, Tesarik and Greco reported that they could predict the developmental potential of human zygotes from a single static evaluation of their pronuclei. This was based on the distribution and number of specific nuclear organelles - the nucleoli. Recent studies in mice show that nucleoli play a key role in parental genome restructuring after fertilization, and that interfering with this process may lead to developmental failure. These studies thus support the Tesarik-Greco evaluation as a potentially useful method for selecting high-quality embryos in human assisted reproductive technologies. In this opinion article we discuss recent evidence linking nucleoli to parental genome reprogramming, and ask whether nucleoli can mirror or be used as representative markers of embryonic parameters such as chromosome content or DNA fragmentation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Structure of the nucleoli in domestic cattle spermatocytes.

PubMed

Andraszek, Katarzyna; Smalec, Elżbieta

2012-10-08

The work was aimed at determining the number and morphology of nucleoli in the prophase of the first meiotic division in domestic cattle males. The use of AgNO₃ staining, commonly applied in cytogenetics for the identification of nucleolar organiser regions, made it possible to identify nucleoli in first-order spermatocytes. One nucleolus was identified in each analysed cell. Considerable morphological differentiation of the nucleoli during the prophase of the first meiotic division, particularly in leptotene, unobserved in other farm animal species, was noticed. Dark-hued grain-like structures were found within the disintegrating nucleoli, corresponding approximately or exactly to the number of the nucleolar organiser regions in the domestic cattle karyotype. Dark areas were identified in the selected prometaphase chromosomes. Their number corresponded with the number of active NORs defined in the domestic cattle karyotype.

Prognostic significance of morphometric parameters of nucleoli and nuclei of invasive ductal breast carcinomas.

PubMed

Karpińska-Kaczmarczyk, Katarzyna; Kram, Andrzej; Kaczmarczyk, Mariusz; Domagała, Wenancjusz

2009-01-01

The aim of this study was to evaluate associations between seven morphometric parameters of the nucleoli and nuclei of methyl green and pyronin Y (MG-PY) stained tumour cells of invasive ductal breast carcinoma with relapse-free survival (RFS) and overall survival (OS) time. Histological sections from 150 invasive ductal breast cancers were stained with MG-PY and the following parameters were evaluated by computer image analysis: the nucleolar area, long to short nucleolar axis ratio, nucleolar shape parameter assessing the degree of nucleolar roundness, long to short nuclear axis ratio, number of nucleoli in the nucleus and the percentage of the nuclear cross-section surface area occupied by the nucleoli. A statistically significant association between a nucleolar shape polymorphism and the number of nucleoli in the nuclei of tumour cells and the RFS but not OS was found in the entire group of patients as well as patients with axillary lymph node metastases. A higher polymorphism of nucleolar shape and a higher number of nucleoli in the nuclei of breast cancer cells were associated with decreased relapse-free survival (p < 0.05). The remaining morphometric parameters showed no statistically significant association with RFS or OS. The results indicate that morphometry of nucleoli in MG-PY stained histological sections can be useful in the analysis of associations between nucleolar parameters and prognosis of patients with invasive breast cancer.

Single ovalbumin molecules exploring nucleoplasm and nucleoli of living cell nuclei.

PubMed

Speil, Jasmin; Kubitscheck, Ulrich

2010-03-01

The nucleus is the center of direction and coordination of the cell's metabolic and reproductive activities and contains numerous functionally specialized domains. These subnuclear structures are not delimited by membranes like cytoplasmic organelles and their function is only poorly understood. Here, we studied the most prominent nuclear domains, nucleoli and the remaining nucleoplasm. We used fluorescently labeled ovalbumin-ATTO647N, an inert protein, to examine their physical properties. This inert tracer was microinjected into the cytoplasm of HeLa cells, and after diffusion into the nucleus the tracer distribution and mobility in the two nuclear compartments was examined. Like many macromolecular probes ovalbumin was significantly less abundant in nucleoli compared to the nucleoplasm. High-speed fluorescence microscopy allowed visualizing and analyzing single tracer molecule trajectories within nucleoli and nucleoplasm. In accordance with previous studies we found that the viscosity of the nucleus is sevenfold higher than that of aqueous buffer. Notably, nucleoplasm and nucleoli did not significantly differ in viscosity, however, the fraction of slow or trapped molecules was higher in the nucleoplasm than in nucleoli (6% versus 0.2%). Surprisingly, even a completely inert molecule like ovalbumin showed at times short-lived binding events with a decay time of 8 ms in the nucleoplasm and even shorter-6.3 ms-within the nucleoli. Copyright 2009 Elsevier B.V. All rights reserved.

Mouse oocytes nucleoli rescue embryonic development of porcine enucleolated oocytes.

PubMed

Morovic, Martin; Strejcek, Frantisek; Nakagawa, Shoma; Deshmukh, Rahul S; Murin, Matej; Benc, Michal; Fulka, Helena; Kyogoku, Hirohisa; Pendovski, Lazo; Fulka, Josef; Laurincik, Jozef

2017-12-01

It is well known that nucleoli of fully grown mammalian oocytes are indispensable for embryonic development. Therefore, the embryos originated from previously enucleolated (ENL) oocytes undergo only one or two cleavages and then their development ceases. In our study the interspecies (mouse/pig) nucleolus transferred embryos (NuTE) were produced and their embryonic development was analyzed by autoradiography, transmission electron microscopy (TEM) and immunofluorescence (C23 and upstream binding factor (UBF)). Our results show that the re-injection of isolated oocyte nucleoli, either from the pig (P + P) or mouse (P + M), into previously enucleolated and subsequently matured porcine oocytes rescues their development after parthenogenetic activation and some of these develop up to the blastocyst stage (P + P, 11.8%; P + M, 13.5%). In nucleolus re-injected 8-cell and blastocyst stage embryos the number of nucleoli labeled with C23 in P + P and P + M groups was lower than in control (non-manipulated) group. UBF was localized in small foci within the nucleoli of blastocysts in control and P + P embryos, however, in P + M embryos the labeling was evenly distributed in the nucleoplasm. The TEM and autoradiographic evaluations showed the formation of functional nucleoli and de novo rRNA synthesis at the 8-cell stage in both, control and P + P group. In the P + M group the formation of comparable nucleoli was delayed. In conclusion, our results indicate that the mouse nucleolus can rescue embryonic development of enucleolated porcine oocytes, but the localization of selected nucleolar proteins, the timing of transcription activation and the formation of the functional nucleoli in NuTE compared with control group show evident aberrations.

Immunofluorescent localization of ubiquitin and proteasomes in nucleolar vacuoles of soybean root meristematic cells

PubMed Central

Stępiński, D.

2012-01-01

In this study, using the immunofluorescent method, the immunopositive signals to ubiquitin and proteasomes in nucleoli of root meristematic cells of soybean seedlings have been observed. In fact, those signals were present exclusively in nucleolar vacuoles. No signals were observed in the nucleolar territory out of the nucleolar vacuoles or in the nucleoli without vacuoles. The ubiquitin-proteasome system (UPS) may act within the nucleoli of plants with high metabolic activities and may provide an additional level of regulation of intracellular proteolysis via compartment-specific activities of their components. It is suggested that the presence of the UPS solely in vacuolated nucleoli serves as a mechanism that enhances the speed of ribosome subunit production in very actively transcribing nucleoli. On the other hand, nucleolar vacuoles in a cell/nucleus could play additional roles associated with temporary sequestration or storage of some cellular factors, including components of the ubiquitin-proteasome system. PMID:22688294

A novel histone variant localized in nucleoli of higher plant cells.

PubMed

Tanaka, I; Akahori, Y; Gomi, K; Suzuki, T; Ueda, K

1999-07-01

Immunofluorescence staining with antisera raised against p35, a basic nuclear protein that accumulates in the pollen nuclei of Lilium longiflorum, specifically stained the nucleoli in interphase nuclei of somatic tissues, including root and leaf, and in pachytene nuclei during meiotic division, whereas antisera raised against histone H1 uniformly stained the entire chromatin domain with the exception of the nucleoli in these nuclei. Further, p35-specific antisera stained the nucleoli in root and leaf nuclei of the monocotyledonous plants Tulipa gesneriana, Allium cepa and Triticum aestivum and of the dicotyledonous plants Vicia faba and Nicotiana tabacum. Thus, these novel antisera stained the nucleoli in cells of all higher plants examined, although the staining patterns within nucleoli were somewhat different among plant species and tissues. The full-length cDNA of p35 was cloned on the basis of the partial amino acid sequence. The deduced amino acid composition and amino acid sequence of p35 indicate that this nucleolar protein is a novel variant of histone Hl. Further, p35 was strongly bound to ribosomal DNA in vitro. The results of immunoblotting of histones extracted from each tissue of the various plant species with the nucleolus-specific antibodies also suggested the conservation of similar epitope(s) in both mono- and dicotyledonous plants. From these results, it is suggested that similar variants of histone Hl are specifically distributed in the nucleoli of all plant species and help to organize the nucleolar chromatin.

Structure of nucleoli in first-order spermatocytes of selected free-living animal species.

PubMed

Andraszek, Katarzyna; Gryzińska, Magdalena; Ceranka, Mariola; Larisch, Agnieszka

2015-10-01

Nucleoli are the product of the activity of nucleolar organizer regions (NOR) in certain chromosomes. Their main functions are the formation of ribosomal subunits from ribosomal protein molecules and the transcription of genes encoding rRNA. Nucleoli are present in the nuclei of nearly all eukaryotic cells because they contain housekeeping genes. The size and number of nucleoli gradually decrease during spermatogenesis. Some of the material originating in the nucleolus probably migrates to the cytoplasm and takes part in the formation of chromatoid bodies (CB). Nucleolus fragmentation and CB assembly take place at the same stage of spermatogenesis. CB are involved in the formation of the acrosome, the migration of mitochondria to the midpiece, and the formation of the sperm tail fibrous sheath. The aim of the study was to characterize the nucleoli in the early prophase of spermatogenesis in the wild boar and the roe deer. The roe deer cells have larger nucleoli and a larger cell nucleus than the wild boar cells. The area of the nucleolus as a percentage of the total area of the nucleus was larger as well. The coefficients of variation for all parameters were higher in the roe deer. In the wild boar cells the nucleoli were mainly regularly shaped. The size of the nucleolus and the nucleus of the spermatocyte is a species-specific trait associated with karyotype and the number of nucleolar organizer regions in a given species. Copyright © 2015 Elsevier B.V. All rights reserved.

Small nucleoli are a cellular hallmark of longevity

PubMed Central

Tiku, Varnesh; Jain, Chirag; Raz, Yotam; Nakamura, Shuhei; Heestand, Bree; Liu, Wei; Späth, Martin; Suchiman, H. Eka. D.; Müller, Roman-Ulrich; Slagboom, P. Eline; Partridge, Linda; Antebi, Adam

2017-01-01

Animal lifespan is regulated by conserved metabolic signalling pathways and specific transcription factors, but whether these pathways affect common downstream mechanisms remains largely elusive. Here we show that NCL-1/TRIM2/Brat tumour suppressor extends lifespan and limits nucleolar size in the major C. elegans longevity pathways, as part of a convergent mechanism focused on the nucleolus. Long-lived animals representing distinct longevity pathways exhibit small nucleoli, and decreased expression of rRNA, ribosomal proteins, and the nucleolar protein fibrillarin, dependent on NCL-1. Knockdown of fibrillarin also reduces nucleolar size and extends lifespan. Among wildtype C. elegans, individual nucleolar size varies, but is highly predictive for longevity. Long-lived dietary restricted fruit flies and insulin-like-peptide mutants exhibit small nucleoli and fibrillarin expression, as do long-lived dietary restricted and IRS1 knockout mice. Furthermore, human muscle biopsies from individuals who underwent modest dietary restriction coupled with exercise also display small nucleoli. We suggest that small nucleoli are a cellular hallmark of longevity and metabolic health conserved across taxa. PMID:28853436

Small nucleoli are a cellular hallmark of longevity.

PubMed

Tiku, Varnesh; Jain, Chirag; Raz, Yotam; Nakamura, Shuhei; Heestand, Bree; Liu, Wei; Späth, Martin; Suchiman, H Eka D; Müller, Roman-Ulrich; Slagboom, P Eline; Partridge, Linda; Antebi, Adam

2016-08-30

Animal lifespan is regulated by conserved metabolic signalling pathways and specific transcription factors, but whether these pathways affect common downstream mechanisms remains largely elusive. Here we show that NCL-1/TRIM2/Brat tumour suppressor extends lifespan and limits nucleolar size in the major C. elegans longevity pathways, as part of a convergent mechanism focused on the nucleolus. Long-lived animals representing distinct longevity pathways exhibit small nucleoli, and decreased expression of rRNA, ribosomal proteins, and the nucleolar protein fibrillarin, dependent on NCL-1. Knockdown of fibrillarin also reduces nucleolar size and extends lifespan. Among wildtype C. elegans, individual nucleolar size varies, but is highly predictive for longevity. Long-lived dietary restricted fruit flies and insulin-like-peptide mutants exhibit small nucleoli and fibrillarin expression, as do long-lived dietary restricted and IRS1 knockout mice. Furthermore, human muscle biopsies from individuals who underwent modest dietary restriction coupled with exercise also display small nucleoli. We suggest that small nucleoli are a cellular hallmark of longevity and metabolic health conserved across taxa.

Positioning of NORs and NOR-bearing chromosomes in relation to nucleoli.

PubMed

Kalmárová, Markéta; Smirnov, Evgeny; Masata, Martin; Koberna, Karel; Ligasová, Anna; Popov, Alexey; Raska, Ivan

2007-10-01

It is widely accepted that chromosomes occupy more or less fixed positions in mammalian interphase nucleus. However, relation between large-scale order of chromosome positioning and gene activity remains unclear. We used the model of the human ribosomal genes to address specific aspects of this problem. Ribosomal genes are organized at particular chromosomal sites in clusters termed nucleolus organizer regions (NORs). Only some NORs, called competent are generally accepted to be transcriptionally active during interphase. Importantly in this respect, the regularities in distribution of competent, and non-competent NORs among the specific chromosomes were already established in two human-derived cell lines: transformed HeLa and primary LEP cells. In the present study, using FISH and immunocytochemistry, we found that in HeLa and LEP cells the large-scale positioning of the NOR-bearing chromosomes with regard to nucleoli is linked to the transcription activity of rDNA. Namely, the tendency of rDNA-bearing chromosomes to associate with nucleoli correlates with the number of transcriptionally competent NORs in the respective chromosome homologs. Regarding the position of NORs, we found that not only competent but also most of the non-competent NORs are included in the nucleoli. Some intranucleolar NORs (supposedly non-competent) are situated on elongated chromatin protrusions connecting nucleoli with respective chromosome territories spatially distanced from nucleoli.

[A morphometric analysis of the nuclei and nucleoli in tumor cells in lymphogranulomatosis, diffuse large B-cell lymphoma and anaplastic large cell lymphoma].

PubMed

Gorgidze, L A; Vorob'ev, I A

2009-01-01

To make a comparative morphometric analysis of the nuclei and nucleoli of tumor cells in lymphogranulomatosis (LGM), diffuse large B-cell lymphoma (DLBCL) and anaplastic large cell lymphoma (ALCL) for differential diagnosis of these lymphomas. Biopsy material (lymph node biopsies) was frozen in hexane, fixed and stained, then microscopic pictures were made. Mean area of tumor cell nuclei in LGM was 97.25 +/- 68.77 mcm2, in DLBCL and ALCL--55.89 +/- 20.13 mcm2 and 70.31 +/- 34.64 mcm2, respectively. The area differences were significant (p < 0.001). Hodgkin's and Berezovsky-Rid-Sternberg cell bucleoli area was the largest (11.44 +/- 7.83 mcm2). The nucleoli of the former are larger than those of the latter. Mean area of the nucleoli in DLBCL was 3.05 +/- 1.58, in ALCL--5.53 +/- 4.94 mcm2. The differences are significant (p < 0.001). Nucleoli in Hodgkin 's cells are significantly larger than those in the tumor cells in ALCL and DLBCL and the nucleoli with the area more than 12 mcm2 can be used in differential diagnosis between LGM and DLBCL but not between LGM and ALCL.

Quantitative analysis of nucleolar chromatin distribution in the complex convoluted nucleoli of Didinium nasutum (Ciliophora).

PubMed

Leonova, Olga G; Karajan, Bella P; Ivlev, Yuri F; Ivanova, Julia L; Skarlato, Sergei O; Popenko, Vladimir I

2013-01-01

We have earlier shown that the typical Didinium nasutum nucleolus is a complex convoluted branched domain, comprising a dense fibrillar component located at the periphery of the nucleolus and a granular component located in the central part. Here our main interest was to study quantitatively the spatial distribution of nucleolar chromatin structures in these convoluted nucleoli. There are no "classical" fibrillar centers in D.nasutum nucleoli. The spatial distribution of nucleolar chromatin bodies, which play the role of nucleolar organizers in the macronucleus of D.nasutum, was studied using 3D reconstructions based on serial ultrathin sections. The relative number of nucleolar chromatin bodies was determined in macronuclei of recently fed, starved D.nasutum cells and in resting cysts. This parameter is shown to correlate with the activity of the nucleolus. However, the relative number of nucleolar chromatin bodies in different regions of the same convoluted nucleolus is approximately the same. This finding suggests equal activity in different parts of the nucleolar domain and indicates the existence of some molecular mechanism enabling it to synchronize this activity in D. nasutum nucleoli. Our data show that D. nasutum nucleoli display bipartite structure. All nucleolar chromatin bodies are shown to be located outside of nucleoli, at the periphery of the fibrillar component.

Lanthanoplatins: emissive Eu(iii) and Tb(iii) complexes staining nucleoli targeted through Pt-DNA crosslinking.

PubMed

Singh, Khushbu; Singh, Swati; Srivastava, Payal; Sivakumar, Sri; Patra, Ashis K

2017-06-01

Two highly luminescent water-soluble heterometallic LnPt 2 complexes, [{cis-PtCl(NH 3 ) 2 } 2 Ln(L)(H 2 O)](NO 3 ) 2 (Ln = Eu (1), Tb (2)), have been designed for their selective nucleoli staining through formation of Pt-DNA crosslinks. The complexes showed significant cellular uptake and distinctive nucleoli localization through intrinsic emission from Eu III or Tb III observed through confocal fluorescence microscopy.

[Morpho-functional parameters of nucleoli in polyploid mucous and albumen cells of salivary gland in the snail Succinea lauta].

PubMed

Anisimova, A A; Anisimov, A P

2005-01-01

Variation of some characteristics of nucleoli of polyploid mucous and albumen cells was examined in salivary glands of the snail Succinea lauta. The number, total area and Ag-protein content of nucleoli, and DNA content in each nucleus were estimated on squashed preparations incubated with AgNO3, decolorized and then Feulgen stained. The ultrastructure of nucleoli was studied by electron microscopy. Differentiated mucous cells had 4c-8c-16c-32c nuclei; albumen cells had 8c-16c-32c-64c-128c nuclei. The ultrastructure of nucleoli of the two cell types was essentially the same. Normally, a large fibrous to granular zone was observed in the nucleoli, without a clear distinction between fibrous and granular components. At the same time, aggregations of granular matter could be discerned at the periphery of nucleoli. No fibrous centers were observed. Occassionally, nucleolonema-like structures occurred. Normally each nucleolus contacted several chromosomes. On squashed preparations, the least size of nucleoli was 2-3 microm, and the largest size amounted to 14 microm in mucous cells, and to 50-80 microm in albumen cells. The number of nucleoli rose from 1-2 in tetraploid nuclei to 2-3 in 32c-nuclei, and to 5-7 in 128c-nuclei. The disparity between the ploidy levels of nuclei and the numbers of nucleoli may be due, presumably, to aggregation of chromosome NORs. The Ag-protein content in the nucleoli, and the total nucleolar area displayed a strong mutual correlation. Both parameters differed significantly by 1.5-2.2 times in mucous and albumen cells of the same ploidy level. Thus, in albumen and mucous cells the total Ag-protein content in octaploid nuclei was 3.3 and 2.2 relative units (r. u.), respectively. In 16c- and 32c-nuclei of albumen cells, it was 7.6 and 15.1 r. u.; and in the same nuclei of mucous cells--3.8 and 6.8 r. u., respectively. On the whole, in albumen cells, in the course of 4 endocycles (4c-128c), the total Ag-protein content increased by 17 times. Therefore, the mean multiplication factor for this parameter was found to be 2.05 per endocycle. In mucous cells, in the course of 3 endocycles (4c-32c), the total Ag-protein content increased by 5.2 times against 8 times expected, with the mean multiplication factor equal to 1.75 per endocycle. Thus, in the course of polyploidization of albumen and mucous cell nuclei, the gene dosage effect was fully pronounced in the former, and only partly in the latter. This differtence is due obviously to peculiarities of differentiation of the two cell types, in particular, to differences in the number of activated ribosomal genes.

Directed proteomic analysis of the human nucleolus.

PubMed

Andersen, Jens S; Lyon, Carol E; Fox, Archa H; Leung, Anthony K L; Lam, Yun Wah; Steen, Hanno; Mann, Matthias; Lamond, Angus I

2002-01-08

The nucleolus is a subnuclear organelle containing the ribosomal RNA gene clusters and ribosome biogenesis factors. Recent studies suggest it may also have roles in RNA transport, RNA modification, and cell cycle regulation. Despite over 150 years of research into nucleoli, many aspects of their structure and function remain uncharacterized. We report a proteomic analysis of human nucleoli. Using a combination of mass spectrometry (MS) and sequence database searches, including online analysis of the draft human genome sequence, 271 proteins were identified. Over 30% of the nucleolar proteins were encoded by novel or uncharacterized genes, while the known proteins included several unexpected factors with no previously known nucleolar functions. MS analysis of nucleoli isolated from HeLa cells in which transcription had been inhibited showed that a subset of proteins was enriched. These data highlight the dynamic nature of the nucleolar proteome and show that proteins can either associate with nucleoli transiently or accumulate only under specific metabolic conditions. This extensive proteomic analysis shows that nucleoli have a surprisingly large protein complexity. The many novel factors and separate classes of proteins identified support the view that the nucleolus may perform additional functions beyond its known role in ribosome subunit biogenesis. The data also show that the protein composition of nucleoli is not static and can alter significantly in response to the metabolic state of the cell.

Positioning of NORs and NOR-bearing chromosomes in relation to nucleoli

PubMed Central

Kalmárová, Markéta; Smirnov, Evgeny; Mašata, Martin; Koberna, Karel; Ligasová, Anna; Popov, Alexey; Raška, Ivan

2007-01-01

It is widely accepted that chromosomes occupy more or less fixed positions in mammalian interphase nucleus. However, relation between large-scale order of chromosome positioning and gene activity remains unclear. We used the model of the human ribosomal genes to address specific aspects of this problem. Ribosomal genes are organized at particular chromosomal sites in clusters termed nucleolus organizer regions (NORs). Only some NORs, called competent are generally accepted to be transcriptionally active during interphase. Importantly in this respect, the regularities in distribution of competent, and non-competent NORs among the specific chromosomes were already established in two human-derived cell lines: transformed HeLa and primary LEP cells. In the present study, using FISH and immunocytochemistry, we found that in HeLa and LEP cells the large-scale positioning of the NOR-bearing chromosomes with regard to nucleoli is linked to the transcription activity of rDNA. Namely, the tendency of rDNA-bearing chromosomes to associate with nucleoli correlates with the number of transcriptionally competent NORs in the respective chromosome homologs. Regarding the position of NORs, we found that not only competent but also most of the non-competent NORs are included in the nucleoli. Some intranucleolar NORs (supposedly non-competent) are situated on elongated chromatin protrusions connecting nucleoli with respective chromosome territories spatially distanced from nucleoli. PMID:17698369

Nucleophosmin/B23 regulates ubiquitin dynamics in nucleoli by recruiting deubiquitylating enzyme USP36.

PubMed

Endo, Akinori; Kitamura, Naomi; Komada, Masayuki

2009-10-09

The nucleolus is a subnuclear compartment with multiple cellular functions, including ribosome biogenesis. USP36 is a deubiquitylating enzyme that localizes to nucleoli and plays an essential role in regulating the structure and function of the organelle. However, how the localization of USP36 is regulated remains unknown. Here, we identified a short stretch of basic amino acids (RGKEKKIKKFKREKRR) that resides in the C-terminal region of USP36 and serves as a nucleolar localization signal for the protein. We found that this motif interacts with a central acidic region of nucleophosmin/B23, a major nucleolar protein involved in various nucleolar functions. Knockdown of nucleophosmin/B23 resulted in a significant reduction in the amount of USP36 in nucleoli, without affecting the cellular USP36 level. This was associated with elevated ubiquitylation levels of fibrillarin, a USP36 substrate protein in nucleoli. We conclude that nucleophosmin/B23 recruits USP36 to nucleoli, thereby serving as a platform for the regulation of nucleolar protein functions through ubiquitylation/deubiquitylation.

Identification of "tumor-associated" nucleolar antigens in human urothelial cancer.

PubMed

Yu, D; Pietro, T; Jurco, S; Scardino, P T

1987-09-01

Nucleoli isolated from HeLa S3 cells were used to produce rabbit antisera capable of binding nucleoli of transitional cell carcinomas (TCCa) of the bladder. Cross-reactivity of the rabbit antiserum with normal nucleoli was reduced by absorption with fetal calf serum, normal human serum, and human placental nucleoli. This antinucleolar antiserum exhibited strong reactivity in immunoperoxidase assays performed on specimens of human bladder cancer. In frozen tissue sections of 24 patients with TCCa and eight individuals without tumor, nucleolar staining was observed in all malignant specimens, but was not observed in seven of the normal specimens. Cytologic examination of bladder washing specimens from 47 normal individuals showed absence of nucleolar staining in 43 (91%) of 47 normal specimens while 12 (86%) of 14 specimens from patients with TCCa were positive. These results suggest that there are antigens associated with the nucleoli of HeLa cells and transitional cell carcinomas which are generally absent (or in low concentration) in normal human urothelial cells, and that antisera to these antigens may be useful in the cytologic diagnosis of human transitional cell carcinoma.

Identification of a silver binding protein associated with the cytological silver staining of actively transcribing nucleolar regions.

PubMed

Hubbell, H R; Rothblum, L I; Hsu, T C

1979-10-01

Nucleoli isolated from Novikoff hepatoma cells were stained with AgNO3 to demonstrate the typical staining of active ribosomal cistrons. Pre-treatment of the nucleoli with 80 mM Tris-HCl (pH 7.5) -- 2.0 M NaCl did not interfere with silver staining. Treatment of the nucleoli with 80 mM Tris-HCl (pH 7.5) -- 0.15 M NaCl did, however, eliminate silver binding. Serial extraction of nucleoli with 2.0 M NaCl buffer followed by 0.15 M NaCl buffer also abolished silver staining. Analysis of the supernatant fraction of these extracts by polyacrylamide gel electrophoresis indicates that, although more than one nucleolar protein can bind silver, only one protein is associated with the staining of active ribosomal cistrons.

In nucleoli, the steady state of nucleolar proteins is leptomycin B-sensitive.

PubMed

Muro, Eleonora; Hoang, Thang Q; Jobart-Malfait, Aude; Hernandez-Verdun, Danièle

2008-05-01

The nucleolus is a dynamic structure. It has been demonstrated that nucleolar proteins rapidly associate with and dissociate from nucleolar components in continuous exchanges with the nucleoplasm using GFP (green fluorescent protein)-tagged proteins. However, how the exchanges within one nucleolus and between nucleoli within the nuclear volume occurred is still poorly understood. The movement of PAGFP (photoactivatable GFP)-tagged proteins that become visible after photoactivation can be followed. In the present study, we establish the protocol allowing quantification of the traffic of PAGFP-tagged nucleolar proteins in nuclei containing two nucleoli. The traffic in the activated area, at the periphery of the activated area and to the neighbouring nucleolus is measured. Protein B23 is rapidly replaced in the activated area, and at the periphery of the activated area the steady state suggests intranucleolar recycling of B23; this recycling is LMB (leptomycin B)-sensitive. The pool of activated B23 is equally distributed in the volume of the two nucleoli within 2 min. The three-dimensional distribution of the proteins Nop52 and fibrillarin is less rapid than that of B23 but is also LMB-sensitive. In contrast, traffic of fibrillarin from the nucleoli to the CB (Cajal body) was not modified by LMB. We propose that the steady state of nucleolar proteins in nucleoli depends on the affinity of the proteins for their partners and on intranucleolar recycling. This steady state can be impaired by LMB but not the uptake in the neighbouring nucleolus or the CB.

Localization of α-Dystrobrevin in Cajal Bodies and Nucleoli: A New Role for α-Dystrobrevin in the Structure/Stability of the Nucleolus.

PubMed

Hernández-Ibarra, Jose Anselmo; Laredo-Cisneros, Marco Samuel; Mondragón-González, Ricardo; Santamaría-Guayasamín, Natalie; Cisneros, Bulmaro

2015-12-01

α-Dystrobrevin (α-DB) is a cytoplasmic component of the dystrophin-associated complex involved in cell signaling; however, its recently revealed nuclear localization implies a role for this protein in the nucleus. Consistent with this, we demonstrated, in a previous work that α-DB1 isoform associates with the nuclear lamin to maintain nuclei morphology. In this study, we show the distribution of the α-DB2 isoform in different subnuclear compartments of N1E115 neuronal cells, including nucleoli and Cajal bodies, where it colocalizes with B23/nucleophosmin and Nopp140 and with coilin, respectively. Recovery in a pure nucleoli fraction undoubtedly confirms the presence of α-DB2 in the nucleolus. α-DB2 redistributes in a similar fashion to that of fibrillarin and Nopp140 upon actinomycin-mediated disruption of nucleoli and to that of coilin after disorganization of Cajal bodies through ultraviolet-irradiation, with relocalization of the proteins to the corresponding reassembled structures after cessation of the insults, which implies α-DB2 in the plasticity of these nuclear bodies. That localization of α-DB2 in the nucleolus is physiologically relevant is demonstrated by the fact that downregulation of α-DB2 resulted in both altered nucleoli structure and decreased levels of B23/nucleophosmin, fibrillarin, and Nopp140. Since α-DB2 interacts with B23/nucleophosmin and overexpression of the latter protein favors nucleolar accumulation of α-DB2, it appears that targeting of α-DB2 to the nucleolus is dependent on B23/nucleophosmin. In conclusion, we show for the first time localization of α-DB2 in nucleoli and Cajal bodies and provide evidence that α-DB2 is involved in the structure of nucleoli and might modulate nucleolar functions. © 2015 Wiley Periodicals, Inc.

Data on the association of the nuclear envelope protein Sun1 with nucleoli.

PubMed

Moujaber, Ossama; Omran, Nawal; Kodiha, Mohamed; Pié, Brigitte; Cooper, Ellis; Presley, John F; Stochaj, Ursula

2017-08-01

SUN proteins participate in diverse cellular activities, many of which are connected to the nuclear envelope. Recently, the family member SUN1 has been linked to novel biological activities. These include the regulation of nucleoli, intranuclear compartments that assemble ribosomal subunits. We show that SUN1 associates with nucleoli in several mammalian epithelial cell lines. This nucleolar localization is not shared by all cell types, as SUN1 concentrates at the nuclear envelope in ganglionic neurons and non-neuronal satellite cells. Database analyses and Western blotting emphasize the complexity of SUN1 protein profiles in different mammalian cells. We constructed a STRING network which identifies SUN1-related proteins as part of a larger network that includes several nucleolar proteins. Taken together, the current data highlight the diversity of SUN1 proteins and emphasize the possible links between SUN1 and nucleoli.

AFFINITY OF ANIMAL CELL NUCLEOLI FOR NORMAL SERUM

PubMed Central

Maisel, John C.; Lytle, Ralph I.

1966-01-01

Nucleoli of animal cells cultured in vitro are modified by a component of "nonimmune" animal serum. Modified nucleoli bind fluorescein-conjugated nonimmune serum proteins, as shown by calcium ion-dependent fluorescence. Analysis of serum indicates that the nucleolar-binding component is a globulin, with an electrophoretic mobility in the same region as the slow alpha-1 component in pH 8.6 Veronal buffer. The component has a low sedimentation constant (2.4S), and appears to contain glycoprotein with relatively high sialic acid content (8.5%); the latter moiety may be essential to reaction with nucleoli. The nucleolar component reacting with this alpha globulin fraction appears to be a histonelike basic protein. Primary cultures of animal cells have been supported for 1 wk through attachment, spreading, and outgrowth from colonies to confluent monolayers in medium containing a nucleolar-reactive serum fraction as the only protein supplement. PMID:4164214

Nucleolar chromatin organization at different activities of soybean root meristematic cell nucleoli.

PubMed

Stępiński, Dariusz

2013-06-01

Nucleolar chromatin, including nucleolus-associated chromatin as well as active and inactive condensed ribosomal DNA (rDNA) chromatin, derives mostly from secondary constrictions known as nucleolus organizer regions containing rDNA genes on nucleolus-forming chromosomes. This chromatin may occupy different nucleolar positions being in various condensation states which may imply different rDNA transcriptional competence. Sections of nucleoli originating from root meristematic cells of soybean seedlings grown at 25 °C (the control), then subjected to chilling stress (10 °C), and next transferred again to 25 °C (the recovery) were used to measure profile areas occupied by nucleolar condensed chromatin disclosed with sodium hydroxide methylation-acetylation plus uranyl acetate technique. The biggest total area of condensed chromatin was found in the nucleoli of chilled plants, while the smallest was found in those of recovered plants in relation to the amounts of chromatin in the control nucleoli. The condensed nucleolar chromatin, in the form of different-sized and different-shaped clumps, was mainly located in fibrillar centers. One can suppose that changes of condensed rDNA chromatin amounts might be a mechanism controlling the number of transcriptionally active rDNA genes as the nucleoli of plants grown under these experimental conditions show different transcriptional activity and morphology.

Phospho-eNOS Ser-1176 is associated with the nucleoli and the Golgi complex in C6 rat glioma cells.

PubMed

Klinz, Franz-Josef; Herberg, Natalie; Arnhold, Stefan; Addicks, Klaus; Bloch, Wilhelm

2007-06-29

Enzymatic activity of endothelial nitric oxide synthase (eNOS) is controlled by posttranslational modifications, protein-protein interactions, and subcellular localization. For example, N-terminal fatty acid modifications target eNOS to the Golgi complex where it becomes phosphorylated. We show here by immunofluorescence analysis that phospho-eNOS Ser-1176 is enriched in the perinuclear region of interphase C6 rat glioma cells. Confocal double immunofluorescence microscopy with the Golgi marker protein 58K revealed that phospho-eNOS Ser-1176 is associated with the Golgi complex. Surprisingly, we observed several spots in the nucleus of C6 cells that were positive for phospho-eNOS Ser-1176. Confocal double immunofluorescence analysis with the nucleolus marker protein fibrillarin revealed that within the nucleus phospho-eNOS Ser-1176 is exclusively associated with the nucleoli. It is known that in mitotic cells nucleoli are lost during prophase and rebuild during telophase. In agreement with this, we find no nucleoli-like distribution of phospho-eNOS Ser-1176 in metaphase and anaphase C6 glioma cells. Our finding that phospho-eNOS Ser-1176 is selectively associated with the nucleoli points to a so far unknown role for eNOS in interphase glioma cells.

Localized movement and morphology of UBF1-positive nucleolar regions are changed by γ-irradiation in G2 phase of the cell cycle

PubMed Central

Sorokin, Dmitry V; Stixová, Lenka; Sehnalová, Petra; Legartová, Soňa; Suchánková, Jana; Šimara, Pavel; Kozubek, Stanislav; Matula, Pavel; Skalníková, Magdalena; Raška, Ivan; Bártová, Eva

2015-01-01

The nucleolus is a well-organized site of ribosomal gene transcription. Moreover, many DNA repair pathway proteins, including ATM, ATR kinases, MRE11, PARP1 and Ku70/80, localize to the nucleolus (Moore et al., 2011). We analyzed the consequences of DNA damage in nucleoli following ultraviolet A (UVA), C (UVC), or γ-irradiation in order to test whether and how radiation-mediated genome injury affects local motion and morphology of nucleoli. Because exposure to radiation sources can induce changes in the pattern of UBF1-positive nucleolar regions, we visualized nucleoli in living cells by GFP-UBF1 expression for subsequent morphological analyses and local motion studies. UVA radiation, but not 5 Gy of γ-rays, induced apoptosis as analyzed by an advanced computational method. In non-apoptotic cells, we observed that γ-radiation caused nucleolar re-positioning over time and changed several morphological parameters, including the size of the nucleolus and the area of individual UBF1-positive foci. Radiation-induced nucleoli re-arrangement was observed particularly in G2 phase of the cell cycle, indicating repair of ribosomal genes in G2 phase and implying that nucleoli are less stable, thus sensitive to radiation, in G2 phase. PMID:26208041

Active liquid-like behavior of nucleoli determines their size and shape in Xenopus laevis oocytes

PubMed Central

Brangwynne, Clifford P.; Mitchison, Timothy J.; Hyman, Anthony A.

2011-01-01

For most intracellular structures with larger than molecular dimensions, little is known about the connection between underlying molecular activities and higher order organization such as size and shape. Here, we show that both the size and shape of the amphibian oocyte nucleolus ultimately arise because nucleoli behave as liquid-like droplets of RNA and protein, exhibiting characteristic viscous fluid dynamics even on timescales of < 1 min. We use these dynamics to determine an apparent nucleolar viscosity, and we show that this viscosity is ATP-dependent, suggesting a role for active processes in fluidizing internal contents. Nucleolar surface tension and fluidity cause their restructuring into spherical droplets upon imposed mechanical deformations. Nucleoli exhibit a broad distribution of sizes with a characteristic power law, which we show is a consequence of spontaneous coalescence events. These results have implications for the function of nucleoli in ribosome subunit processing and provide a physical link between activity within a macromolecular assembly and its physical properties on larger length scales. PMID:21368180

Active liquid-like behavior of nucleoli determines their size and shape in Xenopus laevis oocytes.

PubMed

Brangwynne, Clifford P; Mitchison, Timothy J; Hyman, Anthony A

2011-03-15

For most intracellular structures with larger than molecular dimensions, little is known about the connection between underlying molecular activities and higher order organization such as size and shape. Here, we show that both the size and shape of the amphibian oocyte nucleolus ultimately arise because nucleoli behave as liquid-like droplets of RNA and protein, exhibiting characteristic viscous fluid dynamics even on timescales of < 1 min. We use these dynamics to determine an apparent nucleolar viscosity, and we show that this viscosity is ATP-dependent, suggesting a role for active processes in fluidizing internal contents. Nucleolar surface tension and fluidity cause their restructuring into spherical droplets upon imposed mechanical deformations. Nucleoli exhibit a broad distribution of sizes with a characteristic power law, which we show is a consequence of spontaneous coalescence events. These results have implications for the function of nucleoli in ribosome subunit processing and provide a physical link between activity within a macromolecular assembly and its physical properties on larger length scales.

Isolation of the constitutive heterochromatin from mouse liver nuclei.

PubMed

Zatsepina, Olga V; Zharskaya, Oxana O; Prusov, Andrei N

2008-01-01

A method for isolation of constitutive heterochromatin (chromocenters) from nuclei of mouse liver cells is described. This method is based on the higher resistance of chromocenters to low ionic strength treatment as compared with that of nucleoli and euchromatin. The method allows separation of chromocenters that are essentially free of nucleoli and other nuclear contaminants. In contrast to nuclei and nucleoli, isolated chromocenters are characterized by a simpler protein composition and contain a smaller number of proteins (especially of high molecular weight proteins). They possess telomeric DNA and telomerase activity that suggests a tight association of chromocenters with the telomerase complex in mouse hepatocyte nuclei.

To the Large Nucleolar Bodies in Apoptotic Leukaemic Granulocytic Progenitors without Further Differentiation. Are Large Nucleoli Always Present in Proliferating Cells?

PubMed

Smetana, K; Kuželová, K; Zápotocký, M; Hrkal, Z

2017-01-01

Large nucleoli have generally been believed to be present in less differentiated and proliferating cells including the malignant ones. Such nucleoli have also been considered to be active in the biosynthetic process and major cell developmental activities. In contrast, after cytostatic treatment, apoptotic leukaemic progenitors still containing nuclei did not exhibit substantial reduction of the nucleolar size but displayed decreased nucleolar biosynthetic activity. The present study was undertaken to provide more information on the large nucleoli in spontaneously occurring apoptotic leukaemic progenitors without further differentiation. Leukaemic progenitors of established cell lineages originating from leukaemic patients represented a very convenient model for such study. Some of them exhibit morphological signs of the spontaneously occurring apoptotic process. Since such signs are expressed by nuclear and cytoplasmic morphological variability, the present study dealt with spontaneously occurring apoptotic progenitors with preserved nuclei characterized by heavy chromatin condensation and occasional fragmentation. Based of nucleolar body and nuclear maximal diameter measurements it seems to be clear that the nucleolar size in these cells was not substantially reduced, contrary to that of the nucleus. However, large nucleolar bodies in spontaneously occurring apoptotic cells were characterized by markedly reduced biosynthetic activity, as expressed by the decreased number of nucleolar transcription markers such as nucleolar fibrillar centres. In conclusion, large nucleoli may be present not only in proliferating, but also in spontaneously occurring apoptotic cells.

FoxP3 Functions as a Novel Breast Cancer Suppressor Gene Through Cooperation with NFAT

DTIC Science & Technology

2008-12-01

peared transformed, as demonstrated by enlargement of nuclei and more-active nucleoli (Figure 6C). In most mice, multiple PINs were found in the...papillary and tufting. A high-power imagine showing enlarged nuclei and active nucleoli is presented in the lower panel.tissue is sufficient to initiate

Functional Proteomic Analysis of Human NucleolusD⃞

PubMed Central

Scherl, Alexander; Couté, Yohann; Déon, Catherine; Callé, Aleth; Kindbeiter, Karine; Sanchez, Jean-Charles; Greco, Anna; Hochstrasser, Denis; Diaz, Jean-Jacques

2002-01-01

The notion of a “plurifunctional” nucleolus is now well established. However, molecular mechanisms underlying the biological processes occurring within this nuclear domain remain only partially understood. As a first step in elucidating these mechanisms we have carried out a proteomic analysis to draw up a list of proteins present within nucleoli of HeLa cells. This analysis allowed the identification of 213 different nucleolar proteins. This catalog complements that of the 271 proteins obtained recently by others, giving a total of ∼350 different nucleolar proteins. Functional classification of these proteins allowed outlining several biological processes taking place within nucleoli. Bioinformatic analyses permitted the assignment of hypothetical functions for 43 proteins for which no functional information is available. Notably, a role in ribosome biogenesis was proposed for 31 proteins. More generally, this functional classification reinforces the plurifunctional nature of nucleoli and provides convincing evidence that nucleoli may play a central role in the control of gene expression. Finally, this analysis supports the recent demonstration of a coupling of transcription and translation in higher eukaryotes. PMID:12429849

A new rapid method for isolating nucleoli.

PubMed

Li, Zhou Fang; Lam, Yun Wah

2015-01-01

The nucleolus was one of the first subcellular organelles to be isolated from the cell. The advent of modern proteomic techniques has resulted in the identification of thousands of proteins in this organelle, and live cell imaging technology has allowed the study of the dynamics of these proteins. However, the limitations of current nucleolar isolation methods hinder the further exploration of this structure. In particular, these methods require the use of a large number of cells and tedious procedures. In this chapter we describe a new and improved nucleolar isolation method for cultured adherent cells. In this method cells are snap-frozen before direct sonication and centrifugation onto a sucrose cushion. The nucleoli can be obtained within a time as short as 20 min, and the high yield allows the use of less starting material. As a result, this method can capture rapid biochemical changes in nucleoli by freezing the cells at a precise time, hence faithfully reflecting the protein composition of nucleoli at the specified time point. This protocol will be useful for proteomic studies of dynamic events in the nucleolus and for better understanding of the biology of mammalian cells.

Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

PubMed

Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

2015-11-10

Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

[The WHO/ISUP grading system for renal carcinoma].

PubMed

Moch, H

2016-07-01

Histological tumor grading is an accepted prognostic parameter of renal cell carcinoma (RCC). In 2012, the International Society of Urologic Pathologists (ISUP) proposed a novel grading system for RCC, mainly based on the evaluation of nucleoli: grade 1 tumors have nucleoli that are inconspicuous and basophilic at ×400 magnification; grade 2 tumors have nucleoli that are clearly visible at ×400 magnification and eosinophilic; grade 3 tumors have clearly visible nucleoli at ×100 magnification; and grade 4 tumors have extreme pleomorphism or rhabdoid and/or sarcomatoid morphology. This grading system was validated for clear cell renal cell carcinoma and papillary renal cell carcinoma. At the same time, the ISUP proposed not grading chromophobe renal cell carcinomas according to this system. At a consensus conference in Zurich the World Health Organization (WHO) recommended the ISUP grading system; thus, the WHO/ISUP grading system is now going to be implemented internationally. The ISUP/WHO grading system has not been validated as a prognostic parameter for other tumor subtypes, but can be used for descriptive purposes.

Computer-based fluorescence quantification: a novel approach to study nucleolar biology

PubMed Central

2011-01-01

Background Nucleoli are composed of possibly several thousand different proteins and represent the most conspicuous compartments in the nucleus; they play a crucial role in the proper execution of many cellular processes. As such, nucleoli carry out ribosome biogenesis and sequester or associate with key molecules that regulate cell cycle progression, tumorigenesis, apoptosis and the stress response. Nucleoli are dynamic compartments that are characterized by a constant flux of macromolecules. Given the complex and dynamic composition of the nucleolar proteome, it is challenging to link modifications in nucleolar composition to downstream effects. Results In this contribution, we present quantitative immunofluorescence methods that rely on computer-based image analysis. We demonstrate the effectiveness of these techniques by monitoring the dynamic association of proteins and RNA with nucleoli under different physiological conditions. Thus, the protocols described by us were employed to study stress-dependent changes in the nucleolar concentration of endogenous and GFP-tagged proteins. Furthermore, our methods were applied to measure de novo RNA synthesis that is associated with nucleoli. We show that the techniques described here can be easily combined with automated high throughput screening (HTS) platforms, making it possible to obtain large data sets and analyze many of the biological processes that are located in nucleoli. Conclusions Our protocols set the stage to analyze in a quantitative fashion the kinetics of shuttling nucleolar proteins, both at the single cell level as well as for a large number of cells. Moreover, the procedures described here are compatible with high throughput image acquisition and analysis using HTS automated platforms, thereby providing the basis to quantify nucleolar components and activities for numerous samples and experimental conditions. Together with the growing amount of information obtained for the nucleolar proteome, improvements in quantitative microscopy as they are described here can be expected to produce new insights into the complex biological functions that are orchestrated by the nucleolus. PMID:21639891

Isolation of Nuclei and Nucleoli.

PubMed

Pendle, Alison F; Shaw, Peter J

2017-01-01

Here we describe methods for producing nuclei from Arabidopsis suspension cultures or root tips of Arabidopsis, wheat, or pea. These methods could be adapted for other species and cell types. The resulting nuclei can be further purified for use in biochemical or proteomic studies, or can be used for microscopy. We also describe how the nuclei can be used to obtain a preparation of nucleoli.

Thermally Targeted Delivery of a c-Myc Inhibitory Peptide In Vivo Using Elastin-like Polypeptide

DTIC Science & Technology

2009-10-01

cytoplasm. Also, in a subset of cells, Bac-ELP1⁎-H1 showed very bright nuclear staining exclusive of nucleoli (Fig. 5, lower right, arrows). 3.6. Time...localization was very bright relative to the amount of polypeptide in the cytoplasm, and it appeared to be nucleoplasmic and excluded from nucleoli . The

The effect of a histone deacetylase inhibitor - valproic acid - on nucleoli in human leukaemic myeloblasts.

PubMed

Smetana, K; Zápotocký, M

2010-01-01

The present study was undertaken to provide more information on nucleolar changes induced by a histone deacetylase inhibitor such as valproic acid in leukaemic myeloblasts at the single-cell level. For this study, RNA in nucleoli was visualized by a simple but sensitive cytochemical procedure in unfixed cytospins of short-term bone marrow cultures from patients suffering from acute myeloid leukaemia. Valproic acid in leukaemic myeloblasts markedly reduced the nucleolar size and also produced significant transformation of "active" to "resting" and "inactive" nucleoli that reflected the alteration of the nucleolar transcription in sensitive myeloblasts. On this occasion it should be added that valproic acid significantly increased the incidence of altered myeloblasts that changed to apoptotic cells or apoptotic bodies and cell ghosts. In contrast to the above-mentioned decreased nucleolar size, the nucleolar RNA concentration, expressed by computerassisted RNA image densitometry in valproic acidtreated myeloblasts, was not significantly changed. The results of the present study clearly indicated that the nucleolar size and transformation of "active" to "sleeping" or "inactive" nucleoli are convenient markers of the sensitivity and alteration of leukaemic myeloblasts produced by a histone deacetylase inhibitor, valproic acid, at the single-cell level.

To the nucleolar bodies (nucleoli) in cells of the lymphocytic lineage in patients suffering from B - chronic lymphocytic leukemia.

PubMed

Smetana, K; Karban, J; Trneny, M

2010-01-01

The present study was undertaken to provide more information on nucleoli in lymphocytes of B - chronic lymphocytic leukemia. The computer assisted nucleolar and cytoplasmic RNA image densitometry, reflecting the nucleolar and cytoplasmic RNA concentration at the single cell level, demonstrated a remarkable stability during the differentiation and maturation of B- lymphocytes. In contrast, as it was expected, the nucleolar diameter during the lymphocytic development markedly decreased. Thus the nucleolar RNA content of leukemic B-lymphocytes was apparently related to the nucleolar size. In both immature and mature lymphocytes, the cytostatic treatment increased the incidence of micronucleoli, which represent the "inactive" type of nucleoli. However, the decreased values of the nucleolar diameter were statistically significant only in mature lymphocytes of treated patients. On the other hand, despite such observation, it must be mentioned that "large active" and "ring shaped resting" nucleoli were still present in immature and mature lymphocytes after the cytostatic therapy and such cells might represent a potential pool of proliferating cells. As it is generally accepted "large active nucleoli" with multiple fibrillar centers are known to be characteristic for proliferating cells. "Ring shaped resting nucleoli" are present in sleeping cells, which may be stimulated to return to the cell cycle and to proliferate again. In addition, the nucleolar RNA distribution also indicated that Gumprecht ghosts mostly originated from mature lymphocytes. Increased ratio of the nucleolar to cytoplasmic RNA density in Gumprecht ghosts or apoptotic cells and apoptotic bodies of the lymphocytic origin was related to the decreased cytoplasmic RNA concentration. The increased nucleolar size together with the markedly decreased cytoplasmic RNA concentration characteristic for Gumprecht ghosts just reflected the spreading of lymphocytes during smear preparations. In apoptotic cells or bodies of the lymphocytic origin, the "frozen" nucleolar RNA concentration accompanied by a reduced RNA concentration in the cytoplasm exhibited a remarkable similarity to the apoptotic process induced in vitro by the cytostatic treatment. B-chronic lymphocytic leukemia; lymphocytes; nucleolar classes; size; nucleolar RNA image density -concentration.

A charge-dependent mechanism is responsible for the dynamic accumulation of proteins inside nucleoli.

PubMed

Musinova, Yana R; Kananykhina, Eugenia Y; Potashnikova, Daria M; Lisitsyna, Olga M; Sheval, Eugene V

2015-01-01

The majority of known nucleolar proteins are freely exchanged between the nucleolus and the surrounding nucleoplasm. One way proteins are retained in the nucleoli is by the presence of specific amino acid sequences, namely nucleolar localization signals (NoLSs). The mechanism by which NoLSs retain proteins inside the nucleoli is still unclear. Here, we present data showing that the charge-dependent (electrostatic) interactions of NoLSs with nucleolar components lead to nucleolar accumulation as follows: (i) known NoLSs are enriched in positively charged amino acids, but the NoLS structure is highly heterogeneous, and it is not possible to identify a consensus sequence for this type of signal; (ii) in two analyzed proteins (NF-κB-inducing kinase and HIV-1 Tat), the NoLS corresponds to a region that is enriched for positively charged amino acid residues; substituting charged amino acids with non-charged ones reduced the nucleolar accumulation in proportion to the charge reduction, and nucleolar accumulation efficiency was strongly correlated with the predicted charge of the tested sequences; and (iii) sequences containing only lysine or arginine residues (which were referred to as imitative NoLSs, or iNoLSs) are accumulated in the nucleoli in a charge-dependent manner. The results of experiments with iNoLSs suggested that charge-dependent accumulation inside the nucleoli was dependent on interactions with nucleolar RNAs. The results of this work are consistent with the hypothesis that nucleolar protein accumulation by NoLSs can be determined by the electrostatic interaction of positively charged regions with nucleolar RNAs rather than by any sequence-specific mechanism. Copyright © 2014 Elsevier B.V. All rights reserved.

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

PubMed Central

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

2016-01-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in-trans signaling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identified TCOF1-Treacle, a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle-dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in-trans in the presence of distant chromosome breaks. PMID:25064736

The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage.

PubMed

Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A; Gwerder, Myriam; Gutsche, Katrin; Altmeyer, Matthias; Jungmichel, Stephanie; Toledo, Luis I; Fink, Daniel; Rask, Maj-Britt; Grøfte, Merete; Lukas, Claudia; Nielsen, Michael L; Smerdon, Stephen J; Lukas, Jiri; Stucki, Manuel

2014-08-01

Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1, and demonstrate that NBS1 translocation and accumulation in the nucleoli is Treacle dependent. Finally, we provide evidence that Treacle-mediated NBS1 recruitment into the nucleoli regulates rRNA silencing in trans in the presence of distant chromosome breaks.

The development of fluorescence turn-on probe for Al(III) sensing and live cell nucleus-nucleoli staining

NASA Astrophysics Data System (ADS)

Saini, Anoop Kumar; Sharma, Vinay; Mathur, Pradeep; Shaikh, Mobin M.

2016-10-01

The morphology of nucleus and nucleolus is powerful indicator of physiological and pathological conditions. The specific staining of nucleolus recently gained much attention due to the limited and expensive availability of the only existing stain “SYTO RNA-Select”. Here, a new multifunctional salen type ligand (L1) and its Al3+ complex (1) are designed and synthesized. L1 acts as a chemosensor for Al3+ whereas 1 demonstrates specific staining of nucleus as well as nucleoli. The binding of 1 with nucleic acid is probed by DNase and RNase digestion in stained cells. 1 shows an excellent photostability, which is a limitation for existing nucleus stains during long term observations. 1 is assumed to be a potential candidate as an alternative to expensive commercial dyes for nucleus and nucleoli staining.

The development of fluorescence turn-on probe for Al(III) sensing and live cell nucleus-nucleoli staining.

PubMed

Saini, Anoop Kumar; Sharma, Vinay; Mathur, Pradeep; Shaikh, Mobin M

2016-10-10

The morphology of nucleus and nucleolus is powerful indicator of physiological and pathological conditions. The specific staining of nucleolus recently gained much attention due to the limited and expensive availability of the only existing stain "SYTO RNA-Select". Here, a new multifunctional salen type ligand (L 1 ) and its Al 3+ complex (1) are designed and synthesized. L 1 acts as a chemosensor for Al 3+ whereas 1 demonstrates specific staining of nucleus as well as nucleoli. The binding of 1 with nucleic acid is probed by DNase and RNase digestion in stained cells. 1 shows an excellent photostability, which is a limitation for existing nucleus stains during long term observations. 1 is assumed to be a potential candidate as an alternative to expensive commercial dyes for nucleus and nucleoli staining.

Biosynthesis of ribosomal RNA in nucleoli regulates pluripotency and differentiation ability of pluripotent stem cells.

PubMed

Watanabe-Susaki, Kanako; Takada, Hitomi; Enomoto, Kei; Miwata, Kyoko; Ishimine, Hisako; Intoh, Atsushi; Ohtaka, Manami; Nakanishi, Mahito; Sugino, Hiromu; Asashima, Makoto; Kurisaki, Akira

2014-12-01

Pluripotent stem cells have been shown to have unique nuclear properties, for example, hyperdynamic chromatin and large, condensed nucleoli. However, the contribution of the latter unique nucleolar character to pluripotency has not been well understood. Here, we show that fibrillarin (FBL), a critical methyltransferase for ribosomal RNA (rRNA) processing in nucleoli, is one of the proteins highly expressed in pluripotent embryonic stem (ES) cells. Stable expression of FBL in ES cells prolonged the pluripotent state of mouse ES cells cultured in the absence of leukemia inhibitory factor (LIF). Analyses using deletion mutants and a point mutant revealed that the methyltransferase activity of FBL regulates stem cell pluripotency. Knockdown of this gene led to significant delays in rRNA processing, growth inhibition, and apoptosis in mouse ES cells. Interestingly, both partial knockdown of FBL and treatment with actinomycin D, an inhibitor of rRNA synthesis, induced the expression of differentiation markers in the presence of LIF and promoted stem cell differentiation into neuronal lineages. Moreover, we identified p53 signaling as the regulatory pathway for pluripotency and differentiation of ES cells. These results suggest that proper activity of rRNA production in nucleoli is a novel factor for the regulation of pluripotency and differentiation ability of ES cells. © 2014 AlphaMed Press.

[Cytogenetic characteristics of seed offspring of leafy tree plants from one-kilometer zone of Novovoronezh nuclear power station].

PubMed

Artiukhov, V G; Kalaev, V N; Sen'kevich, E V; Vakhtel', V M; Savko, A D

2004-01-01

Cytogenetic characteristics (mitotic activity, level and spectrum of pathological mitoses, nucleoly characteristics) of seed offspring of Quercus robur L. and Betula pendula Roth from Novovoronezh nuclear power station's 1-kilometer zone have been studied. It has been shown the change of time of passing though mitotic stages by cells, the increasing of bridges frequency occur in spectrum of mitotic aberrations (that shows activation of reparation systems), the change in nucleoly characteristics (the part of polynucleolaris cells increase in case of oak and decrease in case of birch, the rase of surface square of single nucleolies). The phenomena, mean above, probably, induced by synergic effects of Novovoronezh nuclear power station and environment pollutants. The most contaminated territories of 1-kilometer zone of Novovoronezh nuclear power station have been discovered by means of methods of cluster analysis of total cytogenetic characteristics of tree plants seed offspring.

A mRNA and cognate microRNAs localize in the nucleolus.

PubMed

Reyes-Gutierrez, Pablo; Ritland Politz, Joan C; Pederson, Thoru

2014-01-01

We previously discovered that a set of 5 microRNAs are concentrated in the nucleolus of rat myoblasts. We now report that several mRNAs are also localized in the nucleoli of these cells as determined by microarray analysis of RNA from purified nucleoli. Among the most abundant of these nucleolus-localized mRNAs is that encoding insulin-like growth factor 2 (IGF2), a regulator of myoblast proliferation and differentiation. The presence of IGF2 mRNA in nucleoli was confirmed by fluorescence in situ hybridization, and RT-PCR experiments demonstrated that these nucleolar transcripts are spliced, thus arriving from the nucleoplasm. Bioinformatics analysis predicted canonically structured, highly thermodynamically stable interactions between IGF2 mRNA and all 5 of the nucleolus-localized microRNAs. These results raise the possibility that the nucleolus is a staging site for setting up particular mRNA-microRNA interactions prior to export to the cytoplasm.

Dynamic nucleoplasmic and nucleolar localization of mammalian RNase H1 in response to RNAP I transcriptional R-loops

PubMed Central

Sun, Hong; De Hoyos, Cheryl L.; Bailey, Jeffrey K.; Liang, Xue-hai; Crooke, Stanley T.

2017-01-01

Abstract An R-loop is a DNA:RNA hybrid formed during transcription when a DNA duplex is invaded by a nascent RNA transcript. R-loops accumulate in nucleoli during RNA polymerase I (RNAP I) transcription. Here, we report that mammalian RNase H1 enriches in nucleoli and co-localizes with R-loops in cultured human cells. Co-migration of RNase H1 and R-loops from nucleoli to perinucleolar ring structures was observed upon inhibition of RNAP I transcription. Treatment with camptothecin which transiently stabilized nucleolar R-loops recruited RNase H1 to the nucleoli. It has been reported that the absence of Topoisomerase and RNase H activity in Escherichia coli or Saccharomyces cerevisiae caused R-loop accumulation along rDNA. We found that the distribution of RNase H1 and Top1 along rDNA coincided at sites where R-loops accumulated in mammalian cells. Loss of either RNase H1 or Top1 caused R-loop accumulation, and the accumulation of R-loops was exacerbated when both proteins were depleted. Importantly, we observed that protein levels of Top1 were negatively correlated with the abundance of RNase H1. We conclude that Top1 and RNase H1 are partially functionally redundant in mammalian cells to suppress RNAP I transcription-associate R-loops. PMID:28977560

RNA transcription modulates phase transition-driven nuclear body assembly

PubMed Central

Berry, Joel; Weber, Stephanie C.; Vaidya, Nilesh; Haataja, Mikko; Brangwynne, Clifford P.

2015-01-01

Nuclear bodies are RNA and protein-rich, membraneless organelles that play important roles in gene regulation. The largest and most well-known nuclear body is the nucleolus, an organelle whose primary function in ribosome biogenesis makes it key for cell growth and size homeostasis. The nucleolus and other nuclear bodies behave like liquid-phase droplets and appear to condense from the nucleoplasm by concentration-dependent phase separation. However, nucleoli actively consume chemical energy, and it is unclear how such nonequilibrium activity might impact classical liquid–liquid phase separation. Here, we combine in vivo and in vitro experiments with theory and simulation to characterize the assembly and disassembly dynamics of nucleoli in early Caenorhabditis elegans embryos. In addition to classical nucleoli that assemble at the transcriptionally active nucleolar organizing regions, we observe dozens of “extranucleolar droplets” (ENDs) that condense in the nucleoplasm in a transcription-independent manner. We show that growth of nucleoli and ENDs is consistent with a first-order phase transition in which late-stage coarsening dynamics are mediated by Brownian coalescence and, to a lesser degree, Ostwald ripening. By manipulating C. elegans cell size, we change nucleolar component concentration and confirm several key model predictions. Our results show that rRNA transcription and other nonequilibrium biological activity can modulate the effective thermodynamic parameters governing nucleolar and END assembly, but do not appear to fundamentally alter the passive phase separation mechanism. PMID:26351690

NC-Mediated Nucleolar Localization of Retroviral Gag Proteins

PubMed Central

Lochmann, Timothy L.; Bann, Darrin V.; Ryan, Eileen P.; Beyer, Andrea R.; Mao, Annie; Cochrane, Alan

2012-01-01

The assembly and release of retrovirus particles from the cell membrane is directed by the Gag polyprotein. The Gag protein of Rous sarcoma virus (RSV) traffics through the nucleus prior to plasma membrane localization. We previously reported that nuclear localization of RSV Gag is linked to efficient packaging of viral genomic RNA, however the intranuclear activities of RSV Gag are not well understood. To gain insight into the properties of the RSV Gag protein within the nucleus, we examined the subnuclear localization and dynamic trafficking of RSV Gag. Restriction of RSV Gag to the nucleus by mutating its nuclear export signal (NES) in the p10 domain or interfering with CRM1-mediated nuclear export of Gag by leptomycin B (LMB) treatment led to the accumulation of Gag in nucleoli and discrete nucleoplasmic foci. Retention of RSV Gag in nucleoli was reduced with cis-expression of the 5′ untranslated RU5 region of the viral RNA genome, suggesting the psi (ψ packaging signal may alter the subnuclear localization of Gag. Fluorescence recovery after photobleaching (FRAP) demonstrated that the nucleolar fraction of Gag was highly mobile, indicating that the there was rapid exchange with Gag proteins in the nucleoplasm. RSV Gag is targeted to nucleoli by a nucleolar localization signal (NoLS) in the NC domain, and similarly, the human immunodeficiency virus type 1 (HIV-1) NC protein also contains an NoLS consisting of basic residues. Interestingly, co-expression of HIV-1 NC or Rev with HIV-1 Gag resulted in accumulation of Gag in nucleoli. Moreover, a subpopulation of HIV-1 Gag was detected in the nucleoli of HeLa cells stably expressing the entire HIV-1 genome in a Rev-dependent fashion. These findings suggest that the RSV and HIV-1 Gag proteins undergo nucleolar trafficking in the setting of viral infection. PMID:23036987

Construction of synthetic nucleoli in human cells reveals how a major functional nuclear domain is formed and propagated through cell division.

PubMed

Grob, Alice; Colleran, Christine; McStay, Brian

2014-02-01

Human cell nuclei are functionally organized into structurally stable yet dynamic bodies whose cell cycle inheritance is poorly understood. Here, we investigate the biogenesis and propagation of nucleoli, sites of ribosome biogenesis and key regulators of cellular growth. Nucleolar and cell cycles are intimately connected. Nucleoli disappear during mitosis, reforming around prominent uncharacterized chromosomal features, nucleolar organizer regions (NORs). By examining the effects of UBF depletion on both endogenous NORs and synthetic pseudo-NORs, we reveal its essential role in maintaining competency and establishing a bookmark on mitotic NORs. Furthermore, we demonstrate that neo-NORs, UBF-binding site arrays coupled with rDNA transcription units, direct the de novo biogenesis of functional compartmentalized neonucleoli irrespective of their site of chromosomal integration. For the first time, we establish the sequence requirements for nucleolar biogenesis and provide proof that this is a staged process where UBF-dependent mitotic bookmarking precedes function-dependent nucleolar assembly.

Probing the stiffness of isolated nucleoli by atomic force microscopy.

PubMed

Louvet, Emilie; Yoshida, Aiko; Kumeta, Masahiro; Takeyasu, Kunio

2014-04-01

In eukaryotic cells, ribosome biogenesis occurs in the nucleolus, a membraneless nuclear compartment. Noticeably, the nucleolus is also involved in several nuclear functions, such as cell cycle regulation, non-ribosomal ribonucleoprotein complex assembly, aggresome formation and some virus assembly. The most intriguing question about the nucleolus is how such dynamics processes can occur in such a compact compartment. We hypothesized that its structure may be rather flexible. To investigate this, we used atomic force microscopy (AFM) on isolated nucleoli. Surface topography imaging revealed the beaded structure of the nucleolar surface. With the AFM's ability to measure forces, we were able to determine the stiffness of isolated nucleoli. We could establish that the nucleolar stiffness varies upon drastic morphological changes induced by transcription and proteasome inhibition. Furthermore, upon ribosomal proteins and LaminB1 knockdowns, the nucleolar stiffness was increased. This led us to propose a model where the nucleolus has steady-state stiffness dependent on ribosome biogenesis activity and requires LaminB1 for its flexibility.

Deep-Red Fluorescent Gold Nanoclusters for Nucleoli Staining: Real-Time Monitoring of the Nucleolar Dynamics in Reverse Transformation of Malignant Cells.

PubMed

Wang, Xiaojuan; Wang, Yanan; He, Hua; Ma, Xiqi; Chen, Qi; Zhang, Shuai; Ge, Baosheng; Wang, Shengjie; Nau, Werner M; Huang, Fang

2017-05-31

Nucleoli are important subnuclear structures inside cells. We report novel fluorescent gold nanoclusters (K-AuNCs) that are able to stain the nucleoli selectively and make it possible to explore the nucleolar morphology with fluorescence imaging technique. This novel probe is prepared through an easy synthesis method by employing a tripeptide (Lys-Cys-Lys) as the surface ligand. The properties, including deep-red fluorescence emission (680 nm), large Stocks shift, broad excitation band, low cytotoxicity, and good photostability, endow this probe with potential for bioanalytical applications. Because of their small size and their positively charged surface, K-AuNCs are able to accumulate efficiently at the nucleolar regions and provide precise morphological information. K-AuNCs are also used to monitor the nucleolar dynamics along the reverse-transformation process of malignant cells, induced by the agonist of protein A, 8-chloro-cyclic adenosine monophosphate. This gives a novel approach for investigating the working mechanism of antitumor drugs.

The Relationship Between Human Nucleolar Organizer Regions and Nucleoli, Probed by 3D-ImmunoFISH.

PubMed

van Sluis, Marjolein; van Vuuren, Chelly; McStay, Brian

2016-01-01

3D-immunoFISH is a valuable technique to compare the localization of DNA sequences and proteins in cells where three-dimensional structure has been preserved. As nucleoli contain a multitude of protein factors dedicated to ribosome biogenesis and form around specific chromosomal loci, 3D-immunoFISH is a particularly relevant technique for their study. In human cells, nucleoli form around transcriptionally active ribosomal gene (rDNA) arrays termed nucleolar organizer regions (NORs) positioned on the p-arms of each of the acrocentric chromosomes. Here, we provide a protocol for fixing and permeabilizing human cells grown on microscope slides such that nucleolar proteins can be visualized using antibodies and NORs visualized by DNA FISH. Antibodies against UBF recognize transcriptionally active rDNA/NORs and NOP52 antibodies provide a convenient way of visualizing the nucleolar volume. We describe a probe designed to visualize rDNA and introduce a probe comprised of NOR distal sequences, which can be used to identify or count individual NORs.

Construction of synthetic nucleoli in human cells reveals how a major functional nuclear domain is formed and propagated through cell division

PubMed Central

Grob, Alice; Colleran, Christine; McStay, Brian

2014-01-01

Human cell nuclei are functionally organized into structurally stable yet dynamic bodies whose cell cycle inheritance is poorly understood. Here, we investigate the biogenesis and propagation of nucleoli, sites of ribosome biogenesis and key regulators of cellular growth. Nucleolar and cell cycles are intimately connected. Nucleoli disappear during mitosis, reforming around prominent uncharacterized chromosomal features, nucleolar organizer regions (NORs). By examining the effects of UBF depletion on both endogenous NORs and synthetic pseudo-NORs, we reveal its essential role in maintaining competency and establishing a bookmark on mitotic NORs. Furthermore, we demonstrate that neo-NORs, UBF-binding site arrays coupled with rDNA transcription units, direct the de novo biogenesis of functional compartmentalized neonucleoli irrespective of their site of chromosomal integration. For the first time, we establish the sequence requirements for nucleolar biogenesis and provide proof that this is a staged process where UBF-dependent mitotic bookmarking precedes function-dependent nucleolar assembly. PMID:24449107

[Peculiarities of mitosis and nucleolar characteristics of the birch plantlets under antropogenous pollution].

PubMed

Butorina, A K; Kalaev, V N; Karpova, S S

2002-01-01

A study was made of some cytogenetic characteristics (mitotic activity, the level and spectrum of pathological mitosis, nucleolar features in root tip cells) in birch plantlets. The seeds were collected in four districts of Voronezh and in the ecologically clean territory. The index of mitotic activity has a considerable resistance to anthropogenous pollution. In the experimental areas, the level and spectrum of pathological mitosis increase. In contaminated areas we observed changes of nucleolar characteristics (the increased surface area of nucleoli and their higher number in cells, the increased number of cells with highly active types of nucleoli, the appearance of residual nucleoli). These changes can be considered as possible mechanisms of adaptation to stress due to antropogenous pollution. It is suggested that the use of such indices as single nucleolar surface area or the level of pathological mitosis may be perspective for cytogenetic monitoring of the environment, and for prognostification of environmental conditions suitable or unsuitable for the human health.

Deletion and site-specific mutagenesis of nucleolin's carboxy GAR domain.

PubMed

Pellar, Gregory J; DiMario, Patrick J

2003-04-01

Vertebrate nucleolin is an abundant RNA-binding protein in the dense fibrillar component of active nucleoli. Nucleolin is modular in composition. Its amino-terminal third contains alternating acidic and basic domains, its middle section contains four consensus RNA-binding domains (cRBDs), and its carboxy-terminus contains a distinctive glycine/arginine-rich (GAR) domain with several RGG motifs. The arginines within these motifs are asymmetrically dimethylated. Several laboratories have shown that the GAR domain is necessary but not sufficient for the efficient localization of nucleolin to nucleoli. We examined the distribution of endogenous fibrillarin, Nopp140, and B23 when full-length and DeltaGAR nucleolin were expressed exogenously as enhanced green fluorescent protein (EGFP)-tagged fusions. Only B23 redistributed when DeltaGAR-EGFP was expressed at moderate to high levels, suggesting an in vivo interaction between nucleolin and B23. Next we substituted all ten arginines within the GAR domain of Chinese hamster ovary (CHO) nucleolin with lysines to test the hypothesis that methylation of the carboxy GAR domain is necessary for the nucleolar association of nucleolin. The lysine-substituted mutant was not an in vitro substrate for the yeast protein methyltransferase, Hmt1p/Rmt1. It was, however, able to associate properly with interphase nucleoli and with interphase pre-nucleolar bodies upon recovery from hypotonic shock. We conclude, therefore, that although the GAR domain is necessary for the efficient localization of nucleolin to nucleoli, methylation of this domain is not required for proper nucleolar localization.

Dynamic distribution of spindlin in nucleoli, nucleoplasm and spindle from primary oocytes to mature eggs and its critical function for oocyte-to-embryo transition in gibel carp.

PubMed

Sun, Min; Li, Zhi; Gui, Jian-Fang

2010-10-01

Spindlin (Spin) was thought as a maternal-effect factor associated with meiotic spindle. Its role for the oocyte-to-embryo transition was suggested in mouse, but its direct evidence for the function had been not obtained in other vertebrates. In this study, we used the CagSpin-specific antibody to investigate CagSpin expression pattern and distribution during oogenesis of gibel carp (Carassius auratus gibelio). First, the oocyte-specific expression pattern and dynamic distribution was revealed in nucleoli, nucleoplasm, and spindle from primary oocytes to mature eggs by immunofluorescence localization. In primary oocytes and growth stage oocytes, CagSpin accumulates in nucleoli in increasing numbers along with the oocyte growth, and its disassembly occurs in vitellogenic oocytes, which implicates that CagSpin may be a major component of a large number of nucleoli in fish growth oocytes. Then, co-localization of CagSpin and β-tubulin was revealed in meiotic spindle of mature egg, indicating that CagSpin is one spindle-associated factor. Moreover, microinjection of CagSpin-specific antibody into the fertilized eggs blocked the first cleavage, and found that the CagSpin depletion resulted in spindle assembly disturbance. Thereby, our study provided the first direct evidence for the critical oocyte-to-embryo transition function of Spin in vertebrates, and confirmed that Spin is one important maternal-effect factor that participates in oocyte growth, oocyte maturation, and oocyte-to-embryo transition.

Nuclear γ-tubulin associates with nucleoli and interacts with tumor suppressor protein C53.

PubMed

Hořejší, Barbora; Vinopal, Stanislav; Sládková, Vladimíra; Dráberová, Eduarda; Sulimenko, Vadym; Sulimenko, Tetyana; Vosecká, Věra; Philimonenko, Anatoly; Hozák, Pavel; Katsetos, Christos D; Dráber, Pavel

2012-01-01

γ-Tubulin is assumed to be a typical cytosolic protein necessary for nucleation of microtubules from microtubule organizing centers. Using immunolocalization and cell fractionation techniques in combination with siRNAi and expression of FLAG-tagged constructs, we have obtained evidence that γ-tubulin is also present in nucleoli of mammalian interphase cells of diverse cellular origins. Immunoelectron microscopy has revealed γ-tubulin localization outside fibrillar centers where transcription of ribosomal DNA takes place. γ-Tubulin was associated with nucleolar remnants after nuclear envelope breakdown and could be translocated to nucleoli during mitosis. Pretreatment of cells with leptomycin B did not affect the distribution of nuclear γ-tubulin, making it unlikely that rapid active transport via nuclear pores participates in the transport of γ-tubulin into the nucleus. This finding was confirmed by heterokaryon assay and time-lapse imaging of photoconvertible protein Dendra2 tagged to γ-tubulin. Immunoprecipitation from nuclear extracts combined with mass spectrometry revealed an association of γ-tubulin with tumor suppressor protein C53 located at multiple subcellular compartments including nucleoli. The notion of an interaction between γ-tubulin and C53 was corroborated by pull-down and co-immunoprecipitation experiments. Overexpression of γ-tubulin antagonized the inhibitory effect of C53 on DNA damage G(2) /M checkpoint activation. The combined results indicate that aside from its known role in microtubule nucleation, γ-tubulin may also have nuclear-specific function(s). Copyright © 2011 Wiley Periodicals, Inc.

ULTRASTRUCTURE OF THE NUCLEOLUS DURING THE CHINESE HAMSTER CELL CYCLE

PubMed Central

Noel, J. S.; Dewey, W. C.; Abel, J. H.; Thompson, R. P.

1971-01-01

Changes in the structure of the nucleolus during the cell cycle of the Chinese hamster cell in vitro were studied. Quantitative electron microscopic techniques were used to establish the size and volume changes in nucleolar structures. In mitosis, nucleolar remnants, "persistent nucleoli," consisting predominantly of ribosome-like granular material, and a granular coating on the chromosomes were observed. Persistent nucleoli were also observed in some daughter nuclei as they were leaving telophase and entering G1. During very early G1, a dense, fibrous material characteristic of interphase nucleoli was noted in the nucleoplasm of the cells. As the cells progressed through G1, a granular component appeared which was intimately associated with the fibrous material. By the middle of G1, complete, mature nucleoli were present. The nucleolar volume enlarged by a factor of two from the beginning of G1 to the middle of S primarily due to the accumulation of the granular component. During the G2 period, there was a dissolution or breakdown of the nucleolus prior to the entry of the cells into mitosis. Correlations between the quantitative aspects of this study and biochemical and cytochemical data available in the literature suggest the following: nucleolar reformation following division results from the activation of the nucleolar organizer regions which transcribe for RNA first appearing in association with protein as a fibrous component (45S RNA) and then later as a granular component (28S and 32S RNA). PMID:4933472

The nucleolus in the mouse oocyte is required for the early step of both female and male pronucleus organization.

PubMed

OGUSHI, Sugako; SAITOU, Mitinori

2010-10-01

During oocyte growth in the ovary, the nucleolus is mainly responsible for ribosome biogenesis. However, in the fully-grown oocyte, all transcription ceases, including ribosomal RNA synthesis, and the nucleolus adopts a specific monotonous fibrillar morphology without chromatin. The function of this inactive nucleolus in oocytes and embryos is still unknown. We previously reported that the embryo lacking an inactive nucleolus failed to develop past the first few cleavages, indicating the requirement of a nucleolus for preimplantation development. Here, we reinjected the nucleolus into oocytes and zygotes without nucleoli at various time points to examine the timing of the nucleolus requirement during meiosis and early embryonic development. When we put the nucleolus back into oocytes lacking a nucleolus at the germinal vesicle (GV) stage and at second metaphase (MII), these oocytes were fertilized, formed pronuclei with nucleoli and developed to full term. When the nucleolus was reinjected at the pronucleus (PN) stage, most of the reconstructed zygotes cleaved and formed nuclei with nucleoli at the 2-cell stage, but the rate of blastocyst formation and the numbers of surviving pups were profoundly reduced. Moreover, the zygotes without nucleoli showed a disorder of higher chromatin organization not only in the female pronucleus but also, interestingly, in the male pronucleus. Thus, the critical time point when the nucleolus is required for progression of early embryonic development appears to be at the point of the early step of pronucleus organization.

Increased functional load on mouse kidney proximal tubule epithelial cells causes changes in nucleolar 3-D architecture.

PubMed

Chelidze, P V; Dzidziguri, D V; Tumanishvili, G D

1998-05-01

Ultrastructural 3-D analysis of nucleolar architecture and Ag-NOR protein distribution in mouse kidney-cortex proximal-tubule epithelium has been performed. A principal scheme of structural changes of the nucleolus and organization of its components during the intensification of pre-rRNA synthesis (dynamic model of a nucleolus) based on computer spatial modelling has been advanced. According to the nucleolar composition, three groups of cells, which differ from each other by rRNA synthesis, are defined in normal kidney. Most nephron proximal-section cells (about 52%) are characterized by lower activity of RNA synthesis. Such kind of cells are defined as group I (nucleolar diameter 0.7-1.5 microm) and always contain resting, ring-shaped or close to ring-shaped dense nucleoli, which have 2 or 3 fibrillar centers. Nucleoli of group II cells (about 37%, nucleolar diameter 1.5-2.5 microm) have a higher level of activity, contain 4-7 fibrillar centers, and their structural organization is close to reticulated forms due to the first indications of vacuolar network (identified as prereticulated nucleoli). The most active cells of group III (about 11%, nucleolar diameter 2.5-3.5 microm) include cells with typical reticulated nucleoli with a well expressed vacuolar network and numerous fibrillar centers (18-22). Increased functional load of the epithelium caused by unilateral nephrectomy and diuretic (4-chlor-H [2-furylmethyl] 5-sulphamyl-antranic acid) injection changed the proportion of the different cell groups: group I decreased (about 25%), whereas groups II and III increased (about 8% and 17%, respectively). The increase of nucleolar activity first causes a deformation of the individual fibrillar centers as well as complication and growth of their surface. Further, a progressive fragmentation of the fibrillar centers and the growth of their total volume is observed. The complication and growth of the total volume of Ag-positive zones is another indication of the nucleolar activation. The vacuolar system develops by a gradual fusion of small isolated cavities into a united vacuolar network. Nucleoli with 2-7 fibrillar centers are considered to be intermediate forms reflecting successive stages of its activation or inactivation: from the resting ring-shaped nucleolus via transient stages of increasing functional activity to the active reticulated nucleoli and vice versa. The observed differences in the nucleolar ultrastructure are regarded as evidence of the functional heterogeneity of cell populations within one functional segment of nephron.

The Cajal body and the nucleolus: "In a relationship" or "It's complicated"?

PubMed

Trinkle-Mulcahy, Laura; Sleeman, Judith E

2017-06-03

From their initial identification as 'nucleolar accessory bodies' more than a century ago, the relationship between Cajal bodies and nucleoli has been a subject of interest and controversy. In this review, we seek to place recent developments in the understanding of the physical and functional relationships between the 2 structures in the context of historical observations. Biophysical models of nuclear body formation, the molecular nature of CB/nucleolus interactions and the increasing list of joint roles for CBs and nucleoli, predominantly in assembling ribonucleoprotein (RNP) complexes, are discussed.

Effects of aluminum on nucleoli in root tip cells and selected physiological and biochemical characters in Allium cepa var. agrogarum L

PubMed Central

2010-01-01

Background Increased Al concentration causes reduction of mitotic activity, induction of nucleolar alteration, increase of the production of ROS and alteration of several antioxidant enzyme activities in plant cells. Allium cepa is an excellent plant and a useful biomarker for environmental monitoring. Limited information is available about the effects of Al on nucleoli, antioxidant enzyme system, contents of MDA and soluble protein in A. cepa. Therefore, we carried out the investigation in order to better understand the effects of Al on the growth, nucleoli in root tip cells and selected physiological and biochemical characters. Results The results showed that the root growth exposed to 50 μM Al was inhibited significantly. 50 μM Al could induce some particles of argyrophilic proteins scattered in the nuclei and extruded from the nucleoli into the cytoplasm. The nucleolus did not disaggregate normally and still remained its characteristic structure during metaphase. Nucleolar reconstruction was inhibited. 50 μM Al induced high activities of SOD and POD in leaves and roots significantly (P < 0.05) when compared with control, whereas the level of CAT was low significantly (P < 0.05). At 50 μM Al the content of MDA in leaves was high significantly (P < 0.05) at 9th day and in roots increased (P < 0.05) with prolonging the treatment time during 6-12 days. The soluble protein content in leaves treated with 50 μM Al was high significantly (P < 0.05) at 6th day and increased with prolonging the treatment time. Conclusions We suggest that variations in nucleoli and the alterations of antioxidant enzyme activities, MDA and soluble protein contents in Allium cepa can serve as useful biomarkers, which can provide valuable information for monitoring and forecasting effects of exposure to Al in real scenarios conditions. Among the antioxidant enzymes SOD and POD appear to play a key role in the antioxidant defense mechanism under Al toxicity condition. Data from MDA concentration show that Al indirectly produces superoxide radicals, resulting in increased lipid peroxidative products and oxidative stress. PMID:20964828

Effects of aluminum on nucleoli in root tip cells and selected physiological and biochemical characters in Allium cepa var. agrogarum L.

PubMed

Qin, Rong; Jiao, Yunqiu; Zhang, Shanshan; Jiang, Wusheng; Liu, Donghua

2010-10-21

Increased Al concentration causes reduction of mitotic activity, induction of nucleolar alteration, increase of the production of ROS and alteration of several antioxidant enzyme activities in plant cells. Allium cepa is an excellent plant and a useful biomarker for environmental monitoring. Limited information is available about the effects of Al on nucleoli, antioxidant enzyme system, contents of MDA and soluble protein in A. cepa. Therefore, we carried out the investigation in order to better understand the effects of Al on the growth, nucleoli in root tip cells and selected physiological and biochemical characters. The results showed that the root growth exposed to 50 μM Al was inhibited significantly. 50 μM Al could induce some particles of argyrophilic proteins scattered in the nuclei and extruded from the nucleoli into the cytoplasm. The nucleolus did not disaggregate normally and still remained its characteristic structure during metaphase. Nucleolar reconstruction was inhibited. 50 μM Al induced high activities of SOD and POD in leaves and roots significantly (P < 0.05) when compared with control, whereas the level of CAT was low significantly (P < 0.05). At 50 μM Al the content of MDA in leaves was high significantly (P < 0.05) at 9(th) day and in roots increased (P < 0.05) with prolonging the treatment time during 6-12 days. The soluble protein content in leaves treated with 50 μM Al was high significantly (P < 0.05) at 6(th) day and increased with prolonging the treatment time. We suggest that variations in nucleoli and the alterations of antioxidant enzyme activities, MDA and soluble protein contents in Allium cepa can serve as useful biomarkers, which can provide valuable information for monitoring and forecasting effects of exposure to Al in real scenarios conditions. Among the antioxidant enzymes SOD and POD appear to play a key role in the antioxidant defense mechanism under Al toxicity condition. Data from MDA concentration show that Al indirectly produces superoxide radicals, resulting in increased lipid peroxidative products and oxidative stress.

Interphase ribosomal RNA cistron staining in thyroid epithelial cells in Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland

PubMed Central

Mamaev, N N; Grynyeva, E N; Blagosklonnaya, Y V

1996-01-01

Aim—To evaluate the expression of ribosomal cistrons in human thyroid epithelial cells (TECs) of patients with Grave's disease, Hashimoto's thyroiditis and benign and malignant tumours of the thyroid gland. Methods—TEC nucleoli were investigated in fine needle biopsy specimens from 10 controls, 39 patients with Grave's disease, 15 with Hashimoto's thyroiditis, 56 with benign, and 15 with malignant tumours of the thyroid. A one step silver staining method was applied. In most cases serum concentrations of thyroxine and triiodothyronine as well as goitre size were determined. In every case 100 TECs were evaluated for the mean numbers of nucleoli and for the average number of argyrophilic nucleolar organiser regions (AgNORs) per nucleus. Results—NORs were activated in all patients, but not in controls. The numbers of AgNORs in patients with Grave's disease were closely correlated with thyroxine or triiodothyronine, or both, concentrations and with the size of the thyroid. In patients with Hashimoto's thyroiditis about 30% of TECs nucleoli did not contain AgNORs, whereas others were heavily impregnated with silver. Compared with controls and benign tumours, the nucleoli of carcinomatous TECs were larger and irregular in shape. The mean number of AgNORs per nucleus in malignant cells was higher than that in their benign counterparts. Conclusions—The mechanism by which NORs are activated in TECs varies depending on the type of lesion. The higher AgNOR score in TECs from malignant tumours can be used to distinguish them from their benign counterparts. Images PMID:16696083

Bidirectional nucleolar dysfunction in C9orf72 frontotemporal lobar degeneration.

PubMed

Mizielinska, Sarah; Ridler, Charlotte E; Balendra, Rubika; Thoeng, Annora; Woodling, Nathan S; Grässer, Friedrich A; Plagnol, Vincent; Lashley, Tammaryn; Partridge, Linda; Isaacs, Adrian M

2017-04-18

An intronic GGGGCC expansion in C9orf72 is the most common known cause of both frontotemporal lobar degeneration (FTLD) and amyotrophic lateral sclerosis (ALS). The repeat expansion leads to the generation of sense and antisense repeat RNA aggregates and dipeptide repeat (DPR) proteins, generated by repeat-associated non-ATG translation. The arginine-rich DPR proteins poly(glycine-arginine or GR) and poly(proline-arginine or PR) are potently neurotoxic and can localise to the nucleolus when expressed in cells, resulting in enlarged nucleoli with disrupted functionality. Furthermore, GGGGCC repeat RNA can bind nucleolar proteins in vitro. However, the relevance of nucleolar stress is unclear, as the arginine-rich DPR proteins do not localise to the nucleolus in C9orf72-associated FTLD/ALS (C9FTLD/ALS) patient brain. We measured nucleolar size in C9FTLD frontal cortex neurons using a three-dimensional, volumetric approach. Intriguingly, we found that C9FTLD brain exhibited bidirectional nucleolar stress. C9FTLD neuronal nucleoli were significantly smaller than control neuronal nucleoli. However, within C9FTLD brains, neurons containing poly(GR) inclusions had significantly larger nucleolar volumes than neurons without poly(GR) inclusions. In addition, expression of poly(GR) in adult Drosophila neurons led to significantly enlarged nucleoli. A small but significant increase in nucleolar volume was also observed in C9FTLD frontal cortex neurons containing GGGGCC repeat-containing RNA foci. These data show that nucleolar abnormalities are a consistent feature of C9FTLD brain, but that diverse pathomechanisms are at play, involving both DPR protein and repeat RNA toxicity.

Role of cytoskeleton in regulating fusion of nucleoli: a study using the activated mouse oocyte model.

PubMed

Lian, Hua-Yu; Jiao, Guang-Zhong; Wang, Hui-Li; Tan, Xiu-Wen; Wang, Tian-Yang; Zheng, Liang-Liang; Kong, Qiao-Qiao; Tan, Jing-He

2014-09-01

Although fusion of nucleoli was observed during pronuclear development of zygotes and the behavior of nucleoli in pronuclei has been suggested as an indicator of embryonic developmental potential, the mechanism for nucleolar fusion is unclear. Although both cytoskeleton and the nucleolus are important cellular entities, there are no special reports on the relationship between the two. Role of cytoskeleton in regulating fusion of nucleoli was studied using the activated mouse oocyte model. Mouse oocytes were cultured for 6 h in activating medium (Ca²⁺-free CZB medium containing 10 mM SrCl₂) supplemented with or without inhibitors for cytoskeleton or protein synthesis before pronuclear formation, nucleolar fusion, and the activity of maturation-promoting factor (MPF) were examined. Whereas treatment with microfilament inhibitor cytochalasin D or B or intermediate filament inhibitor acrylamide suppressed nucleolar fusion efficiently, treatment with microtubule inhibitor demecolcine or nocodazole or protein synthesis inhibitor cycloheximide had no effect. The cytochalasin D- or acrylamide-sensitive temporal window coincided well with the reported temporal window for nucleolar fusion in activated oocytes. Whereas a continuous incubation with demecolcine prevented pronuclear formation, pronuclei formed normally when demecolcine was excluded during the first hour of activation treatment when the MPF activity dropped dramatically. The results suggest that 1) microfilaments and intermediate filaments but not microtubules support nucleolar fusion, 2) proteins required for nucleolar fusion including microfilaments and intermediate filaments are not de novo synthesized, and 3) microtubule disruption prevents pronuclear formation by activating MPF. © 2014 by the Society for the Study of Reproduction, Inc.

Nucleolar structure and proliferation activity of Arabidopsis root cells from seedlings germinated on the International Space Station

NASA Astrophysics Data System (ADS)

Matía, Isabel; González-Camacho, Fernando; Marco, Roberto; Kiss, John Z.; Gasset, Gilbert; Medina, Francisco-Javier

Seeds of Arabidopsis thaliana were sent to the International Space Station in the "Cervantes Mission" (Spanish Soyuz Mission). Seed germination was initiated in flight by supplying culture medium. Seedlings were grown for 4 days at 22 °C, and growth was stopped by the addition of paraformaldehyde fixative. Once back on the ground, samples were immediately processed for microscopy. A ground control experiment was simultaneously replicated. Glutaraldehyde-fixed root cells from seedlings grown in the Biorack on board of the Space Shuttle (STS-84 Mission) in similar conditions were also ultrastructurally examined. The length of seedlings grown at 1 g was conspicuously shorter than parallel samples grown under microgravity. We examined the morphology of the root meristematic cells, with a focus on their nucleoli in the cortex and stele. In general, root cortical cells proliferate at a higher rate and their nucleoli are more active than those of stele cells. While the stele showed longer cells with larger nucleoli in the flight samples, cortical cells from space-grown seedlings were shorter, more numerous and more densely packed than ground controls. However, nucleoli were smaller and less active in fast proliferating flight cells than in the ground controls. This reduced level of ribosome synthesis in the flight samples is probably the result of an accelerated cell cycle. An altered rate of cell proliferation may be detrimental for the plant and could be the reason for the reported smaller size of older space-grown seedlings. Finally, two-dimensional protein electrophoresis showed noticeable differences between space samples and ground controls.

Cytochemical study of the nucleolus of the slime mold Dictyostelium discoideum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benichou, J.C.; Quiviger, B.; Ryter, A.

1983-07-01

The nucleus of the slime mold Dictyostelium discoideum is characterized by the presence of several large dense masses which are all in tight contact with the nuclear membrane. These dense masses, considered as nucleoli, present a rather homogeneous texture, in which dense chromatin, fibrillar, and granular material are not easily detected. The autoradiographic study of (/sup 3/H)uridine pulse-labeled cells showed that the majority of the silver grains were located inside these masses. The use of EDTA regressive-staining, acetylation and enzymatic digestion indicated that they are mostly composed of RNP and are totally devoid of dense chromatin as the rest ofmore » the nucleus is. After treatment with actinomycin D, fibrillar and granular material segregated but no chromatin could be found. All these observations confirmed that the dense masses correspond to nucleoli despite their peculiar ultrastructure. It can also be concluded that this type of nucleoli cannot be considered as a taxonomic character of the slime molds because it does not exist in all slime molds and was observed in some dinoflagellates, and ascomycetes.« less

Synthesis of RNA molecules larger than 45 S by isolated rat-liver nucleoli.

PubMed

Grummt, I

1975-09-01

Nucleoli, isolated from rat liver, synthesize in vitro high-molecular-weight RNA, the base composition and sedimentation pattern of which resembles that of ribosomal precursor RNA. In addition, RNA molecules larger than 45 S have been found. In this paper experiments are described which indicate that these large RNA molecules represent geniune transcription products and are not aggregates arising under the experimental conditions employed. This was established by comparing different extraction methods, by sedimentation analysis of the RNA after denaturation with formamide and by pulse-chase experiments. Hybridisation-competition studies showed that 45-S RNA competes with those rapidly molecules to about 80-90%, thus providing evidence for the presence of ribosomal precursor RNA sequences in those long transcription products. Intact nuclei are able to synthesize in the presence of Mg2+ and alpha-amanitin RNA molecules larger than 45 S too, provided that the RNAase activity is suppressed effectively by the addition of cytoplasmic RNAase inhibitor. The significance of these results is discussed with respect to the initial transcript of the rDNA genes in rat liver nucleoli.

TP53 supports basal-like differentiation of mammary epithelial cells by preventing translocation of deltaNp63 into nucleoli

NASA Astrophysics Data System (ADS)

Munne, Pauliina M.; Gu, Yuexi; Tumiati, Manuela; Gao, Ping; Koopal, Sonja; Uusivirta, Sanna; Sawicki, Janet; Wei, Gong-Hong; Kuznetsov, Sergey G.

2014-04-01

Multiple observations suggest a cell type-specific role for TP53 in mammary epithelia. We developed an in vitro assay, in which primary mouse mammary epithelial cells (mMECs) progressed from lumenal to basal-like phenotypes based on expression of Krt18 or ΔNp63, respectively. Such transition was markedly delayed in Trp53-/- mMECs suggesting that Trp53 is required for specification of the basal, but not lumenal cells. Evidence from human basal-like cell lines suggests that TP53 may support the activity of ΔNp63 by preventing its translocation from nucleoplasm into nucleoli. In human lumenal cells, activation of TP53 by inhibiting MDM2 or BRCA1 restored the nucleoplasmic expression of ΔNp63. Trp53-/- mMECs eventually lost epithelial features resulting in upregulation of MDM2 and translocation of ΔNp63 into nucleoli. We propose that TP63 may contribute to TP53-mediated oncogenic transformation of epithelial cells and shed light on tissue- and cell type-specific biases observed for TP53-related cancers.

Dynamics of the DNA repair proteins WRN and BLM in the nucleoplasm and nucleoli.

PubMed

Bendtsen, Kristian Moss; Jensen, Martin Borch; May, Alfred; Rasmussen, Lene Juel; Trusina, Ala; Bohr, Vilhelm A; Jensen, Mogens H

2014-11-01

We have investigated the mobility of two EGFP-tagged DNA repair proteins, WRN and BLM. In particular, we focused on the dynamics in two locations, the nucleoli and the nucleoplasm. We found that both WRN and BLM use a "DNA-scanning" mechanism, with rapid binding-unbinding to DNA resulting in effective diffusion. In the nucleoplasm WRN and BLM have effective diffusion coefficients of 1.62 and 1.34 μm(2)/s, respectively. Likewise, the dynamics in the nucleoli are also best described by effective diffusion, but with diffusion coefficients a factor of ten lower than in the nucleoplasm. From this large reduction in diffusion coefficient we were able to classify WRN and BLM as DNA damage scanners. In addition to WRN and BLM we also classified other DNA damage proteins and found they all fall into one of two categories. Either they are scanners, similar to WRN and BLM, with very low diffusion coefficients, suggesting a scanning mechanism, or they are almost freely diffusing, suggesting that they interact with DNA only after initiation of a DNA damage response.

TP53 supports basal-like differentiation of mammary epithelial cells by preventing translocation of deltaNp63 into nucleoli.

PubMed

Munne, Pauliina M; Gu, Yuexi; Tumiati, Manuela; Gao, Ping; Koopal, Sonja; Uusivirta, Sanna; Sawicki, Janet; Wei, Gong-Hong; Kuznetsov, Sergey G

2014-04-11

Multiple observations suggest a cell type-specific role for TP53 in mammary epithelia. We developed an in vitro assay, in which primary mouse mammary epithelial cells (mMECs) progressed from lumenal to basal-like phenotypes based on expression of Krt18 or ΔNp63, respectively. Such transition was markedly delayed in Trp53(-/-) mMECs suggesting that Trp53 is required for specification of the basal, but not lumenal cells. Evidence from human basal-like cell lines suggests that TP53 may support the activity of ΔNp63 by preventing its translocation from nucleoplasm into nucleoli. In human lumenal cells, activation of TP53 by inhibiting MDM2 or BRCA1 restored the nucleoplasmic expression of ΔNp63. Trp53(-/-) mMECs eventually lost epithelial features resulting in upregulation of MDM2 and translocation of ΔNp63 into nucleoli. We propose that TP63 may contribute to TP53-mediated oncogenic transformation of epithelial cells and shed light on tissue- and cell type-specific biases observed for TP53-related cancers.

Effects of creatine and its analog, β-guanidinopropionic acid, on the differentiation of and nucleoli in myoblasts.

PubMed

Ohira, Yoshinobu; Matsuoka, Yoshikazu; Kawano, Fuminori; Ogura, Akihiko; Higo, Yoko; Ohira, Takashi; Terada, Masahiro; Oke, Yoshihiko; Nakai, Naoya

2011-01-01

The effects of supplementation with creatine (Cr) and its analog, β-guanidinopropionic acid (β-GPA), on the differentiation of myoblasts and the numbers of nucleoli were studied in C2C12 cells. The cells were cultured in differentiation medium for 4 d. Then Cr (1 mM) or β-GPA (1 mM) was added to the cells, and the mixture was cultured for an additional 2 d. Although the number of myotubes was not different among the groups, myotube diameters and nuclear numbers in myotubes were increased by Cr and β-GPA treatment respectively. The expression of differentiation marker proteins, myogenin, and the myosine heavy chain, was increased in the β-GPA group. Supplementation with β-GPA also increased the percentage of p21 (inhibitor for cell cycle progression)-positive myoblasts. Supplementation with Cr inhibited the decrease in nucleoli numbers, whereas β-GPA increased nucleolar sizes in the myotubes. These results suggest that β-GPA supplementation stimulated the differentiation of myoblasts into multi-nucleated myotubes through induction of p21 expression.

Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells.

PubMed

Kwon, Ilmin; Xiang, Siheng; Kato, Masato; Wu, Leeju; Theodoropoulos, Pano; Wang, Tao; Kim, Jiwoong; Yun, Jonghyun; Xie, Yang; McKnight, Steven L

2014-09-05

Many RNA regulatory proteins controlling pre-messenger RNA splicing contain serine:arginine (SR) repeats. Here, we found that these SR domains bound hydrogel droplets composed of fibrous polymers of the low-complexity domain of heterogeneous ribonucleoprotein A2 (hnRNPA2). Hydrogel binding was reversed upon phosphorylation of the SR domain by CDC2-like kinases 1 and 2 (CLK1/2). Mutated variants of the SR domains changing serine to glycine (SR-to-GR variants) also bound to hnRNPA2 hydrogels but were not affected by CLK1/2. When expressed in mammalian cells, these variants bound nucleoli. The translation products of the sense and antisense transcripts of the expansion repeats associated with the C9orf72 gene altered in neurodegenerative disease encode GRn and PRn repeat polypeptides. Both peptides bound to hnRNPA2 hydrogels independent of CLK1/2 activity. When applied to cultured cells, both peptides entered cells, migrated to the nucleus, bound nucleoli, and poisoned RNA biogenesis, which caused cell death. Copyright © 2014, American Association for the Advancement of Science.

[The cytogenetic monitoring of the environmental conditions on the territories exposed by the radioactive contamination as a result of Chernobyl Nuclear Power Station accident (colony Urazovo Belgorod region as an example)].

PubMed

Artiukhov, V G; Kalaev, V N

2006-01-01

Cytogenetic characteristics of the seed progeny of birch (Betula pendula Roth), growing in colony Urazovo Belgorod region exposed by the impact of Chernobyl precipitation in 1986, were determinated. The changing of cytogenetic characteristics in comparison with the control (mitotic index and level of mitosis pathologies grown, their spectrum widens part of persistent nucleolies at the stages of metaphase, anaphase, telophase of mitosis enlarges, square of surface of single nucleolies decreases, part of moderate-active nucleolies "bark-core vacuolisated" type increase) on the experimental squares is revealed. The most considerable effects were observed in 2000, which connected with the increasing of the contaminations of mentioned territory as a result of brick factory work. By means of cluster analysis methods it was established that the cleanest in northwestern part of colony Urazovo, the most contaminated is central part. It was purposed, that chemical compounds, are main agents caused the changing of cytogenetic properties of test-object after the normalization of the radiation level.

[Analysis of fragments of intergenome spacers of human body observed in chromosomes containing no nuclear organization].

PubMed

Kupriyanova, N S; Nechvolodov, K K; Korsunenko, A V

2014-01-01

Tandem repetitions of rDNA provide so-called nuclear organizations (NOR). On the other hand, rDNA-structures are observed in some NOR chromosomes. It was demonstrated that, in addition to ribosome biogenesis, nucleoli provided a number of functions: cell cycle regulation, stress-induced response, transcription regulation, which often induced cell cascades. The mechanisms of the induction of rDNA segments in NOR chromosomes are obscure and require further research. About 1/3 repetitions are associated with nucleoli and SINE/Alu repetitions, homogeneous repetition, and tandem repetition. Perhaps, relative position of nucleoli and chromosomes may facilitate/prevent interaction of chromosomes with rDNA clusters. The variability of two larger repetitions in the central part of rMGS, LR1, and LR2 similar by -90% and separated by several hundred pairs of bases from each other was studied in our previous works. This work was devoted to the search for the LR1-LR2 segments in other chromosomes, characterization of their terminal tips at rupture points and genome areas of incorporation of the LR1-LR2 segments.

Spatiotemporal behavior of nuclear cyclophilin B indicates a role in RNA transcription.

PubMed

Dieriks, Birger; Van Oostveldt, Patrick

2012-06-01

Cyclophilin B (CypB) is an ubiquitously expressed protein, which performs several intra- and extracellular functions. Despite its abundant use as a household protein, little is known about its exact cellular localization and dynamics. In the present study we show that endogenous CypB localizes in one of two distinct compartments, either within the endoplasmic reticulum (ER) or inside the nucleus, accumulating in the fibrillar centers of the nucleoli. By means of a genetic deletion screen, we identified a minimal nucleolar localization signal for efficient relocation to the nucleoli. Within the fibrillar centers, CypB colocalized with RNA polymerase, upstream binding factor-1 (UBF), fibrillarin and dyskerin (DCK1). Even after chemical disruption of the nucleoli, a strong interaction with these proteins remained. Using live cell imaging, we showed a persistent colocalization of CypB with proteins involved in the ribosome biogenesis during the transcriptionally more active phases of the cell cycle. Supported by in silico data, our observations suggest that CypB interacts with these proteins and is involved in ribosome biogenesis and RNA transcription.

The Cajal body and the nucleolus: “In a relationship” or “It's complicated”?

PubMed Central

2017-01-01

ABSTRACT From their initial identification as ‘nucleolar accessory bodies’ more than a century ago, the relationship between Cajal bodies and nucleoli has been a subject of interest and controversy. In this review, we seek to place recent developments in the understanding of the physical and functional relationships between the 2 structures in the context of historical observations. Biophysical models of nuclear body formation, the molecular nature of CB/nucleolus interactions and the increasing list of joint roles for CBs and nucleoli, predominantly in assembling ribonucleoprotein (RNP) complexes, are discussed. PMID:27661468

Nucleolar molecular signature of pluripotent stem cells.

PubMed

Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Jiang, Houbo; Hu, Zhixing; Ren, Yong; Feng, Jian; Prasad, Paras N

2013-04-02

Induced pluripotent stem cells (iPSC) are generated by reprogramming somatic cells to the pluripotent state. Identification and quantitative characterization of changes in the molecular organization of the cell during the process of cellular reprogramming is valuable for stem cell research and advancement of its therapeutic applications. Here we employ quantitative Raman microspectroscopy and biomolecular component analysis (BCA) for a comparative analysis of the molecular composition of nucleoli in skin fibroblasts and iPSC derived from them. We report that the cultured fibroblasts obtained from different human subjects, share comparable concentrations of proteins, RNA, DNA, and lipids in the molecular composition of nucleoli. The nucleolar molecular environment is drastically changed in the corresponding iPSC. We measured that the transition from skin fibroblasts to iPSC is accompanied by a statistically significant increase in protein concentrations ~1.3-fold, RNA concentrations ~1.3-fold, and DNA concentrations ~1.4-fold, while no statistically significant difference was found for the lipid concentrations. The analysis of molecular vibrations associated with diverse aminoacids and protein conformations indicates that nucleoli of skin fibroblasts contain similar subsets of proteins, with prevalence of tyrosine. In iPSC, we observed a higher signal from tryptophan with an increase in the random coil and α helix protein conformations, indicating changes in the subset of nucleolar proteins during cell reprogramming. At the same time, the concentrations of major types of macromolecules and protein conformations in the nucleoli of iPSC and human embryonic stem cells (hESC) were found to be similar. We discuss these results in the context of nucleolar function and conclude that the nucleolar molecular content is correlated with the cellular differentiation status. The approach described here shows the potential for spectroscopically monitoring changes in macromolecular organization of the cell at different stages of reprogramming.

CARM1 modulators affect epigenome of stem cells and change morphology of nucleoli.

PubMed

Franek, M; Legartová, S; Suchánková, J; Milite, C; Castellano, S; Sbardella, G; Kozubek, S; Bártová, E

2015-01-01

CARM1 interacts with numerous transcription factors to mediate cellular processes, especially gene expression. This is important for the maintenance of ESC pluripotency or intervention to tumorigenesis. Here, we studied epigenomic effects of two potential CARM1 modulators: an activator (EML159) and an inhibitor (ellagic acid dihydrate, EA). We examined nuclear morphology in human and mouse embryonic stem cells (hESCs, mESCs), as well as in iPS cells. The CARM1 modulators did not function similarly in all cell types. EA decreased the levels of the pluripotency markers, OCT4 and NANOG, particularly in iPSCs, whereas the levels of these proteins increased after EML159 treatment. EML159 treatment of mouse ESCs led to decreased levels of OCT4 and NANOG, which was accompanied by an increased level of Endo-A. The same trend was observed for NANOG and Endo-A in hESCs affected by EML159. Interestingly, EA mainly changed epigenetic features of nucleoli because a high level of arginine asymmetric di-methylation in the nucleoli of hESCs was reduced after EA treatment. ChIP-PCR of ribosomal genes confirmed significantly reduced levels of H3R17me2a, in both the promoter region of ribosomal genes and rDNA encoding 28S rRNA, after EA addition. Moreover, EA treatment changed the nuclear pattern of AgNORs (silver-stained nucleolus organizer regions) in all cell types studied. In EA-treated ESCs, AgNOR pattern was similar to the pattern of AgNORs after inhibition of RNA pol I by actinomycin D. Together, inhibitory effect of EA on arginine methylation and effect on related morphological parameters was especially observed in compartment of nucleoli.

Organotin Dyes Bearing Anionic Boron Clusters as Cell-Staining Fluorescent Probes.

PubMed

Muñoz-Flores, Blanca M; Cabrera-González, Justo; Viñas, Clara; Chávez-Reyes, Arturo; Dias, H V Rasika; Jiménez-Pérez, Víctor M; Núñez, Rosario

2018-04-11

Within the cell nucleus, in the nucleoli, ribosomal RNAs are synthesized and participate in several biological processes. To better understand nucleoli-related processes, their visualization is often required, for which specific markers are needed. Herein, we report the design of novel fluorescent organotin compounds derived from 4-hydroxy-N'-((2-hydroxynaphthalen-1-yl)methylene)benzohydrazide and their cytoplasm and nucleoli staining of B16F10 cells in vitro. Tin compounds bearing an aliphatic carbon chain (-C 12 H 25 ) and an electron-donating group (-OH) were prepared, and the latter could be derivatized to bear the boron cluster anions [B 12 H 12 ] 2- and [3,3'-Co(1,2-C 2 B 9 H 11 ) 2 ] - (COSAN). All of the conjugates have been fully characterized and their luminescence properties have been assessed. In general, they show good quantum yields in solution (24-49 %), those for the COSAN derivatives being lower. Remarkably, the linking of [B 12 H 12 ] 2- and COSAN to the complexes made them more soluble, without being detrimental to their luminescence properties. Living B16F10 cells were treated with all of the compounds to determine their fluorescence staining properties; the compounds bearing the aliphatic chain showed a reduced staining capacity due to the formation of aggregates. Notably, the complexes bearing different boron clusters showed different staining effects; those bearing [B 12 H 12 ] 2- showed extraordinary staining of the nucleoli and cytoplasm, whereas those bearing COSAN were only detected in the cytoplasm. The remarkable fluorescence staining properties shown by these organotin compounds make them excellent candidates for fluorescence bioimaging in vitro. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Pharmacological AMP Kinase Activators Target the Nucleolar Organization and Control Cell Proliferation

PubMed Central

Kodiha, Mohamed; Salimi, Ali; Wang, Yi Meng; Stochaj, Ursula

2014-01-01

Aims Phenformin, resveratrol and AICAR stimulate the energy sensor 5′-AMP activated kinase (AMPK) and inhibit the first step of ribosome biogenesis, de novo RNA synthesis in nucleoli. Nucleolar activities are relevant to human health, because ribosome production is crucial to the development of diabetic complications. Although the function of nucleoli relies on their organization, the impact of AMPK activators on nucleolar structures is not known. Here, we addressed this question by examining four nucleolar proteins that are essential for ribosome biogenesis. Methods Kidney cells were selected as model system, because diabetic nephropathy is one of the complications associated with diabetes mellitus. To determine the impact of pharmacological agents on nucleoli, we focused on the subcellular and subnuclear distribution of B23/nucleophosmin, fibrillarin, nucleolin and RPA194. This was achieved by quantitative confocal microscopy at the single-cell level in combination with cell fractionation and quantitative Western blotting. Results AMPK activators induced the re-organization of nucleoli, which was accompanied by changes in cell proliferation. Among the compounds tested, phenformin and resveratrol had the most pronounced impact on nucleolar organization. For B23, fibrillarin, nucleolin and RPA194, both agents (i) altered the nucleocytoplasmic distribution and nucleolar association and (ii) reduced significantly the retention in the nucleus. (iii) Phenformin and resveratrol also increased significantly the total concentration of B23 and nucleolin. Conclusions AMPK activators have unique effects on the subcellular localization, nuclear retention and abundance of nucleolar proteins. We propose that the combination of these events inhibits de novo ribosomal RNA synthesis and modulates cell proliferation. Our studies identified nucleolin as a target that is especially sensitive to pharmacological AMPK activators. Because of its response to pharmacological agents, nucleolin represents a potential biomarker for the development of drugs that diminish diabetic renal hypertrophy. PMID:24498249

Pharmacological AMP kinase activators target the nucleolar organization and control cell proliferation.

PubMed

Kodiha, Mohamed; Salimi, Ali; Wang, Yi Meng; Stochaj, Ursula

2014-01-01

Phenformin, resveratrol and AICAR stimulate the energy sensor 5'-AMP activated kinase (AMPK) and inhibit the first step of ribosome biogenesis, de novo RNA synthesis in nucleoli. Nucleolar activities are relevant to human health, because ribosome production is crucial to the development of diabetic complications. Although the function of nucleoli relies on their organization, the impact of AMPK activators on nucleolar structures is not known. Here, we addressed this question by examining four nucleolar proteins that are essential for ribosome biogenesis. Kidney cells were selected as model system, because diabetic nephropathy is one of the complications associated with diabetes mellitus. To determine the impact of pharmacological agents on nucleoli, we focused on the subcellular and subnuclear distribution of B23/nucleophosmin, fibrillarin, nucleolin and RPA194. This was achieved by quantitative confocal microscopy at the single-cell level in combination with cell fractionation and quantitative Western blotting. AMPK activators induced the re-organization of nucleoli, which was accompanied by changes in cell proliferation. Among the compounds tested, phenformin and resveratrol had the most pronounced impact on nucleolar organization. For B23, fibrillarin, nucleolin and RPA194, both agents (i) altered the nucleocytoplasmic distribution and nucleolar association and (ii) reduced significantly the retention in the nucleus. (iii) Phenformin and resveratrol also increased significantly the total concentration of B23 and nucleolin. AMPK activators have unique effects on the subcellular localization, nuclear retention and abundance of nucleolar proteins. We propose that the combination of these events inhibits de novo ribosomal RNA synthesis and modulates cell proliferation. Our studies identified nucleolin as a target that is especially sensitive to pharmacological AMPK activators. Because of its response to pharmacological agents, nucleolin represents a potential biomarker for the development of drugs that diminish diabetic renal hypertrophy.

Method for observation of deembedded sections of fish gonad by scanning electron microscopy

NASA Astrophysics Data System (ADS)

Mao, Lian-Ju

2000-09-01

This article reports a method for examining the intracellular structure of fish gonads using a scanning electron microscope(SEM). The specimen preparation procedure is similar to that for transmission electron microscopy wherein samples cut into semi-thin sections are fixed and embedded in plastic. The embedment matrix was removed by solvents. Risen-free specimens could be observed by SEM. The morphology of matured sperms in the gonad was very clear, and the oocyte internal structures appeared in three-dimensional images. Spheroidal nucleoli and yolk vesicles and several bundles of filaments adhered on the nucleoli could be viewed by SEM for the first time.

Three-dimensional architecture of ribosomal DNA within barley nucleoli revealed with electron microscopy.

PubMed

Iwano, Megumi; Che, Fang-Sik; Takayama, Seiji; Fukui, Kiichi; Isogai, Akira

2003-01-01

To elucidate the topological positioning of ribosomal RNA genes (rDNA) and nucleolar structure in three dimensions, we examined the localization of rDNA using in situ hybridization (ISH) analysis by scanning electron microscopy (SEM). The rDNA genes within the three-dimensional architecture of nucleoli were detected on chromatin fibers that connect a thick strand-like structure and a protrusion of rDNA into the inner nuclear hole where the nucleolus is formed. This novel use of ISH together with SEM is useful for the analysis of nucleolar structure in detail. Furthermore, rDNA was detected at the periphery of the fibrillar centers (FCs) of the nucleolus using immuno-gold labeling together with transmission electron microscopy (TEM). In situ hybridization with TEM confirmed that rDNA is naked and thus active in the FCs of nucleoli; ISH with SEM confirmed that rDNA is not covered with ribonucleo proteins at the protruding point and is thus inactive. We also show that the distribution pattern of FCs differs from sample to sample. These results indicate that rDNA is transcribed dynamically in a time- and region-specific manner over the course of the cell cycle.

Neural Differentiation in HDAC1-Depleted Cells Is Accompanied by Coilin Downregulation and the Accumulation of Cajal Bodies in Nucleoli.

PubMed

Krejčí, Jana; Legartová, Soňa; Bártová, Eva

2017-01-01

Cajal bodies (CBs) are important compartments containing accumulated proteins that preferentially regulate RNA-related nuclear events, including splicing. Here, we studied the nuclear distribution pattern of CBs in neurogenesis. In adult brains, coilin was present at a high density, but CB formation was absent in the nuclei of the choroid plexus of the lateral ventricles. Cells of the adult hippocampus were characterized by a crescent-like morphology of coilin protein. We additionally observed a 70 kDa splice variant of coilin in adult mouse brains, which was different to embryonic brains and mouse pluripotent embryonic stem cells (mESCs), characterized by the 80 kDa standard variant of coilin. Here, we also showed that depletion of coilin is induced during neural differentiation and HDAC1 deficiency in mESCs caused coilin accumulation inside the fibrillarin-positive region of the nucleoli. A similar distribution pattern was observed in adult brain hippocampi, characterized by lower levels of both coilin and HDAC1. In summary, we observed that neural differentiation and HDAC1 deficiency lead to coilin depletion and coilin accumulation in body-like structures inside the nucleoli.

TP53 supports basal-like differentiation of mammary epithelial cells by preventing translocation of deltaNp63 into nucleoli

PubMed Central

Munne, Pauliina M.; Gu, Yuexi; Tumiati, Manuela; Gao, Ping; Koopal, Sonja; Uusivirta, Sanna; Sawicki, Janet; Wei, Gong-Hong; Kuznetsov, Sergey G.

2014-01-01

Multiple observations suggest a cell type-specific role for TP53 in mammary epithelia. We developed an in vitro assay, in which primary mouse mammary epithelial cells (mMECs) progressed from lumenal to basal-like phenotypes based on expression of Krt18 or ΔNp63, respectively. Such transition was markedly delayed in Trp53−/− mMECs suggesting that Trp53 is required for specification of the basal, but not lumenal cells. Evidence from human basal-like cell lines suggests that TP53 may support the activity of ΔNp63 by preventing its translocation from nucleoplasm into nucleoli. In human lumenal cells, activation of TP53 by inhibiting MDM2 or BRCA1 restored the nucleoplasmic expression of ΔNp63. Trp53−/− mMECs eventually lost epithelial features resulting in upregulation of MDM2 and translocation of ΔNp63 into nucleoli. We propose that TP63 may contribute to TP53-mediated oncogenic transformation of epithelial cells and shed light on tissue- and cell type-specific biases observed for TP53-related cancers. PMID:24722541

Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III–transcribed genes in budding yeast

PubMed Central

Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

2016-01-01

The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135

C1q Protein Binds to the Apoptotic Nucleolus and Causes C1 Protease Degradation of Nucleolar Proteins*

PubMed Central

Cai, Yitian; Teo, Boon Heng Dennis; Yeo, Joo Guan; Lu, Jinhua

2015-01-01

In infection, complement C1q recognizes pathogen-congregated antibodies and elicits complement activation. Among endogenous ligands, C1q binds to DNA and apoptotic cells, but whether C1q binds to nuclear DNA in apoptotic cells remains to be investigated. With UV irradiation-induced apoptosis, C1q initially bound to peripheral cellular regions in early apoptotic cells. By 6 h, binding concentrated in the nuclei to the nucleolus but not the chromatins. When nucleoli were isolated from non-apoptotic cells, C1q also bound to these structures. In vivo, C1q exists as the C1 complex (C1qC1r2C1s2), and C1q binding to ligands activates the C1r/C1s proteases. Incubation of nucleoli with C1 caused degradation of the nucleolar proteins nucleolin and nucleophosmin 1. This was inhibited by the C1 inhibitor. The nucleoli are abundant with autoantigens. C1q binding and C1r/C1s degradation of nucleolar antigens during cell apoptosis potentially reduces autoimmunity. These findings help us to understand why genetic C1q and C1r/C1s deficiencies cause systemic lupus erythematosus. PMID:26231209

All Small Nuclear RNAs (snRNAs) of the [U4/U6.U5] Tri-snRNP Localize to Nucleoli; Identification of the Nucleolar Localization Element of U6 snRNA

PubMed Central

Gerbi, Susan A.; Lange, Thilo Sascha

2002-01-01

Previously, we showed that spliceosomal U6 small nuclear RNA (snRNA) transiently passes through the nucleolus. Herein, we report that all individual snRNAs of the [U4/U6.U5] tri-snRNP localize to nucleoli, demonstrated by fluorescence microscopy of nucleolar preparations after injection of fluorescein-labeled snRNA into Xenopus oocyte nuclei. Nucleolar localization of U6 is independent from [U4/U6] snRNP formation since sites of direct interaction of U6 snRNA with U4 snRNA are not nucleolar localization elements. Among all regions in U6, the only one required for nucleolar localization is its 3′ end, which associates with the La protein and subsequently during maturation of U6 is bound by Lsm proteins. This 3′-nucleolar localization element of U6 is both essential and sufficient for nucleolar localization and also required for localization to Cajal bodies. Conversion of the 3′ hydroxyl of U6 snRNA to a 3′ phosphate prevents association with the La protein but does not affect U6 localization to nucleoli or Cajal bodies. PMID:12221120

Remodelling of three-dimensional organization of the nucleus during terminal keratinocyte differentiation in the epidermis

PubMed Central

Gdula, Michal R.; Poterlowicz, Krzysztof; Mardaryev, Andrei N.; Sharov, Andrey A.; Peng, Y.; Fessing, Michael Y.; Botchkarev, Vladimir A.

2014-01-01

The nucleus of epidermal keratinocytes is a complex and highly compartmentalized organelle, whose structure is markedly changed during terminal differentiation and transition of the genome from a transcriptionally active state seen in the basal and spinous epidermal cells to a fully inactive state in the keratinized cells of the cornified layer. Here, using multi-color confocal microscopy, followed by computational image analysis and mathematical modelling, we demonstrate that in normal mouse foot-pad epidermis transition of keratinocytes from basal epidermal layer to the granular layer is accompanied by marked differences in nuclear architecture and micro-environment including: i) decrease of the nuclear volume, ii) decrease in expression of the markers of transcriptionally-active chromatin; iii) internalization and decrease in the number of nucleoli; iv) increase in the number of pericentromeric heterochromatic clusters; v) increase in the frequency of associations between pericentromeric clusters, chromosomal territory 3, and nucleoli. These data suggest a role for nucleoli and pericentromeric heterochromatin clusters as organizers of nuclear micro-environment required for proper execution of gene expression programs in differentiating keratinocytes and provide important background information for further analyses of alterations in the topological genome organization seen in pathological skin conditions including disorders of epidermal differentiation and epidermal tumors. PMID:23407401

High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

PubMed Central

van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

2010-01-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

PubMed

van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

2010-11-01

The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

PubMed

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its cellular functions.

Raptor, a positive regulatory subunit of mTOR complex 1, is a novel phosphoprotein of the rDNA transcription machinery in nucleoli and chromosomal nucleolus organizer regions (NORs).

PubMed

Vazquez-Martin, Alejandro; Cufí, Sílvia; Oliveras-Ferraros, Cristina; Menendez, Javier A

2011-09-15

Raptor is the key scaffolding protein that recruits mTOR substrates to rapamycin-sensitive mTOR complex 1 (mTORC1), a molecular integrator of mitogenic and nutrient/energy environmental inputs into protein translation and cell growth. Although Raptor phosphorylation on various sites is pivotal in the regulation of mTORC1 activity, it remains to be elucidated whether site-specific phosphorylation differentially distributes Raptor to unique subcellular compartments. When exploring the spatiotemporal cell cycle dynamics of six different phospho (P)-Raptor isoforms (Thr ( 706) , Ser ( 722) , Ser ( 863) , Ser ( 792) and Ser ( 877) ), a number of remarkable events differentially defined a topological resetting of P-RaptorThr706 on interphasic and mitotic chromosomes. In interphase nuclei, P-Raptor (Thr706) co-localized with fibrillarin, a component of the nucleolar small nuclear ribonucleoprotein particle, as well as with RNA polymerase I, the enzyme that transcribes nucleolar rRNA. Upon Actinomycin D-induced nucleolar segregation and disaggregation, P-RaptorThr706 was excluded from the nucleolus to accumulate at discrete nucleoplasmic bodies. During mitosis, CDK1 inhibition-induced premature assembly of nucleoli relocated fibrillarin to the surrounding regions of chromosomal-associated P-Raptor (Thr706) , suggesting that a subpopulation of mitotic P-Raptor (Thr706) remained targeted at chromosomal loops of rDNA or nuclear organizer regions (NORs). At the end of mitosis and cytokinesis, when reassembly of incipient nucleoli begins upon NORs activation of rDNA transcription, fibrillarin spatially reorganized with P-Raptor (Thr706) to give rise to daughter nucleoli. Treatment with IGF1 exclusively hyperactivated nuclear P-Raptor (Ser706) and concomitantly promoted Ser ( 2481) autophosphorylation of mTOR, which monitors mTORC1-associated catalytic activity. Nucleolar- and NOR-associated P-Raptor (Ser706) may physically link mTORC1 signaling to ever-growing nucleolus plurifunctionality including ribosome biogenesis, cell stress sensor and cell cycle/aging control.

Use of cryostat sections from snap-frozen nervous tissue for combining stereological estimates with histological, cellular, or molecular analyses on adjacent sections.

PubMed

Schmitz, C; Dafotakis, M; Heinsen, H; Mugrauer, K; Niesel, A; Popken, G J; Stephan, M; Van de Berg, W D; von Hörsten, S; Korr, H

2000-10-01

Adequate tissue preparation is essential for both modern stereological and immunohistochemical investigations. However, combining these methodologies in a single study presents a number of obstacles pertaining to optimal histological preparation. Tissue shrinkage and loss of nuclei/nucleoli from the unprotected section surfaces of unembedded tissue used for immunohistochemistry may be problematic with regard to adequate stereological design. In this study, frozen cryostat sections from hippocampal and cerebellar regions of two rat strains and cerebellar and cerebral regions from a human brain were analyzed to determine the potential impact of these factors on estimates of neuron number obtained using the optical disector. Neuronal nuclei and nucleoli were clearly present in thin sections of snap-frozen rat (3 microm) and human (6 microm) tissue, indicating that neuronal nuclei/nucleoli are not unavoidably lost from unprotected section surfaces of unembedded tissue. In order to quantify the potential impact of any nuclear loss, optical fractionator estimates of rat hippocampal pyramidal cells in areas CA1-3 and cerebellar granule and Purkinje cells were made using minimal (1 microm) upper guard zones. Estimates did not differ from data reported previously in the literature. This data indicates that cryostat sections of snap-frozen nervous tissue may successfully be used for estimating total neuronal numbers using optical disectors.

L-Ilf3 and L-NF90 Traffic to the Nucleolus Granular Component: Alternatively-Spliced Exon 3 Encodes a Nucleolar Localization Motif

PubMed Central

Viranaicken, Wildriss; Gasmi, Laila; Chaumet, Alexandre; Durieux, Christiane; Georget, Virginie; Denoulet, Philippe; Larcher, Jean-Christophe

2011-01-01

Ilf3 and NF90, two proteins containing double-stranded RNA-binding domains, are generated by alternative splicing and involved in several functions. Their heterogeneity results from posttranscriptional and posttranslational modifications. Alternative splicing of exon 3, coding for a 13 aa N-terminal motif, generates for each protein a long and short isoforms. Subcellular fractionation and localization of recombinant proteins showed that this motif acts as a nucleolar localization signal. Deletion and substitution mutants identified four arginines, essential for nucleolar targeting, and three histidines to stabilize the proteins within the nucleolus. The short isoforms are never found in the nucleoli, whereas the long isoforms are present in the nucleoplasm and the nucleoli. For Ilf3, only the posttranslationally-unmodified long isoform is nucleolar, suggesting that this nucleolar targeting is abrogated by posttranslational modifications. Confocal microscopy and FRAP experiments have shown that the long Ilf3 isoform localizes to the granular component of the nucleolus, and that L-Ilf3 and L-NF90 exchange rapidly between nucleoli. The presence of this 13 aminoacid motif, combined with posttranslational modifications, is responsible for the differences in Ilf3 and NF90 isoforms subcellular localizations. The protein polymorphism of Ilf3/NF90 and the various subcellular localizations of their isoforms may partially explain the various functions previously reported for these proteins. PMID:21811582

Chromatin tethering effects of hNopp140 are involved in the spatial organization of nucleolus and the rRNA gene transcription

PubMed Central

Tsai, Yi-Tzang; Lin, Chen-I; Chen, Hung-Kai; Lee, Kuo-Ming; Hsu, Chia-Yi; Yang, Shun-Jen

2008-01-01

The short arms of five human acrocentric chromosomes contain ribosomal gene (rDNA) clusters where numerous mini-nucleoli arise at the exit of mitosis. These small nucleoli tend to coalesce into one or a few large nucleoli during interphase by unknown mechanisms. Here, we demonstrate that the N- and C-terminal domains of a nucleolar protein, hNopp140, bound respectively to α-satellite arrays and rDNA clusters of acrocentric chromosomes for nucleolar formation. The central acidic-and-basic repeated domain of hNopp140, possessing a weak self-self interacting ability, was indispensable for hNopp140 to build up a nucleolar round-shaped structure. The N- or the C-terminally truncated hNopp140 caused nucleolar segregation and was able to alter locations of the rDNA transcription, as mediated by detaching the rDNA repeats from the acrocentric α-satellite arrays. Interestingly, an hNopp140 mutant, made by joining the N- and C-terminal domains but excluding the entire central repeated region, induced nucleolar disruption and global chromatin condensation. Furthermore, RNAi knockdown of hNopp140 resulted in dispersion of the rDNA and acrocentric α-satellite sequences away from nucleolus that was accompanied by rDNA transcriptional silence. Our findings indicate that hNopp140, a scaffold protein, is involved in the nucleolar assembly, fusion, and maintenance. PMID:18253863

Fluctuations of pol I and fibrillarin contents of the nucleoli.

PubMed

Hornáček, M; Kováčik, L; Mazel, T; Cmarko, D; Bártová, E; Raška, I; Smirnov, E

2017-07-04

Nucleoli are formed on the basis of ribosomal DNA (rDNA) clusters called Nucleolus Organizer Regions (NORs). Each NOR contains multiple genes coding for RNAs of the ribosomal particles. The prominent components of the nucleolar ultrastructure, fibrillar centers (FC) and dense fibrillar components (DFC), together compose FC/DFC units. These units are centers of rDNA transcription by RNA polymerase I (pol I), as well as the early processing events, in which an essential role belongs to fibrillarin. Each FC/DFC unit probably corresponds to a single transcriptionally active gene. In this work, we transfected human-derived cells with GFP-RPA43 (subunit of pol I) and RFP-fibrillarin. Following changes of the fluorescent signals in individual FC/DFC units, we found two kinds of kinetics: 1) the rapid fluctuations with periods of 2-3 min, when the pol I and fibrillarin signals oscillated in anti-phase manner, and the intensities of pol I in the neighboring FC/DFC units did not correlate. 2) fluctuations with periods of 10 to 60 min, in which pol I and fibrillarin signals measured in the same unit did not correlate, but pol I signals in the units belonging to different nucleoli were synchronized. Our data indicate that a complex pulsing activity of transcription as well as early processing is common for ribosomal genes.

Loss of the integral nuclear envelope protein SUN1 induces alteration of nucleoli

PubMed Central

Matsumoto, Ayaka; Sakamoto, Chiyomi; Matsumori, Haruka; Katahira, Jun; Yasuda, Yoko; Yoshidome, Katsuhide; Tsujimoto, Masahiko; Goldberg, Ilya G; Matsuura, Nariaki; Nakao, Mitsuyoshi; Saitoh, Noriko; Hieda, Miki

2016-01-01

ABSTRACT A supervised machine learning algorithm, which is qualified for image classification and analyzing similarities, is based on multiple discriminative morphological features that are automatically assembled during the learning processes. The algorithm is suitable for population-based analysis of images of biological materials that are generally complex and heterogeneous. Here we used the algorithm wndchrm to quantify the effects on nucleolar morphology of the loss of the components of nuclear envelope in a human mammary epithelial cell line. The linker of nucleoskeleton and cytoskeleton (LINC) complex, an assembly of nuclear envelope proteins comprising mainly members of the SUN and nesprin families, connects the nuclear lamina and cytoskeletal filaments. The components of the LINC complex are markedly deficient in breast cancer tissues. We found that a reduction in the levels of SUN1, SUN2, and lamin A/C led to significant changes in morphologies that were computationally classified using wndchrm with approximately 100% accuracy. In particular, depletion of SUN1 caused nucleolar hypertrophy and reduced rRNA synthesis. Further, wndchrm revealed a consistent negative correlation between SUN1 expression and the size of nucleoli in human breast cancer tissues. Our unbiased morphological quantitation strategies using wndchrm revealed an unexpected link between the components of the LINC complex and the morphologies of nucleoli that serves as an indicator of the malignant phenotype of breast cancer cells. PMID:26962703

Loss of the integral nuclear envelope protein SUN1 induces alteration of nucleoli.

PubMed

Matsumoto, Ayaka; Sakamoto, Chiyomi; Matsumori, Haruka; Katahira, Jun; Yasuda, Yoko; Yoshidome, Katsuhide; Tsujimoto, Masahiko; Goldberg, Ilya G; Matsuura, Nariaki; Nakao, Mitsuyoshi; Saitoh, Noriko; Hieda, Miki

2016-01-01

A supervised machine learning algorithm, which is qualified for image classification and analyzing similarities, is based on multiple discriminative morphological features that are automatically assembled during the learning processes. The algorithm is suitable for population-based analysis of images of biological materials that are generally complex and heterogeneous. Here we used the algorithm wndchrm to quantify the effects on nucleolar morphology of the loss of the components of nuclear envelope in a human mammary epithelial cell line. The linker of nucleoskeleton and cytoskeleton (LINC) complex, an assembly of nuclear envelope proteins comprising mainly members of the SUN and nesprin families, connects the nuclear lamina and cytoskeletal filaments. The components of the LINC complex are markedly deficient in breast cancer tissues. We found that a reduction in the levels of SUN1, SUN2, and lamin A/C led to significant changes in morphologies that were computationally classified using wndchrm with approximately 100% accuracy. In particular, depletion of SUN1 caused nucleolar hypertrophy and reduced rRNA synthesis. Further, wndchrm revealed a consistent negative correlation between SUN1 expression and the size of nucleoli in human breast cancer tissues. Our unbiased morphological quantitation strategies using wndchrm revealed an unexpected link between the components of the LINC complex and the morphologies of nucleoli that serves as an indicator of the malignant phenotype of breast cancer cells.

[Participation of the piRNA pathway in recruiting a component of RNA polymerase I transcription initiation complex to germline cell nucleoli].

PubMed

Fefelova, E A; Stolyarenko, A D; Yakushev, E Y; Gvozdev, V A; Klenov, M S

2017-01-01

Proteins of the Piwi family and short Piwi-interacting RNAs (piRNAs) ensure the protection of the genome from transposable elements. We have previously shown that nuclear Piwi protein tends to concentrate in the nucleoli of the cells of Drosophila melanogaster ovaries. It could be hypothesized that the function of Piwi in the nucleolus is associated with the repression of R1 and R2 retrotransposons inserted into the rDNA cluster. Here, we show that Piwi participates in recruiting Udd protein to nucleoli. Udd is a component of the conserved Selectivity Factor I-like (SL1-like) complex, which is required for transcription initiation by RNA polymerase I. We found that Udd localization depends on Piwi in germline cells, but not in somatic cells of the ovaries. In contrast, knockdowns of the SL1-like components (Udd or TAF1b) do not disrupt Piwi localization. We also observed that the absence of Udd or TAF1b in germline cells, as well as the impairment of Piwi nuclear localization lead to the accumulation of late stage egg chambers in the ovaries, which could be explained by reduced rRNA transcription. These results allow us to propose for the first time a role for Piwi in the nucleolus that is not directly associated with transposable element repression.

C1q protein binds to the apoptotic nucleolus and causes C1 protease degradation of nucleolar proteins.

PubMed

Cai, Yitian; Teo, Boon Heng Dennis; Yeo, Joo Guan; Lu, Jinhua

2015-09-11

In infection, complement C1q recognizes pathogen-congregated antibodies and elicits complement activation. Among endogenous ligands, C1q binds to DNA and apoptotic cells, but whether C1q binds to nuclear DNA in apoptotic cells remains to be investigated. With UV irradiation-induced apoptosis, C1q initially bound to peripheral cellular regions in early apoptotic cells. By 6 h, binding concentrated in the nuclei to the nucleolus but not the chromatins. When nucleoli were isolated from non-apoptotic cells, C1q also bound to these structures. In vivo, C1q exists as the C1 complex (C1qC1r2C1s2), and C1q binding to ligands activates the C1r/C1s proteases. Incubation of nucleoli with C1 caused degradation of the nucleolar proteins nucleolin and nucleophosmin 1. This was inhibited by the C1 inhibitor. The nucleoli are abundant with autoantigens. C1q binding and C1r/C1s degradation of nucleolar antigens during cell apoptosis potentially reduces autoimmunity. These findings help us to understand why genetic C1q and C1r/C1s deficiencies cause systemic lupus erythematosus. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Sequential recovery of macromolecular components of the nucleolus.

PubMed

Bai, Baoyan; Laiho, Marikki

2015-01-01

The nucleolus is involved in a number of cellular processes of importance to cell physiology and pathology, including cell stress responses and malignancies. Studies of macromolecular composition of the nucleolus depend critically on the efficient extraction and accurate quantification of all macromolecular components (e.g., DNA, RNA, and protein). We have developed a TRIzol-based method that efficiently and simultaneously isolates these three macromolecular constituents from the same sample of purified nucleoli. The recovered and solubilized protein can be accurately quantified by the bicinchoninic acid assay and assessed by polyacrylamide gel electrophoresis or by mass spectrometry. We have successfully applied this approach to extract and quantify the responses of all three macromolecular components in nucleoli after drug treatments of HeLa cells, and conducted RNA-Seq analysis of the nucleolar RNA.

[The use of nucleolar morphological characteristics of birch seedlings for the assessment of environmental pollution].

PubMed

Karpova, S S; Kalaev, V N; Artiukov, V G; Trofimova, V A; OstashkovaL G, A D; Savko

2006-01-01

Micronucleus frequency in buccal mucosa from the oral cavity of children as well as nucleolar structural characteristics (surface area of single nucleoli as well as their number and type) in the root meristem of seed progeny of birch (Betula pendula Roth) were studied in some districts of Voronezh City and Voronezh Region (Novovoronezh Town, Zemlyansk Village). Similar trends of changes in cytogenetic parameters have been revealed for both subjects. Regression analysis allowed us to generate an equation relating the cytogenetic parameters of birch seed progeny (surface area of single nucleoli) and humans (frequency of micronuclei in buccal mucosa of children). This study can be considered as a result of cytogenetic monitoring of environmental pollution in some areas of Voronezh City and Voronezh Region.

REFORMATION OF NUCLEOLI AFTER ETHIONE-INDUCED FRAGMENTATION IN THE ABSENCE OF SIGNIFICANT PROTEIN SYNTHESIS

PubMed Central

Shinozuka, Hisashi; Farber, Emmanuel

1969-01-01

The rat liver nucleolus, after fragmentation induced by ethionine treatment, has been found to undergo complete reformation by adenine in the presence of a dose of cycloheximide sufficient to cause inhibition of protein synthesis by 90–95%. In contrast, actinomycin D given along with adenine was followed by the appearance of a small compact mass containing only the fibrillar component with no evident granules. This structure resembled pseudonucleoli seen in the anucleolate mutant of Xenopus laevis or in certain early stages of amphibian oocytes. Actinomycin D administered 2 hr after adenine induced a segregation of the fibrillar and granular components of nucleoli similar to that induced in the normal nucleolus. The implications of these findings in relation to nucleolar organization are briefly discussed. PMID:5775789

Histological and histochemical characteristics of the lymphocystis disease in gilthead seabream, Sparus aurata L. from the south-atlantic coast of Spain.

PubMed

González de Canales, M L; Muñoz-Cueto, J A; Arellano, J; García-García, A; Sarasquete, C

1996-01-01

Lymphocystis disease of the gilthead seabream, Sparus aurata from the south Atlantic coasts of Spain was studied using various cytochemical methods for nucleic acids, proteins, carbohydrates and lipids. In lymphocystis infected cells, cytoplasm and nucleoli contained RNA. DNA was restricted to the periphery of the nucleus and within the intracytoplasmatic inclusions. During the development of infected cells, proteins rich in different aminoacids were observed in the granular cytoplasm, nucleus/nucleoli, intracytoplasm inclusions and hyaline capsule. Some glycogen was observed in the cytoplasm of these cells. The intracytoplasm inclusions and the hyaline capsule also contain hydrophilic lipids, being noticeable the presence of proteins containing S-S groups. Sulphated sialoglycoproteins and glycolipids and/or phospholipids were also components of the hyaline capsule.

Cytogenetics of the Brazilian whiptail lizard Cnemidophorus littoralis (Teiidae) from a restinga area (Barra de Maricá) in Southeastern Brazil.

PubMed

Peccinini-Seale, D; Rocha, C F D; Almeida, T M B; Araújo, A F B; De Sena, M A

2004-08-01

Chromosomes of Cnemidophorus littoralis, a new species of teiid lizard recently described, were studied. The animals are from a restinga area in Barra de Maricá, RJ. The karyotype presents a diploid number of 2n = 46 chromosomes and a chromosomal sex determination mechanism of the type XX:XY. Nucleolar organizer regions, Ag-NORs, are at the sixth pair of chromosomes; there is variability of size and number of the Ag-stained nucleoli on the 50 interphase nuclei for each specimen analyzed. These nucleoli are related to NOR patterns that also demonstrated variability in size and number. This paper presents the first description of the karyotype of Cnemidophorus littoralis and of a chromosomal sex determination mechanism of the XX:XY type in the genus Cnemidophorus from Southeastern Brazil.

Separation of replication and transcription domains in nucleoli.

PubMed

Smirnov, E; Borkovec, J; Kováčik, L; Svidenská, S; Schröfel, A; Skalníková, M; Švindrych, Z; Křížek, P; Ovesný, M; Hagen, G M; Juda, P; Michalová, K; Cardoso, M C; Cmarko, D; Raška, I

2014-12-01

In mammalian cells, active ribosomal genes produce the 18S, 5.8S and 28S RNAs of ribosomal particles. Transcription levels of these genes are very high throughout interphase, and the cell needs a special strategy to avoid collision of the DNA polymerase and RNA polymerase machineries. To investigate this problem, we measured the correlation of various replication and transcription signals in the nucleoli of HeLa, HT-1080 and NIH 3T3 cells using a specially devised software for analysis of confocal images. Additionally, to follow the relationship between nucleolar replication and transcription in living cells, we produced a stable cell line expressing GFP-RPA43 (subunit of RNA polymerase I, pol I) and RFP-PCNA (the sliding clamp protein) based on human fibrosarcoma HT-1080 cells. We found that replication and transcription signals are more efficiently separated in nucleoli than in the nucleoplasm. In the course of S phase, separation of PCNA and pol I signals gradually increased. During the same period, separation of pol I and incorporated Cy5-dUTP signals decreased. Analysis of single molecule localization microscopy (SMLM) images indicated that transcriptionally active FC/DFC units (i.e. fibrillar centers with adjacent dense fibrillar components) did not incorporate DNA nucleotides. Taken together, our data show that replication of the ribosomal genes is spatially separated from their transcription, and FC/DFC units may provide a structural basis for that separation. Copyright © 2014 Elsevier Inc. All rights reserved.

Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III-transcribed genes in budding yeast.

PubMed

Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

2016-10-15

The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Ellagic Acid-Changed Epigenome of Ribosomal Genes and Condensed RPA194-Positive Regions of Nucleoli in Tumour Cells.

PubMed

Legartová, S; Sbardella, G; Kozubek, S; Bártová, E

2015-01-01

We studied the effect of ellagic acid (EA) on the morphology of nucleoli and on the pattern of major proteins of the nucleolus. After EA treatment of HeLa cells, we observed condensation of nucleoli as documented by the pattern of argyrophilic nucleolar organizer regions (AgNORs). EA also induced condensation of RPA194-positive nucleolar regions, but no morphological changes were observed in nucleolar compartments positive for UBF1/2 proteins or fibrillarin. Studied morphological changes induced by EA were compared with the morphology of control, non-treated cells and with pronounced condensation of all nucleolar domains caused by actinomycin D (ACT-D) treatment. Similarly as ACT-D, but in a lesser extent, EA induced an increased number of 53BP1-positive DNA lesions. However, the main marker of DNA lesions, γH2AX, was not accumulated in body-like nuclear structures. An increased level of γH2AX was found by immunofluorescence and Western blots only after EA treatment. Intriguingly, the levels of fibrillarin, UBF1/2 and γH2AX were increased at the promoters of ribosomal genes, while 53BP1 and CARM1 levels were decreased by EA treatment at these genomic regions. In the entire genome, EA reduced H3R17 dimethylation. Taken together, ellagic acid is capable of significantly changing the nucleolar morphology and protein levels inside the nucleolus.

Dynamic subcellular partitioning of the nucleolar transcription factor TIF-IA under ribotoxic stress.

PubMed

Szymański, Jedrzej; Mayer, Christine; Hoffmann-Rohrer, Urs; Kalla, Claudia; Grummt, Ingrid; Weiss, Matthias

2009-07-01

TIF-IA is a basal transcription factor of RNA polymerase I (Pol I) that is a major target of the JNK2 signaling pathway in response to ribotoxic stress. Using advanced fluorescence microscopy and kinetic modeling we elucidated the subcellular localization of TIF-IA and its exchange dynamics between the nucleolus, nucleoplasm and cytoplasm upon ribotoxic stress. In steady state, the majority of (GFP-tagged) TIF-IA was in the cytoplasm and the nucleus, a minor portion (7%) localizing to the nucleoli. We observed a rapid shuttling of GFP-TIF-IA between the different cellular compartments with a mean residence time of approximately 130 s in the nucleus and only approximately 30 s in the nucleoli. The import rate from the cytoplasm to the nucleus was approximately 3-fold larger than the export rate, suggesting an importin/exportin-mediated transport rather than a passive diffusion. Upon ribotoxic stress, GFP-TIF-IA was released from the nucleoli with a half-time of approximately 24 min. Oxidative stress and inhibition of protein synthesis led to a relocation of GFP-TIF-IA with slower kinetics while osmotic stress had no effect. The observed relocation was much slower than the nucleo-cytoplasmic and nucleus-nucleolus exchange rates of GFP-TIF-IA, indicating a time-limiting step upstream of the JNK2 pathway. In support of this, time-course experiments on the activity of JNK2 revealed the activation of the JNK kinase as the rate-limiting step.

Nucleolus Precursor Bodies and Ribosome Biogenesis in Early Mammalian Embryos: Old Theories and New Discoveries.

PubMed

Fulka, Helena; Aoki, Fugaku

2016-06-01

In mammals, mature oocytes and early preimplantation embryos contain transcriptionally inactive structures termed nucleolus precursor bodies instead of the typical fibrillo-granular nucleoli. These nuclear organelles are essential and strictly of maternal origin. If they are removed from oocytes, the resulting embryos are unable to replace them and consequently fail to develop. Historically, nucleolus precursor bodies have been perceived as a passive repository site of nucleolar proteins that are required for embryos to form fully functional nucleoli. Recent results, however, contradict this long-standing dogma and show that these organelles are dispensable for nucleologenesis and ribosome biogenesis. In this article, we discuss the possible roles of nucleolus precursor bodies and propose how they might be involved in embryogenesis. Furthermore, we argue that these organelles are essential only shortly after fertilization and suggest that they might actively participate in centromeric chromatin establishment. © 2016 by the Society for the Study of Reproduction, Inc.

Location of rRNA transcription to the nucleolar components: disappearance of the fibrillar centers in nucleoli of regenerating rat hepatocytes.

PubMed

Montanaro, Lorenzo; Govoni, Marzia; Orrico, Catia; Treré, Davide; Derenzini, Massimo

2011-01-01

The precise location of rDNA transcription to the components of mammalian cell nucleolus is still debated. This was due to the fact that all the molecules necessary for rRNA synthesis are located in two of the three components, the fibrillar centers (FCs) and the dense fibrillar component (DFC), which together with the granular component (GC) are considered to be constantly present in mammalian cell nucleoli. In the present study we demonstrated that in nucleoli of many regenerating rat hepatocytes at 15 h after partial hepatectomy the FCs were no longer present, only the DFC and the GC being detected. At this time of regeneration the rRNA transcriptional activity was three fold that of resting hepatocytes, while the synthesis of DNA was not yet significantly increased, indicating that these nucleolar changes were due to the rRNA synthesis up-regulation. The DFC appeared to be organized in numerous, small, roundish tufts of fibrils. The silver staining procedure for AgNOR proteins, which are associated with the ribosomal genes, selectively and homogeneously stained these fibrillar tufts. Immuno-gold visualization of the Upstream Binding Factor (UBF), which is associated with the promoter region and the transcribed portion of the rRNA 45S gene, demonstrated that UBF was selectively located in the fibrillar tufts. We concluded that in proliferating rat hepatocytes the increased synthesis of rRNA induced an activation of the rRNA transcription machinery located in the fibrillar centers which, by becoming associated with the ribonucleoprotein transcripts, assumed the morphological pattern of the DFC.

Viral Impact in Autoimmune Diseases: Expanding the “X Chromosome–Nucleolus Nexus” Hypothesis

PubMed Central

Brooks, Wesley H.

2017-01-01

Viruses are suspected of significant roles in autoimmune diseases but the mechanisms are unclear. We get some insight by considering demands a virus places on host cells. Viruses not only require production of their own proteins, RNA and/or DNA, but also production of additional cellular machinery, such as ribosomes, to handle the increased demands. Since the nucleolus is a major site of RNA processing and ribonucleoprotein assembly, nucleoli are targeted by viruses, directly when viral RNA and proteins enter the nucleolus and indirectly when viruses induce increased expression of cellular polyamine genes. Polyamines are at high levels in nucleoli to assist in RNA folding. The size and activity of nucleoli increase directly with increases in polyamines. Nucleolar expansion due to abnormal increases in polyamines could disrupt nearby chromatin, such as the inactive X chromosome, leading to expression of previously sequestered DNA. Sudden expression of a large concentration of Alu elements from the disrupted inactive X can compete with RNA transcripts containing intronic Alu sequences that normally maintain nucleolar structural integrity. Such disruption of nucleolar activity can lead to misfolded RNAs, misassembled ribonucleoprotein complexes, and fragmentation of the nucleolus. Many autoantigens in lupus are, at least transiently, components of the nucleolus. Considering these effects of viruses, the “X chromosome–nucleolus nexus” hypothesis, which proposed disruption of the inactive X by the nucleolus during stress, is now expanded here to propose subsequent disruption of the nucleolus by previously sequestered Alu elements, which can fragment the nucleolus, leading to generation of autoantigens. PMID:29234321

The conserved N-terminal domain of herpes simplex virus 1 UL24 protein is sufficient to induce the spatial redistribution of nucleolin.

PubMed

Bertrand, Luc; Pearson, Angela

2008-05-01

UL24 is widely conserved among herpesviruses but its function during infection is poorly understood. Previously, we discovered a genetic link between UL24 and the herpes simplex virus 1-induced dispersal of the nucleolar protein nucleolin. Here, we report that in the absence of viral infection, transiently expressed UL24 accumulated in both the nucleus and the Golgi apparatus. In the majority of transfected cells, nuclear staining for UL24 was diffuse, but a minor staining pattern, whereby UL24 was present in nuclear foci corresponding to nucleoli, was also observed. Expression of UL24 correlated with the dispersal of nucleolin. This dispersal did not appear to be a consequence of a general disaggregation of nucleoli, as foci of fibrillarin staining persisted in cells expressing UL24. The conserved N-terminal region of UL24 was sufficient to cause this change in subcellular distribution of nucleolin. Interestingly, a bipartite nuclear localization signal predicted within the C terminus of UL24 was dispensable for nuclear localization. None of the five individual UL24 homology domains was required for nuclear or Golgi localization, but deletion of these domains resulted in the loss of nucleolin-dispersal activity. We determined that a nucleolar-targeting signal was contained within the first 60 aa of UL24. Our results show that the conserved N-terminal domain of UL24 is sufficient to specifically induce dispersal of nucleolin in the absence of other viral proteins or virus-induced cellular modifications. These results suggest that UL24 directly targets cellular factors that affect the composition of nucleoli.

Proteomic characterization of the nucleolar linker histone H1 interaction network

PubMed Central

Szerlong, Heather J.; Herman, Jacob A.; Krause, Christine M.; DeLuca, Jennifer G.; Skoultchi, Arthur; Winger, Quinton A.; Prenni, Jessica E.; Hansen, Jeffrey C.

2015-01-01

To investigate the relationship between linker histone H1 and protein-protein interactions in the nucleolus, biochemical and proteomics approaches were used to characterize nucleoli purified from cultured human and mouse cells. Mass spectrometry identified 175 proteins in human T-cell nucleolar extracts that bound to sepharose-immobilized H1 in vitro. Gene ontology analysis found significant enrichment for H1 binding proteins with functions related to nucleolar chromatin structure and RNA polymerase I transcription regulation, rRNA processing, and mRNA splicing. Consistent with the affinity binding results, H1 existed in large (400 to >650 kDa) macromolecular complexes in human T cell nucleolar extracts. To complement the biochemical experiments, the effects of in vivo H1 depletion on protein content and structural integrity of the nucleolus were investigated using the H1 triple isoform knock out (H1ΔTKO) mouse embryonic stem cell (mESC) model system. Proteomic profiling of purified wild type mESC nucleoli identified a total of 613 proteins, only ~60% of which were detected in the H1 mutant nucleoli. Within the affected group, spectral counting analysis quantitated 135 specific nucleolar proteins whose levels were significantly altered in H1ΔTKO mESC. Importantly, the functions of the affected proteins in mESC closely overlapped with those of the human T cell nucleolar H1 binding proteins. Immunofluorescence microscopy of intact H1ΔTKO mESC demonstrated both a loss of nucleolar RNA content and altered nucleolar morphology resulting from in vivo H1 depletion. We conclude that H1 organizes and maintains an extensive protein-protein interaction network in the nucleolus required for nucleolar structure and integrity. PMID:25584861

Non-random Patterns in the Distribution of NOR-bearing Chromosome Territories in Human Fibroblasts: A Network Model of Interactions

PubMed Central

Pliss, Artem; Fritz, Andrew J.; Stojkovic, Branislav; Ding, Hu; Mukherjee, Lopamudra; Bhattacharya, Sambit; Xu, Jinhui; Berezney, Ronald

2017-01-01

We present a 3-D mapping in WI38 human diploid fibroblast cells of chromosome territories (CT) 13,14,15,21, and 22, which contain the nucleolar organizing regions (NOR) and participate in the formation of nucleoli. The nuclear radial positioning of NOR-CT correlated with the size of chromosomes with smaller CT more interior. A high frequency of pairwise associations between NOR-CT ranging from 52% (CT13-21) to 82% (CT15-21) was detected as well as a triplet arrangement of CT15-21-22 (72%). The associations of homologous CT were significantly lower (24–36%). The arrangements of each pairwise CT varied from CT13-14 and CT13-22, which had a majority of cells with single associations, to CT13-15 and CT13-21 where a majority of cells had multiple interactions. In cells with multiple nucleoli, one of the nucleoli (termed “dominant”) always associated with a higher number of CT. Moreover, certain CT pairs more frequently contributed to the same nucleolus than to others. This nonrandom pattern suggests that a large number of the NOR-chromsomes are poised in close proximity during the postmitotic nucleolar recovery and through their NORs may contribute to the formation of the same nucleolus. A global data mining program termed the chromatic median determined the most probable interchromosomal arrangement of the entire NOR-CT population. This interactive network model was significantly above randomized simulation and was composed of 13 connections among the NOR-CT. We conclude that the NOR-CT form a global interactive network in the cell nucleus that may be a fundamental feature for the regulation of nucleolar and other genomic functions. PMID:25077974

Localization of SERBP1 in stress granules and nucleoli.

PubMed

Lee, Yu-Jen; Wei, Hung-Ming; Chen, Ling-Yun; Li, Chuan

2014-01-01

SERPINE1 mRNA-binding protein 1 (SERBP1) is an arginine-methylated RNA-binding protein whose modification affects protein interaction and intracellular localization. In the present study, we show that, under normal growth conditions without stress, SERBP1 interacts with arginine-methylated and stress granule-associated proteins such as heterogeneous nuclear ribonucleoprotein A1, fragile X mental retardation protein and fragile X mental retardation syndrome-related protein 1 in an RNA-dependent manner. We also show that, after arsenite treatment, a proportion of full-length SERBP1 protein co-localizes with the typical stress granule marker T-cell intracellular antigen-1 in the cytoplasmic stress granules. Truncated SERBP1 with an N-terminal, central RG or C-terminal deletion, or single-domain segments comprising the N-terminal, central or C-terminal region, were recruited to stress granules upon arsenite treatment but with reduced efficiency. In addition, upon arsenite treatment, the localization of SERBP1 changed from a diffuse cytoplasmic localization to nuclear-dominant (concentrated in the nucleolus) A similar distribution was observed when cells were treated with the methylation inhibitor adenosine periodate, and was also detected for N- or C-terminal domain deletions and all three single-domain fragments even without stress induction. We further demonstrate that adenosine periodate treatment delays the association/dissociation of SERBP1 with stress granules. Hypomethylation retains SERBP1 in the nucleus/nucleolus regardless of arsenite treatment. Our study indicates that arginine methylation is correlated with recruitment of SERBP to stress granules and nucleoli and its retention therein. To our knowledge, this is the first report of an RNA-binding protein that is shifted simultaneously to cytoplasmic stress granules and nucleoli, two ribonucleoprotein-enriched subcellular compartments, upon stress. © 2013 FEBS.

Two distinct events, section compression and loss of particles ("lost caps"), contribute to z-axis distortion and bias in optical disector counting.

PubMed

Baryshnikova, Larisa M; Von Bohlen Und Halbach, Oliver; Kaplan, Suleyman; Von Bartheld, Christopher S

2006-09-01

Deformation of tissue sections in the z-axis can bias optical disector counting. When samples of particle densities are not representative for the entire tissue section, significant bias of estimated numbers can result. To assess the occurrence, prevalence, extent, sequence of events, and causes of z-axis distortion, the distribution of neuronal nucleoli in thick paraffin and vibratome sections was determined in chicken, rodent, and human brain tissues. When positions of neuronal nucleoli were measured in the z-axis, nucleoli were more frequent at the surfaces (bottom and top) of tissue sections than in the core. This nonlinear z-axis distribution was not lab-, equipment-, or investigator-specific, and was independent of age, fixation quality, coverslipping medium, or paraffin melting temperature, but in paraffin sections, was highly correlated with the tilt of the knife (cutting) angle. Manipulation of subsequent tissue processing steps revealed that two events contribute to z-axis distortion. Initially, a higher density of particles results at surfaces after sectioning, apparently due to section compression. Subsequently, particles can be lost to varying degrees from surfaces during floating or staining and dehydration, resulting in "lost caps." These results may explain different degrees of z-axis distortion between different types of sections and different labs, and reinforce the importance of checking z-axis distributions as a "quality control" prior to selection of guard zones in optical disector counting. Indirect approaches to assess section quality, such as resectioning in a perpendicular plane, yield additional artifacts, and should be replaced by a direct quantitative measurement of z-axis distribution of particles. (c) 2006 Wiley-Liss, Inc.

Light regulation of the abundance of mRNA encoding a nucleolin-like protein localized in the nucleoli of pea nuclei.

PubMed Central

Tong, C G; Reichler, S; Blumenthal, S; Balk, J; Hsieh, H L; Roux, S J

1997-01-01

A cDNA encoding a nucleolar protein was selected from a pea (Pisum sativum) plumule library, cloned, and sequenced. The translated sequence of the cDNA has significant percent identity to Xenopus laevis nucleolin (31%), the alfalfa (Medicago sativa) nucleolin homolog (66%), and the yeast (Saccharomyces cerevisiae) nucleolin homolog (NSR1) (28%). It also has sequence patterns in its primary structure that are characteristic of all nucleolins, including an N-terminal acidic motif, RNA recognition motifs, and a C-terminal Gly- and Arg-rich domain. By immunoblot analysis, the polyclonal antibodies used to select the cDNA bind selectively to a 90-kD protein in purified pea nuclei and nucleoli and to an 88-kD protein in extracts of Escherichia coli expressing the cDNA. In immunolocalization assays of pea plumule cells, the antibodies stained primarily a region surrounding the fibrillar center of nucleoli, where animal nucleolins are typically found. Southern analysis indicated that the pea nucleolin-like protein is encoded by a single gene, and northern analysis showed that the labeled cDNA binds to a single band of RNA, approximately the same size and the cDNA. After irradiation of etiolated pea seedlings by red light, the mRNA level in plumules decreased during the 1st hour and then increased to a peak of six times the 0-h level at 12 h. Far-red light reversed this effect of red light, and the mRNA accumulation from red/far-red light irradiation was equal to that found in the dark control. This indicates that phytochrome may regulate the expression of this gene. PMID:9193096

Red emissive cross-linked chitosan and their nanoparticles for imaging the nucleoli of living cells.

PubMed

Wang, Ke; Yuan, Xun; Guo, Zhenpeng; Xu, Jiying; Chen, Yi

2014-02-15

Biocompatible glutaraldehyde-cross-linked chitosan with new red fluorescence were prepared for the first time and were shaped into nanoparticles via inverse-microemulsion method. They could luminesce at ca. 670 nm either as powders and nanoparticles or in real and gelling solutions or suspensions, having a lifetime of 1.353 ns and a quantum yield of 0.08 in solution or 0.01 in solid state. The new-formed pyridinium structures and the intramolecular charge transfer effect are considered to be responsible for the new red emission, which have been proved by FTIR, (13)C NMR, and some calculation using Gaussian 09, respectively. Strikingly, they are quite inert and anti-photobleaching, with only <3% loss of fluorescent intensity per minute in average under a continuous laser illumination at 633 nm and 50 μW. Especially, their nanoparticles (5.6 nm) could enter into the negative nucleoli of living HeLa cells with low cytotoxicity for high contrast imaging inspections. Copyright © 2013 Elsevier Ltd. All rights reserved.

Proteomic Analysis of the Arabidopsis Nucleolus Suggests Novel Nucleolar FunctionsD⃞

PubMed Central

Pendle, Alison F.; Clark, Gillian P.; Boon, Reinier; Lewandowska, Dominika; Lam, Yun Wah; Andersen, Jens; Mann, Matthias; Lamond, Angus I.; Brown, John W. S.; Shaw, Peter J.

2005-01-01

The eukaryotic nucleolus is involved in ribosome biogenesis and a wide range of other RNA metabolism and cellular functions. An important step in the functional analysis of the nucleolus is to determine the complement of proteins of this nuclear compartment. Here, we describe the first proteomic analysis of plant (Arabidopsis thaliana) nucleoli, in which we have identified 217 proteins. This allows a direct comparison of the proteomes of an important nuclear structure between two widely divergent species: human and Arabidopsis. The comparison identified many common proteins, plant-specific proteins, proteins of unknown function found in both proteomes, and proteins that were nucleolar in plants but nonnucleolar in human. Seventy-two proteins were expressed as GFP fusions and 87% showed nucleolar or nucleolar-associated localization. In a striking and unexpected finding, we have identified six components of the postsplicing exon-junction complex (EJC) involved in mRNA export and nonsense-mediated decay (NMD)/mRNA surveillance. This association was confirmed by GFP-fusion protein localization. These results raise the possibility that in plants, nucleoli may have additional functions in mRNA export or surveillance. PMID:15496452

The nucleolar phosphoprotein B23 targets Newcastle disease virus matrix protein to the nucleoli and facilitates viral replication.

PubMed

Duan, Zhiqiang; Chen, Jian; Xu, Haixu; Zhu, Jie; Li, Qunhui; He, Liang; Liu, Huimou; Hu, Shunlin; Liu, Xiufan

2014-03-01

The cellular nucleolar proteins are reported to facilitate the replication cycles of some human and animal viruses by interaction with viral proteins. In this study, a nucleolar phosphoprotein B23 was identified to interact with Newcastle disease virus (NDV) matrix (M) protein. We found that NDV M protein accumulated in the nucleolus by binding B23 early in infection, but resulted in the redistribution of B23 from the nucleoli to the nucleoplasm later in infection. In vitro binding studies utilizing deletion mutants indicated that amino acids 30-60 of M and amino acids 188-245 of B23 were required for binding. Furthermore, knockdown of B23 by siRNA or overexpression of B23 or M-binding B23-derived polypeptides remarkably reduced cytopathic effect and inhibited NDV replication. Collectively, we show that B23 facilitates NDV replication by targeting M to the nucleolus, demonstrating for the first time a direct role for nucleolar protein B23 in a paramyxovirus replication process. Copyright © 2014 Elsevier Inc. All rights reserved.

Treacher Collins syndrome TCOF1 protein cooperates with NBS1 in the DNA damage response.

PubMed

Ciccia, Alberto; Huang, Jen-Wei; Izhar, Lior; Sowa, Mathew E; Harper, J Wade; Elledge, Stephen J

2014-12-30

The signal transduction pathway of the DNA damage response (DDR) is activated to maintain genomic integrity following DNA damage. The DDR promotes genomic integrity by regulating a large network of cellular activities that range from DNA replication and repair to transcription, RNA splicing, and metabolism. In this study we define an interaction between the DDR factor NBS1 and TCOF1, a nucleolar protein that regulates ribosomal DNA (rDNA) transcription and is mutated in Treacher Collins syndrome. We show that NBS1 relocalizes to nucleoli after DNA damage in a manner dependent on TCOF1 and on casein kinase II and ATM, which are known to modify TCOF1 by phosphorylation. Moreover, we identify a putative ATM phosphorylation site that is required for NBS1 relocalization to nucleoli in response to DNA damage. Last, we report that TCOF1 promotes cellular resistance to DNA damaging agents. Collectively, our findings identify TCOF1 as a DDR factor that could cooperate with ATM and NBS1 to suppress inappropriate rDNA transcription and maintain genomic integrity after DNA damage.

Treacher Collins syndrome TCOF1 protein cooperates with NBS1 in the DNA damage response

PubMed Central

Ciccia, Alberto; Huang, Jen-Wei; Izhar, Lior; Sowa, Mathew E.; Harper, J. Wade; Elledge, Stephen J.

2014-01-01

The signal transduction pathway of the DNA damage response (DDR) is activated to maintain genomic integrity following DNA damage. The DDR promotes genomic integrity by regulating a large network of cellular activities that range from DNA replication and repair to transcription, RNA splicing, and metabolism. In this study we define an interaction between the DDR factor NBS1 and TCOF1, a nucleolar protein that regulates ribosomal DNA (rDNA) transcription and is mutated in Treacher Collins syndrome. We show that NBS1 relocalizes to nucleoli after DNA damage in a manner dependent on TCOF1 and on casein kinase II and ATM, which are known to modify TCOF1 by phosphorylation. Moreover, we identify a putative ATM phosphorylation site that is required for NBS1 relocalization to nucleoli in response to DNA damage. Last, we report that TCOF1 promotes cellular resistance to DNA damaging agents. Collectively, our findings identify TCOF1 as a DDR factor that could cooperate with ATM and NBS1 to suppress inappropriate rDNA transcription and maintain genomic integrity after DNA damage. PMID:25512513

Can We Confidently Diagnose Pilomatricoma with Fine Needle Aspiration Cytology?

PubMed Central

WONG, Yin-Ping; MASIR, Noraidah; SHARIFAH, Noor Akmal

2015-01-01

Pilomatricomas can be confidently diagnosed cytologically due to their characteristic cytomorphological features. However, these lesions are rarely encountered by cytopathologists and thus pose a diagnostic dilemma to even experienced individuals, especially when the lesions are focally sampled. We describe two cases of histologically confirmed pilomatricoma. The first case is of a 13-year-old boy with posterior cervical ‘lymphadenopathy’, and the second one is of a 12-year-old girl with a lower cheek swelling. Both aspirates comprised predominantly atypical basal-like cells, with prominent nucleoli. ‘Ghost cells’ were readily identified by cell block in case two, but cell block in case one yielded no diagnostic material. In case two, pilomatricoma was accurately diagnosed pre-operatively. A cytological suspicion of a neoplastic process was raised in case one. Despite being diagnostically challenging, pilomatricoma can be diagnosed with careful observation of two unique cytological features of the lesions: (1) pathognomonic ‘ghost cells’ and (2) irregular, saw-toothed, loosely cohesive basaloid cells, with prominent nucleoli. The role of thorough sampling of the lesion, with multiple passes of various sites, cannot be overemphasized. PMID:25892955

Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

PubMed Central

Nielsen, O F; Carin, M; Westergaard, O

1984-01-01

In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule. Images PMID:6694912

The nucleolus directly regulates p53 export and degradation.

PubMed

Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

2011-09-05

The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

The Nucleolus

PubMed Central

Pederson, Thoru

2011-01-01

When cells are observed by phase contrast microscopy, nucleoli are among the most conspicuous structures. The nucleolus was formally described between 1835 and 1839, but it was another century before it was discovered to be associated with a specific chromosomal locus, thus defining it as a cytogenetic entity. Nucleoli were first isolated in the 1950s, from starfish oocytes. Then, in the early 1960s, a boomlet of studies led to one of the epochal discoveries in the modern era of genetics and cell biology: that the nucleolus is the site of ribosomal RNA synthesis and nascent ribosome assembly. This epistemologically repositioned the nucleolus as not merely an aspect of nuclear anatomy but rather as a cytological manifestation of gene action—a major heuristic advance. Indeed, the finding that the nucleolus is the seat of ribosome production constitutes one of the most vivid confluences of form and function in the history of cell biology. This account presents the nucleolus in both historical and contemporary perspectives. The modern era has brought the unanticipated discovery that the nucleolus is plurifunctional, constituting a paradigm shift. PMID:21106648

The nucleolus.

PubMed

Pederson, Thoru

2011-03-01

When cells are observed by phase contrast microscopy, nucleoli are among the most conspicuous structures. The nucleolus was formally described between 1835 and 1839, but it was another century before it was discovered to be associated with a specific chromosomal locus, thus defining it as a cytogenetic entity. Nucleoli were first isolated in the 1950s, from starfish oocytes. Then, in the early 1960s, a boomlet of studies led to one of the epochal discoveries in the modern era of genetics and cell biology: that the nucleolus is the site of ribosomal RNA synthesis and nascent ribosome assembly. This epistemologically repositioned the nucleolus as not merely an aspect of nuclear anatomy but rather as a cytological manifestation of gene action-a major heuristic advance. Indeed, the finding that the nucleolus is the seat of ribosome production constitutes one of the most vivid confluences of form and function in the history of cell biology. This account presents the nucleolus in both historical and contemporary perspectives. The modern era has brought the unanticipated discovery that the nucleolus is plurifunctional, constituting a paradigm shift.

High-Grade Urothelial Carcinoma on Urine Cytology Resembling Umbrella Cells.

PubMed

Renshaw, Andrew A; Gould, Edwin W

2018-01-01

High-grade urothelial carcinoma (UC) cells have many appearances on urine cytology, but according to The Paris System, they can be easily distinguished from umbrella cells. We aimed to define the incidence and appearance of high-grade UC cells that resemble umbrella cells in Cytospin preparations on urine cytology. Cytospin preparations from 331 cases with biopsy follow-up (230 benign/low-grade and 101 malignant [22 carcinoma in situ, 52 papillary, 19 invasive UC, 8 other] cases) were reviewed. A total of 18 cases with malignant cells resembling umbrella cells were identified (17.8% of the malignant cases) and were the only type of malignant cell in 3% of the cases. Two patterns were identified. Tumor cells were either identifiable by at least 20 abnormal cells which were large, had abundant cytoplasm but an elevated nuclear-to-cytoplasmic ratio, and markedly enlarged, round-to-elongated nucleoli, or else rare cells with abundant cytoplasm but obviously malignant nuclei. Cells without nucleoli or obviously malignant nuclei were not specific. Malignant cells resembling umbrella cells can be seen in up to 17% of urine cytology specimens. © 2017 S. Karger AG, Basel.

Effects of Mg{sup 2+}, Co{sup 2+}, and Hg{sup 2+} on the nucleus and nucleolus in root tip cells of allium cepa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, D.; Jiang, W.; Wang, W.

Metal toxicity in plants has been known for a long time. Much importance has increasingly been attached to the problems of metal pollution with the development of modern industry and agriculture. If metals in plants are accumulated to a large extent, it might seriously affect them. The cytological effects of cobalt and mercury have been studied in Allium cepa by documentation of c-mitosis. Also, the quantification of chromosome aberration in Vicia faba root-tip cells treated by magnesium sulphate and in Allium cepa by metyl mercury chloride and mercuric chloride has been reported. Cytological research on the poisoning effects of Mg,more » Co and Hg on the nuclei and nucleoli in root-tip cells of plants has hardly been reported. The aim of this study was to determine the effects of different concentrations of magnesium, cobalt and mercury ions on root growth, and on the nuclei and nucleoli of root tip cells of Allium-cepa. 20 refs., 3 figs.« less

Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

PubMed

Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

2015-01-15

It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA. Copyright © 2014 Elsevier Inc. All rights reserved.

Determination of the accuracy for targeted irradiations of cellular substructures at SNAKE

NASA Astrophysics Data System (ADS)

Siebenwirth, C.; Greubel, C.; Drexler, S. E.; Girst, S.; Reindl, J.; Walsh, D. W. M.; Dollinger, G.; Friedl, A. A.; Schmid, T. E.; Drexler, G. A.

2015-04-01

In the last 10 years the ion microbeam SNAKE, installed at the Munich 14 MV tandem accelerator, has been successfully used for radiobiological experiments by utilizing pattern irradiation without targeting single cells. Now for targeted irradiation of cellular substructures a precise irradiation device was added to the live cell irradiation setup at SNAKE. It combines a sub-micrometer single ion irradiation facility with a high resolution optical fluorescence microscope. Most systematic errors can be reduced or avoided by using the same light path in the microscope for beam spot verification as well as for and target recognition. In addition online observation of the induced cellular responses is possible. The optical microscope and the beam delivering system are controlled by an in-house developed software which integrates the open-source image analysis software, CellProfiler, for semi-automatic target recognition. In this work the targeting accuracy was determined by irradiation of a cross pattern with 55 MeV carbon ions on nucleoli in U2OS and HeLa cells stably expressing a GFP-tagged repair protein MDC1. For target recognition, nuclei were stained with Draq5 and nucleoli were stained with Syto80 or Syto83. The damage response was determined by live-cell imaging of MDC1-GFP accumulation directly after irradiation. No systematic displacement and a random distribution of about 0.7 μm (SD) in x-direction and 0.8 μm (SD) in y-direction were observed. An independent analysis after immunofluorescence staining of the DNA damage marker yH2AX yielded similar results. With this performance a target with a size similar to that of nucleoli (i.e. a diameter of about 3 μm) is hit with a probability of more than 80%, which enables the investigation of the radiation response of cellular subcompartments after targeted ion irradiation in the future.

High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

PubMed

Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

2015-10-01

Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

Ultrastructure of rabbit embryos exposed to hyperthermia and anti-Hsp 70.

PubMed

Olexikova, L; Makarevich, A V; Pivko, J; Chrenek, P

2013-08-01

The aim of the study was to determine the effect of short-term hyperthermia and Hsp70 blockage on ultrastructural changes in cell organelles and nucleoli of rabbit preimplantation embryos. The embryos were cultured either at 37.5°C (control, C) or 41.5°C (hyperthermia, HT) during 6 h. The antibody against Hsp70 was added into the culture medium (4 μg/ml) of morula stage embryos from C and HT groups. After termination of the culture, the embryos were processed for transmission electron microscopy. The embryos exposed to hyperthermia showed increased volume of lipid droplets, considerable occurrence of cellular debris in the perivitelline space and slight changes in the occurrence of microvilli on the surface of trophoblastic cells. In the embryos exposed to anti-Hsp 70 at 37.5°C, there were considerable changes in mitochondria morphology, decreased volume of dense bodies in the cytoplasm and considerable changes in the occurrence of microvilli on the surface of trophoblastic cells. In the group of embryos exposed simultaneously to hyperthermia and anti-Hsp 70, mitochondria were also expanded and swollen; the volume of flocculent vesicles and lipid droplets was increased and the volume of dense bodies in the cytoplasm was diminished. General organization of the cytoplasm in groups with anti-Hsp70 was characterized by cell organelle segregation. Averaged size of the nucleolar area was significantly increased in the embryos exposed to hyperthermia, whereas in the group exposed to the anti-Hsp70 without hyperthermia it was significantly diminished. Hyperthermia also caused disintegration of compact status of the nucleoli. In presence of anti-Hsp 70, the structural changes, described within the nucleoli during hyperthermia, were not observed. In conclusion, these results document ultrastructural changes in cell organelles of rabbit preimplantation embryo caused by hyperthermia, and also changes in the nucleolar structures, at which presence of Hsp-70 inhibit these changes. © 2012 Blackwell Verlag GmbH.

A cytochemical note on nucleoli of granulocytic precursors and granulocytes in patients suffering from the refractory anemia with excess blasts (RAEB) of the myelodysplastic syndrome (MDS).

PubMed

Smetana, K; Jirásková, I; Malasková, V; Cermák, J

2002-01-01

Nucleoli were studied in the proliferation as well as maturation granulopoietic compartment in patients suffering from refractory anemia with excess blasts (RAEB) of the myelodysplastic syndrome (MDS) by means of simple cytochemical procedures for the demonstration of nucleolar RNA and silver stained proteins of nucleolus organizer regions. Regardless of the procedure used for the nucleolar visualization, early stages of the granulopoietic compartment and particularly myeloblasts of RAEB patients were characterized by reduction of the nucleolar number expressed by the nucleolar coefficient the values of which resembled those described previously in acute myeloid leukemias. The reduced values of the nucleolar coefficient of these cells in silver stained specimens of RAEB patients were accompanied by a decreased number of clusters of silver stained particles representing interphasic silver stained nucleolus organizer regions (AgNORs). The reduction of these clusters was also described previously in leukemic cells. In addition, the differences in the values of the nucleolar coefficient of granulocytic precursors between specimens stained for RNA and those stained with the silver reaction might reflect changing composition and proportions of nucleolar components in the course of the granulocytic development.

Fluctuations and synchrony of RNA synthesis in nucleoli.

PubMed

Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N

2015-06-01

Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.

Reproduction of the FC/DFC units in nucleoli.

PubMed

Smirnov, Evgeny; Hornáček, Matúš; Kováčik, Lubomír; Mazel, Tomáš; Schröfel, Adam; Svidenská, Silvie; Skalníková, Magdalena; Bartová, Eva; Cmarko, Dušan; Raška, Ivan

2016-04-25

The essential structural components of the nucleoli, Fibrillar Centers (FC) and Dense Fibrillar Components (DFC), together compose FC/DFC units, loci of rDNA transcription and early RNA processing. In the present study we followed cell cycle related changes of these units in 2 human sarcoma derived cell lines with stable expression of RFP-PCNA (the sliding clamp protein) and GFP-RPA43 (a subunit of RNA polymerase I, pol I) or GFP-fibrillarin. Correlative light and electron microscopy analysis showed that the pol I and fibrillarin positive nucleolar beads correspond to individual FC/DFC units. In vivo observations showed that at early S phase, when transcriptionally active ribosomal genes were replicated, the number of the units in each cell increased by 60-80%. During that period the units transiently lost pol I, but not fibrillarin. Then, until the end of interphase, number of the units did not change, and their duplication was completed only after the cell division, by mid G1 phase. This peculiar mode of reproduction suggests that a considerable subset of ribosomal genes remain transcriptionally silent from mid S phase to mitosis, but become again active in the postmitotic daughter cells.

X-ray microimaging of cisplatin distribution in ovarian cancer cells

NASA Astrophysics Data System (ADS)

Kiyozuka, Yasuhiko; Takemoto, Kuniko; Yamamoto, Akitsugu; Guttmann, Peter; Tsubura, Airo; Kihara, Hiroshi

2000-05-01

X-ray microscopy has the possibility to be in use for elemental analysis of tissue and cells especially under physiological conditions with high lateral resolution. In X-ray microimaging cisdiamminedichloroplatinum II (cisplatin: CDDP), an anticancer agent, which has a platinum atom at its functional center gives sufficient contrast against organic material at sub-cellular level. We analyzed the enhance effect and intracellular distribution of CDDP in human ovarian cancer cells with the transmission X-ray microscope at BESSY, Berlin. Two human ovarian cancer cell lines (MN-1 and EC) were treated with 1 and 10 μg/ml of CDDP for 4 hours and compared with untreated cells X-ray images of CDDP-treated samples show clearly labeled nucleoli, periphery of the nucleus and mitochondria, in a concentration-dependent manner. CDDP binds to DNA molecules via the formation of intra- or-inter-strand cross-links. Higher contrasts at the periphery of nucleus and nucleoli suggest the distribution of tightly packed heterochromatin. In addition, results show the possibility that CDDP binds to mitochondrial DNA. Biological function of cisplatin is not only the inhibition of DNA replication but is suggested to disturb mitochondrial function and RNA synthesis in the nucleolus.

Nuclear Architecture of Mouse Spermatocytes: Chromosome Topology, Heterochromatin, and Nucleolus.

PubMed

Berrios, Soledad

2017-01-01

The nuclear organization of spermatocytes in meiotic prophase I is primarily determined by the synaptic organization of the bivalents that are bound by their telomeres to the nuclear envelope and described as arc-shaped trajectories through the 3D nuclear space. However, over this basic meiotic organization, a spermatocyte nuclear architecture arises that is based on higher-ordered patterns of spatial associations among chromosomal domains from different bivalents that are conditioned by the individual characteristics of chromosomes and the opportunity for interactions between their domains. Consequently, the nuclear architecture is species-specific and prone to modification by chromosomal rearrangements. This model is valid for the localization of any chromosomal domain in the meiotic prophase nucleus. However, constitutive heterochromatin plays a leading role in shaping nuclear territories. Thus, the nuclear localization of nucleoli depends on the position of NORs in nucleolar bivalents, but the association among nucleolar chromosomes mainly depends on the presence of constitutive heterochromatin that does not affect the expression of the ribosomal genes. Constitutive heterochromatin and nucleoli form complex nuclear territories whose distribution in the nuclear space is nonrandom, supporting the hypothesis regarding the existence of a species-specific nuclear architecture in first meiotic prophase spermatocytes. © 2017 S. Karger AG, Basel.

Pattern multiplicity and fumarate hydratase (FH)/S-(2-succino)-cysteine (2SC) staining but not eosinophilic nucleoli with perinucleolar halos differentiate hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinomas from kidney tumors without FH gene alteration.

PubMed

Muller, Marie; Guillaud-Bataille, Marine; Salleron, Julia; Genestie, Catherine; Deveaux, Sophie; Slama, Abdelhamid; de Paillerets, Brigitte Bressac; Richard, Stéphane; Benusiglio, Patrick R; Ferlicot, Sophie

2018-02-06

Hereditary leiomyomatosis and renal cell carcinoma syndrome is characterized by an increased risk of agressive renal cell carcinoma, often of type 2 papillary histology, and is caused by FH germline mutations. A prominent eosinophilic macronucleolus with a perinucleolar clear halo is distinctive of hereditary leiomyomatosis and renal cell carcinoma syndrome-associated renal cell carcinoma according to the 2012 ISUP and 2016 WHO kidney tumor classification. From an immunohistochemistry perspective, tumors are often FH-negative and S-(2-succino)-cysteine (2SC) positive. We performed a pathology review of 24 renal tumors in 23 FH mutation carriers, and compared them to 12 type 2 papillary renal cell carcinomas from FH wild-type patients. Prominent eosinophilic nucleoli with perinucleolar halos were present in almost all FH-deficient renal cell carcinomas (23/24). Unexpectedly, they were also present in 58% of type 2 papillary renal cell carcinomas from wild-type patients. Renal cell carcinoma in mutation carriers displayed a complex architecture with multiple patterns, typically papillary, tubulopapillary, and tubulocystic, but also sarcomatoid and rhabdoid. Such pattern diversity was not seen in non-carriers. FH/2SC immunohistochemistry was informative as all hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinomas were either FH- or 2SC+. For FH and 2SC immunohistochemistries taken separately, sensitivity of negative anti-FH immunohistochemistry was 87.5% and specificity was 100%. For positive anti-2SC immunohistochemistry, sensitivity, and specificity were 91.7% and 91.7%, respectively. All FH wild-type renal cell carcinoma were FH-positive, and all but one were 2SC-negative. In conclusion, multiplicity of architectural patterns, rhabdoid/sarcomatoid components and combined FH/2SC staining, but not prominent eosinophilic nucleoli with perinucleolar halos, differentiate hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinoma from type 2 papillary renal cell carcinoma with efficient FH gene. Our findings are crucial in identifying who should be referred to Cancer Genetics clinics for genetic counseling and testing.

Detecting and Targeting Oncogenic Myc in Breast Cancer

DTIC Science & Technology

2007-06-01

through an MBII- dependent interaction with TRRAP [40,41]. Inhibition of TRRAP synthesis or function blocks Myc-mediated oncogenesis, establishing an...transcribed by RNAP I and III. In fact, the various components of the ribosomal machinery are synthesised by all three RNA polymerases, RNAP I, II and III... synthesis . Remarkably, the nucleoli are en- larged in cancer cells and several ribosomal proteins are overexpressed in tumours, suggesting a

Chromatin position in human HepG2 cells: although being non-random, significantly changed in daughter cells.

PubMed

Cvacková, Zuzana; Masata, Martin; Stanĕk, David; Fidlerová, Helena; Raska, Ivan

2009-02-01

Mammalian chromosomes occupy chromosome territories within nuclear space the positions of which are generally accepted as non-random. However, it is still controversial whether position of chromosome territories/chromatin is maintained in daughter cells. We addressed this issue and investigated maintenance of various chromatin regions of unknown composition as well as nucleolus-associated chromatin, a significant part of which is composed of nucleolus organizer region-bearing chromosomes. The photoconvertible histone H4-Dendra2 was used to label such regions in transfected HepG2 cells, and its position was followed up to next interphase. The distribution of labeled chromatin in daughter cells exhibited a non-random character. However, its distribution in a vast majority of daughter cells extensively differed from the original ones and the labeled nucleolus-associated chromatin differently located into the vicinity of different nucleoli. Therefore, our results were not consistent with a concept of preservation chromatin position. This conclusion was supported by the finding that the numbers of nucleoli significantly differed between the two daughter cells. Our results support a view that while the transfected daughter HepG2 cells maintain some features of the parental cell chromosome organization, there is also a significant stochastic component associated with reassortment of chromosome territories/chromatin that results in their positional rearrangements.

Localization in the Nucleolus and Coiled Bodies of Protein Subunits of the Ribonucleoprotein Ribonuclease P

PubMed Central

Jarrous, Nayef; Wolenski, Joseph S.; Wesolowski, Donna; Lee, Christopher; Altman, Sidney

1999-01-01

The precise location of the tRNA processing ribonucleoprotein ribonuclease P (RNase P) and the mechanism of its intranuclear distribution have not been completely delineated. We show that three protein subunits of human RNase P (Rpp), Rpp14, Rpp29 and Rpp38, are found in the nucleolus and that each can localize a reporter protein to nucleoli of cells in tissue culture. In contrast to Rpp38, which is uniformly distributed in nucleoli, Rpp14 and Rpp29 are confined to the dense fibrillar component. Rpp29 and Rpp38 possess functional, yet distinct domains required for subnucleolar localization. The subunit Rpp14 lacks such a domain and appears to be dependent on a piggyback process to reach the nucleolus. Biochemical analysis suggests that catalytically active RNase P exists in the nucleolus. We also provide evidence that Rpp29 and Rpp38 reside in coiled bodies, organelles that are implicated in the biogenesis of several other small nuclear ribonucleoproteins required for processing of precursor mRNA. Because some protein subunits of RNase P are shared by the ribosomal RNA processing ribonucleoprotein RNase MRP, these two evolutionary related holoenzymes may share common intranuclear localization and assembly pathways to coordinate the processing of tRNA and rRNA precursors. PMID:10444065

Malignant perivascular epithelioid cell tumor of the kidney with rare pulmonary and ileum metastases

PubMed Central

Shi, Huijuan; Cao, Qinghua; Li, Hui; Zhen, Tiantian; Lai, Yingrong; Han, Anjia

2014-01-01

Aims: To report one case of malignant perivascular epithelioid cell tumor (PEComa) of the kidney with rare pulmonary and ileum metastases and analyze its clinicopathological features. Methods: We analyzed the clinicopathological features of one case of malignant PEComa of the kidney with pulmonary and ileum metastases. Immunohistochemistry staining was performed. Results: The patient was a 48-year-old man with a renal mass approximately 14 cm × 11 cm × 8 cm in size. Microscopically, the tumor was mainly composed of polygonal epithelioid cells with dense eosinophilic cytoplasm and round nuclei with small nucleoli. Focal tumor cells showed pleomorphism with multinucleated giant cells and prominent nucleoli. The tumor cells nests were surrounded by thick-walled irregular blood vessels. Focal fat cells were found within the tumor. Hemorrhage and coagulative necrosis were also present. The tumor cells were positive for vimentin, HMB45, and Melan-A, and focally positive for SMA and S-100 protein. After 5 years and 5.6 years of nephrectomy, the tumor metastasized to the right lung and ileum, respectively. Conclusion: We first reported one case of malignant PEComa of the kidney with pulmonary and ileum metastases. Metastatic PEComa of the lung and ileum should differentiate from primary carcinoma, metastatic carcinoma, malignant melanoma, and gastrointestinal stromal tumor. PMID:25337291

Malignant perivascular epithelioid cell tumor of the kidney with rare pulmonary and ileum metastases.

PubMed

Shi, Huijuan; Cao, Qinghua; Li, Hui; Zhen, Tiantian; Lai, Yingrong; Han, Anjia

2014-01-01

To report one case of malignant perivascular epithelioid cell tumor (PEComa) of the kidney with rare pulmonary and ileum metastases and analyze its clinicopathological features. We analyzed the clinicopathological features of one case of malignant PEComa of the kidney with pulmonary and ileum metastases. Immunohistochemistry staining was performed. The patient was a 48-year-old man with a renal mass approximately 14 cm × 11 cm × 8 cm in size. Microscopically, the tumor was mainly composed of polygonal epithelioid cells with dense eosinophilic cytoplasm and round nuclei with small nucleoli. Focal tumor cells showed pleomorphism with multinucleated giant cells and prominent nucleoli. The tumor cells nests were surrounded by thick-walled irregular blood vessels. Focal fat cells were found within the tumor. Hemorrhage and coagulative necrosis were also present. The tumor cells were positive for vimentin, HMB45, and Melan-A, and focally positive for SMA and S-100 protein. After 5 years and 5.6 years of nephrectomy, the tumor metastasized to the right lung and ileum, respectively. We first reported one case of malignant PEComa of the kidney with pulmonary and ileum metastases. Metastatic PEComa of the lung and ileum should differentiate from primary carcinoma, metastatic carcinoma, malignant melanoma, and gastrointestinal stromal tumor.

Nucleolar-nucleoplasmic shuttling of TARG1 and its control by DNA damage-induced poly-ADP-ribosylation and by nucleolar transcription.

PubMed

Bütepage, Mareike; Preisinger, Christian; von Kriegsheim, Alexander; Scheufen, Anja; Lausberg, Eva; Li, Jinyu; Kappes, Ferdinand; Feederle, Regina; Ernst, Sabrina; Eckei, Laura; Krieg, Sarah; Müller-Newen, Gerhard; Rossetti, Giulia; Feijs, Karla L H; Verheugd, Patricia; Lüscher, Bernhard

2018-04-30

Macrodomains are conserved protein folds associated with ADP-ribose binding and turnover. ADP-ribosylation is a posttranslational modification catalyzed primarily by ARTD (aka PARP) enzymes in cells. ARTDs transfer either single or multiple ADP-ribose units to substrates, resulting in mono- or poly-ADP-ribosylation. TARG1/C6orf130 is a macrodomain protein that hydrolyzes mono-ADP-ribosylation and interacts with poly-ADP-ribose chains. Interactome analyses revealed that TARG1 binds strongly to ribosomes and proteins associated with rRNA processing and ribosomal assembly factors. TARG1 localized to transcriptionally active nucleoli, which occurred independently of ADP-ribose binding. TARG1 shuttled continuously between nucleoli and nucleoplasm. In response to DNA damage, which activates ARTD1/2 (PARP1/2) and promotes synthesis of poly-ADP-ribose chains, TARG1 re-localized to the nucleoplasm. This was dependent on the ability of TARG1 to bind to poly-ADP-ribose. These findings are consistent with the observed ability of TARG1 to competitively interact with RNA and PAR chains. We propose a nucleolar role of TARG1 in ribosome assembly or quality control that is stalled when TARG1 is re-located to sites of DNA damage.

Subcellular Fractionation and Localization Studies Reveal a Direct Interaction of the Fragile X Mental Retardation Protein (FMRP) with Nucleolin

PubMed Central

Taha, Mohamed S.; Nouri, Kazem; Milroy, Lech G.; Moll, Jens M.; Herrmann, Christian; Brunsveld, Luc; Piekorz, Roland P.; Ahmadian, Mohammad R.

2014-01-01

Fragile X mental Retardation Protein (FMRP) is a well-known regulator of local translation of its mRNA targets in neurons. However, despite its ubiquitous expression, the role of FMRP remains ill-defined in other cell types. In this study we investigated the subcellular distribution of FMRP and its protein complexes in HeLa cells using confocal imaging as well as detergent-free fractionation and size exclusion protocols. We found FMRP localized exclusively to solid compartments, including cytosolic heavy and light membranes, mitochondria, nuclear membrane and nucleoli. Interestingly, FMRP was associated with nucleolin in both a high molecular weight ribosomal and translation-associated complex (≥6 MDa) in the cytosol, and a low molecular weight complex (∼200 kDa) in the nucleoli. Consistently, we identified two functional nucleolar localization signals (NoLSs) in FMRP that are responsible for a strong nucleolar colocalization of the C-terminus of FMRP with nucleolin, and a direct interaction of the N-terminus of FMRP with the arginine-glycine-glycine (RGG) domain of nucleolin. Taken together, we propose a novel mechanism by which a transient nucleolar localization of FMRP underlies a strong nucleocytoplasmic translocation, most likely in a complex with nucleolin and possibly ribosomes, in order to regulate translation of its target mRNAs. PMID:24658146

Nepro is localized in the nucleolus and essential for preimplantation development in mice.

PubMed

Hashimoto, Masakazu; Sato, Tatsuya; Muroyama, Yuko; Fujimura, Lisa; Hatano, Masahiko; Saito, Tetsuichiro

2015-09-01

We generated knockout (KO) mice of Nepro, which has been shown to be necessary to maintain neural progenitor cells downstream of Notch in the mouse developing neocortex by using knockdown experiments, to explore its function in embryogenesis. Nepro KO embryos were morphologically indistinguishable from wild type (WT) embryos until the morula stage but failed in blastocyst formation, and many cells of the KO embryos resulted in apoptosis. We found that Nepro was localized in the nucleolus at the blastocyst stage. The number of nucleolus precursor bodies (NPBs) and nucleoli per nucleus was significantly higher in Nepro KO embryos compared with WT embryos later than the 2-cell stage. Furthermore, at the morula stage, whereas 18S rRNA and ribosomal protein S6 (rpS6), which are components of the ribosome, were distributed to the cytoplasm in WT embryos, they were mainly localized in the nucleoli in Nepro KO embryos. In addition, in Nepro KO embryos, the amount of the mitochondria-associated p53 protein increased, and Cytochrome c was distributed in the cytoplasm. These findings indicate that Nepro is a nucleolus-associated protein, and its loss leads to the apoptosis before blastocyst formation in mice. © 2015 Japanese Society of Developmental Biologists.

Dynamic localisation of mature microRNAs in Human nucleoli is influenced by exogenous genetic materials.

PubMed

Li, Zhou Fang; Liang, Yi Min; Lau, Pui Ngan; Shen, Wei; Wang, Dai Kui; Cheung, Wing Tai; Xue, Chun Jason; Poon, Lit Man; Lam, Yun Wah

2013-01-01

Although microRNAs are commonly known to function as a component of RNA-induced silencing complexes in the cytoplasm, they have been detected in other organelles, notably the nucleus and the nucleolus, of mammalian cells. We have conducted a systematic search for miRNAs in HeLa cell nucleoli, and identified 11 abundant miRNAs with a high level of nucleolar accumulation. Through in situ hybridisation, we have localised these miRNAs, including miR-191 and miR-484, in the nucleolus of a diversity of human and rodent cell lines. The nucleolar association of these miRNAs is resistant to various cellular stresses, but highly sensitive to the presence of exogenous nucleic acids. Introduction of both single- and double-stranded DNA as well as double stranded RNA rapidly induce the redistribution of nucleolar miRNAs to the cytoplasm. A similar change in subcellular distribution is also observed in cells infected with the influenza A virus. The partition of miRNAs between the nucleolus and the cytoplasm is affected by Leptomycin B, suggesting a role of Exportin-1 in the intracellular shuttling of miRNAs. This study reveals a previously unknown aspect of miRNA biology, and suggests a possible link between these small noncoding RNAs and the cellular management of foreign genetic materials.

In vivo dynamics and kinetics of pKi-67: transition from a mobile to an immobile form at the onset of anaphase.

PubMed

Saiwaki, Takuya; Kotera, Ippei; Sasaki, Mitsuho; Takagi, Masatoshi; Yoneda, Yoshihiro

2005-08-01

A cell proliferation marker protein, pKi-67, distributes to the chromosome periphery during mitosis and nucleolar heterochromatin in the interphase. We report here on the structural domains of pKi-67 that are required for its correct distribution. While both the LR domain and the conserved domain were involved in localization to the nucleolar heterochromatin, both the LR domain and the Ki-67 repeat domain were required for its distribution to the mitotic chromosome periphery. Using in vivo time-lapse microscopy, GFP-pKi-67 was dynamically tracked from the mitotic chromosome periphery to reforming nucleoli via prenucleolar bodies (PNBs). The signals in PNBs then moved towards and fused into the reforming nucleoli with a thin string-like fluorescence during early G1 phase. An analysis of the in vivo kinetics of pKi-67 using photobleaching indicated that the association of pKi-67 with chromatin was progressively altered from "loose" to "tight" after the onset of anaphase. These findings indicate that pKi-67 dynamically alters the nature of the interaction with chromatin structure during the cell cycle, which is closely related to the reformation process of the interphase nucleolar chromatin.

Plant U13 orthologues and orphan snoRNAs identified by RNomics of RNA from Arabidopsis nucleoli

PubMed Central

Kim, Sang Hyon; Spensley, Mark; Choi, Seung Kook; Calixto, Cristiane P. G.; Pendle, Ali F.; Koroleva, Olga; Shaw, Peter J.; Brown, John W. S.

2010-01-01

Small nucleolar RNAs (snoRNAs) and small Cajal body-specific RNAs (scaRNAs) are non-coding RNAs whose main function in eukaryotes is to guide the modification of nucleotides in ribosomal and spliceosomal small nuclear RNAs, respectively. Full-length sequences of Arabidopsis snoRNAs and scaRNAs have been obtained from cDNA libraries of capped and uncapped small RNAs using RNA from isolated nucleoli from Arabidopsis cell cultures. We have identified 31 novel snoRNA genes (9 box C/D and 22 box H/ACA) and 15 new variants of previously described snoRNAs. Three related capped snoRNAs with a distinct gene organization and structure were identified as orthologues of animal U13snoRNAs. In addition, eight of the novel genes had no complementarity to rRNAs or snRNAs and are therefore putative orphan snoRNAs potentially reflecting wider functions for these RNAs. The nucleolar localization of a number of the snoRNAs and the localization to nuclear bodies of two putative scaRNAs was confirmed by in situ hybridization. The majority of the novel snoRNA genes were found in new gene clusters or as part of previously described clusters. These results expand the repertoire of Arabidopsis snoRNAs to 188 snoRNA genes with 294 gene variants. PMID:20081206

Preliminary observations on polar body extrusion and pronuclear formation in human oocytes using time-lapse video cinematography.

PubMed

Payne, D; Flaherty, S P; Barry, M F; Matthews, C D

1997-03-01

In this study, we have used time-lapse video cinematography to study fertilization in 50 human oocytes that had undergone intracytoplasmic sperm injection (ICSI). Time-lapse recording commenced shortly after ICSI and proceeded for 17-20 h. Oocytes were cultured in an environmental chamber which was maintained under standard culture conditions. Overall, 38 oocytes (76%) were fertilized normally, and the fertilization rate and embryo quality were not significantly different from 487 sibling oocytes cultured in a conventional incubator. Normal fertilization followed a defined course of events, although the timing of these events varied markedly between oocytes. In 35 of the 38 fertilized oocytes (92%), there were circular waves of granulation within the ooplasm which had a periodicity of 20-53 min. The sperm head decondensed during this granulation phase. The second polar body was then extruded, and this was followed by the central formation of the male pronucleus. The female pronucleus formed in the cytoplasm adjacent to the second polar body at the same time as, or slightly after, the male pronucleus, and was subsequently drawn towards the male pronucleus until the two abutted. Both pronuclei then increased in size, the nucleoli moved around within the pronuclei and some nucleoli coalesced. During pronuclear growth, the organelles contracted from the cortex towards the centre of the oocyte, leaving a clear cortical zone. The oocyte decreased in diameter from 112 to 106 microm (P < 0.0001) during the course of the observation period. The female pronucleus was significantly smaller in diameter than the male pronucleus (24.1 and 22.4 microm respectively, P = 0.008) and contained fewer nucleoli (4.2 and 7.0 respectively, P < 0.0001). After time-lapse recording, oocytes were cultured for 48 h prior to embryo transfer or cryopreservation. Embryo quality was related to fertilization events and periodicity of the cytoplasmic wave, and it was found that good quality embryos arose from oocytes that had more uniform timing from injection to pronuclear abuttal and tended to have a longer cytoplasmic wave. In conclusion, we have shown that time-lapse video cinematography is an excellent tool for studying fertilization and early embryo development, and have demonstrated that human fertilization comprises numerous complex dynamic events.

Subcutaneous haemangiosarcoma in a cockatiel (Nymphicus hollandicus).

PubMed

Sledge, D G; Radi, Z A; Miller, D L; Lynn, B S

2006-08-01

An ulcerated, 1 x 0.5 cm, subcutaneous mass on the craniolateral aspect of the right tibiotarsus of a 4-year-old male cockatiel was removed. Histologically, the neoplasm was non-encapsulated, infiltrative and composed of irregular vascular channels lined by branching and variably sized spindle-shaped cells with large vesicular nuclei, prominent nucleoli and rare mitoses. Surrounding these vascular channels were fibroblasts and mixed inflammatory cells. Neoplastic cells had diffuse immunoreactivity to factor VIII supporting a diagnosis of haemangiosarcoma.

Dynamic Localisation of Mature MicroRNAs in Human Nucleoli is Influenced by Exogenous Genetic Materials

PubMed Central

Li, Zhou Fang; Liang, Yi Min; Lau, Pui Ngan; Shen, Wei; Wang, Dai Kui; Cheung, Wing Tai; Xue, Chun Jason; Poon, Lit Man; Lam, Yun Wah

2013-01-01

Although microRNAs are commonly known to function as a component of RNA-induced silencing complexes in the cytoplasm, they have been detected in other organelles, notably the nucleus and the nucleolus, of mammalian cells. We have conducted a systematic search for miRNAs in HeLa cell nucleoli, and identified 11 abundant miRNAs with a high level of nucleolar accumulation. Through in situ hybridisation, we have localised these miRNAs, including miR-191 and miR-484, in the nucleolus of a diversity of human and rodent cell lines. The nucleolar association of these miRNAs is resistant to various cellular stresses, but highly sensitive to the presence of exogenous nucleic acids. Introduction of both single- and double-stranded DNA as well as double stranded RNA rapidly induce the redistribution of nucleolar miRNAs to the cytoplasm. A similar change in subcellular distribution is also observed in cells infected with the influenza A virus. The partition of miRNAs between the nucleolus and the cytoplasm is affected by Leptomycin B, suggesting a role of Exportin-1 in the intracellular shuttling of miRNAs. This study reveals a previously unknown aspect of miRNA biology, and suggests a possible link between these small noncoding RNAs and the cellular management of foreign genetic materials. PMID:23940654

Resistance to maribavir is associated with the exclusion of pUL27 from nucleoli during human cytomegalovirus infection

PubMed Central

Hakki, Morgan; Drummond, Coyne; Houser, Benjamin; Marousek, Gail; Chou, Sunwen

2011-01-01

Select mutations in the human cytomegalovirus (HCMV) gene UL27 confer low-grade resistance to the HCMV UL97 kinase inhibitor maribavir (MBV). It has been reported that the 608-amino acid UL27 gene product (pUL27) normally localizes to cell nuclei and nucleoli, whereas its truncation at codon 415, as found in a MBV-resistant mutant, results in cytoplasmic localization. We now show that in the context of full-length pUL27, diverse single amino acid substitutions associated with MBV resistance result in loss of its nucleolar localization when visualized after transient transfection, whereas substitutions representing normal interstrain polymorphism had no such effect. The same differences in localization were observed during a complete infection cycle with recombinant HCMV strains over-expressing full-length fluorescent pUL27 variants. Nested UL27 C-terminal truncation expression plasmids showed that amino acids 596–599 were required for the nucleolar localization of pUL27. These results indicate that the loss of a nucleolar function of pUL27 may contribute to MBV resistance, and that the nucleolar localization of pUL27 during HCMV infection depends not only on a carboxy-terminal domain but also on a property of pUL27 that is affected by MBV-resistant mutations, such as an interaction with component(s) of the nucleolus. PMID:21906628

Principles of protein targeting to the nucleolus.

PubMed

Martin, Robert M; Ter-Avetisyan, Gohar; Herce, Henry D; Ludwig, Anne K; Lättig-Tünnemann, Gisela; Cardoso, M Cristina

2015-01-01

The nucleolus is the hallmark of nuclear compartmentalization and has been shown to exert multiple roles in cellular metabolism besides its main function as the place of rRNA synthesis and assembly of ribosomes. Nucleolar proteins dynamically localize and accumulate in this nuclear compartment relative to the surrounding nucleoplasm. In this study, we have assessed the molecular requirements that are necessary and sufficient for the localization and accumulation of peptides and proteins inside the nucleoli of living cells. The data showed that positively charged peptide entities composed of arginines alone and with an isoelectric point at and above 12.6 are necessary and sufficient for mediating significant nucleolar accumulation. A threshold of 6 arginines is necessary for peptides to accumulate in nucleoli, but already 4 arginines are sufficient when fused within 15 amino acid residues of a nuclear localization signal of a protein. Using a pH sensitive dye, we found that the nucleolar compartment is particularly acidic when compared to the surrounding nucleoplasm and, hence, provides the ideal electrochemical environment to bind poly-arginine containing proteins. In fact, we found that oligo-arginine peptides and GFP fusions bind RNA in vitro. Consistent with RNA being the main binding partner for arginines in the nucleolus, we found that the same principles apply to cells from insects to man, indicating that this mechanism is highly conserved throughout evolution.

[The characteristic of protein biosynthesis in brain neurons with chronic alcohol intoxication].

PubMed

Morozov, Yu E; Velenko, P S

2018-01-01

The objective of the present study was to evaluate the possibilities for the use of the changes in the AgNOR staining patterns in the neurons of the dorsal raphe nucleus (DRN) for the purposes of the medical differential diagnostics of the cases of death from chronic alcohol intoxication. We elucidated the characteristics of the activity of protein biosynthesis including the number and the area of the nucleoli in the nuclei of the neurons of the individuals who had died from chronic alcohol intoxication (n=20) in comparison with the subjects of the control group (n=13). To reveal the morphological structures associated with protein biosynthesis in the nucleoli of the serotoninergic neurons of the dorsal raphe nucleus in the brain, the histological preparations were stained with the use of the silver-staining technique for nucleolar organizer regions (AgNOR). The comparative statistical analysis of the results thus obtained with the calculated confidence coefficients was carried out. The aggregated analysis of all the dorsal raphe subnuclei revealed the impairment of the AgNOR staining characteristics in the neurons of the subjects who had died from chronic alcohol intoxication in comparison with those of the subjects comprising the control group. It is concluded that the results of the study can be used for differential diagnostics of deaths from chronic alcohol intoxication and other causes.

Nucleolar structure across evolution: the transition between bi- and tri-compartmentalized nucleoli lies within the class Reptilia.

PubMed

Lamaye, Françoise; Galliot, Sonia; Alibardi, Lorenzo; Lafontaine, Denis L J; Thiry, Marc

2011-05-01

Two types of nucleolus can be distinguished among eukaryotic cells: a tri-compartmentalized nucleolus in amniotes and a bi-compartmentalized nucleolus in all the others. However, though the nucleolus' ultrastructure is well characterized in mammals and birds, it has been so far much less studied in reptiles. In this work, we examined the ultrastructural organization of the nucleolus in various tissues from different reptilian species (three turtles, three lizards, two crocodiles, and three snakes). Using cytochemical and immunocytological methods, we showed that in reptiles both types of nucleolus are present: a bi-compartmentalized nucleolus in turtles and a tri-compartmentalized nucleolus in the other species examined in this study. Furthermore, in a given species, the same type of nucleolus is present in all the tissues, however, the importance and the repartition of those nucleolar components could vary from one tissue to another. We also reveal that, contrary to the mammalian nucleolus, the reptilian fibrillar centers contain small clumps of condensed chromatin and that their surrounding dense fibrillar component is thicker. Finally, we also report that Cajal bodies are detected in reptiles. Altogether, we believe that these results have profound evolutionarily implications since they indicate that the point of transition between bipartite and tripartite nucleoli lies at the emergence of the amniotes within the class Reptilia. Copyright © 2011 Elsevier Inc. All rights reserved.

RRP1B Targets PP1 to Mammalian Cell Nucleoli and Is Associated with Pre-60S Ribosomal Subunits

PubMed Central

Chamousset, Delphine; De Wever, Veerle; Moorhead, Greg B.; Chen, Yan; Boisvert, Francois-Michel; Lamond, Angus I.

2010-01-01

A pool of protein phosphatase 1 (PP1) accumulates within nucleoli and accounts for a large fraction of the serine/threonine protein phosphatase activity in this subnuclear structure. Using a combination of fluorescence imaging with quantitative proteomics, we mapped the subnuclear localization of the three mammalian PP1 isoforms stably expressed as GFP-fusions in live cells and identified RRP1B as a novel nucleolar targeting subunit that shows a specificity for PP1β and PP1γ. RRP1B, one of two mammalian orthologues of the yeast Rrp1p protein, shows an RNAse-dependent localization to the granular component of the nucleolus and distributes in a similar manner throughout the cell cycle to proteins involved in later steps of rRNA processing. Quantitative proteomic analysis of complexes containing both RRP1B and PP1γ revealed enrichment of an overlapping subset of large (60S) ribosomal subunit proteins and pre-60S nonribosomal proteins involved in mid-late processing. Targeting of PP1 to this complex by RRP1B in mammalian cells is likely to contribute to modulation of ribosome biogenesis by mechanisms involving reversible phosphorylation events, thus playing a role in the rapid transduction of cellular signals that call for regulation of ribosome production in response to cellular stress and/or changes in growth conditions. PMID:20926688

Rhabdoid Meningioma of Brain - A Rare Aggressive Tumor

PubMed Central

Mondal, Sajeeb; Pradhan, Rajashree; Pal, Subrata; Chatterjee, Sharmistha; Bandyapadhyay, Arindam; Bhattacharyya, Debosmita

2017-01-01

Rhabdoid meningioma is a rare aggressive variant of meningioma, regarded as WHO Grade III type. Histologically and cytologically, it is distinctive type having abundant eosinophilic cytoplasm, cytoplasmic inclusion with eccentrically placed vesicular nuclei and prominent nucleoli. High recurrence rate and poor outcome are important features. Here, we are presenting a rare case of rhabdoid meningioma found in a recurrent meningioma of the posterior fossa in a middle-aged female. We emphasized the squash cytology and histology finding of the rare neoplasm. PMID:28900335

An Imaging System to Monitor Efficacy of Adenovirus-Based Virotherapy Agents

DTIC Science & Technology

2006-02-01

The essence of oncolytic ARTICLE IN PRESS J. Li et al. / Virology xx (2005) – 9virus function is to infect and kill target cells, a concept...protein– protein interactions in living animals. Methods 29 (1), 110–122 (Jan.) Meulenbroek, R.A., Sargent, K.L., Lunde, J., Jasmin , B.J., Parks, R.J...associated with nucleoli. J Gen Virol 79 ( Pt 7), 1671-1675. Meulenbroek, R. A., Sargent, K. L., Lunde, J., Jasmin , B. J., and Parks, R. J. (2004). Use

Self-Affinity and Lacunarity of Chromatin Texture in Benign and Malignant Breast Epithelial Cell Nuclei

NASA Astrophysics Data System (ADS)

Einstein, Andrew J.; Wu, Hai-Shan; Gil, Joan

1998-01-01

Methods are presented for characterizing the self-affinity and lacunarity of arbitrarily shaped images. Chromatin appearance in breast epithelial cell nuclei is shown to be statistically self-affine. Spectral and Minkowski dimensions are lesser in nuclei of malignant cases than in nuclei of benign cases, and lacunarity further quantifies morphologic differences such as chromatin clumping and nucleoli. Fractal texture features are used as the basis for an accurate cytologic diagnosis of breast cancer.

Deep ultraviolet resonant Raman imaging of a cell

NASA Astrophysics Data System (ADS)

Kumamoto, Yasuaki; Taguchi, Atsushi; Smith, Nicholas Isaac; Kawata, Satoshi

2012-07-01

We report the first demonstration of deep ultraviolet (DUV) Raman imaging of a cell. Nucleotide distributions in a HeLa cell were observed without any labeling at 257 nm excitation with resonant bands attributable to guanine and adenine. Obtained images represent DNA localization at nucleoli in the nucleus and RNA distribution in the cytoplasm. The presented technique extends the potential of Raman microscopy as a tool to selectively probe nucleic acids in a cell with high sensitivity due to resonance.

Cationic Organochalcogen with Monomer/Excimer Emissions for Dual-Color Live Cell Imaging and Cell Damage Diagnosis.

PubMed

Chao, Xi-Juan; Wang, Kang-Nan; Sun, Li-Li; Cao, Qian; Ke, Zhuo-Feng; Cao, Du-Xia; Mao, Zong-Wan

2018-04-25

Studies on the development of fluorescent organic molecules with different emission colors for imaging of organelles and their biomedical application are gaining lots of focus recently. Here, we report two cationic organochalcogens 1 and 2, both of which exhibit very weak green emission (Φ 1 = 0.12%; Φ 2 = 0.09%) in dilute solution as monomers, but remarkably enhanced green emission upon interaction with nucleic acids and large red-shifted emission in aggregate state by the formation of excimers at high concentration. More interestingly, the monomer emission and excimer-like emission can be used for dual color imaging of different organelles. Upon passively diffusing into cells, both probes selectively stain nucleoli with strong green emission upon 488 nm excitation, whereas upon 405 nm excitation, a completely different stain pattern by staining lysosomes (for 1) or mitochondria (for 2) with distinct red emission is observed because of the highly concentrated accumulation in these organelles. Studies on the mechanism of the accumulation in lysosomes (for 1) or mitochondria (for 2) found that the accumulations of the probes are dependent on the membrane permeabilization, which make the probes have great potential in diagnosing cell damage by sensing lysosomal or mitochondrial membrane permeabilization. The study is demonstrative, for the first time, of two cationic molecules for dual-color imaging nucleoli and lysosomes (1)/mitochondria (2) simultaneously in live cell based on monomer and excimer-like emission, respectively, and more importantly, for diagnosing cell damage.

Ultrastructural and Molecular Analyses Reveal Enhanced Nucleolar Activity in Medicago truncatula Cells Overexpressing the MtTdp2α Gene

PubMed Central

Macovei, Anca; Faè, Matteo; Biggiogera, Marco; de Sousa Araújo, Susana; Carbonera, Daniela; Balestrazzi, Alma

2018-01-01

The role of tyrosyl-DNA phosphodiesterase 2 (Tdp2) involved in the repair of 5′-end-blocking DNA lesions is still poorly explored in plants. To gain novel insights, Medicago truncatula suspension cultures overexpressing the MtTdp2α gene (Tdp2α-13C and Tdp2α-28 lines, respectively) and a control (CTRL) line carrying the empty vector were investigated. Transmission electron microscopy (TEM) revealed enlarged nucleoli (up to 44% expansion of the area, compared to CTRL), the presence of nucleolar vacuoles, increased frequency of multinucleolate cells (up to 4.3-fold compared to CTRL) and reduced number of ring-shaped nucleoli in Tdp2α-13C and Tdp2α-28 lines. Ultrastructural data suggesting for enhanced nucleolar activity in MtTdp2α-overexpressing lines were integrated with results from bromouridine incorporation. The latter revealed an increase of labeled transcripts in both Tdp2α-13C and Tdp2α-28 cells, within the nucleolus and in the extra-nucleolar region. MtTdp2α-overexpressing cells showed tolerance to etoposide, a selective inhibitor of DNA topoisomerase II, as evidenced by DNA diffusion assay. TEM analysis revealed etoposide-induced rearrangements within the nucleolus, resembling the nucleolar caps observed in animal cells under transcription impairment. Based on these findings it is evident that MtTdp2α-overexpression enhances nucleolar activity in plant cells. PMID:29868059

Label-free imaging of mammalian cell nucleoli by Raman microspectroscopy.

PubMed

Schulze, H Georg; Konorov, Stanislav O; Piret, James M; Blades, Michael W; Turner, Robin F B

2013-06-21

The nucleolus is a prominent subnuclear structure whose major function is the transcription and assembly of ribosome subunits. The size of the nucleolus varies with the cell cycle, proliferation rate and stress. Changes in nucleolar size, number, chemical composition, and shape can be used to characterize malignant cells. We used spontaneous Raman microscopy as a label-free technique to examine nucleolar spatial and chemical features. Raman images of the 1003 cm(-1) phenylalanine band revealed large, well-defined subnuclear protein structures in MFC-7 breast cancer cells. The 783 cm(-1) images showed that nucleic acids were similarly distributed, but varied more in intensity, forming observable high-intensity regions. High subnuclear RNA concentrations were observed within some of these regions as shown by 809 cm(-1) Raman band images. Principal component analyses of sub-images and library spectra validated the subnuclear presence of RNA. They also revealed that an actin-like protein covaried with DNA within the nucleolus, a combination that accounted for 64% or more of the spectral variance. Embryonic stem cells are another rapidly proliferating cell type, but their nucleoli were not as large or well defined. Estimating the size of the larger MCF-7 nucleolus was used to show the utility of Raman microscopy for morphometric analyses. It was concluded that imaging based on Raman microscopy provides a promising new method for the study of nucleolar function and organization, in the evaluation of drug and experimental effects on the nucleolus, and in clinical diagnostics and prognostics.

New localization and function of calpain-2 in nucleoli of colorectal cancer cells in ribosomal biogenesis: effect of KRAS status

PubMed Central

Telechea-Fernández, Marcelino; Rodríguez-Fernández, Lucia; García, Concha; Zaragozá, Rosa; Viña, Juan; Cervantes, Andrés; García-Trevijano, Elena R.

2018-01-01

Calpain-2 belongs to a family of pleiotropic Cys-proteases with modulatory rather than degradative functions. Calpain (CAPN) overexpression has been controversially correlated with poor prognosis in several cancer types, including colorectal carcinoma (CRC). However, the mechanisms of substrate-recognition, calpain-2 regulation/deregulation and specific functions in CRC remain elusive. Herein, calpain subcellular distribution was studied as a key event for substrate-recognition and consequently, for calpain-mediated function. We describe a new localization for calpain-2 in the nucleoli of CRC cells. Calpain-2 nucleolar distribution resulted dependent on its enzymatic activity and on the mutational status of KRAS. In KRASWT/- cells serum-starvation induced CAPN2 expression, nucleolar accumulation and increased binding to the rDNA-core promoter and intergenic spacer (IGS), concomitant with a reduction in pre-rRNA levels. Depletion of calpain-2 by specific siRNA prevented pre-rRNA down-regulation after serum removal. Conversely, ribosomal biogenesis proceeded in the absence of serum in unresponsive KRASG13D/- cells whose CAPN2 expression, nucleolar localization and rDNA-occupancy remained unchanged during the time-course of serum starvation. We propose here that nucleolar calpain-2 might be a KRAS-dependent sensor to repress ribosomal biogenesis in growth limiting conditions. Under constitutive activation of the pathway commonly found in CRC, calpain-2 is deregulated and tumor cells become insensitive to the extracellular microenvironment. PMID:29507677

Role of the Box C/D Motif in Localization of Small Nucleolar RNAs to Coiled Bodies and Nucleoli

PubMed Central

Narayanan, Aarthi; Speckmann, Wayne; Terns, Rebecca; Terns, Michael P.

1999-01-01

Small nucleolar RNAs (snoRNAs) are a large family of eukaryotic RNAs that function within the nucleolus in the biogenesis of ribosomes. One major class of snoRNAs is the box C/D snoRNAs named for their conserved box C and box D sequence elements. We have investigated the involvement of cis-acting sequences and intranuclear structures in the localization of box C/D snoRNAs to the nucleolus by assaying the intranuclear distribution of fluorescently labeled U3, U8, and U14 snoRNAs injected into Xenopus oocyte nuclei. Analysis of an extensive panel of U3 RNA variants showed that the box C/D motif, comprised of box C′, box D, and the 3′ terminal stem of U3, is necessary and sufficient for the nucleolar localization of U3 snoRNA. Disruption of the elements of the box C/D motif of U8 and U14 snoRNAs also prevented nucleolar localization, indicating that all box C/D snoRNAs use a common nucleolar-targeting mechanism. Finally, we found that wild-type box C/D snoRNAs transiently associate with coiled bodies before they localize to nucleoli and that variant RNAs that lack an intact box C/D motif are detained within coiled bodies. These results suggest that coiled bodies play a role in the biogenesis and/or intranuclear transport of box C/D snoRNAs. PMID:10397754

New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes.

PubMed

Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L

2015-09-01

Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

A separable domain of the p150 subunit of human chromatin assembly factor-1 promotes protein and chromosome associations with nucleoli.

PubMed

Smith, Corey L; Matheson, Timothy D; Trombly, Daniel J; Sun, Xiaoming; Campeau, Eric; Han, Xuemei; Yates, John R; Kaufman, Paul D

2014-09-15

Chromatin assembly factor-1 (CAF-1) is a three-subunit protein complex conserved throughout eukaryotes that deposits histones during DNA synthesis. Here we present a novel role for the human p150 subunit in regulating nucleolar macromolecular interactions. Acute depletion of p150 causes redistribution of multiple nucleolar proteins and reduces nucleolar association with several repetitive element-containing loci. Of note, a point mutation in a SUMO-interacting motif (SIM) within p150 abolishes nucleolar associations, whereas PCNA or HP1 interaction sites within p150 are not required for these interactions. In addition, acute depletion of SUMO-2 or the SUMO E2 ligase Ubc9 reduces α-satellite DNA association with nucleoli. The nucleolar functions of p150 are separable from its interactions with the other subunits of the CAF-1 complex because an N-terminal fragment of p150 (p150N) that cannot interact with other CAF-1 subunits is sufficient for maintaining nucleolar chromosome and protein associations. Therefore these data define novel functions for a separable domain of the p150 protein, regulating protein and DNA interactions at the nucleolus. © 2014 Smith et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Human SUV3 helicase regulates growth rate of the HeLa cells and can localize in the nucleoli.

PubMed

Szewczyk, Maciej; Fedoryszak-Kuśka, Natalia; Tkaczuk, Katarzyna; Dobrucki, Jurek; Waligórska, Agnieszka; Stępień, Piotr P

2017-01-01

The human SUV3 helicase (SUV3, hSUV3, SUPV3L1) is a DNA/RNA unwinding enzyme belonging to the class of DexH-box helicases. It localizes predominantly in the mitochondria, where it forms an RNA-degrading complex called mitochondrial degradosome with exonuclease PNP (polynucleotide phosphorylase). Association of this complex with the polyA polymerase can modulate mitochondrial polyA tails. Silencing of the SUV3 gene was shown to inhibit the cell cycle and to induce apoptosis in human cell lines. However, since small amounts of the SUV3 helicase were found in the cell nuclei, it was not clear whether the observed phenotypes of SUV3 depletion were of mitochondrial or nuclear origin. In order to answer this question we have designed gene constructs able to inhibit the SUV3 activity exclusively in the cell nuclei. The results indicate that the observed growth rate impairment upon SUV3 depletion is due to its nuclear function(s). Unexpectedly, overexpression of the nuclear-targeted wild-type copies of the SUV3 gene resulted in a higher growth rate. In addition, we demonstrate that the SUV3 helicase can be found in the HeLa cell nucleoli, but it is not detectable in the DNA-repair foci. Our results indicate that the nucleolar-associated human SUV3 protein is an important factor in regulation of the cell cycle.

New localization and function of calpain-2 in nucleoli of colorectal cancer cells in ribosomal biogenesis: effect of KRAS status.

PubMed

Telechea-Fernández, Marcelino; Rodríguez-Fernández, Lucia; García, Concha; Zaragozá, Rosa; Viña, Juan; Cervantes, Andrés; García-Trevijano, Elena R

2018-02-06

Calpain-2 belongs to a family of pleiotropic Cys-proteases with modulatory rather than degradative functions. Calpain (CAPN) overexpression has been controversially correlated with poor prognosis in several cancer types, including colorectal carcinoma (CRC). However, the mechanisms of substrate-recognition, calpain-2 regulation/deregulation and specific functions in CRC remain elusive. Herein, calpain subcellular distribution was studied as a key event for substrate-recognition and consequently, for calpain-mediated function. We describe a new localization for calpain-2 in the nucleoli of CRC cells. Calpain-2 nucleolar distribution resulted dependent on its enzymatic activity and on the mutational status of KRAS. In KRASWT/- cells serum-starvation induced CAPN2 expression, nucleolar accumulation and increased binding to the rDNA-core promoter and intergenic spacer (IGS), concomitant with a reduction in pre-rRNA levels. Depletion of calpain-2 by specific siRNA prevented pre-rRNA down-regulation after serum removal. Conversely, ribosomal biogenesis proceeded in the absence of serum in unresponsive KRASG13D/- cells whose CAPN2 expression, nucleolar localization and rDNA-occupancy remained unchanged during the time-course of serum starvation. We propose here that nucleolar calpain-2 might be a KRAS-dependent sensor to repress ribosomal biogenesis in growth limiting conditions. Under constitutive activation of the pathway commonly found in CRC, calpain-2 is deregulated and tumor cells become insensitive to the extracellular microenvironment.

UBF-binding site arrays form pseudo-NORs and sequester the RNA polymerase I transcription machinery

PubMed Central

Mais, Christine; Wright, Jane E.; Prieto, José-Luis; Raggett, Samantha L.; McStay, Brian

2005-01-01

Human ribosomal genes (rDNA) are located in nucleolar organizer regions (NORs) on the short arms of acrocentric chromosomes. Metaphase NORs that were transcriptionally active in the previous cell cycle appear as prominent chromosomal features termed secondary constrictions that are achromatic in chromosome banding and positive in silver staining. The architectural RNA polymerase I (pol I) transcription factor UBF binds extensively across rDNA throughout the cell cycle. To determine if UBF binding underpins NOR structure, we integrated large arrays of heterologous UBF-binding sequences at ectopic sites on human chromosomes. These arrays efficiently recruit UBF even to sites outside the nucleolus and, during metaphase, form novel silver stainable secondary constrictions, termed pseudo-NORs, morphologically similar to NORs. We demonstrate for the first time that in addition to UBF the other components of the pol I machinery are found associated with sequences across the entire human rDNA repeat. Remarkably, a significant fraction of these same pol I factors are sequestered by pseudo-NORs independent of both transcription and nucleoli. Because of the heterologous nature of the sequence employed, we infer that sequestration is mediated primarily by protein–protein interactions with UBF. These results suggest that extensive binding of UBF is responsible for formation and maintenance of the secondary constriction at active NORs. Furthermore, we propose that UBF mediates recruitment of the pol I machinery to nucleoli independently of promoter elements. PMID:15598984

The Nun study: clinically silent AD, neuronal hypertrophy, and linguistic skills in early life.

PubMed

Iacono, D; Markesbery, W R; Gross, M; Pletnikova, O; Rudow, G; Zandi, P; Troncoso, J C

2009-09-01

It is common to find substantial Alzheimer disease (AD) lesions, i.e., neuritic beta-amyloid plaques and neurofibrillary tangles, in the autopsied brains of elderly subjects with normal cognition assessed shortly before death. We have termed this status asymptomatic AD (ASYMAD). We assessed the morphologic substrate of ASYMAD compared to mild cognitive impairment (MCI) in subjects from the Nun Study. In addition, possible correlations between linguistic abilities in early life and the presence of AD pathology with and without clinical manifestations in late life were considered. Design-based stereology was used to measure the volumes of neuronal cell bodies, nuclei, and nucleoli in the CA1 region of hippocampus (CA1). Four groups of subjects were compared: ASYMAD (n = 10), MCI (n = 5), AD (n = 10), and age-matched controls (n = 13). Linguistic ability assessed in early life was compared among all groups. A significant hypertrophy of the cell bodies (+44.9%), nuclei (+59.7%), and nucleoli (+80.2%) in the CA1 neurons was found in ASYMAD compared with MCI. Similar differences were observed with controls. Furthermore, significant higher idea density scores in early life were observed in controls and ASYMAD group compared to MCI and AD groups. 1) Neuronal hypertrophy may constitute an early cellular response to Alzheimer disease (AD) pathology or reflect compensatory mechanisms that prevent cognitive impairment despite substantial AD lesions; 2) higher idea density scores in early life are associated with intact cognition in late life despite the presence of AD lesions.

Dynamic and nucleolin-dependent localization of human cytomegalovirus UL84 to the periphery of viral replication compartments and nucleoli.

PubMed

Bender, Brian J; Coen, Donald M; Strang, Blair L

2014-10-01

Protein-protein and protein-nucleic acid interactions within subcellular compartments are required for viral genome replication. To understand the localization of the human cytomegalovirus viral replication factor UL84 relative to other proteins involved in viral DNA synthesis and to replicating viral DNA in infected cells, we created a recombinant virus expressing a FLAG-tagged version of UL84 (UL84FLAG) and used this virus in immunofluorescence assays. UL84FLAG localization differed at early and late times of infection, transitioning from diffuse distribution throughout the nucleus to exclusion from the interior of replication compartments, with some concentration at the periphery of replication compartments with newly labeled DNA and the viral DNA polymerase subunit UL44. Early in infection, UL84FLAG colocalized with the viral single-stranded DNA binding protein UL57, but colocalization became less prominent as infection progressed. A portion of UL84FLAG also colocalized with the host nucleolar protein nucleolin at the peripheries of both replication compartments and nucleoli. Small interfering RNA (siRNA)-mediated knockdown of nucleolin resulted in a dramatic elimination of UL84FLAG from replication compartments and other parts of the nucleus and its accumulation in the cytoplasm. Reciprocal coimmunoprecipitation of viral proteins from infected cell lysates revealed association of UL84, UL44, and nucleolin. These results indicate that UL84 localization during infection is dynamic, which is likely relevant to its functions, and suggest that its nuclear and subnuclear localization is highly dependent on direct or indirect interactions with nucleolin. Importance: The protein-protein interactions among viral and cellular proteins required for replication of the human cytomegalovirus (HCMV) DNA genome are poorly understood. We sought to understand how an enigmatic HCMV protein critical for virus replication, UL84, localizes relative to other viral and cellular proteins required for HCMV genome replication and replicating viral DNA. We found that UL84 localizes with viral proteins, viral DNA, and the cellular nucleolar protein nucleolin in the subnuclear replication compartments in which viral DNA replication occurs. Unexpectedly, we also found localization of UL84 with nucleolin in nucleoli and showed that the presence of nucleolin is involved in localization of UL84 to the nucleus. These results add to previous work showing the importance of nucleolin in replication compartment architecture and viral DNA synthesis and are relevant to understanding UL84 function. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Three-Dimensional Unstained Live-Cell Imaging Using Stimulated Parametric Emission Microscopy

NASA Astrophysics Data System (ADS)

Dang, Hieu M.; Kawasumi, Takehito; Omura, Gen; Umano, Toshiyuki; Kajiyama, Shin'ichiro; Ozeki, Yasuyuki; Itoh, Kazuyoshi; Fukui, Kiichi

2009-09-01

The ability to perform high-resolution unstained live imaging is very important to in vivo study of cell structures and functions. Stimulated parametric emission (SPE) microscopy is a nonlinear-optical microscopy based on ultra-fast electronic nonlinear-optical responses. For the first time, we have successfully applied this technique to archive three-dimensional (3D) images of unstained sub-cellular structures, such as, microtubules, nuclei, nucleoli, etc. in live cells. Observation of a complete cell division confirms the ability of SPE microscopy for long time-scale imaging.

Core filaments of the nuclear matrix

PubMed Central

1990-01-01

The nuclear matrix is concealed by a much larger mass of chromatin, which can be removed selectively by digesting nuclei with DNase I followed by elution of chromatin with 0.25 M ammonium sulfate. This mild procedure removes chromatin almost completely and preserves nuclear matrix morphology. The complete nuclear matrix consists of a nuclear lamina with an interior matrix composed of thick, polymorphic fibers and large masses that resemble remnant nucleoli. Further extraction of the nuclear matrices of HeLa or MCF-7 cells with 2 M sodium chloride uncovered a network of core filaments. A few dark masses remained enmeshed in the filament network and may be remnants of the nuclear matrix thick fibers and nucleoli. The highly branched core filaments had diameters of 9 and 13 nm measured relative to the intermediate filaments. They may serve as the core structure around which the matrix is constructed. The core filaments retained 70% of nuclear RNA. This RNA consisted both of ribosomal RNA precursors and of very high molecular weight hnRNA with a modal size of 20 kb. Treatment with RNase A removed the core filaments. When 2 M sodium chloride was used directly to remove chromatin after DNase I digestion without a preceding 0.25 M ammonium sulfate extraction, the core filaments were not revealed. Instead, the nuclear interior was filled with amorphous masses that may cover the filaments. This reflected a requirement for a stepwise increase in ionic strength because gradual addition of sodium chloride to a final concentration of 2 M without an 0.25 M ammonium sulfate extraction uncovered core filaments. PMID:2307700

Conserved composition of mammalian box H/ACA and box C/D small nucleolar ribonucleoprotein particles and their interaction with the common factor Nopp140.

PubMed

Yang, Y; Isaac, C; Wang, C; Dragon, F; Pogacic, V; Meier, U T

2000-02-01

Small nucleolar ribonucleoprotein particles (snoRNPs) mainly catalyze the modification of rRNA. The two major classes of snoRNPs, box H/ACA and box C/D, function in the pseudouridylation and 2'-O-methylation, respectively, of specific nucleotides. The emerging view based on studies in yeast is that each class of snoRNPs is composed of a unique set of proteins. Here we present a characterization of mammalian snoRNPs. We show that the previously characterized NAP57 is specific for box H/ACA snoRNPs, whereas the newly identified NAP65, the rat homologue of yeast Nop5/58p, is a component of the box C/D class. Using coimmunoprecipitation experiments, we show that the nucleolar and coiled-body protein Nopp140 interacts with both classes of snoRNPs. This interaction is corroborated in vivo by the exclusive depletion of snoRNP proteins from nucleoli in cells transfected with a dominant negative Nopp140 construct. Interestingly, RNA polymerase I transcription is arrested in nucleoli depleted of snoRNPs, raising the possibility of a feedback mechanism between rRNA modification and transcription. Moreover, the Nopp140-snoRNP interaction appears to be conserved in yeast, because depletion of Srp40p, the yeast Nopp140 homologue, in a conditional lethal strain induces the loss of box H/ACA small nucleolar RNAs. We propose that Nopp140 functions as a chaperone of snoRNPs in yeast and vertebrate cells.

Conserved Composition of Mammalian Box H/ACA and Box C/D Small Nucleolar Ribonucleoprotein Particles and Their Interaction with the Common Factor Nopp140

PubMed Central

Yang, Yunfeng; Isaac, Cynthia; Wang, Chen; Dragon, François; Pogac̆ić, Vanda; Meier, U. Thomas

2000-01-01

Small nucleolar ribonucleoprotein particles (snoRNPs) mainly catalyze the modification of rRNA. The two major classes of snoRNPs, box H/ACA and box C/D, function in the pseudouridylation and 2′-O-methylation, respectively, of specific nucleotides. The emerging view based on studies in yeast is that each class of snoRNPs is composed of a unique set of proteins. Here we present a characterization of mammalian snoRNPs. We show that the previously characterized NAP57 is specific for box H/ACA snoRNPs, whereas the newly identified NAP65, the rat homologue of yeast Nop5/58p, is a component of the box C/D class. Using coimmunoprecipitation experiments, we show that the nucleolar and coiled-body protein Nopp140 interacts with both classes of snoRNPs. This interaction is corroborated in vivo by the exclusive depletion of snoRNP proteins from nucleoli in cells transfected with a dominant negative Nopp140 construct. Interestingly, RNA polymerase I transcription is arrested in nucleoli depleted of snoRNPs, raising the possibility of a feedback mechanism between rRNA modification and transcription. Moreover, the Nopp140-snoRNP interaction appears to be conserved in yeast, because depletion of Srp40p, the yeast Nopp140 homologue, in a conditional lethal strain induces the loss of box H/ACA small nucleolar RNAs. We propose that Nopp140 functions as a chaperone of snoRNPs in yeast and vertebrate cells. PMID:10679015

Dual Role of a SAS10/C1D Family Protein in Ribosomal RNA Gene Expression and Processing Is Essential for Reproduction in Arabidopsis thaliana

PubMed Central

Chen, Ying-Jiun C.; Wang, Huei-Jing

2016-01-01

In eukaryotic cells, ribosomal RNAs (rRNAs) are transcribed, processed, and assembled with ribosomal proteins in the nucleolus. Regulatory mechanisms of rRNA gene (rDNA) transcription and processing remain elusive in plants, especially their connection to nucleolar organization. We performed an in silico screen for essential genes of unknown function in Arabidopsis thaliana and identified Thallo (THAL) encoding a SAS10/C1D family protein. THAL disruption caused enlarged nucleoli in arrested embryos, aberrant processing of precursor rRNAs at the 5’ External Transcribed Spacer, and repression of the major rDNA variant (VAR1). THAL overexpression lines showed de-repression of VAR1 and overall reversed effects on rRNA processing sites. Strikingly, THAL overexpression also induced formation of multiple nucleoli per nucleus phenotypic of mutants of heterochromatin factors. THAL physically associated with histone chaperone Nucleolin 1 (NUC1), histone-binding NUC2, and histone demethylase Jumonji 14 (JMJ14) in bimolecular fluorescence complementation assay, suggesting that it participates in chromatin regulation. Furthermore, investigation of truncated THAL proteins revealed that the SAS10 C-terminal domain is likely important for its function in chromatin configuration. THAL also interacted with putative Small Subunit processome components, including previously unreported Arabidopsis homologue of yeast M Phase Phosphoprotein 10 (MPP10). Our results uncovering the dual role of THAL in transcription and processing events critical for proper rRNA biogenesis and nucleolar organization during reproduction are the first to define the function of SAS10/C1D family members in plants. PMID:27792779

The cytologic features of NUT midline carcinoma.

PubMed

Bellizzi, Andrew M; Bruzzi, Cynthia; French, Christopher A; Stelow, Edward B

2009-12-25

Nuclear protein in testis (NUT) midline carcinoma (NMC) represents an aggressive, high-grade carcinoma typically involving the upper aerodigestive tract or mediastinum. Although the tumor was originally noted in young persons, we have subsequently identified 5 adult cases. To our knowledge, the cytology of NMC has not been systematically described. We recently published a series of NMCs identified by fluorescent in situ hybridization for characteristic NUT rearrangement. Three of these patients had undergone fine-needle aspiration. Patient age, sex, primary tumor location, and aspiration site were noted. Cases were assessed for the following: cellularity, architecture, cytoplasm, cell size, nuclear contours, nucleoli, chromatin, anisonucleosis/cytosis, mitotic activity, background, and nuclear crush. The 3 cases occurred in 2 women and 1 man, ages 31-79 years. Primaries involved the sinonasal tract (2) and larynx. Aspirates were of right neck masses (2) and supraclavicular lymph node. Smears were highly cellular and generally noncohesive. Cytoplasm was scant/delicate, although occasional cells with denser cytoplasm were noted in 1 case. Cells were 2-3 times the diameter of a small lymphocyte with irregular nuclear contours, discrete nucleoli, and fine/granular to vesicular chromatin. Anisonucleosis/cytosis was slight to moderate. Mitotic figures were noted in each case. The background contained naked nuclei and karyorrhectic debris; nuclear crush was noted. NMCs exhibit cytologic features of a poorly differentiated or undifferentiated carcinoma. Although reports mention squamous differentiation as a histologic feature, it is typically focal, and overt squamous differentiation was not identified in our cases. Given morphologic overlap with other high-grade carcinomas, diagnosis requires a high index of suspicion. (c) 2009 American Cancer Society.

[Renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions: a study of 11 cases and review of literature].

PubMed

Rao, Qiu; Zhou, Xiao-jun; Wu, Bo; Ma, Heng-hui; Zhou, Hang-bo; Liu, Xiao-hong; Chen, Jie-yu

2007-04-01

To study the clinicopathologic features, differential diagnosis and prognosis of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions. The histopathologic findings and immunophenotype of 11 cases of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions were studied. Follow-up data (ranged from 10 to 112 months) were also analyzed. There were a total of 7 females and 4 males. The age of patients ranged from 8 to 26 years (mean = 16.3 years). The diameter of the tumors varied from 2.5 to 6.0 cm. Histologically, two morphologic patterns were seen. The first pattern consisted of alveolar, papillary or nested architecture. The tumor cells contained voluminous, clear to eosinophilic cytoplasm, distinct cell borders, vesicular chromatin, and prominent nucleoli. Psammoma bodies were frequently found and could be abundant. In contrast, the second pattern was composed of nested and compact architecture. The tumor cells possessed less abundant cytoplasm and inconspicuous nucleoli. Few psammoma bodies were detected. Immunohistochemical study showed that all cases strongly expressed TFE3, CD10 and P504s. Variable positivity for pan-cytokeratin, epithelial membrane antigen and vimentin was also noted. None of them expressed CK7, Ksp-cadherin and CD117. Renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions is a newly described but rarely encountered subtype of renal cell carcinoma. Pathologic diagnosis can be established when taken age of the patients, histopathologic findings and immunoreactivity for TFE3 protein into consideration.

Emerging roles of the nucleolus in regulating the DNA damage response: the noncanonical DNA repair enzyme APE1/Ref-1 as a paradigmatical example.

PubMed

Antoniali, Giulia; Lirussi, Lisa; Poletto, Mattia; Tell, Gianluca

2014-02-01

An emerging concept in DNA repair mechanisms is the evidence that some key enzymes, besides their role in the maintenance of genome stability, display also unexpected noncanonical functions associated with RNA metabolism in specific subcellular districts (e.g., nucleoli). During the evolution of these key enzymes, the acquisition of unfolded domains significantly amplified the possibility to interact with different partners and substrates, possibly explaining their phylogenetic gain of functions. After nucleolar stress or DNA damage, many DNA repair proteins can freely relocalize from nucleoli to the nucleoplasm. This process may represent a surveillance mechanism to monitor the synthesis and correct assembly of ribosomal units affecting cell cycle progression or inducing p53-mediated apoptosis or senescence. A paradigm for this kind of regulation is represented by some enzymes of the DNA base excision repair (BER) pathway, such as apurinic/apyrimidinic endonuclease 1 (APE1). In this review, the role of the nucleolus and the noncanonical functions of the APE1 protein are discussed in light of their possible implications in human pathologies. A productive cross-talk between DNA repair enzymes and proteins involved in RNA metabolism seems reasonable as the nucleolus is emerging as a dynamic functional hub that coordinates cell growth arrest and DNA repair mechanisms. These findings will drive further analyses on other BER proteins and might imply that nucleic acid processing enzymes are more versatile than originally thought having evolved DNA-targeted functions after a previous life in the early RNA world.

Long-term imaging of mouse embryos using adaptive harmonic generation microscopy

NASA Astrophysics Data System (ADS)

Thayil, Anisha; Watanabe, Tomoko; Jesacher, Alexander; Wilson, Tony; Srinivas, Shankar; Booth, Martin

2011-04-01

We present a detailed description of an adaptive harmonic generation (HG) microscope and culture techniques that permit long-term, three-dimensional imaging of mouse embryos. HG signal from both pre- and postimplantation stage (0.5-5.5 day-old) mouse embryos are fully characterized. The second HG images reveal central spindles during cytokinesis whereas third HG images show several features, such as lipid droplets, nucleoli, and plasma membranes. The embryos are found to develop normally during one-day-long discontinuous HG imaging, permitting the observation of several dynamic events, such as morula compaction and blastocyst formation.

Pleomorphic lobular carcinoma of the breast: a comparison of cytopathological features with other lobular carcinoma variants.

PubMed

Ohashi, R; Matsubara, M; Watarai, Y; Yanagihara, K; Yamashita, K; Tsuchiya, S-I; Takei, H; Naito, Z

2017-04-01

Pleomorphic lobular carcinoma (PLC) is a subtype of breast cancer with unique morphological features, but it remains controversial whether PLC should be considered an independent disease entity. The aim of this study was to illustrate cytopathological characteristics of PLC in comparison with other lobular carcinoma variants. We investigated clinicopathological features of PLC (n = 11) compared with those of other variants of invasive lobular carcinoma (ILC, non-PLC) (n = 32). Histological variants of the non-PLC group consisted of classic (n = 25), solid (n = 2), alveolar (n = 1) and a tubulolobular type (n = 4). A review of cytological reports and fine needle aspiration (FNA) smear samples was performed for the PLC (n = 9) and non-PLC (n = 27) groups. Patients with PLC were older, and had a higher nuclear grade and a higher incidence of axillary lymph node metastasis and triple negative phenotype than non-PLC patients (P = 0.007, P < 0.001, P = 0.02 and P < 0.001, respectively). Cytological findings in PLC included medium- to large-sized nuclei, prominent nucleoli, a moderate-to-severe degree of pleomorphism, apocrine change and background necrosis, none of which were evident in the smears of the non-PLC group (P < 0.001, P = 0.002, P < 0.001, P < 0.001, and P = 0.03, respectively). Despite these differences, patients with PLC and non-PLC showed similar clinical outcomes in our follow-up period. Based on our results, a cytological diagnosis of PLC should be proposed if there are moderate- to large-sized nuclei, prominent nucleoli, a moderate-to severe degree of nuclear pleomorphism, apocrine change and necrosis in the background in FNA biopsy samples. © 2016 John Wiley & Sons Ltd.

Emerging Roles of the Nucleolus in Regulating the DNA Damage Response: The Noncanonical DNA Repair Enzyme APE1/Ref-1 as a Paradigmatical Example

PubMed Central

Antoniali, Giulia; Lirussi, Lisa; Poletto, Mattia

2014-01-01

Abstract Significance: An emerging concept in DNA repair mechanisms is the evidence that some key enzymes, besides their role in the maintenance of genome stability, display also unexpected noncanonical functions associated with RNA metabolism in specific subcellular districts (e.g., nucleoli). During the evolution of these key enzymes, the acquisition of unfolded domains significantly amplified the possibility to interact with different partners and substrates, possibly explaining their phylogenetic gain of functions. Recent Advances: After nucleolar stress or DNA damage, many DNA repair proteins can freely relocalize from nucleoli to the nucleoplasm. This process may represent a surveillance mechanism to monitor the synthesis and correct assembly of ribosomal units affecting cell cycle progression or inducing p53-mediated apoptosis or senescence. Critical Issues: A paradigm for this kind of regulation is represented by some enzymes of the DNA base excision repair (BER) pathway, such as apurinic/apyrimidinic endonuclease 1 (APE1). In this review, the role of the nucleolus and the noncanonical functions of the APE1 protein are discussed in light of their possible implications in human pathologies. Future Directions: A productive cross-talk between DNA repair enzymes and proteins involved in RNA metabolism seems reasonable as the nucleolus is emerging as a dynamic functional hub that coordinates cell growth arrest and DNA repair mechanisms. These findings will drive further analyses on other BER proteins and might imply that nucleic acid processing enzymes are more versatile than originally thought having evolved DNA-targeted functions after a previous life in the early RNA world. Antioxid. Redox Signal. 20, 621–639. PMID:23879289

Analysis of the internal nuclear matrix. Oligomers of a 38 kD nucleolar polypeptide stabilized by disulfide bonds.

PubMed

Fields, A P; Kaufmann, S H; Shaper, J H

1986-05-01

When rat liver nuclei are treated with the sulfhydryl cross-linking reagent sodium tetrathionate (NaTT) prior to nuclease treatment and extraction with 1.6 M NaCl, residual nucleoli and an extensive non-chromatin intranuclear network remain associated with the nuclear envelope. Subsequent treatment of this structure with 1 M NaCl containing 20 mM dithiothreitol (DTT) solubilizes the intranuclear material, while the nuclear envelope remains structurally intact. We have isolated and partially characterized a major polypeptide of the disulfide-stabilized internal nuclear matrix. The polypeptide, which has an apparent molecular mass 38 kD and isoelectric point 5.3, has been localized to the nucleolus of rat liver nuclei by indirect immunofluorescence using a specific polyclonal chicken antiserum. Based on its molecular mass, isoelectric point, intracellular localization and amino acid composition, the 38 kD polypeptide appears to be analogous to the nucleolar phosphoprotein B23 described by Prestayko et al. (Biochemistry 13 (1974) 1945) [20]. Immunologically related polypeptides have likewise been localized to the nucleoli of both hamster and human tissue culture cell lines as well as the cellular slime mold Physarum polycephalum. By immunoblotting, a single 38 kD polypeptide is recognized by the antiserum in rat, mouse, hamster and human cell lines. The antiserum has been utilized to investigate the oligomeric structure of the 38 kD polypeptide and the nature of its association with the rat liver nuclear matrix. By introducing varying numbers of disulfide bonds, we have found that the 38 kD polypeptide becomes incorporated into the internal nuclear matrix in a two-step process. Soluble disulfide-bonded homodimers of the polypeptide are first formed and then are rendered salt-insoluble by more extensive disulfide cross-linking.

Proteomic profiling of the human T-cell nucleolus.

PubMed

Jarboui, Mohamed Ali; Wynne, Kieran; Elia, Giuliano; Hall, William W; Gautier, Virginie W

2011-12-01

The nucleolus, site of ribosome biogenesis, is a dynamic subnuclear organelle involved in diverse cellular functions. The size, number and organisation of nucleoli are cell-specific and while it remains to be established, the nucleolar protein composition would be expected to reflect lineage-specific transcriptional regulation of rDNA genes and have cell-type functional components. Here, we describe the first characterisation of the human T-cell nucleolar proteome. Using the Jurkat T-cell line and a reproducible organellar proteomic approach, we identified 872 nucleolar proteins. In addition to ribosome biogenesis and RNA processing networks, network modeling and topological analysis of nucleolar proteome revealed distinct macromolecular complexes known to orchestrate chromatin structure and to contribute to the regulation of gene expression, replication, recombination and repair, and chromosome segregation. Furthermore, among our dataset, we identified proteins known to functionally participate in T-cell biology, including RUNX1, ILF3, ILF2, STAT3, LSH, TCF-1, SATB1, CTCF, HMGB3, BCLAF1, FX4L1, ZAP70, TIAM1, RAC2, THEMIS, LCP1, RPL22, TOPK, RETN, IFI-16, MCT-1, ISG15, and 14-3-3τ, which support cell-specific composition of the Jurkat nucleolus. Subsequently, the nucleolar localisation of RUNX1, ILF3, STAT3, ZAP70 and RAC2 was further validated by Western Blot analysis and immunofluorescence microscopy. Overall, our T-cell nucleolar proteome dataset not only further expands the existing repertoire of the human nucleolar proteome but support a cell type-specific composition of the nucleolus in T cell and highlights the potential roles of the nucleoli in lymphocyte biology. Copyright © 2011 Elsevier Ltd. All rights reserved.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

PubMed

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

PubMed Central

Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

2015-01-01

Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

Loss of Nucleolar Histone Chaperone NPM1 Triggers Rearrangement of Heterochromatin and Synergizes with a Deficiency in DNA Methyltransferase DNMT3A to Drive Ribosomal DNA Transcription*

PubMed Central

Holmberg Olausson, Karl; Nistér, Monica; Lindström, Mikael S.

2014-01-01

Nucleoli are prominent nuclear structures assembled and organized around actively transcribed ribosomal DNA (rDNA). The nucleolus has emerged as a platform for the organization of chromatin enriched for repressive histone modifications associated with repetitive DNA. NPM1 is a nucleolar protein required for the maintenance of genome stability. However, the role of NPM1 in nucleolar chromatin dynamics and ribosome biogenesis remains unclear. We found that normal fibroblasts and cancer cells depleted of NPM1 displayed deformed nucleoli and a striking rearrangement of perinucleolar heterochromatin, as identified by immunofluorescence staining of trimethylated H3K9, trimethylated H3K27, and heterochromatin protein 1γ (HP1γ/CBX3). By co-immunoprecipitation we found NPM1 associated with HP1γ and core and linker histones. Moreover, NPM1 was required for efficient tethering of HP1γ-enriched chromatin to the nucleolus. We next tested whether the alterations in perinucleolar heterochromatin architecture correlated with a difference in the regulation of rDNA. U1242MG glioma cells depleted of NPM1 presented with altered silver staining of nucleolar organizer regions, coupled to a modest decrease in H3K9 di- and trimethylation at the rDNA promoter. rDNA transcription and cell proliferation were sustained in these cells, indicating that altered organization of heterochromatin was not secondary to inhibition of rDNA transcription. Furthermore, knockdown of DNA methyltransferase DNMT3A markedly enhanced rDNA transcription in NPM1-depleted U1242MG cells. In summary, this study highlights a function of NPM1 in the spatial organization of nucleolus-associated heterochromatin. PMID:25349213

An ancillary method in urine cytology: Nucleolar/nuclear volume ratio for discrimination between benign and malignant urothelial cells.

PubMed

Tone, Kiyoshi; Kojima, Keiko; Hoshiai, Keita; Kumagai, Naoya; Kijima, Hiroshi; Kurose, Akira

2016-06-01

The essential of urine cytology for the diagnosis and the follow-up of urothelial neoplasia has been widely recognized. However, there are some cases in which a definitive diagnosis cannot be made due to difficulty in discriminating between benign and malignant. This study evaluated the practicality of nucleolar/nuclear volume ratio (%) for the discrimination. Using Papanicolaou-stained slides, 253 benign urothelial cells and 282 malignant urothelial cells were selected and divided into a benign urothelial cell and an urothelial carcinoma (UC) cell groups. Three suspicious cases and four cases in which discrimination between benign and malignant was difficult were prepared for verification test. Subject cells were decolorized and stained with 4',6-diamidino-2-phenylindole for detection of the nuclei and the nucleoli. Z-stack method was performed to analyze. When the cutoff point of 1.514% discriminating benign urothelial cells and UC cells from nucleolar/nuclear volume ratio (%) was utilized, the sensitivity was 56.0%, the specificity was 88.5%, the positive predictive value was 84.5%, and the negative predictive value was 64.4%. Nuclear and nucleolar volume, number of the nucleoli, and nucleolar/nuclear volume ratio (%) were significantly higher in the UC cell group than in the benign urothelial cell group (P <0.001). In the verification test using the nucleolar/nuclear ratio (%), four of the seven cases were concordant with the final diagnosis. This study analyzed the nuclear and nucleolar volume to establish an index for discrimination of benign and malignant urothelial cells, providing possible additional information in urine cytology. Diagn. Cytopathol. 2016;44:483-491. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

The protein domains of the Dictyostelium microprocessor that are required for correct subcellular localization and for microRNA maturation.

PubMed

Kruse, Janis; Meier, Doreen; Zenk, Fides; Rehders, Maren; Nellen, Wolfgang; Hammann, Christian

2016-10-02

The maturation pathways of microRNAs (miRNAs) have been delineated for plants and several animals, belonging to the evolutionary supergroups of Archaeplastida and Opisthokonta, respectively. Recently, we reported the discovery of the microprocessor complex in Dictyostelium discoideum of the Amoebozoa supergroup. The complex is composed of the Dicer DrnB and the dsRBD (double-stranded RNA binding domain) containing protein RbdB. Both proteins localize at nucleoli, where they physically interact, and both are required for miRNA maturation. Here we show that the miRNA phenotype of a ΔdrnB gene deletion strain can be rescued by ectopic expression of a series of DrnB GFP fusion proteins, which consistently showed punctate perinucleolar localization in fluorescence microscopy. These punctate foci appear surprisingly stable, as they persist both disintegration of nucleoli and degradation of cellular nucleic acids. We observed that DrnB expression levels influence the number of microprocessor foci and alter RbdB accumulation. An investigation of DrnB variants revealed that its newly identified nuclear localization signal is necessary, but not sufficient for the perinucleolar localization. Biogenesis of miRNAs, which are RNA Pol II transcripts, is correlated with that localization. Besides its bidentate RNase III domains, DrnB contains only a dsRBD, which surprisingly is dispensable for miRNA maturation. This dsRBD can, however, functionally replace the homologous domain in RbdB. Based on the unique setup of the Dictyostelium microprocessor with a subcellular localization similar to plants, but a protein domain composition similar to animals, we propose a model for the evolutionary origin of RNase III proteins acting in miRNA maturation.

The structure of the mitotic spindle and nucleolus during mitosis in the amebo-flagellate Naegleria.

PubMed

Walsh, Charles J

2012-01-01

Mitosis in the amebo-flagellate Naegleria pringsheimi is acentrosomal and closed (the nuclear membrane does not break down). The large central nucleolus, which occupies about 20% of the nuclear volume, persists throughout the cell cycle. At mitosis, the nucleolus divides and moves to the poles in association with the chromosomes. The structure of the mitotic spindle and its relationship to the nucleolus are unknown. To identify the origin and structure of the mitotic spindle, its relationship to the nucleolus and to further understand the influence of persistent nucleoli on cellular division in acentriolar organisms like Naegleria, three-dimensional reconstructions of the mitotic spindle and nucleolus were carried out using confocal microscopy. Monoclonal antibodies against three different nucleolar regions and α-tubulin were used to image the nucleolus and mitotic spindle. Microtubules were restricted to the nucleolus beginning with the earliest prophase spindle microtubules. Early spindle microtubules were seen as short rods on the surface of the nucleolus. Elongation of the spindle microtubules resulted in a rough cage of microtubules surrounding the nucleolus. At metaphase, the mitotic spindle formed a broad band completely embedded within the nucleolus. The nucleolus separated into two discreet masses connected by a dense band of microtubules as the spindle elongated. At telophase, the distal ends of the mitotic spindle were still completely embedded within the daughter nucleoli. Pixel by pixel comparison of tubulin and nucleolar protein fluorescence showed 70% or more of tubulin co-localized with nucleolar proteins by early prophase. These observations suggest a model in which specific nucleolar binding sites for microtubules allow mitotic spindle formation and attachment. The fact that a significant mass of nucleolar material precedes the chromosomes as the mitotic spindle elongates suggests that spindle elongation drives nucleolar division.

Urothelial cells in smears from cervix uteri

PubMed Central

Palaoro, Luis Alberto; Guerra, Fernando; Angeleri, Anabela; Palamas, Marta; Melba, Sardi-Segovia; Rocher, Adriana Esther

2012-01-01

Objectives: To establish the cytological criteria to identify the urothelial cells in cervical smears in order to avoid mistakes in the cytological diagnosis. Materials and Methods: Cervical smears from 34 post menopausal women with vesicovaginal fistulas, advanced bladder prolapse and genital erosive lichen planes (vulvar kraurosis) (Group 1) and transitional cell metaplasia of the cervix (TCM, Group 2) were stained with Papanicolaou technique. The cervical samples were taken during the routine annual examination for prevention of the uterine cancer. Results: The smears of cervix from Group 1 showed urothelial cells from the three layers of the transitional epithelium. The umbrella cells are the bigger ones with relatively large nuclei. Frequently, they are multinucleated with single or multiple nucleoli and a typical “frothy” cytoplasm (cytoplasmic vacuoles). The cells of the Group 2 showed nuclei with oval to spindled shapes, some tapered ends, less cytoplasm than squamous metaplastic cells, powdery chromatin, small nucleoli and nuclear grooves. Conclusions: The umbrella cells may be mistaken for dysplastic cells originating in low grade squamous intraepithelial lesions lesions (LSILs) due to their nuclear and cytoplasm sizes. Therefore, it is important to know the possibility of their appearance in the cervical smears, especially in post menopausal patients in order to avoid a false diagnosis of an intraepithelial lesion. It is unlikely that deeper cells of urothelium would be confused with high grade squamous intraepithelial lesion (HSIL) cells. However, their presence might be a reason of mistake in the diagnosis. TCM is an under-recognized metaplastic phenomenon of the cervix and vagina, which is a mimicker of high-grade squamous intraepithelial lesion. The differential characteristic between umbrella cells, cells from TCM and the deeper urothelial cells, and LSIL and HSIL are detailed in the present paper. PMID:22438615

Association of pKi-67 with satellite DNA of the human genome in early G1 cells.

PubMed

Bridger, J M; Kill, I R; Lichter, P

1998-01-01

pKi-67 is a nucleolar antigen that provides a specific marker for proliferating cells. It has been shown previously that pKi-67's distribution varies in a cell cycle-dependent manner: it coats all chromosomes during mitosis, accumulates in nuclear foci during G1 phase (type I distribution) and localizes within nucleoli in late G1 S and G2 phase (type II distribution). Although no function has as yet been ascribed to pKi-67, it has been found associated with centromeres in G1. In the present study the distribution pattern of pKi-67 during G1 in human dermal fibroblasts (HDFs) was analysed in more detail. Synchronization experiments show that in very early G1 cells pKi-67 coincides with virtually all satellite regions analysed, i.e. with centromeric (alpha-satellite), telomeric (minisatellite) and heterochromatic blocks (satellite III) on chromosomes 1 and Y (type Ia distribution). In contrast, later in the G1 phase, a smaller fraction of satellite DNA regions are found collocalized with pKi-67 foci (type Ib distribution). When all pKi-67 becomes localized within nucleoli, even fewer satellite regions remain associated with the pKi-67 staining. However, all centromeric and short arm regions of the acrocentric chromosomes, which are in very close proximity to or even contain the rRNA genes, are collocalized with anti-pKi-67 staining throughout the remaining interphase of the cell cycle. Thus, our data demonstrate that during post-mitotic reformation and nucleogenesis there is a progressive decline in the fraction of specific satellite regions of DNA that remain associated with pKi-67. This may be relevant to nucleolar reformation following mitosis.

Modern Pathologic Diagnosis of Renal Oncocytoma.

PubMed

Wobker, Sara E; Williamson, Sean R

2017-01-01

Oncocytoma is a well-defined benign renal tumor, with classic gross and histologic features, including a tan or mahogany-colored mass with central scar, microscopic nested architecture, bland cytology, and round, regular nuclei with prominent central nucleoli. As a result of variations in this classic appearance, difficulty in standardizing diagnostic criteria, and entities that mimic oncocytoma, such as eosinophilic variant chromophobe renal cell carcinoma and succinate dehydrogenase-deficient renal cell carcinoma, pathologic diagnosis remains a challenge. This review addresses the current state of pathologic diagnosis of oncocytoma, with emphasis on modern diagnostic markers, areas of controversy, and emerging techniques for less invasive diagnosis, including renal mass biopsy and advanced imaging.

Germination of pine seed in weightlessness (investigation in Kosmos 782)

NASA Technical Reports Server (NTRS)

Platonova, R. N.; Parfenov, G. P.; Olkhovenko, V. P.; Karpova, N. I.; Pichugov, M. Y.

1978-01-01

An investigation was made of the orientation of aboveground and underground organs of pine plants grown from seed in weightlessness. Orientation was found to be caused by the position of the seeds relative to the substrate surface. Normal growth was manifest only for the plants grown from seed oriented with embryo toward the substrate. Differences were noted between experiment and control as to the quantitative content of nucleoli in the meristematic cells of the rootlets and the shape of cells in the cotyledonous leaflets. No complete agreement was found between data obtained in weightlessness and when gravity was compensated (clinostat treatment with horizontal rotation).

A Method to Identify Nucleolus-Associated Chromatin Domains (NADs).

PubMed

Carpentier, Marie-Christine; Picart-Picolo, Ariadna; Pontvianne, Frédéric

2018-01-01

The nuclear context needs to be taken into consideration to better understand the mechanisms shaping the epigenome and its organization, and therefore its impact on gene expression. For example, in Arabidopsis, heterochromatin is preferentially localized at the nuclear and the nucleolar periphery. Although chromatin domains associating with the nuclear periphery remain to be identified in plant cells, Nucleolus Associated chromatin Domains (NADs) can be identified thanks to a protocol allowing the isolation of pure nucleoli. We describe here the protocol enabling the identification of NADs in Arabidopsis. Providing the transfer of a nucleolus marker as described here in other crop species, this protocol is broadly applicable.

Pine seed germination under weightlessness (a study of the Kosmos 782 satellite)

NASA Technical Reports Server (NTRS)

Platonova, R. N.; Parfenov, G. P.; Olkhovenko, V. P.; Karpova, N. I.; Pichugov, M. Y.

1977-01-01

Orientation of the above and underground organs of pine plants, grown from seeds under weightlessness, was found to be determined by seed position on the substrate. Normal plant growth was observed only if the seed embryos were oriented toward the substrate. Some differences were noted between the experimental and control plants concerning the amount of nucleoli in the root meristematic cells and the cell shape in cotyledonous leaves. No complete similarity was found in experimental results obtained with plants under weightlessness and under compensated gravity. The seeds were obtained from Pinus silvestris, considered to be particularly suitable for this experiment.

High frame-rate resolution of cell division during Candida albicans filamentation

PubMed Central

Thomson, Darren D.; Berman, Judith; Brand, Alexandra C.

2016-01-01

The commensal yeast, Candida albicans, is an opportunistic pathogen in humans and forms filaments called hyphae and pseudohyphae, in which cell division requires precise temporal and spatial control to produce mononuclear cell compartments. High-frame-rate live-cell imaging (1 frame/min) revealed that nuclear division did not occur across the septal plane. We detected the presence of nucleolar fragments that may be extrachromosomal molecules carrying the ribosomal RNA genes. Cells occasionally maintained multiple nucleoli, suggesting either polyploidy, multiple nuclei and/or aneuploidy of ChrR., while the migration pattern of sister nuclei differed between unbranched and branched hyphae. The presented movie challenges and extends previous concepts of C. albicans cell division. PMID:26854071

Interdigitating cells in the thymus of the frog, Rana temporaria.

PubMed

Bigaj, J; Płytycz, B

1987-01-01

Interdigitating cells (IDC) of the thymic medulla of the frog, Rana temporaria, collected in the summer, were examined by electron microscopy. The most characteristic cytological features of IDC are voluminous electron-lucent cytoplasm and widespread interdigitations and invaginations of the cell membrane. IDC possess an excentrically located nucleus with pronounced nucleoli and a thin rim of a dense chromatine as well as a perinuclear area with characteristic tubulo-vesicular complex. In our material Birbeck granules were absent. Some IDC contain phagocytized material. A few transitional forms between monocytes and IDC were observed. On the basis of these observations it is highly probable that the amphibian IDC belong to the mononuclear phagocyte system.

The structural and functional organization of the vestibular apparatus of rats exposed to weightlessness for 20 days on board the Sputnik "Kosmos-782".

PubMed

Vinnikov, Y A; Gazenko, O G; Titova, L K; Bronstein, A A; Govardovskii, V I; Gribakin, F G; Pevzner, R A; Aronova, M Z; Kharkeevich, T A; Tsirulis, T P; Pyatkina, G A; Lichakov, D V; Pal'mbach, L P; Anichin, V F

1979-01-01

This investigation of the vestibular apparatus of rats exposed for 20 days to weightlessness on board an earth satellite and to acceleration during take-off and landing has revealed a set of changes in the structural and functional organization, such as adjoinment of the otolith to the utricle receptor surface and peripheral localization of the nucleoli inside the receptor cells' nuclei. Destruction of some receptor cells, apparently due to increased swelling of the vestibular apparatus tissue and alteration of the shape and structure of the otoconia were observed. In the horizontal crista, detachment of the cupula took place.

Vector-averaged gravity alters myocyte and neuron properties in cell culture

NASA Technical Reports Server (NTRS)

Gruener, Raphael; Hoeger, Glenn

1991-01-01

The effect of changes in the gravitational field of developing neurons and myocytes on the development of these cells was investigated using observations of rotated cultures of embryonic spinal neurons and myocytes in a horizontal clinostat, in which rotation produces, from the cells' perspective, a 'vector-free' gravity environment by continous averaging of the vector, thus simulating the microgravity of space. It was found that, at rotation rates between 1 and 50 rpm, cellular and nuclear areas of myocytes become significantly enlarged and the number of presumptive nucleoli increase; in neurons, frequent and large swellings appeared along neuritic shafts. Some of these changes were reversible after the cessation of rotation.

Sub-cellular localisation studies may spuriously detect the Yes-associated protein, YAP, in nucleoli leading to potentially invalid conclusions of its function.

PubMed

Finch, Megan L; Passman, Adam M; Strauss, Robyn P; Yeoh, George C; Callus, Bernard A

2015-01-01

The Yes-associated protein (YAP) is a potent transcriptional co-activator that functions as a nuclear effector of the Hippo signaling pathway. YAP is oncogenic and its activity is linked to its cellular abundance and nuclear localisation. Activation of the Hippo pathway restricts YAP nuclear entry via its phosphorylation by Lats kinases and consequent cytoplasmic retention bound to 14-3-3 proteins. We examined YAP expression in liver progenitor cells (LPCs) and surprisingly found that transformed LPCs did not show an increase in YAP abundance compared to the non-transformed LPCs from which they were derived. We then sought to ascertain whether nuclear YAP was more abundant in transformed LPCs. We used an antibody that we confirmed was specific for YAP by immunoblotting to determine YAP's sub-cellular localisation by immunofluorescence. This antibody showed diffuse staining for YAP within the cytosol and nuclei, but, noticeably, it showed intense staining of the nucleoli of LPCs. This staining was non-specific, as shRNA treatment of cells abolished YAP expression to undetectable levels by Western blot yet the nucleolar staining remained. Similar spurious YAP nucleolar staining was also seen in mouse embryonic fibroblasts and mouse liver tissue, indicating that this antibody is unsuitable for immunological applications to determine YAP sub-cellular localisation in mouse cells or tissues. Interestingly nucleolar staining was not evident in D645 cells suggesting the antibody may be suitable for use in human cells. Given the large body of published work on YAP in recent years, many of which utilise this antibody, this study raises concerns regarding its use for determining sub-cellular localisation. From a broader perspective, it serves as a timely reminder of the need to perform appropriate controls to ensure the validity of published data.

Sub-Cellular Localisation Studies May Spuriously Detect the Yes-Associated Protein, YAP, in Nucleoli Leading to Potentially Invalid Conclusions of Its Function

PubMed Central

Finch, Megan L.; Passman, Adam M.; Strauss, Robyn P.; Yeoh, George C.; Callus, Bernard A.

2015-01-01

The Yes-associated protein (YAP) is a potent transcriptional co-activator that functions as a nuclear effector of the Hippo signaling pathway. YAP is oncogenic and its activity is linked to its cellular abundance and nuclear localisation. Activation of the Hippo pathway restricts YAP nuclear entry via its phosphorylation by Lats kinases and consequent cytoplasmic retention bound to 14-3-3 proteins. We examined YAP expression in liver progenitor cells (LPCs) and surprisingly found that transformed LPCs did not show an increase in YAP abundance compared to the non-transformed LPCs from which they were derived. We then sought to ascertain whether nuclear YAP was more abundant in transformed LPCs. We used an antibody that we confirmed was specific for YAP by immunoblotting to determine YAP’s sub-cellular localisation by immunofluorescence. This antibody showed diffuse staining for YAP within the cytosol and nuclei, but, noticeably, it showed intense staining of the nucleoli of LPCs. This staining was non-specific, as shRNA treatment of cells abolished YAP expression to undetectable levels by Western blot yet the nucleolar staining remained. Similar spurious YAP nucleolar staining was also seen in mouse embryonic fibroblasts and mouse liver tissue, indicating that this antibody is unsuitable for immunological applications to determine YAP sub-cellular localisation in mouse cells or tissues. Interestingly nucleolar staining was not evident in D645 cells suggesting the antibody may be suitable for use in human cells. Given the large body of published work on YAP in recent years, many of which utilise this antibody, this study raises concerns regarding its use for determining sub-cellular localisation. From a broader perspective, it serves as a timely reminder of the need to perform appropriate controls to ensure the validity of published data. PMID:25658431

Histochemical and biochemical studies of carbonic anhydrase activity in the opercular epithelium of the euryhaline teleost, Fundulus heteroclitus.

PubMed

Lacy, E R

1983-01-01

Carbonic anhydrase (CAH) activity was biochemically measured and histochemically localized (at both the light and electron microscope levels) in isolated opercular membranes from teleost fish, Fundulus heteroclitus, adapted to freshwater (FW), seawater (SW), and double-strength seawater (2 x SW). The normal morphology of this membrane showed that its epithelial portion consisted of five cell types: (1) chloride cells, which have been previously implicated as responsible for the active chloride transport across the epithelium; (2) mucous cells; (3) pavement cells, which formed the major portion of the free epithelial surface; (4) supportive cells, which had an abundance of intermediate (10 nm)-type filaments suggesting a structural role for these cells; and (5) vesicular cells, which were characterized by various types of membrane-bound vesicles, including lysosomes, and numerous free ribosomes. Vesicular cells may be stem cells and/or endocrine cells. Hansson's histochemical method for CAH revealed cobalt sulfide reaction product confined to the following structures in fish from each environment: (1) chloride cells: throughout the cytoplasm and some nuclear staining; (2) mucous cells: throughout the cytoplasm, some nuclear staining, and some in mucous granules; (3) vesicular cells: confined to lysosomes, some of the vesicles, and nucleoli; (4) a small portion of the intracellular space between adjacent vesicular cells and supportive cells; and (5) supportive cells: in nucleoli and occasionally in larger membrane-bound lysosomelike structures. Acetazolamide (10(-5) M) and potassium cyanate (KCNO) (10(-1) M) in Hansson's incubation medium completely inhibited the formation of reaction product. Biochemical determination of CAH activity on vascularly perfused, isolated opercular membranes showed no statistically significant difference in enzyme activity between environmental groups. The following units of activity/mg opercular membrane protein were measured: FW: 0.63 +/- 0.02; SW: 0.43 +/- 0.08; 2 x SW: 0.64 +/- 0.09.

Nucleolar sub-compartments in motion during rRNA synthesis inhibition: Contraction of nucleolar condensed chromatin and gathering of fibrillar centers are concomitant

PubMed Central

Tchelidze, Pavel; Benassarou, Aassif; Kaplan, Hervé; O’Donohue, Marie-Françoise; Lucas, Laurent; Terryn, Christine; Rusishvili, Levan; Mosidze, Giorgi; Lalun, Nathalie

2017-01-01

The nucleolus produces the large polycistronic transcript (47S precursor) containing the 18S, 5.8S and 28S rRNA sequences and hosts most of the nuclear steps of pre-rRNA processing. Among numerous components it contains condensed chromatin and active rRNA genes which adopt a more accessible conformation. For this reason, it is a paradigm of chromosome territory organization. Active rRNA genes are clustered within several fibrillar centers (FCs), in which they are maintained in an open configuration by Upstream Binding Factor (UBF) molecules. Here, we used the reproducible reorganization of nucleolar components induced by the inhibition of rRNA synthesis by Actinomycin D (AMD) to address the steps of the spatiotemporal reorganization of FCs and nucleolar condensed chromatin. To reach that goal, we used two complementary approaches: i) time-lapse confocal imaging of cells expressing one or several GFP-tagged proteins (fibrillarin, UBF, histone H2B) and ii) ultrastructural identification of nucleolar components involved in the reorganization. Data obtained by time lapse confocal microscopy were analyzed through detailed 3D imaging. This allowed us to demonstrate that AMD treatment induces no fusion and no change in the relative position of the different nucleoli contained in one nucleus. In contrast, for each nucleolus, we observed step by step gathering and fusion of both FCs and nucleolar condensed chromatin. To analyze the reorganization of FCs and condensed chromatin at a higher resolution, we performed correlative light and electron microscopy electron microscopy (CLEM) imaging of the same cells. We demonstrated that threads of intranucleolar condensed chromatin are localized in a complex 3D network of vacuoles. Upon AMD treatment, these structures coalesce before migrating toward the perinucleolar condensed chromatin, to which they finally fuse. During their migration, FCs, which are all linked to ICC, are pulled by the latter to gather as caps disposed at the periphery of nucleoli. PMID:29190286

CYTOCHEMICAL STUDIES OF THE NUCLEOPROTEINS OF HELA CELLS INFECTED WITH HERPES VIRUS

PubMed Central

Love, Robert; Wildy, Peter

1963-01-01

The morphological and cytochemical changes in HeLa cells infected with herpes virus have been studied at frequent intervals during infection and related to the growth of virus and the multiplicity of the virus inoculum. Infection with a high multiplicity inoculum produced enlargement and extrusion of small ribonucleoprotein (RNP) bodies in the nucleoli (nucleolini) to form RNP bodies in the nucleoplasm (B bodies) beginning ½ hour after infection. 3 hours after infection, RNP of the pars amorpha appeared to diffuse into the adjacent nucleoplasm, where, ½ hour later, the classical type A inclusion or A body first appeared. The A bodies displaced the B bodies and the nucleoli and eventually filled the nucleus. 6 hours after infection, minute granules containing RNA, DNA, and non-histone protein appeared inside the A bodies (A granules) and increased in number until the late stages of infection, when they disappeared. 18 hours after infection, at the time when the A bodies came to fill the nucleus completely, extrusion of RNP from the nucleus produced cytoplasmic masses which have been termed C bodies. B bodies were formed in the majority of cells before the maturation of infectious virus, but the number of B bodies could not be correlated with the amount of virus in the cell or with the multiplicity of the inoculum. It is suggested that the formation of B bodies may be the result of inhibition of the onset of mitotic division by a mechanism which does not inhibit the formation of RNA in the nucleolini. The nature of the A bodies, the A granules, and the C bodies is discussed and it is concluded that the A granules may represent aggregations of maturing virus in the nucleus. The progression of some C mitotic metaphases to the formation of post-C mitotic multinucleated giant cells is described. These are distinct from syncytia formed by cell fusion. PMID:19866625

CYTOCHEMICAL STUDIES OF THE NUCLEOPROTEINS OF HELA CELLS INFECTED WITH HERPES VIRUS.

PubMed

Love, R; Wildy, P

1963-05-01

The morphological and cytochemical changes in HeLa cells infected with herpes virus have been studied at frequent intervals during infection and related to the growth of virus and the multiplicity of the virus inoculum. Infection with a high multiplicity inoculum produced enlargement and extrusion of small ribonucleoprotein (RNP) bodies in the nucleoli (nucleolini) to form RNP bodies in the nucleoplasm (B bodies) beginning (1/2) hour after infection. 3 hours after infection, RNP of the pars amorpha appeared to diffuse into the adjacent nucleoplasm, where, (1/2) hour later, the classical type A inclusion or A body first appeared. The A bodies displaced the B bodies and the nucleoli and eventually filled the nucleus. 6 hours after infection, minute granules containing RNA, DNA, and non-histone protein appeared inside the A bodies (A granules) and increased in number until the late stages of infection, when they disappeared. 18 hours after infection, at the time when the A bodies came to fill the nucleus completely, extrusion of RNP from the nucleus produced cytoplasmic masses which have been termed C bodies. B bodies were formed in the majority of cells before the maturation of infectious virus, but the number of B bodies could not be correlated with the amount of virus in the cell or with the multiplicity of the inoculum. It is suggested that the formation of B bodies may be the result of inhibition of the onset of mitotic division by a mechanism which does not inhibit the formation of RNA in the nucleolini. The nature of the A bodies, the A granules, and the C bodies is discussed and it is concluded that the A granules may represent aggregations of maturing virus in the nucleus. The progression of some C mitotic metaphases to the formation of post-C mitotic multinucleated giant cells is described. These are distinct from syncytia formed by cell fusion.

Examination of the antioxidant effects of pre-HSG melatonin use on ovarian surface epithelium in rats: An experimental study.

PubMed

Yılmaz, Esra Saygılı; Sapmaz, Tansel; Kazgan, Halil; Yildiz, Şule Menziletoglu; Kocamaz, Derya; Akpolat, Nusret; Sapmaz, Ekrem

2018-06-28

There is no study of whether the dysplastic changes in the ovarian surface epithelium of X-ray-exposed rats during hysterosalpingography (HSG) decrease or not with the use of Lipiodol and melatonin given both intraperitoneally (i.p.) and into the suspensorium ovarii. We investigated the restorative effects of melatonin and Lipiodol administration during the HSG procedure on the dysplastic changes in the ovarian surface epithelium of X-ray-exposed rats. A total of 50 Wistar rats with regular estrous cycles were randomly divided into 5 groups. Group 1 was the control group. In other groups, X-ray was applied (group 2), 0.1 mL Lipiodol was applied to each uterine horn (group 3), 20 mg/kg intraperitoneal melatonin application was followed by 0.1 mL Lipiodol administration to each uterine horn after 15 min (group 4), and 20 mg/kg melatonin was administered to the ligamentum suspensorium ovarii, followed by 0.1 mL Lipiodol application to each uterine horn after 15 min (group 5). The rats in groups 2-5 were exposed to whole body radiation 3 times. After 3 h, the abdomens of all rats were reopened and left oophorectomy was performed. The presence of nucleoli and mitosis values were found similar among the groups. All other parameters were significantly higher in group 2 compared to other groups, except for the presence of nucleoli and mitosis values (p < 0.05). The presence of hyperchromasia and the total score were found to be the highest in group 2, followed by group 3, when compared to other groups (p < 0.05). It was detected that the detrimental effects of X-ray exposure diminished with Lipiodol use, and were further reduced by the use of melatonin in combination. We suggest that the use of melatonin and Lipiodol during HSG may prevent the carcinogenic changes exerted by radiation on the ovarian surface epithelium.

Altered gravity causes the changes in the proteins NoA100 in plant cell nucleoli

NASA Astrophysics Data System (ADS)

Sobol, Margarita A.; Gonzalez-Camacho, Fernando; Kordyum, Elizabeth L.; Medina, Francisco Javier

2005-08-01

A nucleolar protein homologous to the mammalian nucleolin and to the onion nucleolin-like protein NopA100 was detected in nuclear soluble protein fraction from Lepidium sativum root meristematic cells, using the specific silver staining method and the cross-reaction with the anti-NopA100 antibody. In 2D Western blots of soluble nuclear fraction, NopA100 was revealed as a smear extending through a certain range of pI. In extracts obtained from seedlings grown under clinorotation, the extension of the pI range was shorter than in the stationary control indicating a lower phosphorylation of the protein. This suggests that altered gravity causes a decrease in the rate of nucleolar activity.

Understanding cellular architecture in cancer cells

NASA Astrophysics Data System (ADS)

Bianco, Simone; Tang, Chao

2011-03-01

Understanding the development of cancer is an important goal for today's science. The morphology of cellular organelles, such as the nucleus, the nucleoli and the mitochondria, which is referred to as cellular architecture or cytoarchitecture, is an important indicator of the state of the cell. In particular, there are striking difference between the cellular architecture of a healthy cell versus a cancer cell. In this work we present a dynamical model for the evolution of organelles morphology in cancer cells. Using a dynamical systems approach, we describe the evolution of a cell on its way to cancer as a trajectory in a multidimensional morphology state. The results provided by this work may increase our insight on the mechanism of tumorigenesis and help build new therapeutic strategies.

Measurement of particle size distribution in mammalian cells in vitro by use of polarized light spectroscopy

NASA Astrophysics Data System (ADS)

Bartlett, Matthew; Huang, George; Larcom, Lyndon; Jiang, Huabei

2004-02-01

We demonstrate the feasibility of measuring the particle size distribution (PSD) of internal cell structures in vitro. We use polarized light spectroscopy to probe the internal morphology of mammalian breast cancer (MCF7) and cervical cancer (Siha) cells. We find that graphing the least-squared error versus the scatterer size provides insight into cell scattering. A nonlinear optimization scheme is used to determine the PSD iteratively. The results suggest that 2-μm particles (possibly the mitochondria) contribute most to the scattering. Other subcellular structures, such as the nucleoli and the nucleus, may also contribute significantly. We reconstruct the PSD of the mitochondria, as verified by optical microscopy. We also demonstrate the angle dependence of the PSD.

Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

NASA Technical Reports Server (NTRS)

Gruener, Raphael; Hoeger, Glenn

1988-01-01

Cocultured Xenopus neurons and myocytes were subjected to nonvectorial gravity by clinostat rotation to determine the effects of microgravity on cell development and communications. Observed effects included increases in the myocyte and its nuclear area, fragmentation of nucleoli, the appearance of neuritic aneurysms, decreased growth in the presence of trophic factors, and decreased yolk utilization. These effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. It is found that, in microgravity, cell differentiation is altered by interference with cytoskeleton-related mechanisms. It is suggested that the alteration of the distribution of acetylcholine receptor aggregates on myocytes which occurs might indicate that microgravity affects brain development.

The cytology of a thyroid granular cell tumor.

PubMed

Chang, Shu-Mei; Wei, Chang-Kuo; Tseng, Chih-En

2009-01-01

Granular cell tumor (GCT) of the thyroid is rare. Before this report, only four cases of thyroid GCT have been reported, none of which presented a cytopathological examination. In this paper, we report the fine needle aspiration cytology and pathological analysis of a thyroid GCT from a 12-year-old girl who presented with a painless neck mass. The tumor cells were single, in syncytial clusters, or pseudofollicles, contained small round, oval, or spindle nuclei, indistinct nucleoli, and a large amount of grayish, granular fragile cytoplasm. The background contained granular debris and naked nuclei. A differential diagnosis of thyroid GCT with more frequent thyroid lesions containing cytoplasmic granules, including Hurthle cells, macrophages, follicular cells, and cells of black thyroid syndrome, was also performed.

Gravity and the cell: Intracellular structures and Stokes sedimentation

NASA Technical Reports Server (NTRS)

Todd, P.

1977-01-01

Plant and certain animal embryos appear to be responsive to the gravity vector during early stages of development. The convection of particle sedimentation as the basis for the sensing of gravity is investigated using the cells of wheat seedlings, amphibian embryos, and mammals. Exploration of the mammalian cell for sedimenting particles reveals that their existence is unlikely, especially in the presence of a network of microtubules and microfilaments considered to be responsible for intracellular organization. Destruction of these structures renders the cell susceptible to accelerations several times g. Large dense particles, such as chromosomes, nucleoli, and cytoplasmic organelles are acted upon by forces much larger than that due to gravity, and their positions in the cell appear to be insensitive to gravity.

Cytochemical features common to nucleoli and cytoplasmic nucleoloids of Olea europaea meiocytes: detection of rRNA by in situ hybridization.

PubMed

Alché, J D; Fernández, M C; Rodríguez-García, M I

1994-02-01

We used light and electron microscopic techniques to study the composition of cytoplasmic nucleoloids during meiotic division in Olea europaea. Nucleoloids were found in two clearly distinguishable morphological varieties: one similar in morphology to the nucleolus, and composed mainly of dense fibrillar component, and another surrounded by many ribosome-like particles. Cytochemical and immunocytochemical techniques showed similar reactivities in nucleoloids and the nucleolus: both are ribonucleoproteic in nature, and possess argyrophillic, argentaffinic and highly phosphorylated proteins. Immunohistochemical techniques failed to detect DNA in either structure. In situ hybridization to a 18 S rRNA probe demonstrated the presence of ribosomal transcripts in both the nucleolus and nucleoloids. These similarities in morphology and composition may reflect similar functionalities.

Nuclear bodies in the oocyte nucleus of ground beetles are enriched in snRNPs.

PubMed

Jaglarz, M K

2001-08-01

Within the oocyte nucleus of many insect species, a variable number of intensely stained spherical bodies occur. These nuclear bodies differ significantly from nucleoli and their precise role in nuclei has not been elucidated yet. I have examined some of the histochemical properties as well as the molecular composition of these structures in a representative of ground (carabid) beetles. I demonstrate, using molecular markers, that the nuclear bodies are composed of small nuclear RNAs and associated proteins, including p80 coilin. Hence, they correspond to Cajal bodies (= coiled bodies) described in somatic cell nuclei as well as oocyte germinal vesicles in plant and animal organisms. It is suggested that Cajal bodies in the carabid germinal vesicle serve as a storage site for splicing factors.

Light scattering microscopy measurements of single nuclei compared with GPU-accelerated FDTD simulations

NASA Astrophysics Data System (ADS)

Stark, Julian; Rothe, Thomas; Kieß, Steffen; Simon, Sven; Kienle, Alwin

2016-04-01

Single cell nuclei were investigated using two-dimensional angularly and spectrally resolved scattering microscopy. We show that even for a qualitative comparison of experimental and theoretical data, the standard Mie model of a homogeneous sphere proves to be insufficient. Hence, an accelerated finite-difference time-domain method using a graphics processor unit and domain decomposition was implemented to analyze the experimental scattering patterns. The measured cell nuclei were modeled as single spheres with randomly distributed spherical inclusions of different size and refractive index representing the nucleoli and clumps of chromatin. Taking into account the nuclear heterogeneity of a large number of inclusions yields a qualitative agreement between experimental and theoretical spectra and illustrates the impact of the nuclear micro- and nanostructure on the scattering patterns.

Cellular uptake of modified oligonucleotides: fluorescence approach

NASA Astrophysics Data System (ADS)

Kočišová, Eva; Praus, Petr; Rosenberg, Ivan; Seksek, Olivier; Sureau, Franck; Štěpánek, Josef; Turpin, Pierre-Yves

2005-06-01

Cellular uptake and intracellular distribution of the synthetic antisense analogue of dT 15 oligonucleotide (homogenously containing 3'-O-P-CH 2-O-5' internucleotide linkages and labeled with tetramethylrhodamine dye) was studied on B16 melanoma cell line by fluorescence micro-imaging and time-resolved microspectrofluorimetry. By using amphotericin B 3-dimethylaminopropyl amide as an enhancer molecule for the uptake process, homogenous staining of the cells with rather distinct nucleoli staining was achieved after 4 h of incubation. Two spectral components of 2.7 and 1.3 ns lifetime, respectively, were resolved in the emission collected from the cell nucleus. The way of staining and the long-lived component differed from our previous experiments demonstrating complexity of the intracellular oligonucleotide distribution and in particular of the binding inside the nucleus.

Flow cytometric analysis of leukocytes and reticulocytes stained with proflavine.

PubMed

Sagawa, H; Tatsumi, N

1997-12-01

Proflavine, an acridine analog for industrial use, was used to stain blood cells. A drop of blood treated with ethylenediaminetetraacetic acid-2K was mixed with a 0.00001% solution of the dye and observed immediately by fluorescence microscopy with a green filter. Leukocytes, platelets, and reticulocytes were stained but mature red blood cells were not. Chromatin in the nuclei of all leukocytes and nucleoli of lymphocytes and monocytes had greenish-yellow fluorescence, and the kind of cell could be identified by the tone and intensity of this color. Granules in granulocytes were in green. Reticular fine-granular or granulofibrous structures in the reticulocytes were brownish. The proflavine could be used routinely in clinical laboratories because this single stain makes possible simultaneous differentiation of leukocytes and counting of reticulocytes.

The nucleolus: an emerging target for cancer therapy.

PubMed

Hein, Nadine; Hannan, Katherine M; George, Amee J; Sanij, Elaine; Hannan, Ross D

2013-11-01

For over 100 years, pathologists have utilised an increase in size and number of nucleoli, the subnuclear site of ribosome synthesis, as a marker of aggressive tumours. Despite this, the contribution of the nucleolus and ribosomal RNA synthesis to cancer has been largely overlooked. This concept has recently changed with the demonstration that the nucleolus indirectly controls numerous other cellular functions, in particular, the cellular activity of the critical tumour suppressor protein, p53. Moreover, selective inhibition of ribosomal gene transcription in the nucleolus has been shown to be an effective therapeutic strategy to promote cancer-specific activation of p53. This article reviews the largely untapped potential of the nucleolus and ribosomal gene transcription as exciting new targets for cancer therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

Light scattering microscopy measurements of single nuclei compared with GPU-accelerated FDTD simulations.

PubMed

Stark, Julian; Rothe, Thomas; Kieß, Steffen; Simon, Sven; Kienle, Alwin

2016-04-07

Single cell nuclei were investigated using two-dimensional angularly and spectrally resolved scattering microscopy. We show that even for a qualitative comparison of experimental and theoretical data, the standard Mie model of a homogeneous sphere proves to be insufficient. Hence, an accelerated finite-difference time-domain method using a graphics processor unit and domain decomposition was implemented to analyze the experimental scattering patterns. The measured cell nuclei were modeled as single spheres with randomly distributed spherical inclusions of different size and refractive index representing the nucleoli and clumps of chromatin. Taking into account the nuclear heterogeneity of a large number of inclusions yields a qualitative agreement between experimental and theoretical spectra and illustrates the impact of the nuclear micro- and nanostructure on the scattering patterns.

Ultrastructural analysis of oocytes of Rhipicephalus (Boophilus) annulatus during postengorgement period as a tool to evaluate the cytotoxic effects of amitraz and deltamethrin on the germinative cells.

PubMed

Sreelekha, Kanapadinchareveetil; Chandrasekhar, Leena; Kartha, Harikumar S; Ravindran, Reghu; Juliet, Sanis; Ajithkumar, Karapparambu G; Nair, Suresh N; Ghosh, Srikanta

2017-11-30

The present study utilizes the ultrastructural analysis of the fully engorged female Rhipicephalus (Boophilus) annulatus ticks, as a tool to evaluate the cytotoxic potential of deltamethrin and amitraz on the germinative cells. The ultrastructural analysis of the ovary of the normal (untreated) R (B.) annulatus revealed, oocytes in different stages of development, attached to the ovary wall by pedicel cells. The attachment site of oocyte to the pedicel cell was characterized by indentations of the plasma membrane. The oocyte was bound by three cell membranes viz., plasma membrane, chorion and basal lamina. The stages of oocytes were differentiated ultrastructurally based on the features of their outer membrane and the number and size of lipid and yolk droplets. Detailed day wise analysis of ultrastructural changes in the ovary during the post-engorgement period revealed the occurrence of the degenerative changes from day five onwards. These appeared first in the oocytes followed by the germinal epithelium. The ovary of ticks treated with methanol (control), revealed similar topographies as that of a normal ovary except for the presence of very few oocytes with ring shaped nucleoli. Ultrastructurally, treatment with deltamethrin produced more prominent and extensive morphological alterations when compared to amitraz. In the case of ticks treated with amitraz, the oocytes of stage IV and V showed wavy and disrupted outer boundaries along with the loss of integrity of the yolk droplets. Uneven nuclear membranes of stage II oocytes and cristolysis of mitochondria of mature oocytes were the other changes noticed. Ticks treated with deltamethrin revealed prominent modifications such as, detachment of the basal lamina, wrinkled boundary, inconsistent nuclear membrane, ring shaped nucleoli and chromatin clumping in the case of the early stage oocytes (I and II), whereas swelling and cristolysis of mitochondria were seen in mature oocytes. The study further indicated that, in addition to the previous proven neurotoxic effects, these compounds act directly on the ovary of tick. Copyright © 2017 Elsevier B.V. All rights reserved.

The temporal and spatial distribution of the proliferation associated Ki-67 protein during female and male meiosis.

PubMed

Traut, Walther; Endl, Elmar; Scholzen, Thomas; Gerdes, Johannes; Winking, Heinz

2002-09-01

We used immunolocalization in tissue sections and cytogenetic preparations of female and male gonads to study the distribution of the proliferation marker pKi-67 during meiotic cell cycles of the house mouse, Mus musculus. During male meiosis, pKi-67 was continuously present in nuclei of all stages from the spermatogonium through spermatocytes I and II up to the earliest spermatid stage (early round spermatids) when it appeared to fade out. It was not detected in later spermatid stages or sperm. During female meiosis, pKi-67 was present in prophase I oocytes of fetal ovaries. It was absent in oocytes from newborn mice and most oocytes of primordial follicles from adults. The Ki-67 protein reappeared in oocytes of growing follicles and was continuously present up to metaphase II. Thus, pKi-67 was present in all stages of cell growth and cell division while it was absent from resting oocytes and during the main stages of spermiocytogenesis. Progression through the meiotic cell cycle was associated with extensive intranuclear relocation of pKi-67. In the zygotene and pachytene stages, most of the pKi-67 colocalized with centromeric (centric and pericentric) heterochromatin and adjacent nucleoli; the heterochromatic XY body in male pachytene, however, was free of pKi-67. At early diplotene, pKi-67 was mainly associated with nucleoli. At late diplotene, diakinesis, metaphase I and metaphase II of meiosis, pKi-67 preferentially bound to the perichromosomal layer and was almost absent from the heterochromatic centromeric regions of the chromosomes. After the second division of male meiosis, the protein reappeared at the centromeric heterochromatin and an adjacent region in the earliest spermatid stage and then faded out. The general patterns of pKi-67 distribution were comparable to those in mitotic cell cycles. With respect to the timing, it is interesting to note that relocation from the nucleolus to the perichromosomal layer takes place at the G2/M-phase transition in the mitotic cell cycle but at late diplotene of prophase I in meiosis, suggesting physiological similarity of these stages.

Dependency of subcellular reactions during PDT on the metabolic state of cell cultures probed by different microscopic techniques

NASA Astrophysics Data System (ADS)

Rueck, Angelika C.; Schneckenburger, Herbert; Strauss, Wolfgang S. L.; Gschwend, Michael H.; Beck, Gerd C.; Kunzi-Rapp, Karin; Steiner, Rudolf W.

1994-02-01

Various microscopic techniques were used to study the dependency of photodynamically induced subcellular reactions on the metabolic state of cell cultures. TPPS4 and AlS2-3Pc were incubated in RR 1022 epithelial cells with varying cell density. To attain almost isolated cells (low cell density) or confluent growing cells (high cell density) 25 cells/mm2 or 500 cells/mm2 were seeded, respectively. Low cell density irradiation with blue light led to a change in the initial cytoplasmatic fluorescence pattern. For both sensitizers, TPPS4 as well as AlS2-3, a fluorescence relocalization and fluorescence intensity increase could be detected, moreover in the case of TPPS4 a fluorescence formation in the nucleus and nucleoli were detected. In contrast, for confluent growing cells no redistribution was observed.

Subcellular localization of estradiol receptor in MCF7 cells studied with nanogold-labelled antibody fragments.

PubMed

Kessels, M M; Qualmann, B; Thole, H H; Sierralta, W D

1998-01-01

Ultrastructural localization studies of estradiol receptor in hormone-deprived and hormone-stimulated MCF7 cells were done using F(ab') fragments of three different antibodies (#402, 13H2, HT277) covalently linked to nanogold. These ultra-small, non-charged immunoreagents, combined with a size-enlargement by silver enhancement, localized estradiol receptor in both nuclear and cytoplasmic areas of non-stimulated target cells; stimulation with the steroid induced a predominantly nuclear labelling. In the cytoplasm of resting cells, tagging was often observed at or in the proximity of stress fibers. In the nucleus a large proportion of receptor was found inside the nucleolus, specially with the reagent derived from antibody 13H2. We postulate that different accessibilities of receptor epitopes account for the different labelling densities observed at cytoskeletal elements and the nucleoli.

Biomechanics of subcellular structures by non-invasive Brillouin microscopy

NASA Astrophysics Data System (ADS)

Antonacci, Giuseppe; Braakman, Sietse

2016-11-01

Cellular biomechanics play a pivotal role in the pathophysiology of several diseases. Unfortunately, current methods to measure biomechanical properties are invasive and mostly limited to the surface of a cell. As a result, the mechanical behaviour of subcellular structures and organelles remains poorly characterised. Here, we show three-dimensional biomechanical images of single cells obtained with non-invasive, non-destructive Brillouin microscopy with an unprecedented spatial resolution. Our results quantify the longitudinal elastic modulus of subcellular structures. In particular, we found the nucleoli to be stiffer than both the nuclear envelope (p < 0.0001) and the surrounding cytoplasm (p < 0.0001). Moreover, we demonstrate the mechanical response of cells to Latrunculin-A, a drug that reduces cell stiffness by preventing cytoskeletal assembly. Our technique can therefore generate valuable insights into cellular biomechanics and its role in pathophysiology.

Hodgkin's-like lymphoma in a ferret (Mustela putorius furo).

PubMed

Matsumoto, Isao; Uchida, Kazuyuki; Chambers, James Kenn; Nibe, Kazumi; Sato, Yu; Hamasu, Taku; Nakayama, Hiroyuki

2017-10-07

A 7-year-old castrated male ferret developed unilateral cervical lymphadenomegaly over a 1-month period. Histological examination revealed proliferation of tumor cells in a diffuse and partially nodular pattern. The tumor cells were predominantly Hodgkin cells and binucleated Reed-Sternberg cells, characterized by abundant, clear, vacuolated cytoplasm, pleomorphic, ovoid nuclei with thick nuclear membranes and distinct nucleoli. Multinucleated cells, resembling lymphocytic and histiocytic (L&H) cells, were also observed. Immunohistochemically, the tumor cells expressed Pax-5, BLA-36 and vimentin. A small population of the tumor cells expressed CD20. This case showed proliferation of Hodgkin/Reed-Sternberg cells in conjunction with L&H cells that were histologically analogous to feline Hodgkin's-like lymphoma. However, Pax-5 and BLA-36 expression along with rare CD20 expression were consistent with classical Hodgkin's lymphoma in humans.

The physiological and pathological biophysics of phase separation and gelation of RNA binding proteins in amyotrophic lateral sclerosis and fronto-temporal lobar degeneration.

PubMed

St George-Hyslop, Peter; Lin, Julie Qiaojin; Miyashita, Akinori; Phillips, Emma C; Qamar, Seema; Randle, Suzanne J; Wang, GuoZhen

2018-04-30

Many RNA binding proteins, including FUS, contain moderately repetitive, low complexity, intrinsically disordered domains. These sequence motifs have recently been found to underpin reversible liquid: liquid phase separation and gelation of these proteins, permitting them to reversibly transition from a monodispersed state to liquid droplet- or hydrogel-like states. This function allows the proteins to serve as scaffolds for the formation of reversible membraneless intracellular organelles such as nucleoli, stress granules and neuronal transport granules. Using FUS as an example, this review examines the biophysics of this physiological process, and reports on how mutations and changes in post-translational state alter phase behaviour, and lead to neurodegenerative diseases such as amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Copyright © 2018. Published by Elsevier B.V.

ARF tumor suppression in the nucleolus.

PubMed

Maggi, Leonard B; Winkeler, Crystal L; Miceli, Alexander P; Apicelli, Anthony J; Brady, Suzanne N; Kuchenreuther, Michael J; Weber, Jason D

2014-06-01

Since its discovery close to twenty years ago, the ARF tumor suppressor has played a pivotal role in the field of cancer biology. Elucidating ARF's basal physiological function in the cell has been the focal interest of numerous laboratories throughout the world for many years. Our current understanding of ARF is constantly evolving to include novel frameworks for conceptualizing the regulation of this critical tumor suppressor. As a result of this complexity, there is great need to broaden our understanding of the intricacies governing the biology of the ARF tumor suppressor. The ARF tumor suppressor is a key sensor of signals that instruct a cell to grow and proliferate and is appropriately localized in nucleoli to limit these processes. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease. Copyright © 2014 Elsevier B.V. All rights reserved.

Recurrent sebaceous carcinoma in an African hedgehog (Atelerix albiventris).

PubMed

Kim, Hyung-Jin; Kim, Yong-Baek; Park, Jun-Won; Oh, Won-Seok; Kim, Eun-Ok; Lim, Byoung-Yong; Kim, Dae-Yong

2010-07-01

A 1.5-year-old intact male African hedgehog (Atelerix albiventris) was presented with a firm, non-movable subcutaneous mass on ventral chest area. Microscopically, the tumor was un-encapsulated, invasive up to the muscle layer, and composed of highly pleomorphic polygonal cells arranged in variably-sized lobules. The neoplastic cells had abundant cytoplasm with vacuolation and a large pleomorphic nucleus with prominent nucleoli. Mitotic figures were frequently observed with atypical mitoses. Immunohistochemically, the neoplastic cells were strongly positive for cytokeratin, but negative for vimentin. Based on these findings, a diagnosis of sebaceous carcinoma was made. Three months after the surgery, a recurrent mass was found at the surgical site. On necropsy, the mass has penetrated the underlying intercostal musculature, without metastasis to distant organs. This is the first report of a sebaceous carcinoma in an African hedgehog.

Viral and cellular subnuclear structures in human cytomegalovirus-infected cells.

PubMed

Strang, Blair L

2015-02-01

In human cytomegalovirus (HCMV)-infected cells, a dramatic remodelling of the nuclear architecture is linked to the creation, utilization and manipulation of subnuclear structures. This review outlines the involvement of several viral and cellular subnuclear structures in areas of HCMV replication and virus-host interaction that include viral transcription, viral DNA synthesis and the production of DNA-filled viral capsids. The structures discussed include those that promote or impede HCMV replication (such as viral replication compartments and promyelocytic leukaemia nuclear bodies, respectively) and those whose role in the infected cell is unclear (for example, nucleoli and nuclear speckles). Viral and cellular proteins associated with subnuclear structures are also discussed. The data reviewed here highlight advances in our understanding of HCMV biology and emphasize the complexity of HCMV replication and virus-host interactions in the nucleus. © 2015 The Authors.

SHPRH regulates rRNA transcription by recognizing the histone code in an mTOR-dependent manner.

PubMed

Lee, Deokjae; An, Jungeun; Park, Young-Un; Liaw, Hungjiun; Woodgate, Roger; Park, Jun Hong; Myung, Kyungjae

2017-04-25

Many DNA repair proteins have additional functions other than their roles in DNA repair. In addition to catalyzing PCNA polyubiquitylation in response to the stalling of DNA replication, SHPRH has the additional function of facilitating rRNA transcription by localizing to the ribosomal DNA (rDNA) promoter in the nucleoli. SHPRH was recruited to the rDNA promoter using its plant homeodomain (PHD), which interacts with histone H3 when the fourth lysine of H3 is not trimethylated. SHPRH enrichment at the rDNA promoter was inhibited by cell starvation, by treatment with actinomycin D or rapamycin, or by depletion of CHD4. SHPRH also physically interacted with the RNA polymerase I complex. Taken together, we provide evidence that SHPRH functions in rRNA transcription through its interaction with histone H3 in a mammalian target of rapamycin (mTOR)-dependent manner.

Immunoelectron microscopy of RNA combined with nucleic acid cytochemistry in plant nucleoli.

PubMed

Mena, C G; Testillano, P S; González-Melendi, P; Gorab, E; Risueño, M C

1994-06-01

The immunoelectron microscopy detection of RNA using anti-RNA monoclonal antibodies has been performed for the first time over different plant cells. The use of the methylation-acetylation (MA) method permits clear distinction among the nuclear and nucleolar compartments and can be combined with the immunogold approach. Cytochemical methods for nucleic acids were performed together with the immunoassays, providing additional data about the different composition of the various nucleolar components. Anti-RNA antibodies highly labeled the ribosome-rich areas of the cytoplasm and the nucleolus. The interchromatin region also is labeled. The labeling was intense in the granular component, lower in the dense fibrillar component, and very scarce in the fibrillar centers. The MA method made possible the statistical evaluation of the labeling density in the various nuclear compartments by permitting the clear assignment of the particles to precise nuclear structures.

Nano-imaging of single cells using STIM

NASA Astrophysics Data System (ADS)

Minqin, Ren; van Kan, J. A.; Bettiol, A. A.; Daina, Lim; Gek, Chan Yee; Huat, Bay Boon; Whitlow, H. J.; Osipowicz, T.; Watt, F.

2007-07-01

Scanning transmission ion microscopy (STIM) is a technique which utilizes the energy loss of high energy (MeV) ions passing through a sample to provide structural images. In this paper, we have successfully demonstrated STIM imaging of single cells at the nano-level using the high resolution capability of the proton beam writing facility at the Centre for Ion Beam Applications, National University of Singapore. MCF-7 breast cancer cells (American Type Culture Collection [ATCC]) were seeded on to silicon nitride windows, backed by a Hamamatsu pin diode acting as a particle detector. A reasonable contrast was obtained using 1 MeV protons and excellent contrast obtained using 1 MeV alpha particles. In a further experiment, nano-STIM was also demonstrated using cells seeded on to the pin diode directly, and high quality nano-STIM images showing the nucleus and multiple nucleoli were extracted before the detector was significantly damaged.

Developmental Regulation of Nucleolus Size during Drosophila Eye Differentiation

PubMed Central

Baker, Nicholas E.

2013-01-01

When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals. PMID:23472166

Light-induced translocation of Pyronine G from mitochondria to nucleoli in monkey kidney CV-1 cells

NASA Astrophysics Data System (ADS)

Geze, Marc; Dellinger, M.; Bazin, M.; Santus, Rene C.

1996-12-01

Pyronine G (3,6-bis-N,N-dimethylaminoxanthylium chloride; PG) is a cationic dye that concentrates in mitochondria of living cells due to the high membrane potential of these organelles, similarly to rhodamine 123 and many other cationic dyes. Pyronine G also shows a preferential affinity for RNA. Upon light irradiation PG has been shown to induce cell death, but the photosensitizing properties of this molecule and the mechanism of cell death are not well understood. Microfluorometry and most particularly microspectrofluorometry are now powerful non-invasive techniques for quantitative studies of single living cells in real time which allow, for example, knowing how living cells are affected by photosensitization. To demonstrate the usefulness of image acquisition with high resolution and high sensitive camera, we present data on photosensitizer relocalization during illumination leading to functional and structural damage in the cells.

Determinants of Mammalian Nucleolar Architecture

PubMed Central

Farley, Katherine I.; Surovtseva, Yulia; Merkel, Janie; Baserga, Susan J.

2015-01-01

The nucleolus is responsible for the production of ribosomes, essential machines which synthesize all proteins needed by the cell. The structure of human nucleoli is highly dynamic and is directly related to its functions in ribosome biogenesis. Despite the importance of this organelle, the intricate relationship between nucleolar structure and function remains largely unexplored. How do cells control nucleolar formation and function? What are the minimal requirements for making a functional nucleolus? Here we review what is currently known regarding mammalian nucleolar formation at nucleolar organizer regions (NORs), which can be studied by observing the dissolution and reformation of the nucleolus during each cell division. Additionally, the nucleolus can be examined by analyzing how alterations in nucleolar function manifest in differences in nucleolar architecture. Furthermore, changes in nucleolar structure and function are correlated with cancer, highlighting the importance of studying the determinants of nucleolar formation. PMID:25670395

Method for evaluation of human induced pluripotent stem cell quality using image analysis based on the biological morphology of cells.

PubMed

Wakui, Takashi; Matsumoto, Tsuyoshi; Matsubara, Kenta; Kawasaki, Tomoyuki; Yamaguchi, Hiroshi; Akutsu, Hidenori

2017-10-01

We propose an image analysis method for quality evaluation of human pluripotent stem cells based on biologically interpretable features. It is important to maintain the undifferentiated state of induced pluripotent stem cells (iPSCs) while culturing the cells during propagation. Cell culture experts visually select good quality cells exhibiting the morphological features characteristic of undifferentiated cells. Experts have empirically determined that these features comprise prominent and abundant nucleoli, less intercellular spacing, and fewer differentiating cellular nuclei. We quantified these features based on experts' visual inspection of phase contrast images of iPSCs and found that these features are effective for evaluating iPSC quality. We then developed an iPSC quality evaluation method using an image analysis technique. The method allowed accurate classification, equivalent to visual inspection by experts, of three iPSC cell lines.

[Cytogenetic characteristics of seed progeny of trees under condition of antropogenic contamination in Voronezh town].

PubMed

Butorina, A K; Kalaev, V N; Vostrikova, T V; Miagkova, O E

2000-01-01

It has been shown that in seed progeny of Quercus robur L., Pinus sylvestris L. and Betula pendula Roth. some cytogenetical characteristics vary under conditions of contamination. Such changes may be common or specific type. Thus, the frequency of pathological mitosis increases under such conditions in all the investigated species of trees. Inhibition of mitosis was found in the progeny of the pine, and variability in the number of nucleoli was detected in the pine and oak. However, in some cases the level of pathological mitosis in the oak progeny did not differ from the control, but the mitotic activity was higher due to the presence of much more cells being at the prophase stage. In the birch progeny under conditions of contamination the mitotic index increased, with a simultaneous shifts in the peaks of mitotic activity. The possibility of using these cytological characteristics for the aims of cytogenetical monitoring is considered.

Cytological diagnosis of metastatic glioblastoma in the pleural effusion of a lung transplant patient.

PubMed

Nauen, David W; Li, Qing Kay

2014-07-01

The extracranial metastasis of glioblastoma is a rare event. We report the case of a patient who developed metastatic glioblastoma in pleural effusion 15 months after lung transplant, with emphasis on differential diagnosis based on cytological material. In our case, tumor cells had pleomorphic nuclei, prominent nucleoli, and fine vesicular chromatin. Some were arranged in a poorly formed pseudo-glandular architecture, mimicking a poorly differentiated adenocarcinoma. The cytological diagnosis of metastatic glioblastoma is difficult and depends critically on clinical history and suspicion, particularly in the transplant setting. Review of the literature indicates that transmission/metastasis of intracranial malignancy occurs rarely following organ transplantation, with some debate on the suitability for transplant of organs from affected donors. Although the situation is uncommon, this report of the cytological findings of extracranial glioblastoma may extend our current knowledge and provide additional differential diagnostic information for this entity. © 2013 Wiley Periodicals, Inc.

[Stability in association of the peripheral material with mitotic chromosomes].

PubMed

Kosykh, M I; Chentsov, Iu S

2002-01-01

The localization of nucleolar proteins (fibrillarin and B-23), and of the protein of interphase nuclear matrix (NMP-65) was studied in the perichromosomal material (CM) after of short hypotonic treatment (15% solution of Henks medium) on cultured pig embryonic kidney cells, followed by restoration of isotonic conditions. It is shown that during hypotonic shock the mitotic chromosomes demonstrate reversible swelling, but their periphery is bounded with a rim of PCM, containing antibodies to fibrillarin and NMP-65, but not to B-23. After returning the cells to the initial isotonic medium, all the three proteins can be detected again on the periphery of chromosomes. It suggests the existence of different stability in the association of free proteins with chromosome bodies. Besides, B-23 and fibrillarin could be visualized in residual nucleoli after a complete extraction of histones and DNA from nuclei.

Insulin/IGF1-PI3K-dependent nucleolar localization of a glycolytic enzyme--phosphoglycerate mutase 2, is necessary for proper structure of nucleolus and RNA synthesis.

PubMed

Gizak, Agnieszka; Grenda, Marcin; Mamczur, Piotr; Wisniewski, Janusz; Sucharski, Filip; Silberring, Jerzy; McCubrey, James A; Wisniewski, Jacek R; Rakus, Dariusz

2015-07-10

Phosphoglycerate mutase (PGAM), a conserved, glycolytic enzyme has been found in nucleoli of cancer cells. Here, we present evidence that accumulation of PGAM in the nucleolus is a universal phenomenon concerning not only neoplastically transformed but also non-malignant cells. Nucleolar localization of the enzyme is dependent on the presence of the PGAM2 (muscle) subunit and is regulated by insulin/IGF-1-PI3K signaling pathway as well as drugs influencing ribosomal biogenesis. We document that PGAM interacts with several 40S and 60S ribosomal proteins and that silencing of PGAM2 expression results in disturbance of nucleolar structure, inhibition of RNA synthesis and decrease of the mitotic index of squamous cell carcinoma cells. We conclude that presence of PGAM in the nucleolus is a prerequisite for synthesis and initial assembly of new pre-ribosome subunits.

Developmental regulation of nucleolus size during Drosophila eye differentiation.

PubMed

Baker, Nicholas E

2013-01-01

When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals.

The Nucleolus: In Genome Maintenance and Repair.

PubMed

Tsekrekou, Maria; Stratigi, Kalliopi; Chatzinikolaou, Georgia

2017-07-01

The nucleolus is the subnuclear membrane-less organelle where rRNA is transcribed and processed and ribosomal assembly occurs. During the last 20 years, however, the nucleolus has emerged as a multifunctional organelle, regulating processes that go well beyond its traditional role. Moreover, the unique organization of rDNA in tandem arrays and its unusually high transcription rates make it prone to unscheduled DNA recombination events and frequent RNA:DNA hybrids leading to DNA double strand breaks (DSBs). If not properly repaired, rDNA damage may contribute to premature disease onset and aging. Deregulation of ribosomal synthesis at any level from transcription and processing to ribosomal subunit assembly elicits a stress response and is also associated with disease onset. Here, we discuss how genome integrity is maintained within nucleoli and how such structures are functionally linked to nuclear DNA damage response and repair giving an emphasis on the newly emerging roles of the nucleolus in mammalian physiology and disease.

Hidradenocarcinoma presenting as soft tissue mass: Case report with cytomorphologic description, histologic correlation, and differential diagnosis.

PubMed

Jinnah, Alexander H; Emory, Cynthia L; Mai, Nicholas H; Bergman, Simon; Salih, Ziyan T

2016-05-01

Hidradenocarcinoma (HAC) is a rare adenexal tumor with a propensity for the head and neck region and extremities. We report a case of hidradenocarcinnoma in a 56-year-old woman with a mass on her right palm sampled by fine-needle aspiration and later confirmed on histological examination. Fine-needle aspiration cytology revealed a dual population of cells including polyhedral eosinophilic cells and glycogen containing cells with pale/clear cytoplasm. The nuclei were pleomorphic with prominent nucleoli. Occassional papillary structures were identified on the cell block material. A series of immunohistochemical stains were performed and an adnexal neoplasm was suggested. The mass was resected. On histologic sections, infiltration into the adjacent soft tissue was identified. After an additional series of immunohistochemical stains, the diagnosis was confirmed as a HAC. Herein, we present our findings and discuss the differential diagnoses. © 2016 Wiley Periodicals, Inc.

T-cell/histiocyte-rich large B-cell lymphoma of stomach.

PubMed

Barut, Figen; Kandemir, Nilufer Onak; Gun, Banu Dogan; Ozdamar, Sukru Oguz

2016-07-01

T-cell/histiocyte-rich large B-cell lymphoma is an unusually encountered lymphoid neoplasm of stomach with aggressive course, and is an uncommon morphologic variant of diffuse large B-cell lymphoma. An ulcerated mass, 7x5x1 cm in size was observed within the gastrectomy specimen of a 76-year-old female patient. In cross sections, besides mature lymphoid cells displaying T-cell phenotype, a neoplastic formation composed of large, pleomorphic atypical lymphoid cells with, prominent nucleoli, vesicular nuclei and abundant eosinophilic cytoplasm displaying B-cell phenotype were observed. Meanwhile, histiocyte-like mononuclear cells and Reed-Sternberg-like multinuclear cells expressing CD68 and Mac387 were also observed. The diagnosis of the case was T cell/histiocyte-rich large B-cell lymphoma. This rarely encountered neoplasm should be kept in mind in the differential diagnosis of primary gastric lymphomas.

From noise to synthetic nucleoli: can synthetic biology achieve new insights?

PubMed

Ciechonska, Marta; Grob, Alice; Isalan, Mark

2016-04-18

Synthetic biology aims to re-organise and control biological components to make functional devices. Along the way, the iterative process of designing and testing gene circuits has the potential to yield many insights into the functioning of the underlying chassis of cells. Thus, synthetic biology is converging with disciplines such as systems biology and even classical cell biology, to give a new level of predictability to gene expression, cell metabolism and cellular signalling networks. This review gives an overview of the contributions that synthetic biology has made in understanding gene expression, in terms of cell heterogeneity (noise), the coupling of growth and energy usage to expression, and spatiotemporal considerations. We mainly compare progress in bacterial and mammalian systems, which have some of the most-developed engineering frameworks. Overall, one view of synthetic biology can be neatly summarised as "creating in order to understand."

Atypical feline sporotrichosis resembling vaccine-induced sarcoma: clinical and histopathological aspects.

PubMed

dos Santos, Isabele Barbieri; Quintella, Leonardo Pereira; de Miranda, Luisa Helena Monteiro; de Sousa Trotte, Marcele Nogueira; Schubach, Tânia Maria Pacheco; Tortelly, Rogerio

2013-06-01

A 7-year-old Siamese cat presenting with three ulcerated cutaneous nodules in the lumbosacral region was seen at the Laboratory for Clinical Research on Dermatozoonoses in Domestic Animals in Rio de Janeiro, Brazil. Histopathological analysis showed that the lesions consisted of polyhedral and spindle-shaped voluminous mononuclear cells with loose chromatin and clearly visible nucleoli, few giant cells, and foci of coagulative and caseous necrosis -- findings suggestive of a vaccine-induced sarcoma. No significant mitotic rate, cytological atypias or asteroid bodies were observed. Special histopathological staining with periodic acid-Schiff and Grocott's silver stain demonstrated the presence of small yeast cells characterized by simple and narrow-base budding compatible with Sporothrix schenckii. Mycological culture grew S schenckii. Cytopathology was negative for yeast cells. These atypical clinical and histopathological signs support the importance of histopathological analysis with special staining techniques, in addition to mycological culture in the diagnosis of feline sporotrichosis.

Nuclear Lipids in the Nervous System: What they do in Health and Disease.

PubMed

Garcia-Gil, Mercedes; Albi, Elisabetta

2017-02-01

In the last 20 years it has been widely demonstrated that cell nucleus contains neutral and polar lipids localized in nuclear membranes, nucleoli, nuclear matrix and chromatin. Nuclear lipids may show specific organization forming nuclear lipid microdomains and have both structural and functional roles. Depending on their localization, nuclear lipids play different roles such as the regulation of nuclear membrane and nuclear matrix fluidity but they also can act as platforms for vitamin and hormone function, for active chromatin anchoring, and for the regulation of gene expression, DNA duplication and transcription. Crosstalk among different kinds of lipid signalling pathways influence the physiopathology of numerous cell types. In neural cells the nuclear lipids are involved in cell proliferation, differentiation, inflammation, migration and apoptosis. Abnormal metabolism of nuclear lipids might be closely associated with tumorigenesis and neurodegenerative diseases such as Alzheimer disease and Parkinson disease among others.

Malignant mast cell tumor of the thymus in an Royal College of Surgeons (RCS) rat.

PubMed

Terayama, Yui; Matsuura, Tetsuro; Ozaki, Kiyokazu

2017-01-01

A 152-week-old male Royal College of Surgeons (RCS) rat kept as a non-treated animal in a long-term animal study presented with a soft mass in the anterior mediastinum, which adhered to the pleura of the lung. Histopathologically, the mass mainly consisted of round to short spindle-shaped tumor cells that had infiltrated through the hyperplastic thymic tissue. The tumor cells were arranged in loose to dense sheets. Nuclei were moderate in size and round to spindle-shaped, with small nucleoli. Almost all tumor cells exhibited abundant eosinophilic cytoplasm, including eosinophilic granules of a range of sizes. The granules of tumor cells exhibited metachromasia with toluidine blue stain and were positive for c-kit and mast cell protease II. These findings indicate that the tumor described here represents a rare case of spontaneous malignant mast cell tumor with thymic epithelial hyperplasia.

Nuclear organization during in vitro differentiation of porcine mesenchymal stem cells (MSCs) into adipocytes.

PubMed

Stachecka, Joanna; Walczak, Agnieszka; Kociucka, Beata; Ruszczycki, Błażej; Wilczyński, Grzegorz; Szczerbal, Izabela

2018-02-01

Differentiation of progenitor cells into adipocytes is accompanied by remarkable changes in cell morphology, cytoskeletal organization, and gene expression profile. Mature adipocytes are filled with a large lipid droplet and the nucleus tends to move to the cell periphery. It was hypothesized that the differentiation process is also associated with changes of nuclear organization. The aim of this study was to determine the number and distribution of selected components of nuclear architecture during porcine in vitro adipogenesis. The pig is an important animal model sharing many similarities to humans at the anatomical, physiological, and genetic levels and has been recognized as a good model for human obesity. Thus, understanding how cellular structures important for fundamental nuclear processes may be altered during adipocyte differentiation is of great importance. Mesenchymal stem cells (MSCs) were derived from bone marrow (BM-MSCs) and adipose tissue (AD-MSCs) and were cultured for 7 days in the adipogenic medium. A variable differentiation potential of these cell populations towards adipogenic lineage was observed, and for further study, a comparative characteristic of the nuclear organization in BM-MSCs and AD-MSCs was performed. Nuclear substructures were visualized by indirect immunofluorescence (nucleoli, nuclear speckles, PML bodies, lamins, and HP1α) or fluorescence in situ hybridization (telomeres) on fixed cells at 0, 3, 5, and 7 days of differentiation. Comprehensive characterization of these structures, in terms of their number, size, dynamics, and arrangement in three-dimensional space of the nucleus, was performed. It was found that during differentiation of porcine MSCs into adipocytes, changes of nuclear organization occurred and concerned: (1) the nuclear size and shape; (2) reduced lamin A/C expression; and (3) reorganization of chromocenters. Other elements of nuclear architecture such as nucleoli, SC-35 nuclear speckles, and telomeres showed no significant changes when compared to undifferentiated and mature fat cells. In addition, the presence of a low number of PML bodies was characteristic of the studied porcine mesenchymal stem cell adipogenesis system. It has been shown that the arrangement of selected components of nuclear architecture was very similar in MSCs derived from different sources, whereas adipocyte differentiation involves nuclear reorganization. This study adds new data on nuclear organization during adipogenesis using the pig as a model organism.

A non-isotopic assay uses bromouridine and RNA synthesis to detect DNA damage responses.

PubMed

Hasegawa, Mayu; Iwai, Shigenori; Kuraoka, Isao

2010-06-17

Individuals with inherited xeroderma pigmentosum (XP) disorder and Cockayne syndrome (CS) are deficient in nucleotide excision repair and experience hypersensitivity to sunlight. Although there are several diagnostic assays for these disorders, the recovery of RNA synthesis (RRS) assay that can discriminate between XP cells and CS cells is very laborious. Here, we report on a novel non-radioisotope RRS assay that uses bromouridine (a uridine analog) as an alternative to (3)H-uridine. This assay can easily detect RNA polymerase I transcription in nucleoli and RNA polymerase II transcription in nuclei. The non-RI RSS assay also can rapidly detect normal RRS activity in HeLa cells. Thus, this assay is useful as a novel and easy technique for CS diagnosis. Because RRS is thought to be related to transcription-coupled DNA repair, which is triggered by the blockage of transcriptional machinery by DNA lesions, this assay may be of use for analysis of DNA repair, transcription, and/or genetic toxicity. Copyright 2010 Elsevier B.V. All rights reserved.

Localization of nucleolar chromatin by immunocytochemistry and in situ hybridization at the electron microscopic level.

PubMed

Thiry, M; Scheer, U; Goessens, G

1991-01-01

Nucleoli are the morphological expression of the activity of a defined set of chromosomal segments bearing rRNA genes. The topological distribution and composition of the intranucleolar chromatin as well as the definition of nucleolar structures in which enzymes of the rDNA transcription machinery reside have been investigated in mammalian cells by various immunogold labelling approaches at the ultrastructural level. The precise intranucleolar location of rRNA genes has been further specified by electron microscopic in situ hybridization with a non-autoradiographic procedure. Our results indicate that the fibrillar centers are the sole nucleolar structures where rDNA, core histones, RNA polymerase I and DNA topoisomerase I are located together. Taking into account the potential value and limitations of immunoelectron microscopic techniques, we propose that transcription of the rRNA genes takes place within the confines of the fibrillar centers, probably close to the boundary regions to the surrounding dense fibrillar component.

The Nucleolus: In Genome Maintenance and Repair

PubMed Central

Tsekrekou, Maria; Stratigi, Kalliopi; Chatzinikolaou, Georgia

2017-01-01

The nucleolus is the subnuclear membrane-less organelle where rRNA is transcribed and processed and ribosomal assembly occurs. During the last 20 years, however, the nucleolus has emerged as a multifunctional organelle, regulating processes that go well beyond its traditional role. Moreover, the unique organization of rDNA in tandem arrays and its unusually high transcription rates make it prone to unscheduled DNA recombination events and frequent RNA:DNA hybrids leading to DNA double strand breaks (DSBs). If not properly repaired, rDNA damage may contribute to premature disease onset and aging. Deregulation of ribosomal synthesis at any level from transcription and processing to ribosomal subunit assembly elicits a stress response and is also associated with disease onset. Here, we discuss how genome integrity is maintained within nucleoli and how such structures are functionally linked to nuclear DNA damage response and repair giving an emphasis on the newly emerging roles of the nucleolus in mammalian physiology and disease. PMID:28671574

Influence of sample preparation and identification of subcelluar structures in quantitative holographic phase contrast microscopy

NASA Astrophysics Data System (ADS)

Kemper, Björn; Schmidt, Lisa; Przibilla, Sabine; Rommel, Christina; Vollmer, Angelika; Ketelhut, Steffi; Schnekenburger, Jürgen; von Bally, Gert

2010-04-01

Digital holographic microscopy (DHM) provides label-free quantitative phase contrast with low demands on sample preparation. Nevertheless, for DHM measurements on fixed cells the mounting medium has to be considered while the phase contrast of living cells may be influenced by the used buffer solution. To quantify these effects, the maximum cell caused phase contrast and the visibility of the nucleoli were analyzed. A second aim of the study was to identify subcellular components in DHM phase contrast images. Therefore, comparative investigations using bright field imaging, DHM and fluorescence microscopy with 4',6- Diamidino-2-phenylindol (DAPI) staining were performed. DAPI-staining visualizes cell components containing DNA. The obtained results demonstrate exemplarily for two tumor cell lines that from DHM phase contrast images of fixed cells in phosphate buffer saline (PBS) cell thickness values are obtained which are comparable to living cells. Furthermore, it is shown that in many cases nucleus components can be identified only by DHM phase contrast.

Mutagenic activity of heavy metals in soils of wayside slopes

NASA Astrophysics Data System (ADS)

Fedorova, A. I.; Kalaev, V. N.; Prosvirina, Yu. G.; Goryainova, S. A.

2007-08-01

The genotoxic properties of soils polluted with heavy metals were studied on two wayside slopes covered with trees in the city of Voronezh. The nucleolar test in cells of the apical meristem of Zebrina pendula Schnizl. roots was used. The genotoxic effect of the soils was revealed according to the increased number of 2-and 3-nucleolar cells (from 41 to 54% and from 19 to 23% in the upper part of the first and second slopes, respectively; in the control, their number was 18 and 7%). The mean number of nucleoli per cell increased from 1.7 to 1.95 in the experiment and 1.31 in the control. The increased vehicle emissions, especially when cars go up the slopes (mainly in the upper and middle parts), correlated with the elevated heavy metal (Pb, Cu, Cd, and Zn) contents in the soil. The mutagenic substances may be removed to the Voronezh Reservoir, where they may be accumulated in some living organisms.

Tomographic brain imaging with nucleolar detail and automatic cell counting

NASA Astrophysics Data System (ADS)

Hieber, Simone E.; Bikis, Christos; Khimchenko, Anna; Schweighauser, Gabriel; Hench, Jürgen; Chicherova, Natalia; Schulz, Georg; Müller, Bert

2016-09-01

Brain tissue evaluation is essential for gaining in-depth insight into its diseases and disorders. Imaging the human brain in three dimensions has always been a challenge on the cell level. In vivo methods lack spatial resolution, and optical microscopy has a limited penetration depth. Herein, we show that hard X-ray phase tomography can visualise a volume of up to 43 mm3 of human post mortem or biopsy brain samples, by demonstrating the method on the cerebellum. We automatically identified 5,000 Purkinje cells with an error of less than 5% at their layer and determined the local surface density to 165 cells per mm2 on average. Moreover, we highlight that three-dimensional data allows for the segmentation of sub-cellular structures, including dendritic tree and Purkinje cell nucleoli, without dedicated staining. The method suggests that automatic cell feature quantification of human tissues is feasible in phase tomograms obtained with isotropic resolution in a label-free manner.

The influenza fingerprints: NS1 and M1 proteins contribute to specific host cell ultrastructure signatures upon infection by different influenza A viruses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Terrier, Olivier; Moules, Vincent; Carron, Coralie

Influenza A are nuclear replicating viruses which hijack host machineries in order to achieve optimal infection. Numerous functional virus-host interactions have now been characterized, but little information has been gathered concerning their link to the virally induced remodeling of the host cellular architecture. In this study, we infected cells with several human and avian influenza viruses and we have analyzed their ultrastructural modifications by using electron and confocal microscopy. We discovered that infections lead to a major and systematic disruption of nucleoli and the formation of a large number of diverse viral structures showing specificity that depended on the subtypemore » origin and genomic composition of viruses. We identified NS1 and M1 proteins as the main actors in the remodeling of the host ultra-structure and our results suggest that each influenza A virus strain could be associated with a specific cellular fingerprint, possibly correlated to the functional properties of their viral components.« less

Ring-like distribution of constitutive heterochromatin in bovine senescent cells.

PubMed

Pichugin, Andrey; Beaujean, Nathalie; Vignon, Xavier; Vassetzky, Yegor

2011-01-01

Cells that reach "Hayflick limit" of proliferation, known as senescent cells, possess a particular type of nuclear architecture. Human senescent cells are characterized by the presence of highly condensed senescent associated heterochromatin foci (SAHF) that can be detected both by immunostaining for histone H3 three-methylated at lysine 9 (H3K9me3) and by DAPI counterstaining. We have studied nuclear architecture in bovine senescent cells using a combination of immunofluorescence and 3D fluorescent in-situ hybridization (FISH). Analysis of heterochromatin distribution in bovine senescent cells using fluorescent in situ hybridization for pericentric chromosomal regions, immunostaining of H3K9me3, centromeric proteins CENP A/B and DNA methylation showed a lower level of heterochromatin condensation as compared to young cells. No SAHF foci were observed. Instead, we observed fibrous ring-like or ribbon-like heterochromatin patterns that were undetectable with DAPI counterstaining. These heterochromatin fibers were associated with nucleoli. Constitutive heterochromatin in bovine senescent cells is organized in ring-like structures.

Involvement of UL24 in herpes-simplex-virus-1-induced dispersal of nucleolin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lymberopoulos, Maria H.; Pearson, Angela

2007-07-05

UL24 of herpes simplex virus 1 is important for efficient viral replication, but its function is unknown. We generated a recombinant virus, vHA-UL24, encoding UL24 with an N-terminal hemagglutinin tag. By indirect immunofluorescence at 9 h post-infection (hpi), we detected HA-UL24 in nuclear foci and in cytoplasmic speckles. HA-UL24 partially co-localized with nucleolin, but not with ICP8 or coilin, markers for nucleoli, viral replication compartments, and Cajal bodies respectively. HA-UL24 staining was often juxtaposed to that of another nucleolar protein, fibrillarin. Analysis of HSV-1-induced nucleolar modifications revealed that by 18 hpi, nucleolin staining had dispersed, and fibrillarin staining went frommore » clusters of small spots to a few separate but prominent spots. Fibrillarin redistribution appeared to be independent of UL24. In contrast, cells infected with a UL24-deficient virus retained foci of nucleolin staining. Our results demonstrate involvement of UL24 in dispersal of nucleolin during infection.« less

Nucleoprotein Changes in Plant Tumor Growth

PubMed Central

Rasch, Ellen; Swift, Hewson; Klein, Richard M.

1959-01-01

Tumor cell transformation and growth were studied in a plant neoplasm, crown gall of bean, induced by Agrobacterium rubi. Ribose nucleic acid (RNA), deoxyribose nucleic acid (DNA), histone, and total protein were estimated by microphotometry of nuclei, nucleoli, and cytoplasm in stained tissue sections. Transformation of normal cells to tumor cells was accompanied by marked increases in ribonucleoprotein content of affected tissues, reaching a maximum 2 to 3 days after inoculation with virulent bacteria. Increased DNA levels were in part associated with increased mitotic frequency, but also with progressive accumulation of nuclei in the higher DNA classes, formed by repeated DNA doubling without intervening reduction by mitosis. Some normal nuclei of the higher DNA classes (with 2, 4, or 8 times the DNA content of diploid nuclei) were reduced to diploid levels by successive cell divisions without intervening DNA synthesis. The normal relation between DNA synthesis and mitosis was thus disrupted in tumor tissue. Nevertheless, clearly defined DNA classes, as found in homologous normal tissues, were maintained in the tumor at all times. PMID:13673042

In vivo self-bio-imaging of tumors through in situ biosynthesized fluorescent gold nanoclusters

NASA Astrophysics Data System (ADS)

Wang, Jianling; Zhang, Gen; Li, Qiwei; Jiang, Hui; Liu, Chongyang; Amatore, Christian; Wang, Xuemei

2013-01-01

Fluorescence imaging in vivo allows non-invasive tumor diagnostic thus permitting a direct monitoring of cancer therapies progresses. It is established herein that fluorescent gold nanoclusters are spontaneously biosynthesized by cancerous cell (i.e., HepG2, human hepatocarcinoma cell line; K562, leukemia cell line) incubated with micromolar chloroauric acid solutions, a biocompatible molecular Au(III) species. Gold nanoparticles form by Au(III) reduction inside cells cytoplasms and ultimately concentrate around their nucleoli, thus affording precise cell imaging. Importantly, this does not occur in non-cancerous cells, as evidenced with human embryo liver cells (L02) used as controls. This dichotomy is exploited for a new strategy for in vivo self-bio-imaging of tumors. Subcutaneous injections of millimolar chloroauric acid solution near xenograft tumors of the nude mouse model of hepatocellular carcinoma or chronic myeloid leukemia led to efficient biosynthesis of fluorescent gold nanoclusters without significant dissemination to the surrounding normal tissues, hence allowing specific fluorescent self-bio-marking of the tumors.

Cooperative transformation and coexpression of bovine papillomavirus type 1 E5 and E7 proteins.

PubMed

Bohl, J; Hull, B; Vande Pol, S B

2001-01-01

Productively infected bovine fibropapillomas were examined for bovine papillomavirus type 1 (BPV-1) E7 localization. BPV-1 E7 was observed in the cytoplasm of basal and lower spinous epithelial cells, coexpressed in the cytoplasm of basal cells with the E5 oncoprotein. E7 was also observed in nucleoli throughout the basal and spinous layers but not in the granular cell layer. Ectopic expression of E7 in cultured epithelial cells gave rise to localization similar to that seen in productive fibropapillomas, with cytoplasmic and nucleolar expression observed. Consistent with the coexpression of E7 and E5 in basal keratinocytes, BPV-1 E7 cooperated with E5 as well as E6 in an anchorage independence transformation assay. While E5 is expressed in both basal and superficial differentiating keratinocytes, BPV-1 E7 is only observed in basal and lower spinous epithelial cells. Therefore, BPV-1 E7 may serve to modulate the cellular response of basal epithelial cells to E5 expression.

[Nuclear protein matrix from giant nuclei of Chironomus plumosus determinates polythene chromosome organization].

PubMed

Makarov, M S; Chentsov, Iu S

2010-01-01

Giant nuclei from salivary glands of Chironomus plumosus were treated in situ with detergent, 2 M NaCl and nucleases in order to reveal residual nuclear matrix proteins (NMP). It was shown, that preceding stabilization of non-histone proteins with 2 mM CuCl2 allowed to visualize the structure of polythene chromosomes at every stage of the extraction of histones and DNA. Stabilized NPM of polythene chromosomes maintains their morphology and banding patterns, which is observed by light and electron microscopy, whereas internal fibril net or residual nucleoli are not found. In stabilized NPM of polythene chromosomes, topoisomerase IIalpha and SMC1 retain their localization that is typical of untreated chromosomes. NPM of polythene chromosomes also includes sites of DNA replication, visualized with BrDU incubation, and some RNA-components. So, we can conclude that structure of NPM from giant nuclei is equal to NPM from normal interphase nuclei, and that morphological features of polythene chromosomes depend on the presence of NMP.

Variant hairy cell leukemia following papillary urothelial neoplasm of bladder.

PubMed

Beyan, Cengiz; Kaptan, Kürsat

2014-03-01

A 65 years old man was admitted with multiple lymphadenopathy, weight loss, night sweats and fatigue for 2 months. He had been treated for bladder cancer 2 years ago. Leukocyte count was 37.9 x10(9)/l. Peripheral blood smear had 91% lymphocytes. Lymphocytes had large nuclei with prominent nucleoli, heterogeneous appearance, and large cytoplasm with hairy projections. Flow cytometric immunophenotyping revealed CD20, CD22, CD24, CD45 and HLA-DR positivity. Atypical lymphocytes were stained with tartrate resistant acid phosphatase. Increased metabolic activity was detected in multiple lymph nodes, bone marrow and extremely enlarged spleen with positron emission tomography-computed tomography. Excisional biopsy of the left axillary lymph node revealed infiltration with diffuse B-cell leukemia/lymphoma. Immunohistochemistry showed CD20 positive atypical cells with weak expression of CD11c. The patient was diagnosed as a case of variant hairy cell leukemia and cladribine was administered. A probable second primary malignancy should be kept in mind in cases with a defined malignancy in the presence of unusual symptoms.

Assembly and disassembly of the nucleolus during the cell cycle.

PubMed

Hernandez-Verdun, Danièle

2011-01-01

The nucleolus is a large nuclear domain in which transcription, maturation and assembly of ribosomes take place. In higher eukaryotes, nucleolar organization in three sub-domains reflects the compartmentation of the machineries related to active or inactive transcription of the ribosomal DNA, ribosomal RNA processing and assembly with ribosomal proteins of the two (40S and 60S) ribosomal subunits. The assembly of the nucleoli during telophase/early G(1) depends on pre-existing machineries inactivated during prophase (the transcription machinery and RNP processing complexes) and on partially processed 45S rRNAs inherited throughout mitosis. In telophase, the 45S rRNAs nucleate the prenucleolar bodies and order the dynamics of nucleolar assembly. The assembly/disassembly processes of the nucleolus depend on the equilibrium between phosphorylation/dephosphorylation of the transcription machinery and on the RNP processing complexes under the control of the CDK1-cyclin B kinase and PP1 phosphatases. The dynamics of assembly/disassembly of the nucleolus is time and space regulated.

Identification of nucleolus-associated chromatin domains reveals the role of the nucleolus in the 3D organisation of the A. thaliana genome

PubMed Central

Pontvianne, Frédéric; Carpentier, Marie-Christine; Durut, Nathalie; Pavlištová, Veronika; Jaške, Karin; Schořová, Šárka; Parrinello, Hugues; Rohmer, Marine; Pikaard, Craig S; Fojtová, Miloslava; Fajkus, Jiří; Saez-Vasquez, Julio

2017-01-01

The nucleolus is the site of ribosomal RNA (rRNA) gene transcription, rRNA processing and ribosome biogenesis. However, the nucleolus also plays additional roles in the cell. We isolated nucleoli by Fluorescence Activated Cell Sorting (FACS) and identified Nucleolus-Associated Chromatin Domains (NADs) by deep sequencing, comparing wild-type plants and null mutants for the nucleolar protein, NUCLEOLIN 1 (NUC1). NADs are primarily genomic regions with heterochromatic signatures and include transposable elements (TEs), sub-telomeric regions and mostly inactive protein-coding genes. However, NADs also include active ribosomal RNA genes, and the entire short arm of chromosome 4 adjacent to them. In nuc1 null mutants, which alter rRNA gene expression and overall nucleolar structure, NADs are altered, telomere association with the nucleolus is decreased and telomeres become shorter. Collectively, our studies reveal roles for NUC1 and the nucleolus in the spatial organization of chromosomes as well as telomere maintenance. PMID:27477271

Enrichment of dynamic chromosomal crosslinks drive phase separation of the nucleolus

PubMed Central

Hult, Caitlin; Adalsteinsson, David; Vasquez, Paula A.; Lawrimore, Josh; Bennett, Maggie; York, Alyssa; Cook, Diana; Yeh, Elaine; Forest, Mark Gregory

2017-01-01

Abstract Regions of highly repetitive DNA, such as those found in the nucleolus, show a self-organization that is marked by spatial segregation and frequent self-interaction. The mechanisms that underlie the sequestration of these sub-domains are largely unknown. Using a stochastic, bead-spring representation of chromatin in budding yeast, we find enrichment of protein-mediated, dynamic chromosomal cross-links recapitulates the segregation, morphology and self-interaction of the nucleolus. Rates and enrichment of dynamic crosslinking have profound consequences on domain morphology. Our model demonstrates the nucleolus is phase separated from other chromatin in the nucleus and predicts that multiple rDNA loci will form a single nucleolus independent of their location within the genome. Fluorescent labeling of budding yeast nucleoli with CDC14-GFP revealed that a split rDNA locus indeed forms a single nucleolus. We propose that nuclear sub-domains, such as the nucleolus, result from phase separations within the nucleus, which are driven by the enrichment of protein-mediated, dynamic chromosomal crosslinks. PMID:28977453

Nucleophosmin integrates within the nucleolus via multi-modal interactions with proteins displaying R-rich linear motifs and rRNA.

PubMed

Mitrea, Diana M; Cika, Jaclyn A; Guy, Clifford S; Ban, David; Banerjee, Priya R; Stanley, Christopher B; Nourse, Amanda; Deniz, Ashok A; Kriwacki, Richard W

2016-02-02

The nucleolus is a membrane-less organelle formed through liquid-liquid phase separation of its components from the surrounding nucleoplasm. Here, we show that nucleophosmin (NPM1) integrates within the nucleolus via a multi-modal mechanism involving multivalent interactions with proteins containing arginine-rich linear motifs (R-motifs) and ribosomal RNA (rRNA). Importantly, these R-motifs are found in canonical nucleolar localization signals. Based on a novel combination of biophysical approaches, we propose a model for the molecular organization within liquid-like droplets formed by the N-terminal domain of NPM1 and R-motif peptides, thus providing insights into the structural organization of the nucleolus. We identify multivalency of acidic tracts and folded nucleic acid binding domains, mediated by N-terminal domain oligomerization, as structural features required for phase separation of NPM1 with other nucleolar components in vitro and for localization within mammalian nucleoli. We propose that one mechanism of nucleolar localization involves phase separation of proteins within the nucleolus.

Kinetics of the association of dengue virus capsid protein with the granular component of nucleolus.

PubMed

Tiwary, Ashish Kumar; Cecilia, D

2017-02-01

Dengue virus (DENV) replicates in the cytoplasm but translocation of the capsid protein (C) to the nucleoli of infected cells has been shown to facilitate virus multiplication for DENV-2. This study demonstrates that the nucleolar localization of C occurs with all four serotypes of DENV. The interaction of C with the nucleolus was found to be dynamic with a mobile fraction of 66% by FRAP. That the C shuttled between the nucleus and cytoplasm was suggested by FLIP and translation inhibition experiments. Colocalization with B23 indicated that DENV C targeted the granular component (GC) of the nucleolus. Presence of DENV C in the nucleolus affected the recovery kinetics of B23 in infected and transfected cells. Sub-nucleolar localization of DENV C of all serotypes to the GC, its mobility in and out of the nucleolus and its affect on the dynamics of B23 is being shown for the first time. Copyright © 2016 Elsevier Inc. All rights reserved.

The nucleolar helicase DDX56 redistributes to West Nile virus assembly sites.

PubMed

Reid, Colleen R; Hobman, Tom C

2017-01-01

Flaviviruses, including the human pathogen, West Nile virus (WNV), are known to co-opt many host factors for their replication and propagation. To this end, we previously reported that the nucleolar DEAD-box RNA helicase, DDX56, is important for production of infectious WNV virions. In this study, we show that WNV infection results in relocalization of DDX56 from nucleoli to virus assembly sites on the endoplasmic reticululm (ER), an observation that is consistent with a role for DDX56 in WNV virion assembly. Super-resolution microscopy revealed that capsid and DDX56 localized to the same subcompartment of the ER, however, unexpectedly, stable interaction between these two proteins was only detected in the nucleus. Together, these data suggest that DDX56 relocalizes to the site of virus assembly during WNV infection and that its interaction with WNV capsid in the cytoplasm may occur transiently during virion morphogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

Stiffness nanotomography of human epithelial cancer cells

NASA Astrophysics Data System (ADS)

Staunton, Jack R.; Doss, Bryant L.; Gilbert, C. Michael; Kasas, Sandor; Ros, Robert

2012-02-01

The mechanical stiffness of individual cells is important in both cancer initiation and metastasis. We present atomic force microscopy (AFM) based nanoindentation experiments on various human mammary and esophagus cell lines covering the spectrum from normal immortalized cells to highly metastatic ones. The combination of an AFM with a confocal fluorescence lifetime imaging microscope (FLIM) in conjunction with the ability to move the sample and objective independently allow for precise alignment of AFM probe and laser focus with an accuracy down to a few nanometers. This enables us to correlate the mechanical properties with the point of indentation in the FLIM image. We are using force-volume measurements as well as force indentation curves on distinct points on the cells to compare the elastic moduli of the nuclei, nucleoli, and the cytoplasm, and how they vary within and between individual cells and cell lines. Further, a detailed analysis of the force-indentation curves allows study of the cells' mechanical properties at different indentation depths and to generate 3D elasticity maps.

Histone H1 phosphorylation is associated with transcription by RNA polymerases I and II

PubMed Central

Zheng, Yupeng; John, Sam; Pesavento, James J.; Schultz-Norton, Jennifer R.; Schiltz, R. Louis; Baek, Sonjoon; Nardulli, Ann M.; Hager, Gordon L.; Kelleher, Neil L.

2010-01-01

Histone H1 phosphorylation affects chromatin condensation and function, but little is known about how specific phosphorylations impact the function of H1 variants in higher eukaryotes. In this study, we show that specific sites in H1.2 and H1.4 of human cells are phosphorylated only during mitosis or during both mitosis and interphase. Antisera generated to individual H1.2/H1.4 interphase phosphorylations reveal that they are distributed throughout nuclei and enriched in nucleoli. Moreover, interphase phosphorylated H1.4 is enriched at active 45S preribosomal RNA gene promoters and is rapidly induced at steroid hormone response elements by hormone treatment. Our results imply that site-specific interphase H1 phosphorylation facilitates transcription by RNA polymerases I and II and has an unanticipated function in ribosome biogenesis and control of cell growth. Differences in the numbers, structure, and locations of interphase phosphorylation sites may contribute to the functional diversity of H1 variants. PMID:20439994

[Compartmentalization of the cell nucleus and spatial organization of the genome].

PubMed

Gavrilov, A A; Razin, S V

2015-01-01

The eukaryotic cell nucleus is one of the most complex cell organelles. Despite the absence of membranes, the nuclear space is divided into numerous compartments where different processes in- volved in the genome activity take place. The most important nuclear compartments include nucleoli, nuclear speckles, PML bodies, Cajal bodies, histone locus bodies, Polycomb bodies, insulator bodies, transcription and replication factories. The structural basis for the nuclear compartmentalization is provided by genomic DNA that occupies most of the nuclear volume. Nuclear compartments, in turn, guide the chromosome folding by providing a platform for the spatial interaction of individual genomic loci. In this review, we discuss fundamental principles of higher order genome organization with a focus on chromosome territories and chromosome domains, as well as consider the structure and function of the key nuclear compartments. We show that the func- tional compartmentalization of the cell nucleus and genome spatial organization are tightly interconnected, and that this form of organization is highly dynamic and is based on stochastic processes.

Neuroendocrine carcinoma in the nasal cavity of ten dogs.

PubMed

Sako, T; Shimoyama, Y; Akihara, Y; Ohmachi, T; Yamashita, K; Kadosawa, T; Nakade, T; Uchida, E; Okamoto, M; Hirayama, K; Taniyama, H

2005-01-01

Neuroendocrine (NE) carcinoma was diagnosed in 10 dogs. In six cases examined by cephalometric radiography and computerized tomography, a large mass was seen to fill the nasal cavity. Histopathologically, sheets, nests or ribbons of neoplastic cells were separated by delicate or thick fibrovascular stroma. The neoplastic cells were round, oval, or spindle-shaped; cytoplasmic granules and hyperchromatic nuclei with prominent nucleoli were present. Neoplastic cells were invariably immunohistochemically positive for cytokeratin (CK) AE1/AE3, neuron-specific enolase, chromogranin A and vasoactive intestinal polypeptide. Eight dogs were positive for S100 protein, seven for synaptophysin, five for protein gene product 9.5, two for somatostatin, and one for Leu-7. Immunolabelling gave negative results for CK 8, CK 19, calcitonin, calcitonin gene-related polypeptide, neurofilaments, serotonin, gastrin and glial fibrillary acidic protein. Ultrastructurally, the neoplastic cells contained a large number of round, membrane-bounded, densely-cored granules corresponding to neurosecretory granules. These observations were consistent with the neuroendocrine nature of the carcinomas.

ELECTRON MICROSCOPY OF MITOSIS IN A RADIOSENSITIVE GIANT AMOEBA

PubMed Central

Daniels, E. W.; Roth, L. E.

1964-01-01

Various aspects of the ultrastructure of the dividing nuclei in the large radiosensitive amoeba Pelomyxa illinoisensis are demonstrated. Evidence of nuclear envelope breakdown is presented, and membrane fragments are traced throughout metaphase to envelope reconstruction in anaphase and telophase. Annuli in the nuclear envelope and its fragments are shown throughout mitosis. During metaphase and anaphase some 15 to 20 mitochondria are aligned at each end of the spindle, and are called polar mitochondria. The radioresistant amoebae Pelomyxa carolinensis and Amoeba proteus do not have polar mitochondria, and Pelomyxa illinoisensis is unique in this regard. The shape of the P. illinoisensis interphase nucleoli differs from that in the two radioresistant species, and certain aspects of nucleolar dissolution in the prophase vary. Helical coils in the interphase nucleoplasm are similar to those in the radioresistant amoebae. A "blister" phase in the flatly shaped telophase nuclei of P. illinoisensis is described which is interpreted to be the result of a rapid nuclear expansion leading to the formation of the normal spherical interphase nuclei. PMID:14105218

The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice.

PubMed

Nacerddine, Karim; Lehembre, François; Bhaumik, Mantu; Artus, Jérôme; Cohen-Tannoudji, Michel; Babinet, Charles; Pandolfi, Pier Paolo; Dejean, Anne

2005-12-01

Covalent modification by SUMO regulates a wide range of cellular processes, including transcription, cell cycle, and chromatin dynamics. To address the biological function of the SUMO pathway in mammals, we generated mice deficient for the SUMO E2-conjugating enzyme Ubc9. Ubc9-deficient embryos die at the early postimplantation stage. In culture, Ubc9 mutant blastocysts are viable, but fail to expand after 2 days and show apoptosis of the inner cell mass. Loss of Ubc9 leads to major chromosome condensation and segregation defects. Ubc9-deficient cells also show severe defects in nuclear organization, including nuclear envelope dysmorphy and disruption of nucleoli and PML nuclear bodies. Moreover, RanGAP1 fails to accumulate at the nuclear pore complex in mutant cells that show a collapse in Ran distribution. Together, these findings reveal a major role for Ubc9, and, by implication, for the SUMO pathway, in nuclear architecture and function, chromosome segregation, and embryonic viability in mammals.

Nucleophosmin integrates within the nucleolus via multi-modal interactions with proteins displaying R-rich linear motifs and rRNA

PubMed Central

Mitrea, Diana M; Cika, Jaclyn A; Guy, Clifford S; Ban, David; Banerjee, Priya R; Stanley, Christopher B; Nourse, Amanda; Deniz, Ashok A; Kriwacki, Richard W

2016-01-01

The nucleolus is a membrane-less organelle formed through liquid-liquid phase separation of its components from the surrounding nucleoplasm. Here, we show that nucleophosmin (NPM1) integrates within the nucleolus via a multi-modal mechanism involving multivalent interactions with proteins containing arginine-rich linear motifs (R-motifs) and ribosomal RNA (rRNA). Importantly, these R-motifs are found in canonical nucleolar localization signals. Based on a novel combination of biophysical approaches, we propose a model for the molecular organization within liquid-like droplets formed by the N-terminal domain of NPM1 and R-motif peptides, thus providing insights into the structural organization of the nucleolus. We identify multivalency of acidic tracts and folded nucleic acid binding domains, mediated by N-terminal domain oligomerization, as structural features required for phase separation of NPM1 with other nucleolar components in vitro and for localization within mammalian nucleoli. We propose that one mechanism of nucleolar localization involves phase separation of proteins within the nucleolus. DOI: http://dx.doi.org/10.7554/eLife.13571.001 PMID:26836305

Knowledge-based design of a biosensor to quantify localized ERK activation in living cells

PubMed Central

Kummer, Lutz; Hsu, Chia-Wen; Dagliyan, Onur; MacNevin, Christopher; Kaufholz, Melanie; Zimmermann, Bastian; Dokholyan, Nikolay V.; Hahn, Klaus M.; Plückthun, Andreas

2014-01-01

Summary Investigation of protein activation in living cells is fundamental to understand how proteins are influenced by the full complement of upstream regulators they experience. We describe here the generation of a biosensor based on the Designed Ankyrin Repeat Protein (DARPin) binding scaffold suited for intracellular applications. Combining selection and evolution from libraries, knowledge-based design and efficient and rapid testing of conjugate candidates, we created an ERK activity biosensor by derivatizing a DARPin specific for phosphorylated ERK (pERK) with a solvatochromic merocyanine dye (mero87), whose fluorescence increases upon pERK binding. The biosensor specifically responded to pERK2, recognized by its conformation, but not to non-phosphorylated ERK2 or other closely related mitogen-activated kinases tested. Activated endogenous ERK was visualized in mouse embryo fibroblasts incubated in 2% serum, revealing greater activation in the nucleus, perinuclear regions, and especially the nucleoli. Activity was greatly reduced by the MEK1/2 inhibitor U0126. The DARPin-based biosensor will serve as useful tool for studying biological functions of ERK in vitro and in vivo. PMID:23790495

Localization of ascorbic acid, ascorbic acid oxidase, and glutathione in roots of Cucurbita maxima L.

PubMed

Liso, Rosalia; De Tullio, Mario C; Ciraci, Samantha; Balestrini, Raffaella; La Rocca, Nicoletta; Bruno, Leonardo; Chiappetta, Adriana; Bitonti, Maria Beatrice; Bonfante, Paola; Arrigoni, Oreste

2004-12-01

To understand the function of ascorbic acid (ASC) in root development, the distribution of ASC, ASC oxidase, and glutathione (GSH) were investigated in cells and tissues of the root apex of Cucubita maxima. ASC was regularly distributed in the cytosol of almost all root cells, with the exception of quiescent centre (QC) cells. ASC also occurred at the surface of the nuclear membrane and correspondingly in the nucleoli. No ASC could be observed in vacuoles. ASC oxidase was detected by immunolocalization mainly in cell walls and vacuoles. This enzyme was particularly abundant in the QC and in differentiating vascular tissues and was absent in lateral root primordia. Administration of the ASC precursor L-galactono-gamma-lactone markedly increased ASC content in all root cells, including the QC. Root treatment with the ASC oxidized product, dehydroascorbic acid (DHA), also increased ASC content, but caused ASC accumulation only in peripheral tissues, where DHA was apparently reduced at the expense of GSH. The different pattern of distribution of ASC in different tissues and cell compartments reflects its possible role in cell metabolism and root morphogenesis.

Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

PubMed Central

Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

1992-01-01

Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

Metastatic Blue Nevus-Like Melanoma Detected by Liquid-Based Catheterized Urine Cytology.

PubMed

Kim, Sue Kyung; Yang, Ji Young; Han, Jae Ho; Kwon, Ji Eun

2018-06-01

Primary or metastatic malignant melanoma can mimic benign blue nevus in rare cases, making the diagnosis challenging. Herein, we report an exceptionally rare case of blue nevus-like melanoma and its blue nevus-like metastasis which was detected by catheterized urine cytology. The patient presented with blue-colored papuloplaques on his temple which were diagnosed as blue nevus-like melanoma on punch biopsies. While he was admitted for administration of chemotherapy, hematuria was detected. Catheterized urine cytology revealed singly scattered oval to spindle-shaped pigmented cells with a moderate degree of variation in shape and size. Many of them had small nuclei with indiscernible to inconspicuous nucleoli while only a few cells showed nuclear enlargement and nuclear hyperchromasia, which could be diagnostic pitfalls. Most of the cells on the smear were positive for HMB45 immunostaining, which confirmed the diagnosis of metastatic blue nevus-like melanoma. To the best of our knowledge, the present case is the first report describing cytomorphologic findings of blue nevus-like metastasis of melanoma in the urine specimen.

Neuronal composition of the magnocellular division of the medial preoptic nucleus (MPN mag) is sex specific in the Syrian hamster (Mesocricetus auratus).

PubMed

Richendrfer, Holly A; Swann, Jennifer M

2010-09-10

The magnocellular division of the medial Preoptic nucleus (MPN mag) plays a critical role in the regulation of male sexual behavior in the hamster. Results from previous studies indicated that the number of neurons in the MPN mag is greater in males than females but failed to find significant differences in the volume of the nucleus suggesting that other elements in the nucleus may be greater in the female. The results of the present study, using NeuN to identify neurons, are in line with this hypothesis. The data show that (1) neurons in the MPN mag display two distinct phenotypes, those with a single nucleolus and those with multiple nucleoli; (2) the percentage of each phenotype is sex specific, differing over the course of development and (3) there is no sex difference in the number of glial cells at any age. Sex differences in the numbers of each type are correlated with developmental milestones and suggest that morphological changes are influenced by changes in circulating gonadal steroids during development. 2010 Elsevier B.V. All rights reserved.

Composition of ribonucleic acid from various parts of spider oocytes.

PubMed

EDSTROM, J E

1960-09-01

Microphoretic purine-pyrimidine analyses of the ribonucleic acid (RNA) in nucleoli, nucleoplasm, cytoplasm, and yolk nuclei of spider oocytes have been carried out. The material necessary for the analyses was isolated by micromanipulation. Determinations of the amounts of RNA in the different parts of the cell were also performed. No differences between the composition of RNA in the nucleolus and the cytoplasm could be disclosed. Nucleoplasmic RNA was, on the other hand, distinctly different from that in the nucleolus and in the cytoplasm. The difference lies in the content of adenine, which is highest in nucleoplasmic RNA. The few analyses carried out on yolk nuclei showed their RNA to be variable in composition with a tendency to high purine values. The cytoplasm contains about 99 per cent of the total RNA in these cells, the nucleoplasm about 1 per cent, and the nucleolus not more than 0.3 per cent, although the highest concentrations are found in these latter structures. When considered in the light of other recent findings the results are compatible with the view that nucleolar RNA is the precursor of cytoplasmic RNA.

Role of nuclear bodies in apoptosis signalling.

PubMed

Krieghoff-Henning, Eva; Hofmann, Thomas G

2008-11-01

Promyelocytic leukemia nuclear bodies (PML NBs) are dynamic macromolecular multiprotein complexes that recruit and release a plethora of proteins. A considerable number of PML NB components play vital roles in apoptosis, senescence regulation and tumour suppression. The molecular basis by which PML NBs control these cellular responses is still just beginning to be understood. In addition to PML itself, numerous further tumour suppressors including transcriptional regulator p53, acetyl transferase CBP (CREB binding protein) and protein kinase HIPK2 (homeodomain interacting protein kinase 2) are recruited to PML NBs in response to genotoxic stress or oncogenic transformation and drive the senescence and apoptosis response by regulating p53 activity. Moreover, in response to death-receptor activation, PML NBs may act as nuclear depots that release apoptotic factors, such as the FLASH (FLICE-associated huge) protein, to amplify the death signal. PML NBs are also associated with other nuclear domains including Cajal bodies and nucleoli and share apoptotic regulators with these domains, implying crosstalk between NBs in apoptosis regulation. In conclusion, PML NBs appear to regulate cell death decisions through different, pathway-specific molecular mechanisms.

6,6″-Dimethyl-2,2':6',2″-terpyridine revisited: new fluorescent silver(I) helicates with in vitro antiproliferative activity via selective nucleoli targeting.

PubMed

Fik, Marta A; Gorczyński, Adam; Kubicki, Maciej; Hnatejko, Zbigniew; Fedoruk-Wyszomirska, Agnieszka; Wyszko, Eliza; Giel-Pietraszuk, Małgorzata; Patroniak, Violetta

2014-10-30

6,6″-Dimethyl-2,2':6',2″-terpyridine ligand (L) reacts in equimolar ratio with Ag(I) ions what results in formation of dinuclear double helicates, which differ in terms of framework and complexity in accordance to counterions and solvent applied. Obtained complexes were thoroughly studied in terms of their biological activity, with the positive antiproliferative outcome on three human cancer cell lines: human breast cancer (T47D), human cervical carcinoma (HeLa) and human lung cancer (A-549). Performed DNA binding experiments showed that given Ag(I) species specifically interact with DNA double helix via intercalation and were visualized by confocal microscopy to specifically bind to the nuclei. All newly synthesized helical systems exhibit promising antimicrobial activity against Gram-negative Escherichia coli and Gram-positive Staphylococcus aureus bacterial strains. Spectrophotometric properties were described as fulfilment of structural studies of newly presented complexes confirming their helical structure in solution. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

HPLC-Chip/MS Technology in Proteomic Profiling

NASA Astrophysics Data System (ADS)

Vollmer, Martin; van de Goor, Tom

HPLC-chip/MS is a novel nanoflow analytical technology conducted on a microfabricated chip that allows for highly efficient HPLC separation and superior sensitive MS detection of complex proteomic mixtures. This is possible through on-chip preconcentration and separation with fluidic connection made automatically in a leak-tight fashion. Minimum precolumn and postcolumn peak dispersion and uncompromised ease of use result in compounds eluting in bands of only a few nanoliters. The chip is fabricated out of bio-inert polyimide-containing channels and integrated chip structures, such as an electrospray emitter, columns, and frits manufactured by laser ablation technology. Meanwhile, a variety of HPLC-chips differing in design and stationary phase are commercially available, which provide a comprehensive solution for applications in proteomics, glycomics, biomarker, and pharmaceutical discovery. The HPLC-chip can also be easily integrated into a multidimensional separation workflow where different orthogonal separation techniques are combined to solve a highly complex separation problems. In this chapter, we describe in detail the methodological chip usage and functionality and its application in the elucidation of the protein profile of human nucleoli.

Growth Kinetics of Intracellular RNA/Protein Droplets: Signature of a Liquid-Liquid Phase Transition?

NASA Astrophysics Data System (ADS)

Berry, Joel; Weber, Stephanie C.; Vaidya, Nilesh; Zhu, Lian; Haataja, Mikko; Brangwynne, Clifford P.

2015-03-01

Nonmembrane-bound organelles are functional, dynamic assemblies of RNA and/or protein that can self-assemble and disassemble within the cytoplasm or nucleoplasm. The possibility that underlying intracellular phase transitions may drive and mediate the morphological evolution of some membrane-less organelles has been supported by several recent studies. In this talk, results from a collaborative experimental-theoretical study of the growth and dissolution kinetics of nucleoli and extranucleolar droplets (ENDs) in C. elegans embryos will be presented. We have employed Flory-Huggins solution theory, reaction-diffusion kinetics, and quantitative statistical dynamic scaling analysis to characterize the specific growth mechanisms at work. Our findings indicate that both in vivo and in vitro droplet scaling and growth kinetics are consistent with those resulting from an equilibrium liquid-liquid phase transition mediated by passive nonequilibrium growth mechanisms - simultaneous Brownian coalescence and Ostwald ripening. This supports a view in which cells can employ phase transitions to drive structural organization, while utilizing active processes, such as local transcriptional activity, to fine tune the kinetics of these phase transitions in response to given conditions.

Proliferation-dependent positioning of individual centromeres in the interphase nucleus of human lymphoblastoid cell lines

PubMed Central

Ollion, Jean; Loll, François; Cochennec, Julien; Boudier, Thomas; Escudé, Christophe

2015-01-01

The cell nucleus is a highly organized structure and plays an important role in gene regulation. Understanding the mechanisms that sustain this organization is therefore essential for understanding genome function. Centromeric regions (CRs) of chromosomes have been known for years to adopt specific nuclear positioning patterns, but the significance of this observation is not yet completely understood. Here, using a combination of fluorescence in situ hybridization and immunochemistry on fixed human cells and high-throughput imaging, we directly and quantitatively investigated the nuclear positioning of specific human CRs. We observe differential attraction of individual CRs toward both the nuclear border and the nucleoli, the former being enhanced in nonproliferating cells and the latter being enhanced in proliferating cells. Similar positioning patterns are observed in two different lymphoblastoid cell lines. Moreover, the positioning of CRs differs from that of noncentromeric regions, and CRs display specific orientations within chromosome territories. These results suggest the existence of not-yet-characterized mechanisms that drive the nuclear positioning of CRs and therefore pave the way toward a better understanding of how CRs affect nuclear organization. PMID:25947134

B23/nucleophosmin interacts with bovine immunodeficiency virus Rev protein and facilitates viral replication.

PubMed

Passos-Castilho, Ana Maria; Marchand, Claude; Archambault, Denis

2018-02-01

The bovine immunodeficiency virus (BIV) Rev shuttling protein contains nuclear/nucleolar localization signals and nuclear import/export mechanisms that are novel among lentivirus Rev proteins. Several viral proteins localize to the nucleolus, which may play a role in processes that are essential to the outcome of viral replication. Although BIV Rev localizes to the nucleoli of transfected/infected cells and colocalizes with one of its major proteins, nucleophosmin (NPM1, also known as B23), the role of the nucleolus and B23 in BIV replication remains to be determined. Here, we demonstrate for the first time that BIV Rev interacts with nucleolar phosphoprotein B23 in cells. Using small interfering RNA (siRNA) technology, we show that depletion of B23 expression inhibits virus production by BIV-infected cells, indicating that B23 plays an important role in BIV replication. The interaction between Rev and B23 may represent a potential new target for the development of antiviral drugs against lentiviruses. Copyright © 2017 Elsevier Inc. All rights reserved.

Cytogenetic toxicity effects of inorganic nickel and organic Ni(II) complexes on Brassica oleracea L. root meristem.

PubMed

Molas, J

2001-01-01

Experiments were carried out on the effect of nickel as an inorganic compound (NiSO4.7H2O) and organic Ni(II) complexes (i.e. Ni(II)-Glu and Ni(II)-EDTA) in concentrations of 20, 40 and 85 ?M dm-3 on meristematic cells of root tips of Brassica oleracea L. cv. Sława from Enkhouizen. All three tested chemical forms of nickel had a mitodepressive effect and inhibited root elongation. With respect to the degree of root elongation inhibition and mitodepressive effect, the tested forms of nickel can be put in the following order: Ni(II)-Glu NiSO4.7H2O Ni(II)-EDTA. In all three tested forms, nickel caused disturbances in mitotic divisions, resulting in anaphase bridges and binuclear cells, whose nuclei were joined by a bridge of condensed chromatin or separated. Inorganic nickel and Ni(II)-Glu in higher concentrations damaged nuclei (the amount of condensed chromatin increased), nucleoli (their structure became more condensed and vacuolisation was observed), endoplasmic reticulum (fragmentation, swelling of cisternae) and mitochondria (structure condensation).

Does vector-free gravity simulate microgravity? Functional and morphologic attributes of clinorotated nerve and muscle grown in cell culture

NASA Technical Reports Server (NTRS)

Gruener, R.; Hoeger, G.

1988-01-01

Cocultured Xenopus neurons and myocytes were subjected to non-vectorial gravity by clinostat rotation to determine if microgravity, during space flights, may affect cell development and communications. Clinorotated cells showed changes consistent with the hypothesis that cell differentiation, in microgravity, is altered by interference with cytoskeleton-related mechanisms. We found: increases in the myocyte and its nuclear area, "fragmentation" of nucleoli, appearance of neuritic "aneurysms", decreased growth in the presence of "trophic" factors, and decreased yolk utilization. The effects were most notable at 1-10 rpm and depended on the onset and duration of rotation. Some parameters returned to near control values within 48 hrs after cessation of rotation. Cells from cultures rotated at higher speeds (>50 rpm) appeared comparable to controls. Compensation by centrifugal forces may account for this finding. Our data are consistent, in principle, with effects on other, flighted cells and suggest that "vector-free" gravity may simulate certain aspects of microgravity. The distribution of acetylcholine receptor aggregates, on myocytes, was also altered. This indicates that brain development, in microgravity, may also be affected.

Critical pathogenic steps to high risk Helicobacter pylori gastritis and gastric carcinogenesis

PubMed Central

Lee, Inchul

2014-01-01

Helicobacter pylori (H. pylori) gastritis may progress to high risk gastropathy and cancer. However, the pathological progression has not been characterized in detail. H. pylori induce persistent inflammatory infiltration. Neutrophils are unique in that they directly infiltrate into foveolar epithelium aiming the proliferative zone specifically. Neutrophilic proliferative zone foveolitis is a critical pathogenic step in H. pylori gastritis inducing intensive epithelial damage. Epithelial cells carrying accumulated genomic damage and mutations show the Malgun (clear) cell change, characterized by large clear nucleus and prominent nucleolus. Malgun cells further undergo atypical changes, showing nuclear folding, coarse chromatin, and multiple nucleoli. The atypical Malgun cell (AMC) change is a novel premalignant condition in high risk gastropathy, which may progress and undergo malignant transformation directly. The pathobiological significance of AMC in gastric carcinogenesis is reviewed. A new diagnosis system of gastritis is proposed based on the critical pathologic steps classifying low and high risk gastritis for separate treatment modality. It is suggested that the regulation of H. pylori-induced neutrophilic foveolitis might be a future therapeutic goal replacing bactericidal antibiotics approach. PMID:24914362

Critical pathogenic steps to high risk Helicobacter pylori gastritis and gastric carcinogenesis.

PubMed

Lee, Inchul

2014-06-07

Helicobacter pylori (H. pylori) gastritis may progress to high risk gastropathy and cancer. However, the pathological progression has not been characterized in detail. H. pylori induce persistent inflammatory infiltration. Neutrophils are unique in that they directly infiltrate into foveolar epithelium aiming the proliferative zone specifically. Neutrophilic proliferative zone foveolitis is a critical pathogenic step in H. pylori gastritis inducing intensive epithelial damage. Epithelial cells carrying accumulated genomic damage and mutations show the Malgun (clear) cell change, characterized by large clear nucleus and prominent nucleolus. Malgun cells further undergo atypical changes, showing nuclear folding, coarse chromatin, and multiple nucleoli. The atypical Malgun cell (AMC) change is a novel premalignant condition in high risk gastropathy, which may progress and undergo malignant transformation directly. The pathobiological significance of AMC in gastric carcinogenesis is reviewed. A new diagnosis system of gastritis is proposed based on the critical pathologic steps classifying low and high risk gastritis for separate treatment modality. It is suggested that the regulation of H. pylori-induced neutrophilic foveolitis might be a future therapeutic goal replacing bactericidal antibiotics approach.

Stellate-cell lipidosis in liver biopsy specimens. Recognition and significance.

PubMed

Levine, Pascale Hummel; Delgado, Yara; Theise, Neil D; West, A Brian

2003-02-01

Hepatic stellate-cell lipidosis due to hypervitaminosis A can lead to cirrhosis, which can be averted by restricting vitamin A intake. Other causes, including the use of synthetic retinoids, have been postulated. We studied the frequency and etiology of stellate-cell lipidosis in patients undergoing liver biopsy for reasons other than vitamin A abuse. Fourteen cases (1.1%) were identified retrospectively among 1,235 nontransplant liver biopsy specimens examined from January 1995 through December 1999. Diagnostic criteria included the following: lipid-laden cells in the space of Disse; small, dark, crescent-shaped nuclei with inconspicuous nucleoli; and wispy cytoplasmic strands separating fat droplets. Patient details, reason for biopsy, and medication use were studied. Reasons for biopsy included hepatitis C (10 cases), abnormal liver enzyme levels (2 cases), methotrexate use (1 case), and alcohol abuse (1 case). Hypervitaminosis A was not suspected clinically in the 5 patients who used oral vitamin A or 3 who used topical tretinoin (Retin-A). In 6 patients, no cause of stellate-cell lipidosis was discerned. Stellate-cell lipidosis should be reported to alert clinicians to a potentially preventable form of liver injury.

Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

PubMed

Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

2016-08-01

The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.

Stable expression of hepatitis delta virus antigen in a eukaryotic cell line.

PubMed

Macnaughton, T B; Gowans, E J; Reinboth, B; Jilbert, A R; Burrell, C J

1990-06-01

The gene encoding the hepatitis delta virus structural antigen (HDAg) was linked to a neomycin resistance gene in a retrovirus expression vector, and human HepG2 cells were transfected with the recombinant plasmid. A stable cell line was cloned that expressed HDAg in the nuclei of 100% of cells, in a pattern indicating a close relationship with cell nucleoli. Analysis of partially purified recombinant HDAg by HPLC showed an Mr in the range of 7 x 10(5) to 2 x 10(6), which appeared to contain conformation-dependent epitopes, whereas the density of the antigen was 1.19 g/ml by equilibrium centrifugation in caesium chloride, and in rate zonal centrifugation it sedimented with a value of 50S, close to that of particulate hepatitis B virus surface antigen. Immunoblotting demonstrated a single polypeptide with an Mr of 24K which corresponded to the smaller of the two HDAg-specific polypeptides present in infected sera. The recombinant HDAg polypeptide was shown to be a RNA-binding protein with specificity for both genomic and antigenomic species of hepatitis delta virus RNA.

ISOLATION OF SKELETAL MUSCLE NUCLEI

PubMed Central

Edelman, Jean C.; Edelman, P. Michael; Knigge, Karl M.; Schwartz, Irving L.

1965-01-01

A method employing aqueous media for isolation of nuclei from rat skeletal muscle is described. The technique involves (a) mincing and then homogenizing in a 0.32 M sucrose-salt solution with a Potter-Elvehjem type homogenizer using a Delrin (an acetal resin) pestle and a carefully controlled, relatively large pestle-to-glass clearance, (b) filtering through fiberglass and stainless steel screens of predetermined mesh size to remove myofibrils and connective tissue, and (c) centrifuging in a 2.15 M sucrose-salt solution containing 0.7 mM ATP. Electron and phase-contrast microscopic observations show that the nuclei are intact, unencumbered by cytoplasmic tags, and possess well preserved distinct nucleoli, nucleoplasm, and nuclear membranes. Cytoplasmic contamination is minimal and mainly mitochondrial. Chemical assays of the nuclear fraction show that the DNA/protein and RNA/DNA ratios are comparable to those obtained in other tissues. These ratios, as well as the low specific activity obtained for cytochrome c oxidase and the virtual absence of myofibrillar ATPase, indicate a high degree of purity with minimal mitochondrial and myofibrillar contamination. The steps comprising the technique and the reasons for their selection are discussed. PMID:4287141

Genetic inactivation of the transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis.

PubMed

Yuan, Xuejun; Zhou, Yonggang; Casanova, Emilio; Chai, Minqiang; Kiss, Eva; Gröne, Hermann-Josef; Schütz, Günter; Grummt, Ingrid

2005-07-01

Growth-dependent regulation of rRNA synthesis is mediated by TIF-IA, a basal transcription initiation factor for RNA polymerase I. We inactivated the murine TIF-IA gene by homologous recombination in mice and embryonic fibroblasts (MEFs). TIF-IA-/- embryos die before or at embryonic day 9.5 (E9.5), displaying retardation of growth and development. In MEFs, Cre-mediated depletion of TIF-IA leads to disruption of nucleoli, cell cycle arrest, upregulation of p53, and induction of apoptosis. Elevated levels of p53 after TIF-IA depletion are due to increased binding of ribosomal proteins, such as L11, to MDM2 and decreased interaction of MDM2 with p53 and p19(ARF). RNAi-induced loss of p53 overcomes proliferation arrest and apoptosis in response to TIF-IA ablation. The striking correlation between perturbation of nucleolar function, elevated levels of p53, and induction of cell suicide supports the view that the nucleolus is a stress sensor that regulates p53 activity.

Meiotic nucleolar cycle and chromatoid body formation during the rat (Rattus novergicus) and mouse (Mus musculus) spermiogenesis.

PubMed

Peruquetti, Rita Luiza; Assis, Isabella Mariana; Taboga, Sebastião Roberto; de Azeredo-Oliveira, Maria Tercília Vilela

2008-06-01

The aims of the present study were to follow the nucleolar cycle in spermiogenesis of the laboratory rodents Rattus novergicus and Mus musculus, to verify the relationship between the nucleolar component and chromatoid body (CB) formation and to investigate the function of this cytoplasmic supramolecular structure in spermatogenic haploid cells. Histological sections of adult seminiferous tubules were analyzed cytochemically by light microscopy and ultrastructural procedures by transmission electron microscopy. The results reveal that in early spermatids, the CB was visualized in association with the Golgi cisterns indicating that this structure may participate in the acrosome formation process. In late spermatids, the CB was observed near the axonema, a fact suggesting that this structure may support the formation of the spermatozoon tail. In conclusion, our data showed that there is disintegration of spermatid nucleoli at the beginning of spermatogenesis and a fraction of this nucleolar material migrates to the cytoplasm, where a specific structure is formed, known as the "chromatoid body", which, apparently, participates in some parts of the rodent spermiogenesis process.

Multifocal Adenomatous Oncocytic Hyperplasia of the Parotid Gland

PubMed Central

Kinoshita, Yuichi; Harada, Hiroshi; Kobayashi, Tadao K.; Yoshizawa, Katsuhiko; Yuri, Takashi; Takasu, Kosho; Tsubura, Airo; Shikata, Nobuaki

2014-01-01

Multifocal adenomatous oncocytic hyperplasia (MAOH) is a non-neoplastic lesion that is classified as oncocytosis. MAOH is a rare entity of the parotid gland and accounts for approximately 0.1% of salivary gland lesions. Here, we report a case of MAOH of the parotid gland. The patient was a 71-year-old woman who presented with discomfort at the left side of her neck. Fine-needle aspiration cytology of the parotid gland revealed a loose sheet-like cluster of round to polygonal cells with granular cytoplasm against a hemorrhagic background. The cells had round to oval, centrally located nuclei with granular chromatin and without distinct nucleoli. Histologically, the lesion was formed of many variable-sized nodules, comprising oncocyte-like cells with small round nuclei and eosinophilic granular cytoplasm that was positive for mitochondrial antibodies. The diagnosis of MAOH is difficult to make by cytology alone, because the findings overlap with those of other oncocytic lesions. In particular, the cytological findings of MAOH have not been sufficiently reported to date. A correlation of cytology and histology was expected. PMID:25580104

Plant nuclei can contain extensive grooves and invaginations

NASA Technical Reports Server (NTRS)

Collings, D. A.; Carter, C. N.; Rink, J. C.; Scott, A. C.; Wyatt, S. E.; Allen, N. S.; Brown, C. S. (Principal Investigator)

2000-01-01

Plant cells can exhibit highly complex nuclear organization. Through dye-labeling experiments in untransformed onion epidermal and tobacco culture cells and through the expression of green fluorescent protein targeted to either the nucleus or the lumen of the endoplasmic reticulum/nuclear envelope in these cells, we have visualized deep grooves and invaginations into the large nuclei of these cells. In onion, these structures, which are similar to invaginations seen in some animal cells, form tubular or planelike infoldings of the nuclear envelope. Both grooves and invaginations are stable structures, and both have cytoplasmic cores containing actin bundles that can support cytoplasmic streaming. In dividing tobacco cells, invaginations seem to form during cell division, possibly from strands of the endoplasmic reticulum trapped in the reforming nucleus. The substantial increase in nuclear surface area resulting from these grooves and invaginations, their apparent preference for association with nucleoli, and the presence in them of actin bundles that support vesicle motility suggest that the structures might function both in mRNA export from the nucleus and in protein import from the cytoplasm to the nucleus.

Laser Scanning Cytometry

PubMed Central

Pozarowski, Piotr; Holden, Elena; Darzynkiewicz, Zbigniew

2013-01-01

Summary The laser scanning cytometer (LSC) is the microscope-based cytofluorometer that offers a plethora of analytical capabilities. Multilaser-excited fluorescence emitted from individual cells is measured at several wavelength ranges, rapidly (up to 5000 cells/min), with high sensitivity and accuracy. The following applications of LSC are reviewed: (1) identification of cells that differ in degree of chromatin condensation (e.g., mitotic or apoptotic cells or lymphocytes vs granulocytes vs monocytes); (2) detection of translocation between cytoplasm vs nucleus or nucleoplasm vs nucleolus of regulatory molecules such as NF- κB, p53, or Bax; (3) semiautomatic scoring of micronuclei in mutagenicity assays; (4) analysis of fluorescence in situ hybridization; (5) enumeration and morphometry of nucleoli; (6) analysis of phenotype of progeny of individual cells in clonogenicity assay; (7) cell immunophenotyping; (8) visual examination, imaging, or sequential analysis of the cells measured earlier upon their relocation, using different probes; (9) in situ enzyme kinetics and other time-resolved processes; (10) analysis of tissue section architecture; (11) application for hypocellular samples (needle aspirate, spinal fluid, etc.); (12) other clinical applications. Advantages and limitations of LSC are discussed and compared with flow cytometry. PMID:16719355

Antisense Proline-Arginine RAN dipeptides linked to C9ORF72-ALS/FTD form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death

PubMed Central

Wen, Xinmei; Tan, Wenzhi; Westergard, Thomas; Krishnamurthy, Karthik; ShamamandriMarkandaiah, Shashirekha; Shi, Yingxiao; Lin, Shaoyu; Shneider, Neil A.; Monaghan, John; Pandey, Udai B.; Pasinelli, Piera; Ichida, Justin K.; Trotti, Davide

2015-01-01

SUMMARY Expanded GGGGCC nucleotide repeats within the C9ORF72 gene are the most common genetic mutation associated with both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Sense and antisense transcripts of these expansions are translated to form five dipeptide repeat proteins (DRPs). We employed primary cortical and motor neuron cultures, live-cell imaging, and transgenic fly models and found that the arginine-rich dipeptides, in particular Proline-Arginine (PR), are potently neurotoxic. Factors that anticipated their neurotoxicity included aggregation in nucleoli, decreased number of processing bodies, and stress granules formation, implying global translational dysregulation as path accountable for toxicity. Nuclear PR aggregates were also found in human-induced motor neurons and postmortem spinal cord tissues from C9ORF72 ALS and ALS/FTD patients. Intronic G4C2 transcripts, but not loss of C9ORF72 protein, are also toxic to motor and cortical neurons. Interestingly, G4C2 transcript-mediated neurotoxicity synergizes with that of PR aggregates, suggesting convergence of mechanisms. PMID:25521377

Viruses and the nucleolus: the fatal attraction.

PubMed

Salvetti, Anna; Greco, Anna

2014-06-01

Viruses are small obligatory parasites and as a consequence, they have developed sophisticated strategies to exploit the host cell's functions to create an environment that favors their own replication. A common feature of most - if not all - families of human and non-human viruses concerns their interaction with the nucleolus. The nucleolus is a multifunctional nuclear domain, which, in addition to its well-known role in ribosome biogenesis, plays several crucial other functions. Viral infection induces important nucleolar alterations. Indeed, during viral infection numerous viral components localize in nucleoli, while various host nucleolar proteins are redistributed in other cell compartments or are modified, and non-nucleolar cellular proteins reach the nucleolus. This review highlights the interactions reported between the nucleolus and some human or animal viral families able to establish a latent or productive infection, selected on the basis of their known interactions with the nucleolus and the nucleolar activities, and their links with virus replication and/or pathogenesis. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of Nucleolus-Associated Chromatin Domains Reveals a Role for the Nucleolus in 3D Organization of the A. thaliana Genome.

PubMed

Pontvianne, Frédéric; Carpentier, Marie-Christine; Durut, Nathalie; Pavlištová, Veronika; Jaške, Karin; Schořová, Šárka; Parrinello, Hugues; Rohmer, Marine; Pikaard, Craig S; Fojtová, Miloslava; Fajkus, Jiří; Sáez-Vásquez, Julio

2016-08-09

The nucleolus is the site of rRNA gene transcription, rRNA processing, and ribosome biogenesis. However, the nucleolus also plays additional roles in the cell. We isolated nucleoli using fluorescence-activated cell sorting (FACS) and identified nucleolus-associated chromatin domains (NADs) by deep sequencing, comparing wild-type plants and null mutants for the nucleolar protein NUCLEOLIN 1 (NUC1). NADs are primarily genomic regions with heterochromatic signatures and include transposable elements (TEs), sub-telomeric regions, and mostly inactive protein-coding genes. However, NADs also include active rRNA genes and the entire short arm of chromosome 4 adjacent to them. In nuc1 null mutants, which alter rRNA gene expression and overall nucleolar structure, NADs are altered, telomere association with the nucleolus is decreased, and telomeres become shorter. Collectively, our studies reveal roles for NUC1 and the nucleolus in the spatial organization of chromosomes as well as telomere maintenance. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Enrichment of dynamic chromosomal crosslinks drive phase separation of the nucleolus.

PubMed

Hult, Caitlin; Adalsteinsson, David; Vasquez, Paula A; Lawrimore, Josh; Bennett, Maggie; York, Alyssa; Cook, Diana; Yeh, Elaine; Forest, Mark Gregory; Bloom, Kerry

2017-11-02

Regions of highly repetitive DNA, such as those found in the nucleolus, show a self-organization that is marked by spatial segregation and frequent self-interaction. The mechanisms that underlie the sequestration of these sub-domains are largely unknown. Using a stochastic, bead-spring representation of chromatin in budding yeast, we find enrichment of protein-mediated, dynamic chromosomal cross-links recapitulates the segregation, morphology and self-interaction of the nucleolus. Rates and enrichment of dynamic crosslinking have profound consequences on domain morphology. Our model demonstrates the nucleolus is phase separated from other chromatin in the nucleus and predicts that multiple rDNA loci will form a single nucleolus independent of their location within the genome. Fluorescent labeling of budding yeast nucleoli with CDC14-GFP revealed that a split rDNA locus indeed forms a single nucleolus. We propose that nuclear sub-domains, such as the nucleolus, result from phase separations within the nucleus, which are driven by the enrichment of protein-mediated, dynamic chromosomal crosslinks. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Plant Nuclei Can Contain Extensive Grooves and InvaginationsW⃞W⃞

PubMed Central

Collings, David A.; Carter, Crystal N.; Rink, Jochen C.; Scott, Amie C.; Wyatt, Sarah E.; Allen, Nina Strömgren

2000-01-01

Plant cells can exhibit highly complex nuclear organization. Through dye-labeling experiments in untransformed onion epidermal and tobacco culture cells and through the expression of green fluorescent protein targeted to either the nucleus or the lumen of the endoplasmic reticulum/nuclear envelope in these cells, we have visualized deep grooves and invaginations into the large nuclei of these cells. In onion, these structures, which are similar to invaginations seen in some animal cells, form tubular or planelike infoldings of the nuclear envelope. Both grooves and invaginations are stable structures, and both have cytoplasmic cores containing actin bundles that can support cytoplasmic streaming. In dividing tobacco cells, invaginations seem to form during cell division, possibly from strands of the endoplasmic reticulum trapped in the reforming nucleus. The substantial increase in nuclear surface area resulting from these grooves and invaginations, their apparent preference for association with nucleoli, and the presence in them of actin bundles that support vesicle motility suggest that the structures might function both in mRNA export from the nucleus and in protein import from the cytoplasm to the nucleus. PMID:11148288

Nucleophosmin integrates within the nucleolus via multi-modal interactions with proteins displaying R-rich linear motifs and rRNA

DOE PAGES

Mitrea, Diana M.; Cika, Jaclyn A.; Guy, Clifford S.; ...

2016-02-02

In this study, the nucleolus is a membrane-less organelle formed through liquid-liquid phase separation of its components from the surrounding nucleoplasm. Here, we show that nucleophosmin (NPM1) integrates within the nucleolus via a multi-modal mechanism involving multivalent interactions with proteins containing arginine-rich linear motifs (R-motifs) and ribosomal RNA (rRNA). Importantly, these R-motifs are found in canonical nucleolar localization signals. Based on a novel combination of biophysical approaches, we propose a model for the molecular organization within liquid-like droplets formed by the N-terminal domain of NPM1 and R-motif peptides, thus providing insights into the structural organization of the nucleolus. We identifymore » multivalency of acidic tracts and folded nucleic acid binding domains, mediated by N-terminal domain oligomerization, as structural features required for phase separation of NPM1 with other nucleolar components in vitro and for localization within mammalian nucleoli. We propose that one mechanism of nucleolar localization involves phase separation of proteins within the nucleolus.« less

Targeted intracellular delivery of proteins with spatial and temporal control.

PubMed

Morales, Demosthenes P; Braun, Gary B; Pallaoro, Alessia; Chen, Renwei; Huang, Xiao; Zasadzinski, Joseph A; Reich, Norbert O

2015-02-02

While a host of methods exist to deliver genetic materials or small molecules to cells, very few are available for protein delivery to the cytosol. We describe a modular, light-activated nanocarrier that transports proteins into cells by receptor-mediated endocytosis and delivers the cargo to the cytosol by light triggered endosomal escape. The platform is based on hollow gold nanoshells (HGN) with polyhistidine tagged proteins attached through an avidity-enhanced, nickel chelation linking layer; here, we used green fluorescent protein (GFP) as a model deliverable cargo. Endosomal uptake of the GFP loaded nanocarrier was mediated by a C-end Rule (CendR) internalizing peptide fused to the GFP. Focused femtosecond pulsed-laser excitation triggered protein release from the nanocarrier and endosome disruption, and the released protein was capable of targeting the nucleoli, a model intracellular organelle. We further demonstrate the generality of the approach by loading and releasing Sox2 and p53. This method for targeting of individual cells, with resolution similar to microinjection, provides spatial and temporal control over protein delivery.

Control of nuclear β-dystroglycan content is crucial for the maintenance of nuclear envelope integrity and function.

PubMed

Vélez-Aguilera, Griselda; de Dios Gómez-López, Juan; Jiménez-Gutiérrez, Guadalupe E; Vásquez-Limeta, Alejandra; Laredo-Cisneros, Marco S; Gómez, Pablo; Winder, Steve J; Cisneros, Bulmaro

2018-02-01

β-Dystroglycan (β-DG) is a plasma membrane protein that has ability to target to the nuclear envelope (NE) to maintain nuclear architecture. Nevertheless, mechanisms controlling β-DG nuclear localization and the physiological consequences of a failure of trafficking are largely unknown. We show that β-DG has a nuclear export pathway in myoblasts that depends on the recognition of a nuclear export signal located in its transmembrane domain, by CRM1. Remarkably, NES mutations forced β-DG nuclear accumulation resulting in mislocalization and decreased levels of emerin and lamin B1 and disruption of various nuclear processes in which emerin (centrosome-nucleus linkage and β-catenin transcriptional activity) and lamin B1 (cell cycle progression and nucleoli structure) are critically involved. In addition to nuclear export, the lifespan of nuclear β-DG is restricted by its nuclear proteasomal degradation. Collectively our data show that control of nuclear β-DG content by the combination of CRM1 nuclear export and nuclear proteasome pathways is physiologically relevant to preserve proper NE structure and activity. Copyright © 2017 Elsevier B.V. All rights reserved.

The RNA Exosome Adaptor ZFC3H1 Functionally Competes with Nuclear Export Activity to Retain Target Transcripts.

PubMed

Silla, Toomas; Karadoulama, Evdoxia; Mąkosa, Dawid; Lubas, Michal; Jensen, Torben Heick

2018-05-15

Mammalian genomes are promiscuously transcribed, yielding protein-coding and non-coding products. Many transcripts are short lived due to their nuclear degradation by the ribonucleolytic RNA exosome. Here, we show that abolished nuclear exosome function causes the formation of distinct nuclear foci, containing polyadenylated (pA + ) RNA secluded from nucleocytoplasmic export. We asked whether exosome co-factors could serve such nuclear retention. Co-localization studies revealed the enrichment of pA + RNA foci with "pA-tail exosome targeting (PAXT) connection" components MTR4, ZFC3H1, and PABPN1 but no overlap with known nuclear structures such as Cajal bodies, speckles, paraspeckles, or nucleoli. Interestingly, ZFC3H1 is required for foci formation, and in its absence, selected pA + RNAs, including coding and non-coding transcripts, are exported to the cytoplasm in a process dependent on the mRNA export factor AlyREF. Our results establish ZFC3H1 as a central nuclear pA + RNA retention factor, counteracting nuclear export activity. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Involvement of the UL24 protein in herpes simplex virus 1-induced dispersal of B23 and in nuclear egress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lymberopoulos, Maria H.; Bourget, Amelie; Abdeljelil, Nawel Ben

2011-04-10

UL24 of herpes simplex virus 1 (HSV-1) is widely conserved within the Herpesviridae family. Herein, we tested the hypothesis that UL24, which we have previously shown to induce the redistribution of nucleolin, also affects the localization of the nucleolar protein B23. We found that HSV-1-induced dispersal of B23 was dependent on UL24. The conserved N-terminal portion of UL24 was sufficient to induce the redistribution of B23 in transient transfection assays. Mutational analysis revealed that the endonuclease motif of UL24 was important for B23 dispersal in both transfected and infected cells. Nucleolar protein relocalization during HSV-1 infection was also observed inmore » non-immortalized cells. Analysis of infected cells by electron microscopy revealed a decrease in the ratio of cytoplasmic versus nuclear viral particles in cells infected with a UL24-deficient strain compared to KOS-infected cells. Our results suggest that UL24 promotes nuclear egress of nucleocapsids during HSV-1 infection, possibly though effects on nucleoli.« less

A Genetic Cascade of let-7-ncl-1-fib-1 Modulates Nucleolar Size and rRNA Pool in Caenorhabditis elegans

PubMed Central

Chiou, Pey-Tsyr; Chen, Po-Hsiang; Lee, Ching-Ming; Chu, Yu-De; Yu, Hsiang; Hsiung, Kuei-Ching; Tsai, Yi-Tzang; Lee, Chi-Chang; Chang, Yu-Sun; Chan, Shih-Peng; Tan, Bertrand Chin-Ming; Lo, Szecheng J.

2015-01-01

Ribosome biogenesis takes place in the nucleolus, the size of which is often coordinated with cell growth and development. However, how metazoans control nucleolar size remains largely unknown. Caenorhabditis elegans provides a good model to address this question owing to distinct tissue distribution of nucleolar sizes and a mutant, ncl-1, which exhibits larger nucleoli than wild-type worms. Here, through a series of loss-of-function analyses, we report that the nucleolar size is regulated by a circuitry composed of microRNA let-7, translation repressor NCL-1, and a major nucleolar pre-rRNA processing protein FIB-1/fibrillarin. In cooperation with RNA binding proteins PUF and NOS, NCL-1 suppressed the translation of FIB-1/fibrillarin, while let-7 targeted the 3’UTR of ncl-1 and inhibited its expression. Consequently, the abundance of FIB-1 is tightly controlled and correlated with the nucleolar size. Together, our findings highlight a novel genetic cascade by which post-transcriptional regulators interplay in developmental control of nucleolar size and function. PMID:26492166

Multicentric epitheliotropic T-cell lymphoma in an African hedgehog (Atelerix albiventris).

PubMed

Chung, Tae-Ho; Kim, Hyo-Jin; Choi, Ul-Soo

2014-12-01

A 2-year-old female African hedgehog was presented with a 5-month history of pruritus, and diffuse spine and hair loss. A dermatologic examination revealed erythema, excoriation, scales, and crusting affecting the face, flanks, forelimbs, hindlimbs, and dorsal and ventral abdomen. Fine-needle aspiration was performed and skin biopsies were taken from several lesions for cytologic and histologic evaluation. The aspirates yielded smears characterized by a monomorphic population of medium-sized to large lymphocytes with scant to moderate amounts of clear to moderately basophilic cytoplasm and distinct nucleoli along with a low number of cytoplasmic fragments. On histopathologic examination, there were dense dermal lymphoid infiltrates invading the dermis and a monomorphic population of round cells that had infiltrated the overlying epidermis. Epitheliotropic cutaneous lymphoma was diagnosed based on morphologic features. Additional immunochemical analysis using anti-CD3 and anti-CD79a antibodies revealed strong CD3 expression by the tumor cells, which confirmed epitheliotropic cutaneous T-cell lymphoma. This is the first description of a multicentric pattern of epitheliotropic cutaneous T-cell lymphoma in an African hedgehog. © 2014 American Society for Veterinary Clinical Pathology.

BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase

PubMed Central

Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K.; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M.; Ha, Taekjip; Prasanth, Kannanganattu V.; Prasanth, Supriya G.

2015-01-01

Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1–interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

PubMed

Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

2015-07-07

Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing.

Proteomics Analysis of the Nucleolus in Adenovirus-infected Cells

PubMed Central

Lam, Yun W.; Evans, Vanessa C.; Heesom, Kate J.; Lamond, Angus I.; Matthews, David A.

2010-01-01

Adenoviruses replicate primarily in the host cell nucleus, and it is well established that adenovirus infection affects the structure and function of host cell nucleoli in addition to coding for a number of nucleolar targeted viral proteins. Here we used unbiased proteomics methods, including high throughput mass spectrometry coupled with stable isotope labeling by amino acids in cell culture (SILAC) and traditional two-dimensional gel electrophoresis, to identify quantitative changes in the protein composition of the nucleolus during adenovirus infection. Two-dimensional gel analysis revealed changes in six proteins. By contrast, SILAC-based approaches identified 351 proteins with 24 proteins showing at least a 2-fold change after infection. Of those, four were previously reported to have aberrant localization and/or functional relevance during adenovirus infection. In total, 15 proteins identified as changing in amount by proteomics methods were examined in infected cells using confocal microscopy. Eleven of these proteins showed altered patterns of localization in adenovirus-infected cells. Comparing our data with the effects of actinomycin D on the nucleolar proteome revealed that adenovirus infection apparently specifically targets a relatively small subset of nucleolar antigens at the time point examined. PMID:19812395

Distribution of DNA in human Sertoli cell nucleoli.

PubMed

Mosgöller, W; Schöfer, C; Derenzini, M; Steiner, M; Maier, U; Wachtler, F

1993-10-01

For better understanding of nucleolar architecture, different techniques have been used to localize DNA within the dense fibrillar component (DF) or within the fibrillar centers (FC) by electron microscopy (EM). Since it still remains controversial which components contain DNA, we investigated the distribution of DNA in human Sertoli cells using various approaches. In situ hybridization (ISH) with human total genomic DNA as probe and the use of anti-DNA antibody were followed by immunogold detection. This allowed statistical evaluation of the signal density over individual components. The Feulgen-like osmium-ammine (OA) technique for the selective visualization of DNA was also applied. The anti-DNA antibodies detected DNA in mitochondria, in chromatin, and in the DF of the nucleolus. ISH using human total genomic DNA showed similar labeling patterns. The OA technique revealed DNA filaments in the FC and focal agglomerates of decondensed DNA within the DF. We conclude that (a) EM staining techniques that utilize colloidal gold appear to be less sensitive for DNA detection than the OA method, (b) the DF consists of different domains with different molecular composition, and (c) decondensed DNA is not necessarily confined to one particular nucleolar component.

Proteomics analysis of the nucleolus in adenovirus-infected cells.

PubMed

Lam, Yun W; Evans, Vanessa C; Heesom, Kate J; Lamond, Angus I; Matthews, David A

2010-01-01

Adenoviruses replicate primarily in the host cell nucleus, and it is well established that adenovirus infection affects the structure and function of host cell nucleoli in addition to coding for a number of nucleolar targeted viral proteins. Here we used unbiased proteomics methods, including high throughput mass spectrometry coupled with stable isotope labeling by amino acids in cell culture (SILAC) and traditional two-dimensional gel electrophoresis, to identify quantitative changes in the protein composition of the nucleolus during adenovirus infection. Two-dimensional gel analysis revealed changes in six proteins. By contrast, SILAC-based approaches identified 351 proteins with 24 proteins showing at least a 2-fold change after infection. Of those, four were previously reported to have aberrant localization and/or functional relevance during adenovirus infection. In total, 15 proteins identified as changing in amount by proteomics methods were examined in infected cells using confocal microscopy. Eleven of these proteins showed altered patterns of localization in adenovirus-infected cells. Comparing our data with the effects of actinomycin D on the nucleolar proteome revealed that adenovirus infection apparently specifically targets a relatively small subset of nucleolar antigens at the time point examined.

STUDIES ON ISOLATED NUCLEI. I. ISOLATION AND CHEMICAL CHARACTERIZATION OF A NUCLEAR FRACTION FROM GUINEA PIG LIVER.

PubMed

MAGGIO, R; SIEKEVITZ, P; PALADE, G E

1963-08-01

This article describes a method for the isolation of nuclei from guinea pig liver. It involves the homogenization of the tissue in 0.88 M sucrose-1.5 mM CaCl(2) followed by centrifugation in a discontinuous density gradient in which the upper phase is the homogenate and the lower phase is 2.2 M sucrose-0.5 mM CaCl(2). Based on DNA recovery, the isolated fraction contains 25 to 30 per cent of the nuclei of the original homogenate. Electron microscopical observations showed that approximately 88 per cent of the isolated nuclei come from liver cells (the rest from von Kupffer cells and leucocytes) and that approximately 90 per cent of the nuclei appear intact, with well preserved nucleoli, nucleoplasm, nuclear envelope, and pores. Cytoplasmic contamination is minimal and consists primarily of the nuclear envelope and its attached ribosomes. The nuclear fraction consists of approximately 22.3 per cent DNA, approximately 4.7 per cent RNA, and approximately 73 per cent protein, the DNA/RNA ratio being 4.7. Data on RNA extractibility by phosphate and salt and on the base composition of total nuclear RNA are included.

Nucleolar changes after microinjection of antibodies to RNA polymerase I into the nucleus of mammalian cells.

PubMed

Benavente, R; Reimer, G; Rose, K M; Hügle-Dörr, B; Scheer, U

1988-01-01

After microinjection of antibodies against RNA polymerase I into the nuclei of cultured rat kangaroo (PtK2) and rat (RVF-SMC) cells alterations in nucleolar structure and composition were observed. These were detected by electron microscopy and double-label immunofluorescence microscopy using antibodies to proteins representative of the three major components of the nucleolus. The microinjected antibodies produced a progressive loss of the material of the dense fibrillar component (DFC) from the nucleoli which, at 4 h after injection, were transformed into bodies with purely granular component (GC) structure with attached fibrillar centers (FCs). Concomitantly, numerous extranucleolar aggregates appeared in the nucleoplasm which morphologically resembled fragments of the DFC and contained a protein (fibrillarin) diagnostic for this nucleolar structure. These observations indicate that the topological distribution of the material constituting the DFC can be experimentally influenced in interphase cells, apparently by modulating the transcriptional activity of the rRNA genes. These effects are different from nucleolar lesions induced by inhibitory drugs such as actinomycin D-dependent "nucleolar segregation". The structural alterations induced by antibodies to RNA polymerase I resemble, however, the initial events of nucleolar disintegration during mitotic prophase.

STUDIES ON ISOLATED NUCLEI. II. ISOLATION AND CHEMICAL CHARACTERIZATION OF NUCLEOLAR AND NUCLEOPLASMIC SUBFRACTIONS.

PubMed

MAGGIO, R; SIEKEVITZ, P; PALADE, G E

1963-08-01

This paper describes the subfractionation of nuclei isolated from guinea pig liver by the procedure presented in the first article of the series (8). Centrifugation in a density gradient system of nuclear fractions disrupted by sonication permits the isolation of the following subfractions: (a) a nucleolar subfraction which consists mainly of nucleoli surrounded by a variable amount of nucleolus-associated chromatin and contaminated by chromatin blocks derived primarily from von Kupffer cell nuclei; (b) and (c), two nucleoplasmic subfractions (I and II) which consist mainly of chromatin threads in a coarser (I) or finer (II) degree of fragmentation. The protein, RNA, and DNA content of these subfractions was determined, and their RNA's characterized in terms of NaCl-solubility, nucleotide composition, and in vivo nucleotide turnover, using inorganic (32)P as a marker. The results indicate that there are at least three types of RNA in the nucleus (one in the nucleolus and two in the nucleoplasm or chromatin), which differ from one another in NaCl-solubility, nucleotide composition, turnover, and possibly sequence. Possible relations among these RNA's and those of the cytoplasm are discussed.

Sex-determining mechanism in Buergeria buergeri (Anura, Rhacophoridae). III. Does the ZZW triploid frog become female or male?

PubMed

Ohta, S; Sumida, M; Nishioka, M

1999-02-15

Both triploids and gynogenetic diploids (GDs) were produced to clarify the relationship between the sex-chromosome constitution and the expression of sex in the common bell-ring frog, Buergeria buergeri. The sex differentiation of triploids in B. buergeri is quite remarkable. Triploid frogs consisted of three sex genotypes, ZZZ, ZWW and ZZW. All ZZZ triploids were males, and all ZWW triploids were females. It is very interesting that half of the ZZW triploids became female, and the other half became male. The GD frogs consisted of two sex genotypes, ZW and ZZ, which did not differ from the controls in sex differentiation. Since the ratios of ZZ and ZW eggs were significantly different among female parents, it is assumed that most (approximately 80-90%) of the eggs made pre-reductional division in some females and post-reductional division in others during meiosis. It seems that ZW eggs were produced by the occurrence of recombination between the centromere and the sex-determining genes in B. buergeri. It was also found that the number of Z chromosomes in each cell of these triploids and GDs agreed with that of the nucleoli in each cell.

Modeling phase separation in mixtures of intrinsically-disordered proteins

NASA Astrophysics Data System (ADS)

Gu, Chad; Zilman, Anton

Phase separation in a pure or mixed solution of intrinsically-disordered proteins (IDPs) and its role in various biological processes has generated interest from the theoretical biophysics community. Phase separation of IDPs has been implicated in the formation of membrane-less organelles such as nucleoli, as well as in a mechanism of selectivity in transport through the nuclear pore complex. Based on a lattice model of polymers, we study the phase diagram of IDPs in a mixture and describe the selective exclusion of soluble proteins from the dense-phase IDP aggregates. The model captures the essential behaviour of phase separation by a minimal set of coarse-grained parameters, corresponding to the average monomer-monomer and monomer-protein attraction strength, as well as the protein-to-monomer size ratio. Contrary to the intuition that strong monomer-monomer interaction increases exclusion of soluble proteins from the dense IDP aggregates, our model predicts that the concentration of soluble proteins in the aggregate phase as a function of monomer-monomer attraction is non-monotonic. We corroborate the predictions of the lattice model using Langevin dynamics simulations of grafted polymers in planar and cylindrical geometries, mimicking various in-vivo and in-vitro conditions.

Interspecies Somatic Cell Nuclear Transfer: Advancements and Problems

PubMed Central

Lagutina, Irina; Fulka, Helena; Lazzari, Giovanna

2013-01-01

Abstract Embryologists working with livestock species were the pioneers in the field of reprogramming by somatic cell nuclear transfer (SCNT). Without the “Dolly experiment,” the field of cellular reprogramming would have been slow and induced plutipotent cells (iPSCs) would not have been conceived. The major drive of the work in mammalian cloning was the interest of the breeding industry to propagate superior genotypes. Soon it was realized that the properties of oocytes could be used also to clone endangered mammalian species or to reprogram the genomes of unrelated species through what is known as interspecies (i) SCNT, using easily available oocytes of livestock species. iSCNT for cloning animals works only for species that can interbreed, and experiments with taxonomically distant species have not been successful in obtaining live births or deriving embryonic stem cell (ESC) lines to be used for regenerative medicine. There are controversial reports in the literature, but in most cases these experiments have underlined some of the cellular and molecular mechanisms that are incomplete during cell nucleus reprogramming, including the failure to organize nucleoli, silence somatic cell genes, activate the embryonic genome, and resume mitochondrial replication and function, thus indicating nucleus–cytoplasmic incompatibility. PMID:24033141

Spectral imaging of histological and cytological specimens

NASA Astrophysics Data System (ADS)

Rothmann, Chana; Malik, Zvi

1999-05-01

Evaluation of cell morphology by bright field microscopy is the pillar of histopathological diagnosis. The need for quantitative and objective parameters for diagnosis has given rise to the development of morphometric methods. The development of spectral imaging for biological and medical applications introduced both fields to large amounts of information extracted from a single image. Spectroscopic analysis is based on the ability of a stained histological specimen to absorb, reflect, or emit photons in ways characteristic to its interactions with specific dyes. Spectral information obtained from a histological specimen is stored in a cube whose appellate signifies the two spatial dimensions of a flat sample (x and y) and the third dimension, the spectrum, representing the light intensity for every wavelength. The spectral information stored in the cube can be further processed by morphometric analysis and quantitative procedures. Such a procedure is spectral-similarity mapping (SSM), which enables the demarcation of areas occupied by the same type of material. SSM constructs new images of the specimen, revealing areas with similar stain-macromolecule characteristics and enhancing subcellular features. Spectral imaging combined with SSM reveals nuclear organization through the differentiation stages as well as in apoptotic and necrotic conditions and identifies specifically the nucleoli domains.

Energy dispersive X-ray analyses of organelles of NaCI-treated maize root cells

NASA Astrophysics Data System (ADS)

Stelzer, Ralf

1984-04-01

NaCl sensitive plants of Zea mays cv. ADOUR were grown in nutrient solutions with or without NaCl. Frozen, hydrated root-tip tissues were investigated by means of an ETEC scanning electron microscope fitted with a KEVEX energy dispersive X-ray analyser. Morphological details of the gently etched but non-coated surface of the cross fractured specimen were easy to identify and to analyse using an electron beam with a low intensity at 10 kV. X-ray data obtained from cell compartments and organelles as nuclei, nucleoli and mitochondria within individual cells establish typical X-ray spectra. Comparisons of these spectra support the hypothesis that Na + ions are predominantly localized in vacuoles and also to a lesser extent in the cytoplasm, e.g. in small vesicles, but not in other cell organelles. Furthermore the analysed cell compartments show differences in the distribution of Mg, P, S, Cl, K and Ca effected by the addition of NaCl to the growth medium. The X-ray data are discussed in relation to the physiological meaning of a NaCl induced redistribution of elements within individual maize root cells.

A Case of Solitary Well-Differentiated Papillary Mesothelioma with Invasive Foci in the Pleura.

PubMed

Shimizu, Shigeki; Yoon, Hyung-Eun; Ito, Norimasa; Tsuji, Taisuke; Funakoshi, Yasunobu; Utsumi, Tomoki; Sakaguchi, Masahiro; Tsujimura, Toru; Kasai, Takahiko; Hiroshima, Kenzo; Matsumura, Akihide

2017-01-01

Well-differentiated papillary mesothelioma (WDPM) is a rare, distinct tumor consisting of mesothelial cells with a papillary architecture, bland cytological features, and a tendency toward superficial spread without invasion. Rare cases with superficial invasion are termed WDPM with invasive foci. We report a case of solitary WDPM with invasive foci in the pleura. A 61-year-old woman presented with a lung adenocarcinoma. A small papillary lesion measuring 29 × 10 × 8 mm was incidentally found in the parietal pleura during a lobectomy for the lung adenocarcinoma. The fibrovascular core of the small papillary lesion was surrounded by a single layer of cuboidal cells with mild to moderate atypia and large nucleoli. Atypical mesothelial cells focally invaded the submesothelial layer. The cells of the papillary lesion were positive for cytokeratins and mesothelial markers. The Ki67 index was <1 %. The lesion did not show p16 loss on fluorescence in situ hybridization. We could not detect atypical mesothelial cells in the specimen from an extrapleural pneumonectomy. WDPM with invasive foci is prone to multifocality; however, our case represents a solitary case in the pleura. © 2016 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Nucleolar Reorganization Upon Site-Specific Double-Strand Break Induction.

PubMed

Franek, Michal; Kovaříková, Alena; Bártová, Eva; Kozubek, Stanislav

2016-11-01

DNA damage response (DDR) in ribosomal genes and mechanisms of DNA repair in embryonic stem cells (ESCs) are less explored nuclear events. DDR in ESCs should be unique due to their high proliferation rate, expression of pluripotency factors, and specific chromatin signature. Given short population doubling time and fast progress through G1 phase, ESCs require a sustained production of rRNA, which leads to the formation of large and prominent nucleoli. Although transcription of rRNA in the nucleolus is relatively well understood, little is known about DDR in this nuclear compartment. Here, we directed formation of double-strand breaks in rRNA genes with I- PpoI endonuclease, and we studied nucleolar morphology, DDR, and chromatin modifications. We observed a pronounced formation of I- PpoI-induced nucleolar caps, positive on BRCA1, NBS1, MDC1, γH2AX, and UBF1 proteins. We showed interaction of nucleolar protein TCOF1 with HDAC1 and TCOF1 with CARM1 after DNA injury. Moreover, H3R17me2a modification mediated by CARM1 was found in I- PpoI-induced nucleolar caps. Finally, we report that heterochromatin protein 1 is not involved in DNA repair of nucleolar caps.

Immunohistochemical and ultrastructural changes in rat fat tissue related to the local hCG injection.

PubMed

Tunç, E; Erdogan, D; Calgüner, E; Göktas, G; Elmas, Ç; Gözil, R; Bahçelioglu, M; Öktem, H

2013-11-01

Recently, it has been observed that weight loss is accelerated by human chorionic gonadotropin (hCG) hormone preparation used for hypothalamic dysfunction in obesity treatment in both sexes. hCG is also used for in vitro fertilization and in treatment of hypogonadotropic hypogonadism. Our aim was to observe the ultrastructural changes caused by local injections of hCG made for purpose of weight loss and to present them to inform those receiving such therapy. In our study, 10 obese female, 10 male obese, 10 non-obese female and 10 non-obese male rats were used. In each group, single dose of subcutaneous hCG injection has been applied to 7 rats for 5 weeks in 5 days of the week, and placebo has been applied to the remaining 3 rats. Following the injection, the tissues were evaluated morphologically, immunohistochemically and ultrastructurally. Leptin immunoreactivity was similar in all groups. When the adipose tissue samples were examined under electron microscope, they were observed to exhibit normal structure with organelles located around the nuclei and nucleoli, and no distinctive features were found among the groups. Administering hCG in addition to diet had no advantage on weight reduction in rats.

Adjuvant radiation therapy for malignant Abrikossoff's tumor: a case report about a femoral triangle localisation.

PubMed

Marchand Crety, C; Garbar, C; Madelis, G; Guillemin, F; Soibinet Oudot, P; Eymard, J C; Servagi Vernat, S

2018-06-20

Granular cell or Abrikossoff's tumors are usually benign however rare malignant forms concern 1 to 3% of cases reported. Pelvic locations are exceptional. We report a case of a 43-years-old patient who had a benign Abrikossoff's tumor localized in the right femoral triangle diagnosed at the biopsy. The patient underwent a surgical tumorectomy and inguinal lymph nodes resection. Histologically, the tumor showed enough criteria to give diagnosis of malignancy: nuclear pleomorphism, tumor cell spindling, vesicular nuclei with large nucleoli. Moreover, five lymph nodes were metastatic. Immunohistochemistry findings confirmed the diagnosis of granular cell tumor which is positive for S100 protein and CD68 antibodies. The mitotic index was nevertheless low with a Ki67 labeling index of 1-2%. A large surgical revision with an inguinal curage following radiotherapy were decided on oncology committee. Adjuvant radiotherapy on the tumor bed and right inguinal area of ​​50 Gy in conventional fractionation was delivered with the aim of reducing local recurrence risk. There was no recurrence on longer follow-up (10 months post radiotherapy). Adjuvant radiotherapy seems an appropriate therapeutic approach, even if controversial, given that some authors report effectiveness on local disease progression.

Fibroblastic connective tissue nevus.

PubMed

Velez, Moises J; Billings, Steven D; Weaver, Joshua A

2016-01-01

Fibroblastic connective tissue nevus (FCTN) is a newly recognized, benign cutaneous mesenchymal lesion of fibroblasts/myofibroblastic lineage, which expands the classification of connective tissue nevi. We present three cases of FCTN and discuss significant clinical, morphologic and immunophenotypic overlap with dermatomyofibroma. Our cases were from young women, aged 32, 24 and 10, and presented as 1.2 and 1 cm nodules on the posterior neck and right upper flank, respectively while presenting as a linear plaque of the right posterior thigh in the latter case. The lesions showed a poorly circumscribed proliferation of hypercellular spindle cells arranged in short to longer intersecting fascicles entrapping adnexal structures. Superficial adipose tissue was also entrapped in one case. The spindle cells had fibroblastic features with pale eosinophilic cytoplasmic extensions and inconspicuous nucleoli. The spindle cells were positive for CD34 in two cases. One case was negative for CD34, smooth muscle actin (SMA), desmin and S100. The overall features were consistent with a diagnosis of FCTN. In two cases, we further elucidated the fibroblastic differentiation of the spindle cells in FCTN with electron microscopy, which has not been previously described. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Fine-needle aspiration cytology of malignant hemangiopericytomas with ultrastructural and flow cytometric analyses.

PubMed

Geisinger, K R; Silverman, J F; Cappellari, J O; Dabbs, D J

1990-07-01

A hemangiopericytoma (HPC) is an uncommon soft-tissue neoplasm that may arise in many body sites. The cytologic features of fine-needle aspirates (FNAs) of HPCs have only rarely been described in the literature. We examined FNAs of malignant HPCs from the head and neck region (three) and the retroperitoneum (one) in four adults (aged 38 to 83 years). All four FNAs yielded cellular specimens that consisted of uninuclear tumor cells with high nuclear-cytoplasmic ratios. The cytomorphological spectrum included nuclei that were oval to elongate and had very finely granular, evenly distributed chromatin with one or two small but distinct nucleoli. Hemangiopericytomas yield aspirates that may be considered malignant and may suggest sarcoma. Histologically, all four neoplasms manifested high mitotic activity. The ultrastructural features of all four tumors were supportive of the diagnosis of HPC. Although a specific primary diagnosis of HPC on FNA of a soft-tissue mass is unlikely, cytologic analysis may allow diagnosis of recurrent or metastatic HPC. We were able to perform flow cytometric determinations of tumor DNA content on three of the resected neoplasms. In two, an aneuploid pattern was found, including the neoplasm with the most marked pleomorphism in the FNA. The third was diploid.

An Algorithmic Approach to the Management of Infantile Digital Fibromatosis: Review of Literature and a Case Report.

PubMed

Eypper, Elizabeth H; Lee, Johnson C; Tarasen, Ashley J; Weinberg, Maxene H; Adetayo, Oluwaseun A

2018-01-01

Objective: Infantile digital fibromatosis is a rare benign childhood tumor, infrequently cited in the literature. Hallmarks include nodular growths exclusive to fingers and toes and the presence of eosinophilic cytoplasmic inclusions on histology. This article aims to exemplify diagnoses of infantile digital fibromatosis and possible treatment options. Methods: A computerized English literature search was performed in the PubMed/MEDLINE database using MeSH headings "infantile," "juvenile," "digital," and "fibromatosis." Twenty electronic publications were selected and their clinical and histological data recorded and used to compile a treatment algorithm. Results: A 9-month-old male child was referred for a persistent, symptomatic nodule on the third left toe. A direct excision with Brunner-type incisions was performed under general anesthesia. The procedure was successful without complications. The patient has no recurrence at 2 years postsurgery and continues to be followed. Histological examination revealed a proliferation of bland, uniformly plump spindle cells with elongated nuclei and small central nucleoli without paranuclear inclusions consistent with fibromatosis. Conclusions: Asymptomatic nodules should be observed for spontaneous regression or treated with nonsurgical techniques such as chemotherapeutic or steroid injection. Surgical removal should be reserved for cases with structural or functional compromise.

Histopathologic features in actinic cheilitis by the comparison of grading dysplasia systems.

PubMed

Pilati, Sfm; Bianco, B C; Vieira, Dsc; Modolo, F

2017-03-01

This study aimed to determine the histopathologic findings in actinic cheilitis (AC) and lip squamous cell carcinomas (LSCC) diagnosed at Federal University of Santa Catarina in order to attempt to predict the evolution from AC to LSCC based on the comparison of two dysplasia classification systems. Histopathologic features were evaluated according to the World Health Organization classification of dysplasia and binary system of classification. Also, in LSCC, pattern, stage of invasion, and degree of keratinization were evaluated. A total of 58 cases of AC and 70 cases of LSCC were studied, and data correlation was performed using statistical analysis. The presence of dyskeratosis and keratin pearls was found to be strongly associated with severe dysplasia and could represent higher proximity between the severe dysplasia in AC and LSCC. Also, changes related to the nuclei, such as hyperchromasia, nuclear pleomorphism, anisonucleosis, increase in the number and size of nucleoli, increased number of mitoses, and atypical mitoses, indicate progression in dysplasia spectrum. Knowledge of clinical and histological features of AC and LSCC leads to better understanding of factors possibly associated with malignant transformation of epithelial dysplasia. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Split sample comparison of a liquid-based method and conventional smears in thyroid fine needle aspiration.

PubMed

Jung, Chan-Kwon; Lee, Ahwon; Jung, Eun-Sun; Choi, Yeong-Jin; Jung, So-Lyung; Lee, Kyo-Young

2008-01-01

To compare the efficacy of the SurePath (SP) vs. conventional smears (CS) in fine needle aspiration (FNA) of thyroid gland lesions. A total of 193 FNA cases with thyroid nodules were studied. Samples from ultrasound-guided FNA were split to prepare CS and SP slides. The diagnostic categories of unsatisfactory, benign, atypical and malignant were compared. Galectin-3 immunostaining was performed on SP slides. Some differences were found between the cytomorphology of CS and SP. SP slides showed more increased cellularity and more clustered tissue fragments. On SP slides, nuclear detail and nucleoli were more easily detected and nuclear irregularity was very useful for the diagnosis of papillary carcinoma. SP showed a trend toward a lower proportion of atypical category. The overall sensitivity of FNA in diagnosing thyroid neoplasm was 90.9% for CS and 93.9% for SP. Most lesions (73%) diagnosed as papillary carcinoma after surgery showed positive staining of galectin-3. The SP method showed easy evaluation of cytomorphologic features and consistent specimen quality and appeared to be more useful in diagnosing the suspicious cases. Moreover, it offered the possibility of adjunctive immunocytochemistry on the same sample.

Demonstration of mechanical connections between integrins, cytoskeletal filaments, and nucleoplasm that stabilize nuclear structure

NASA Technical Reports Server (NTRS)

Maniotis, A. J.; Chen, C. S.; Ingber, D. E.

1997-01-01

We report here that living cells and nuclei are hard-wired such that a mechanical tug on cell surface receptors can immediately change the organization of molecular assemblies in the cytoplasm and nucleus. When integrins were pulled by micromanipulating bound microbeads or micropipettes, cytoskeletal filaments reoriented, nuclei distorted, and nucleoli redistributed along the axis of the applied tension field. These effects were specific for integrins, independent of cortical membrane distortion, and were mediated by direct linkages between the cytoskeleton and nucleus. Actin microfilaments mediated force transfer to the nucleus at low strain; however, tearing of the actin gel resulted with greater distortion. In contrast, intermediate filaments effectively mediated force transfer to the nucleus under both conditions. These filament systems also acted as molecular guy wires to mechanically stiffen the nucleus and anchor it in place, whereas microtubules acted to hold open the intermediate filament lattice and to stabilize the nucleus against lateral compression. Molecular connections between integrins, cytoskeletal filaments, and nuclear scaffolds may therefore provide a discrete path for mechanical signal transfer through cells as well as a mechanism for producing integrated changes in cell and nuclear structure in response to changes in extracellular matrix adhesivity or mechanics.

Poly(ADP-Ribose) Polymerase 1 (PARP-1) Regulates Ribosomal Biogenesis in Drosophila Nucleoli

PubMed Central

Boamah, Ernest K.; Kotova, Elena; Garabedian, Mikael; Jarnik, Michael; Tulin, Alexei V.

2012-01-01

Poly(ADP-ribose) polymerase 1 (PARP1), a nuclear protein, utilizes NAD to synthesize poly(AD-Pribose) (pADPr), resulting in both automodification and the modification of acceptor proteins. Substantial amounts of PARP1 and pADPr (up to 50%) are localized to the nucleolus, a subnuclear organelle known as a region for ribosome biogenesis and maturation. At present, the functional significance of PARP1 protein inside the nucleolus remains unclear. Using PARP1 mutants, we investigated the function of PARP1, pADPr, and PARP1-interacting proteins in the maintenance of nucleolus structure and functions. Our analysis shows that disruption of PARP1 enzymatic activity caused nucleolar disintegration and aberrant localization of nucleolar-specific proteins. Additionally, PARP1 mutants have increased accumulation of rRNA intermediates and a decrease in ribosome levels. Together, our data suggests that PARP1 enzymatic activity is required for targeting nucleolar proteins to the proximity of precursor rRNA; hence, PARP1 controls precursor rRNA processing, post-transcriptional modification, and pre-ribosome assembly. Based on these findings, we propose a model that explains how PARP1 activity impacts nucleolar functions and, consequently, ribosomal biogenesis. PMID:22242017

Molecules that target nucleophosmin for cancer treatment: an update

PubMed Central

Di Matteo, Adele; Franceschini, Mimma; Chiarella, Sara; Rocchio, Serena; Travaglini-Allocatelli, Carlo; Federici, Luca

2016-01-01

Nucleophosmin is a highly and ubiquitously expressed protein, mainly localized in nucleoli but able to shuttle between nucleus and cytoplasm. Nucleophosmin plays crucial roles in ribosome maturation and export, centrosome duplication, cell cycle progression, histone assembly and response to a variety of stress stimuli. Much interest in this protein has arisen in the past ten years, since the discovery of heterozygous mutations in the terminal exon of the NPM1 gene, which are the most frequent genetic alteration in acute myeloid leukemia. Nucleophosmin is also frequently overexpressed in solid tumours and, in many cases, its overexpression correlates with mitotic index and metastatization. Therefore it is considered as a promising target for the treatment of both haematologic and solid malignancies. NPM1 targeting molecules may suppress different functions of the protein, interfere with its subcellular localization, with its oligomerization properties or drive its degradation. In the recent years, several such molecules have been described and here we review what is currently known about them, their interaction with nucleophosmin and the mechanistic basis of their toxicity. Collectively, these molecules exemplify a number of different strategies that can be adopted to target nucleophosmin and we summarize them at the end of the review. PMID:27058426

Targeting the nucleolus for cancer intervention.

PubMed

Quin, Jaclyn E; Devlin, Jennifer R; Cameron, Donald; Hannan, Kate M; Pearson, Richard B; Hannan, Ross D

2014-06-01

The contribution of the nucleolus to cancer is well established with respect to its traditional role in facilitating ribosome biogenesis and proliferative capacity. More contemporary studies however, infer that nucleoli contribute a much broader role in malignant transformation. Specifically, extra-ribosomal functions of the nucleolus position it as a central integrator of cellular proliferation and stress signaling, and are emerging as important mechanisms for modulating how oncogenes and tumor suppressors operate in normal and malignant cells. The dependence of certain tumor cells to co-opt nucleolar processes to maintain their cancer phenotypes has now clearly been demonstrated by the application of small molecule inhibitors of RNA Polymerase I to block ribosomal DNA transcription and disrupt nucleolar function (Bywater et al., 2012 [1]). These drugs, which selectively kill tumor cells in vivo while sparing normal cells, have now progressed to clinical trials. It is likely that we have only just begun to scratch the surface of the potential of the nucleolus as a new target for cancer therapy, with "suppression of nucleolar stress" representing an emerging "hallmark" of cancer. This article is part of a Special Issue entitled: Role of the Nucleolus in Human Disease. Copyright © 2013 Elsevier B.V. All rights reserved.

Phase Transitions in the Nucleus: the functional implications of concentration-dependent assembly of a Liquid-like RNA/Protein Body

NASA Astrophysics Data System (ADS)

Zhu, Lian; Weber, Stephanie; Berry, Joel; Vaidya, Nilesh; Haataja, Mikko; Brangwynne, Clifford

2015-03-01

The nucleolus is a liquid-like membrane-less nuclear body which plays an important role in cell growth and size control. By modulating nucleolar component concentration through RNAi conditions that change C. elegans cell size, we find that nucleoli only assemble above a threshold concentration; moreover, the ripening dynamics of nucleated droplets are consistent with the hypothesis that the assembly of the nucleolus represents an intracellular liquid-liquid phase transition. A key question is how this phase-transition is linked to the primary function of the nucleolus, in transcribing and processing ribosomal RNA. To address this, we characterize the localization of RNA Polymerase I, a key transcriptional enzyme, into nucleolar foci as a function of nucleolar component concentration. Our results suggest that there are a small number of key disordered phosphoproteins that may serve as a link between transcription and assembly. Finally, we present preliminary results using a reduced model system consisting of purified nucleolar proteins to assess the ability of nucleolar proteins to drive liquid-liquid phase separation in vitro. These results lay the foundation for a quantitative understanding of intracellular phase transitions and their impact on biomedically-critical RNA-processing steps.

MDS/AML del(11)(q14) Share Common Morphological Features Despite Different Chromosomal Breakpoints.

PubMed

Dambruoso, Irene; Invernizzi, Rosangela; Boni, Marina; Zappatore, Rita; Giardini, Ilaria; Cavigliano, Maria Paola; Rocca, Barbara; Calvello, Celeste; Bastia, Raffaella; Caresana, Marilena; Pasi, Francesca; Nano, Rosanna; Bernasconi, Paolo

2017-02-01

In myelodysplatic syndromes and acute myeloid leukemia (MDS/AML) deletion of the 11q14 region is a rare chromosomal defect (incidence: 0.6-1.0%), included within the intermediate risk criteria by the International Prognostic Scoring System. No fluorescence in situ hybridization (FISH) study has yet been performed to identify a common breakpoint region (CBR). In our study through FISH with bacterial artificial chromosomes and commercial probes, we analyzed seven patients with MDS/AML harboring 11q14 deletion on conventional cytogenetic analysis. FISH revealed deletions in five patients and amplifications in two. Three patients with deletion carried a CBR, two had a deletion involving a more centromeric breakpoint. These five patients exhibited multilineage dysplasia, blast cells with large round nuclei, loose chromatin, small and abundant nucleoli, and vacuolated cytoplasm with very thin Auer bodies. In conclusion, the morphological features which occur independently of the extent of the deletion are of multilineage dysplasia in MDS and leukemic blasts strongly reactive to peroxidase in AML; despite the variable size of the deleted area, some patients harbor a CBR. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Nuclear envelope expansion is crucial for proper chromosomal segregation during a closed mitosis.

PubMed

Takemoto, Ai; Kawashima, Shigehiro A; Li, Juan-Juan; Jeffery, Linda; Yamatsugu, Kenzo; Elemento, Olivier; Nurse, Paul

2016-03-15

Here, we screened a 10,371 library of diverse molecules using a drug-sensitive fission yeast strain to identify compounds which cause defects in chromosome segregation during mitosis. We identified a phosphorium-ylide-based compound Cutin-1 which inhibits nuclear envelope expansion and nuclear elongation during the closed mitosis of fission yeast, and showed that its target is the β-subunit of fatty acid synthase. A point mutation in the dehydratase domain of Fas1 conferred in vivo and in vitro resistance to Cutin-1. Time-lapse photomicrography showed that the bulk of the chromosomes were only transiently separated during mitosis, and nucleoli separation was defective. Subsequently sister chromatids re-associated leading to chromosomal mis-segregation. These segregation defects were reduced when the nuclear volume was increased and were increased when the nuclear volume was reduced. We propose that there needs to be sufficient nuclear volume to allow the nuclear elongation necessary during a closed mitosis to take place for proper chromosome segregation, and that inhibition of fatty acid synthase compromises nuclear elongation and leads to defects in chromosomal segregation. © 2016. Published by The Company of Biologists Ltd.

Ultrastructural evaluation of gingival connective tissue in hereditary gingival fibromatosis.

PubMed

Pêgo, Sabina Pena B; de Faria, Paulo Rogério; Santos, Luis Antônio N; Coletta, Ricardo D; de Aquino, Sibele Nascimento; Martelli-Júnior, Hercílio

2016-07-01

To describe the ultrastructural features of hereditary gingival fibromatosis (HGF) in affected family members and compare microscopic findings with normal gingival (NG) tissue. Gingival tissue samples from nine patients with HGF from five unrelated families were evaluated by transmission electron microscopy. Nine NG tissue samples were used for comparison. Areas containing collagen fibrils forming loops and folds were observed in both groups, whereas oxytalan fibers were frequently identified in the HGF group. The diameter of collagen fibrils and the interfibrillar space among them were more uniform in the NG group than in the HGF group. Fibroblasts were the most common cells found in both the HGF and NG groups and exhibited enlarged, rough endoplasmic reticulum, mitochondria with well-preserved crests, conspicuous nucleoli, and euchromatic chromatin. Other cells, such as mast cells, plasma cells, and macrophages, were also observed. HGF tissues had ultrastructural characteristics that were very similar to those of NG tissues. Oxytalan fibers were observed more frequently in the HGF samples than in the NG samples. Other studies of HGF in patients from different families should be performed to better understand the pathogenesis of this hereditary condition. Copyright © 2016 Elsevier Inc. All rights reserved.

FISH-aimed karyotyping and characterization of Renner complexes in permanent heterozygote Rhoeo spathacea.

PubMed

Golczyk, Hieronim; Hasterok, Robert; Joachimiak, Andrzej J

2005-02-01

Fluorescence in situ hybridization (FISH) using 25S rDNA, 5S rDNA, and telomere sequences as probes was carried out in the complex permanent heterozygote Rhoeo spathacea. Telomere sites were exclusively terminal. All 10 25S rDNA loci were located distally and appeared transcriptionally active after silver staining. Six distal and 2 interstitial 5S rDNA sites were detected; 2 of the distal sites strictly colocalized with 25S rDNA loci. The 2 intercalary 5S rDNA loci occurred in short arms of 2 chromosomes that conjoined at meiosis. Chromosomes differed as to the amount of AT-rich centric heterochromatin, suggesting involvement of pericentromeric regions in translocations. The possibility of Robertsonian-like rearrangements was discussed. Double target FISH with ribosomal probes along with DAPI fluorescence gave the basis for full chromosome identification in mitosis. The 2 Renner complexes are structurally balanced, both having 5 25S and 4 5S rDNA sites. Centromere clustering, telomere association, a high number of NOR sites, and a strong tendency for formation of joint nucleoli contribute to the preservation of highly polarized Rabl arrangement at interphase. These findings were discussed in relation to meiotic catenation in Rhoeo.

THE ACTION OF α-AMANITIN ON RNA SYNTHESIS IN CHINESE HAMSTER OVARY CELLS

PubMed Central

Kedinger, Claude; Simard, Rene

1974-01-01

α-Amanitin acts in vitro as a selective inhibitor of the nucleoplasmic form B RNA polymerases. Treatment of Chinese hamster ovary (CHO) cells with this drug leads principally to a severe fragmentation of the nucleoli. While the ultrastructural lesions induced by α-amanitin in CHO cells and in rat or mouse liver are quite similar, the results diverge concerning the effect on RNA synthesis. It has been shown that in rat or mouse liver α-amanitin blocks both extranucleolar and nucleolar RNA synthesis. Our autoradiographic and biochemical evidence indicates that in CHO cells high molecular weight extranucleolar RNA synthesis (HnRNA) is blocked by the α-amanitin treatment, whereas nucleolar RNA (preribosomal RNA) synthesis remains unaffected even several hours after the inhibition of extranucleolar RNA synthesis. Furthermore, the processing of this RNA as well as its transport to the cytoplasm seem only slightly affected by the treatment. Finally, under these conditions, the synthesis of the low molecular RNA species (4–5S) still occurs, though less actively. The results are interpreted as evidence for a selective impairment of HnRNA synthesis by α-amanitin in CHO cells. PMID:4474178

Cellular and molecular aspects of quinoa leaf senescence.

PubMed

López-Fernández, María Paula; Burrieza, Hernán Pablo; Rizzo, Axel Joel; Martínez-Tosar, Leandro Julián; Maldonado, Sara

2015-09-01

During leaf senescence, degradation of chloroplasts precede to changes in nuclei and other cytoplasmic organelles, RuBisCO stability is progressively lost, grana lose their structure, plastidial DNA becomes distorted and degraded, the number of plastoglobuli increases and abundant senescence-associated vesicles containing electronically dense particles emerge from chloroplasts pouring their content into the central vacuole. This study examines quinoa leaf tissues during development and senescence using a range of well-established markers of programmed cell death (PCD), including: morphological changes in nuclei and chloroplasts, degradation of RuBisCO, changes in chlorophyll content, DNA degradation, variations in ploidy levels, and changes in nuclease profiles. TUNEL reaction and DNA electrophoresis demonstrated that DNA fragmentation in nuclei occurs at early senescence, which correlates with induction of specific nucleases. During senescence, metabolic activity is high and nuclei endoreduplicate, peaking at 4C. At this time, TEM images showed some healthy nuclei with condensed chromatin and nucleoli. We have found that DNA fragmentation, induction of senescence-associated nucleases and endoreduplication take place during leaf senescence. This provides a starting point for further research aiming to identify key genes involved in the senescence of quinoa leaves. Published by Elsevier Ireland Ltd.

Malignant pleural effusion from papillary thyroid carcinoma diagnosed by pleural effusion cytology: A case report.

PubMed

Kosmas, Konstantinos; Tsonou, Anna; Mitropoulou, Georgia; Salemi, Eufrosyni; Kazi, Danai; Theofanopoulou, Ageliki

2018-02-01

Papillary thyroid carcinoma (PTC) is by far the most common thyroid malignancy (over 85%) of all the thyroid cancers. It has excellent prognosis and 10-year survival rate in most of the cases (95%). Most of the tumors are indolent and do not recur or metastasize after removal. However, widespread metastases to lung, skeleton, central nervous system and, occasionally, other organs may be observed. In rare instances, this disease may metastasize to the pleura and manifest as a malignant pleural effusion (MPE) and portend poor prognosis. This article reports the cytomorphologic and immunocytochemical findings of a female patient with a symptomatic pleural effusion resulting from PTC metastatic to the pleura. Pleural fluid cytology revealed abundant papillary clusters with relatively nuclear pleomorphism, intranuclear cytoplasmic inclusions and nuclear grooves, small and distinct nucleoli as well as small discrete vacuoles. Psammoma bodies were not seen. Immunocytochemical staining was positive for TGB, EMA, Ber-EP4, CK19, and negative for TTF-1. Metastasis of PTC to pleural fluid is extremely rare and diagnosing the disease by cytology is challenging and requires medical expertise as well as knowledge of clinical context and immunocytochemical staining. Additionally, a cytologic diagnosis of MPE due to PTC provides important treatment information and plays an important role in prognosis. © 2017 Wiley Periodicals, Inc.

Is Imprint Cytology Useful to Diagnose Malignancy for Brenner Tumors? A Case Series at a Single Institute.

PubMed

Minato, Junko; Tokunaga, Hideki; Okamoto, Satoshi; Shibuya, Yusuke; Niikura, Hitoshi; Yaegashi, Nobuo

2017-01-01

The aim of this study was to investigate cytological features of Brenner tumors according to tumor grade using imprint cytology. Between 2004 and 2015, intraoperative imprint cytology was performed on 8 patients with Brenner tumors suspected to be malignant neoplasmas on gross examination because of their large size and solid part. These consisted of 1 benign, 3 borderline, and 4 malignant tumors. In patients with benign and borderline tumors, naked nucleus-like stromal cells and tumor cells in a sheet-like arrangement were observed against a clear background. The nuclei were round to oval-shaped with finely granular chromatin patterns and small nucleoli. Papillary cell clusters and high nucleus-to-cytoplasm ratios were only observed in 1 borderline case. In cases with malignancy, the background was necrotic. The tumor cells occurred in large papillary clusters. The nuclei showed a high degree of nuclear atypia. Nuclear grooves were present in 6 of our 8 cases and they were scant in the malignant cases. Imprint cytology of Brenner tumors provided no characteristic findings to enable a definitive distinction of benign versus borderline tumors, but it enabled discrimination between malignant and other tumors. Imprint cytology can facilitate intraoperative diagnosis and aid in selecting the appropriate surgical procedure. © 2017 S. Karger AG, Basel.

Imprint cytology of clear cell sarcoma-like tumor of the gastrointestinal tract in the small intestine: A case report.

PubMed

Kato, Takashi; Ichihara, Shin; Gotoda, Hiroko; Muraoka, Shunji; Kubo, Terufumi; Sugita, Shintaro; Hasegawa, Tadashi

2017-12-01

Clear cell sarcoma-like tumor of the gastrointestinal tract (CCSLGT) is an extremely rare malignant neoplasm in the digestive tract. Its cytomorphologic features have never previously been reported. Here, we describe a case of CCSLGT, including its cytologic examination findings. A 47-year-old woman presented with a mass in the small intestine, which was resected and sent for imprint cytology. Imprint smears revealed tumor cells with light eosinophilic or clear cytoplasm in a necrotic background. Many of the tumor cells were arranged in a perivascular growth with a pseudopapillary formation, and there were some non-neoplastic osteoclast-like giant cells. Histological examination revealed solid nests and a pseudopapillary pattern of the tumor cells with clear or pale eosinophilic cytoplasm and large nuclei with small nucleoli. Immunohistochemistry showed positive for vimentin, S-100, and SOX-10, and negative for SMA, c-KIT, cytokeratin, HMB-45, and MelanA. The EWSR1 gene split signal was detected by reverse transcriptase fluorescence in situ hybridization, and EWSR1-CREB1 gene fusion was indicated by reverse transcriptase polymerase chain reaction analysis. From these findings, we diagnosed the tumor as CCSLGT. To best of our knowledge, this is the first description of the imprint cytology features of CCSLGT. © 2017 Wiley Periodicals, Inc.

Regional specialization in human nuclei: visualization of discrete sites of transcription by RNA polymerase III.

PubMed Central

Pombo, A; Jackson, D A; Hollinshead, M; Wang, Z; Roeder, R G; Cook, P R

1999-01-01

Mammalian nuclei contain three different RNA polymerases defined by their characteristic locations and drug sensitivities; polymerase I is found in nucleoli, and polymerases II and III in the nucleoplasm. As nascent transcripts made by polymerases I and II are concentrated in discrete sites, the locations of those made by polymerase III were investigated. HeLa cells were lysed with saponin in an improved 'physiological' buffer that preserves transcriptional activity and nuclear ultrastructure; then, engaged polymerases were allowed to extend nascent transcripts in Br-UTP, before the resulting Br-RNA was immunolabelled indirectly with fluorochromes or gold particles. Biochemical analysis showed that approximately 10 000 transcripts were being made by polymerase III at the moment of lysis, while confocal and electron microscopy showed that these transcripts were concentrated in only approximately 2000 sites (diameter approximately 40 nm). Therefore, each site contains approximately five active polymerases. These sites contain specific subunits of polymerase III, but not the hyperphosphorylated form of the largest subunit of polymerase II. The results indicate that the active forms of all three nuclear polymerases are concentrated in their own dedicated transcription sites or 'factories', suggesting that different regions of the nucleus specialize in the transcription of different types of gene. PMID:10205177

A Reliable and Reproducible Model for Assessing the Effect of Different Concentrations of α-Solanine on Rat Bone Marrow Mesenchymal Stem Cells.

PubMed

Ordóñez-Vásquez, Adriana; Jaramillo-Gómez, Lorenza; Duran-Correa, Camilo; Escamilla-García, Erandi; De la Garza-Ramos, Myriam Angélica; Suárez-Obando, Fernando

2017-01-01

Αlpha-solanine ( α -solanine) is a glycoalkaloid present in potato (Solanum tuberosum) . It has been of particular interest because of its toxicity and potential teratogenic effects that include abnormalities of the central nervous system, such as exencephaly, encephalocele, and anophthalmia. Various types of cell culture have been used as experimental models to determine the effect of α -solanine on cell physiology. The morphological changes in the mesenchymal stem cell upon exposure to α -solanine have not been established. This study aimed to describe a reliable and reproducible model for assessing the structural changes induced by exposure of mouse bone marrow mesenchymal stem cells (MSCs) to different concentrations of α -solanine for 24 h. The results demonstrate that nonlethal concentrations of α -solanine (2-6  μ M) changed the morphology of the cells, including an increase in the number of nucleoli, suggesting elevated protein synthesis, and the formation of spicules. In addition, treatment with α -solanine reduced the number of adherent cells and the formation of colonies in culture. Immunophenotypic characterization and staining of MSCs are proposed as a reproducible method that allows description of cells exposed to the glycoalkaloid, α -solanine.

A Reliable and Reproducible Model for Assessing the Effect of Different Concentrations of α-Solanine on Rat Bone Marrow Mesenchymal Stem Cells

PubMed Central

Ordóñez-Vásquez, Adriana; Jaramillo-Gómez, Lorenza; Duran-Correa, Camilo

2017-01-01

Αlpha-solanine (α-solanine) is a glycoalkaloid present in potato (Solanum tuberosum). It has been of particular interest because of its toxicity and potential teratogenic effects that include abnormalities of the central nervous system, such as exencephaly, encephalocele, and anophthalmia. Various types of cell culture have been used as experimental models to determine the effect of α-solanine on cell physiology. The morphological changes in the mesenchymal stem cell upon exposure to α-solanine have not been established. This study aimed to describe a reliable and reproducible model for assessing the structural changes induced by exposure of mouse bone marrow mesenchymal stem cells (MSCs) to different concentrations of α-solanine for 24 h. The results demonstrate that nonlethal concentrations of α-solanine (2–6 μM) changed the morphology of the cells, including an increase in the number of nucleoli, suggesting elevated protein synthesis, and the formation of spicules. In addition, treatment with α-solanine reduced the number of adherent cells and the formation of colonies in culture. Immunophenotypic characterization and staining of MSCs are proposed as a reproducible method that allows description of cells exposed to the glycoalkaloid, α-solanine. PMID:29201465

How does the nucleolar number involve in muscle fiber atrophy? Response to Beta-guanidinopropionic acid supplementation

NASA Astrophysics Data System (ADS)

Matsuoka, Yoshikazu; Kawano, Fuminori; Oke, Yoshihiko; Higo, Yoko; Umemoto, Shiori; Kawabe, Naoko; Wang, Xiaodong; Terada, Masahiro; Shinoda, Yo; Lan, Yongbo; Ogura, Akihiko; Ohira, Yoshinobu

2005-08-01

To investigate the relationship between the myonuclear capability and the number of nucleolus during muscle remodeling, oral supplementation of β-guanidinopropionic acid (β-GPA) on the characteristics of plantaris muscle fibers was performed for 2 weeks in adult male Wistar rats. Effects of β-GPA supply in culture medium on mouse myoblast cell line C2C12 was also studied. The mean fiber cross-sectional area was less in β-GPA-fed than control rats (35%, p<0.05). And the myonuclear number per mm of fiber length was significantly greater (35%, p<0.05). Thus, the cytoplasmic volume per myonucleus was less (52%) in β-GPA-fed rats (p<0.05). The number of nucleolar organizer regions (NORs) per myonucleus was also less (17%) in β-GPA-fed group (p<0.05). The number of NORs was greater (14%) in the myoblasts cultured with creatine phosphate compared with non-supplemented control, but it was less (10%) in the myoblasts cultured with β-GPA (p<0.05). Further, the number of NORs was also greater (26%) in the differentiated myotubes cultured with creatine phosphate (p<0.05). The results suggested that the nucleoli may play some role(s) in the regulation of muscle fiber size and its number may be influenced by creatine content.

Pemphigus vulgaris of the cervix: diagnostic difficulties associated with the Pap test.

PubMed

Munhoz de Paula Alves Coelho, Karina; Stall, Jaqueline; Henrique Condeixa de França, Paulo; Cristina de Carvalho Tavares, Lara; Stefanello Bublitz, Giuliano; Loos, Beliza; Carvalho Costa, Luciana; Fronza Júnior, Hercílio

2015-08-01

Pemphigus vulgaris (PV) is a rare mucocutaneous disease caused by the abnormal production of antibodies against epithelial cell surface glycoproteins, resulting in loss of cell adhesion and intraepithelial blister formation. Cervical involvement in PV has been poorly reported, and there is little information regarding the criteria about consequential cytological changes identified in a Papanicolaou-stained cervicovaginal smear (Pap smear). Here, we report a case of PV manifesting in the cervix as well as the difficulty associated with the cytomorphological identification and interpretation of acantholytic cells. This case involved a 40-year-old patient with no history of Pap test abnormalities and no prior diagnosis of PV. In the cytological assessment, cells were identified both in isolation and in clusters that exhibited round nuclei of increased volume, inconspicuous nucleoli, and perinuclear halos. The patient underwent a cervical biopsy that revealed vesiculobullous lesions and morphological pattern consistent with PV. A skin biopsy confirmed this diagnosis. We concluded that knowledge of PV cytomorphology is important because difficulties associated with the identification and interpretation of acantholytic cells might be responsible for false positive diagnoses of cervical neoplasia. However, a suspected diagnosis of PV is possible if the cytological findings are carefully correlated with the clinical data. © 2015 Wiley Periodicals, Inc.

Distribution of calmodulin in pea seedlings: immunocytochemical localization in plumules and root apices

NASA Technical Reports Server (NTRS)

Dauwalder, M.; Roux, S. J.; Hardison, L.

1986-01-01

Immunofluorescence techniques have been used to study the distribution of calmodulin in several tissues in young etiolated pea (Pisum sativum L.) seedlings. A fairly uniform staining was seen in the nucleoplasm and background cytoplasm of most cell types. Cell walls and nucleoli were not stained. In addition, patterned staining reactions were seen in many cells. In cells of the plumule, punctate staining of the cytoplasm was common, and in part this stain appeared to be associated with the plastids. A very distinctive staining of amyloplasts was seen in the columella of the root cap. Staining associated with cytoskeletal elements could be shown in division stages. By metaphase, staining of the spindle region was quite evident. In epidermal cells of the stem and along the underside of the leaf there was an intense staining of the vacuolar contents. Guard cells lacked this vacuolar stain. Vacuolar staining was sometimes seen in cells of the stele, but the most distinctive pattern in the stele was associated with young conducting cells of the xylem. These staining patterns are consistent with the idea that the interactions of plastids and the cytoskeletal may be one of the Ca(2+)-mediated steps in the response of plants to environmental stimuli. Nuclear functions may also be controlled, at least in part, by Ca2+.

Bioinformatic analysis of the nucleolus.

PubMed

Leung, Anthony K L; Andersen, Jens S; Mann, Matthias; Lamond, Angus I

2003-12-15

The nucleolus is a plurifunctional, nuclear organelle, which is responsible for ribosome biogenesis and many other functions in eukaryotes, including RNA processing, viral replication and tumour suppression. Our knowledge of the human nucleolar proteome has been expanded dramatically by the two recent MS studies on isolated nucleoli from HeLa cells [Andersen, Lyon, Fox, Leung, Lam, Steen, Mann and Lamond (2002) Curr. Biol. 12, 1-11; Scherl, Coute, Deon, Calle, Kindbeiter, Sanchez, Greco, Hochstrasser and Diaz (2002) Mol. Biol. Cell 13, 4100-4109]. Nearly 400 proteins were identified within the nucleolar proteome so far in humans. Approx. 12% of the identified proteins were previously shown to be nucleolar in human cells and, as expected, nearly all of the known housekeeping proteins required for ribosome biogenesis were identified in these analyses. Surprisingly, approx. 30% represented either novel or uncharacterized proteins. This review focuses on how to apply the derived knowledge of this newly recognized nucleolar proteome, such as their amino acid/peptide composition and their homologies across species, to explore the function and dynamics of the nucleolus, and suggests ways to identify, in silico, possible functions of the novel/uncharacterized proteins and potential interaction networks within the human nucleolus, or between the nucleolus and other nuclear organelles, by drawing resources from the public domain.

Fine-needle aspiration biopsy of large-cell undifferentiated carcinoma of the salivary glands: presentation of two cases, literature review, and differential cytodiagnosis of high-grade salivary gland malignancies.

PubMed

Moore, J G; Bocklage, T

1998-07-01

Primary undifferentiated carcinoma of the salivary glands is a rare, high-grade neoplasm which accounts for a very small number (1-5.5%) of malignant salivary gland tumors. The large-cell variant (LCU) is less well-characterized than the small-cell form. We report on the fine-needle aspiration (FNA) biopsy findings of 2 cases of LCU, one arising in the parotid gland, and the other in a buccal mucosa accessory salivary gland. The 2 cases were similar in composition: isolated and loosely cohesive large cells with abundant cytoplasm, and variability pleomorphic nuclei with prominent nucleoli. One case also featured multinucleated tumor giant cells and macrophage polykaryons; the latter has not previously been described in FNA biopsies of LCU. There was no evidence of squamous, myoepithelial, or widespread mucinous differentiation by morphological, cytochemical, or immunohistochemical analyses (focal rare mucin production identified on special stains in one case). The differential diagnosis is lengthy and consists of other high-grade primary salivary gland malignancies as well as metastatic lesions, including melanoma. The pattern of immunohistochemical reactivity (positive keratin, negative S-100, and HMB-45 antigens), and lack of conspicuous mucin production of significant lymphoidinfiltrate, were useful in establishing the correct diagnosis.

Laser Surgery: Organelles to Organs

NASA Astrophysics Data System (ADS)

Berns, Michael W. D.

1998-03-01

Understanding the physical mechanisms of light interaction with biological molecules and structure has resulted in the application of photons to a wide variety of biological and medical problems ranging from subcellular manipulation/surgery to the successful diagnosis and treatment of human disease. Mechanisms such as the generation and transfer of heat, light-driven chemistry (photochemistry), high peak power acoustic-mechanical effects, high photon-energy induced bond breaking, and optical induced forces through momentum transfer, are being utilized in single cells at the microscopic (submicron and micron) level as well as the macroscopic level in tissue and organs. At the subcellular level, focused laser microbeams (laser scissors and tweezers) are being used to cut and move chromosomes to study genetic function as well as to clone and sequence genes. The same laser technology is being used to manipulate a variety of cell organelles such as mitochondria, cell membranes, nucleoli, and mitochondria in order to study their functions in cell physiology. At the tissue level, lasers are being used to diagnose and treat malignancy in combination with light-activated drugs, to ablate cornea and other hard and soft tissue through ultraviolet photoablation, to selectively ablate structures within the skin under controlled heating/cooling conditions, and to differentiate normal from abnormal tissue using a variety of fluorescence detection and light scattering techniques.

Nucleolar Reorganization Upon Site-Specific Double-Strand Break Induction

PubMed Central

Franek, Michal; Kovaříková, Alena; Bártová, Eva; Kozubek, Stanislav

2016-01-01

DNA damage response (DDR) in ribosomal genes and mechanisms of DNA repair in embryonic stem cells (ESCs) are less explored nuclear events. DDR in ESCs should be unique due to their high proliferation rate, expression of pluripotency factors, and specific chromatin signature. Given short population doubling time and fast progress through G1 phase, ESCs require a sustained production of rRNA, which leads to the formation of large and prominent nucleoli. Although transcription of rRNA in the nucleolus is relatively well understood, little is known about DDR in this nuclear compartment. Here, we directed formation of double-strand breaks in rRNA genes with I-PpoI endonuclease, and we studied nucleolar morphology, DDR, and chromatin modifications. We observed a pronounced formation of I-PpoI-induced nucleolar caps, positive on BRCA1, NBS1, MDC1, γH2AX, and UBF1 proteins. We showed interaction of nucleolar protein TCOF1 with HDAC1 and TCOF1 with CARM1 after DNA injury. Moreover, H3R17me2a modification mediated by CARM1 was found in I-PpoI-induced nucleolar caps. Finally, we report that heterochromatin protein 1 is not involved in DNA repair of nucleolar caps. PMID:27680669

Simulated microgravity, Mars gravity, and 2g hypergravity affect cell cycle regulation, ribosome biogenesis, and epigenetics in Arabidopsis cell cultures.

PubMed

Kamal, Khaled Y; Herranz, Raúl; van Loon, Jack J W A; Medina, F Javier

2018-04-23

Gravity is the only component of Earth environment that remained constant throughout the entire process of biological evolution. However, it is still unclear how gravity affects plant growth and development. In this study, an in vitro cell culture of Arabidopsis thaliana was exposed to different altered gravity conditions, namely simulated reduced gravity (simulated microgravity, simulated Mars gravity) and hypergravity (2g), to study changes in cell proliferation, cell growth, and epigenetics. The effects after 3, 14, and 24-hours of exposure were evaluated. The most relevant alterations were found in the 24-hour treatment, being more significant for simulated reduced gravity than hypergravity. Cell proliferation and growth were uncoupled under simulated reduced gravity, similarly, as found in meristematic cells from seedlings grown in real or simulated microgravity. The distribution of cell cycle phases was changed, as well as the levels and gene transcription of the tested cell cycle regulators. Ribosome biogenesis was decreased, according to levels and gene transcription of nucleolar proteins and the number of inactive nucleoli. Furthermore, we found alterations in the epigenetic modifications of chromatin. These results show that altered gravity effects include a serious disturbance of cell proliferation and growth, which are cellular functions essential for normal plant development.

[Chromatin in diapause of the silkworm Bombyx mori L.: thermal parthenogenesis and normal development].

PubMed

Klimenko, V V; Khaoiuan', Lian

2012-01-01

Having used hematoxylin as a stain, some features of silkworm embryo chromatin in diapause have been studied in normal and parthenogenetic development. With found direct correlation between the number of interphase chromatin grains and the number of chromosomes in the nucleus, we examined cell polyploidization in the embryo at diapause stage. Polyploidization by parthenogenesis is not reducible to endomitotic doubling of the chromosome set because it comprises 6n-nuclei. Explanation of more diverse range of polyploid cells in parthenogenesis needs to consider the fusion of cleavage nuclei that is carried out by the cytoplasmic karyogamic mechanism in the absence of fertilization. For the first time on squash preparations, in diapausing embryo, we have identified primary germ cells (PGC) that are characterized by less compact chromatin, especially in the zygotic form of development, a larger size of the nucleus and cytoplasm, and irregular number and size of nucleoli. Evaluation of PGC ploidy in parthenogenesis by calculation of "loose" chromatin grains in diapause is possible and testifies polyploidization in embryo germ-line. This explains the inevitable admixture of tetraploid eggs in diploid parthenoclone grain and its absence in normal development. Cytological method used has revealed a spiral arrangement of chromatin grains on the inner surface of the nucleus at different levels of ploidy.

Fate of nuclear material during subsequent steps of the kinetin-induced PCD in apical parts of Vicia faba ssp. minor seedling roots.

PubMed

Kaźmierczak, Andrzej; Soboska, Kamila

2018-07-01

In animals during apoptosis, the best examined type of programmed cell death (PCD), three main phases are distinguished: (i) specification (signaling), (ii) killing and (iii) execution one. It has bean postulated that plant PCD also involves three subsequent phases: (i) transmission of death signals to cells (signaling), (ii) initiation of killing processes and (iii) destruction of cells. One of the most important hallmarks of animal and plant PCD are those regarding nucleus, not thoroughly studied in plants so far. To study kinetin-induced PCD (Kin-PCD) in the context of nuclear material faith, 2-cm apical parts of Vicia faba ssp. minor seedling roots were used. Applied assays involving spectrophotometry, transmission electron microscopy, fluorescence and white light microscopy allowed to examine metabolic and cytomorphologic hallmarks such as changes in DNA content, ssDNA formation and activity of acidic and basic nucleases (DNases and RNases) as well as malformations and fragmentation of nucleoli and nuclei. The obtained results concerning the PCD hallmarks and influence of ZnSO 4 on Kin-PCD allowed us to confirmed presence of specification/signaling, killing and execution/degradation phases of the process and broaden the knowledge about processes affecting nuclei during PCD. Copyright © 2018 Elsevier Ltd. All rights reserved.

Dynamics and Function of Nuclear Bodies during Embryogenesis.

PubMed

Arias Escayola, Dahyana; Neugebauer, Karla M

2018-05-01

Nuclear bodies are RNA-rich membraneless organelles in the cell nucleus that concentrate specific sets of nuclear proteins and RNA-protein complexes. Nuclear bodies such as the nucleolus, Cajal body (CB), and the histone locus body (HLB) concentrate factors required for nuclear steps of RNA processing. Formation of these nuclear bodies occurs on genomic loci and is frequently associated with active sites of transcription. Whether nuclear body formation is dependent on a particular gene element, an active process such as transcription, or the nascent RNA present at gene loci is a topic of debate. Recently, this question has been addressed through studies in model organisms and their embryos. The switch from maternally provided RNA and protein to zygotic gene products in early embryos has been well characterized in a variety of organisms. This process, termed maternal-to-zygotic transition, provides an excellent model for studying formation of nuclear bodies before, during, and after the transcriptional activation of the zygotic genome. Here, we review findings in embryos that reveal key principles in the study of the formation and function of nucleoli, CBs, and HLBs. We propose that while particular gene elements may contribute to formation of these nuclear bodies, active transcription promotes maturation of nuclear bodies and efficient RNA processing within them.

Polyploidization on SK-N-MC human neuroblastoma cells infected with herpes simplex virus 1.

PubMed

Karalyan, Zaven; Izmailyan, Roza; Karalova, Elena; Abroyan, Liana; Hakobyan, Lina; Avetisyan, Aida; Semerjyan, Zara

2016-01-01

Polyploidization is one of the most dramatic changes occurring within cell genome owing to various reasons including under many viral infections. We examined the impact of herpes simplex virus-1 (HSV-1) on SK-N-MC human neuroblastoma cell line. The infected cells were followed from 6 hours up to 96 hours post infection (hpi). A large number of polyploid cells with giant nuclei was observed under the influence of HSV-1 at 24 hpi with the DNA content of 32c to 64c or more, in comparison with control SK-N-MC cells that were characterized by relatively moderate values of ploidy, i.e. 8с to 16с (where 1c is the haploid amount of nuclear DNA found in normal diploid populations in G0/G1). After 48-96 hpi, the population of polyploid cells with giant nuclei decreased to the benchmark level. The SK-NMC cells infected with HSV-1 for 24 hours were stained with gallocyanine and monitored for cytological features. The infected cells underwent virus induced cellcell and nuclei fusion with the formation of dense nuclei syncytium. The metabolic activity of HSV-1 infected cells was higher in both nuclei and nucleoli when compared to control cells.

[1,10]Phenanthroline based cyanine dyes as fluorescent probes for ribonucleic acids in live cells

NASA Astrophysics Data System (ADS)

Kovalska, Vladyslava; Kuperman, Marina; Varzatskii, Oleg; Kryvorotenko, Dmytro; Kinski, Elisa; Schikora, Margot; Janko, Christina; Alexiou, Christoph; Yarmoluk, Sergiy; Mokhir, Andriy

2017-12-01

A series of monomethine, trimethine- and styrylcyanine dyes based on a [1,10]phenanthroline moiety was synthesized, characterized and investigated as potential fluorescent probes for nucleic acids in cell free settings and in cells. The dyes were found to be weakly fluorescent in the unbound state, whereas upon the binding to dsDNA or RNA their emission intensity raised up to 50 times (for monomethine benzothiazole derivative FT1 complexed with RNA). The strongest fluorescence intensity in assemblies with dsDNA and RNA was observed for the trimethine benzothiazole derivative FT4. The quantum yield of FT4 fluorescence in its complex with dsDNA was found to be 1.5% and the binding constant (K b) was estimated to be 7.9 × 104 M-1 that is a typical value for intercalating molecules. The FT4 dye was found to be cell membrane permeable. It stains RNA rich components—the nucleoli and most probably the cytoplasmic RNA. FT4 bound to RNAs delivers a very strong fluorescence signal, which makes this easily accessible dye a potentially useful alternative to known RNA stains, e.g. expensive SYTO® 83. The advantage of FT4 is its easy synthetic access including no chromatographic purification steps, which will be reflected in its substantially lower price.

Cytologic Features of Renal Carcinoma Associated with Xp11.2 Translocations/ TFE3 Gene Fusions: A Case Report with Voided and Catheterized Urine Cytology and a Literature Review.

PubMed

Kuwamoto, Satoshi; Murai, Yuki; Endo, Yukari; Masago, Toshihiko; Kuroda, Naoto; Horie, Yasushi

2014-01-01

Renal carcinomas associated with Xp11.2 translocations/TFE3 gene fusions are rare subtypes of renal neoplasm that predominantly occur in younger individuals. There are very few reports describing the cytologic features of these tumors. A 27-year-old man presented with hematuria and was found to have a mass in the lower part of the right kidney. Cytology of catheterized urine obtained from the right renal pelvis showed clusters of cells with abundant clear or eosinophilic granular cytoplasm, large round nuclei and prominent nucleoli. Papillary clusters containing thin fibrous stroma were occasionally seen. Voided urine cytology showed similar cell clusters but degeneration made the features obscure. Nephroureterectomy revealed a renal tumor showing a mixed papillary and nested architecture. The diagnosis was confirmed by immunohistochemistry and fluorescence in situ hybridization. The present case indicates that the characteristic features of these tumor subtypes can be retained in urine cytology. Cytology may be enough to suspect these tumors as part of the differential diagnosis when the patient's age and imaging findings are taken into account and may facilitate further studies for a definitive diagnosis. © 2014 S. Karger AG, Basel.

The nuclear matrix protein NMP-1 is the transcription factor YY1.

PubMed Central

Guo, B; Odgren, P R; van Wijnen, A J; Last, T J; Nickerson, J; Penman, S; Lian, J B; Stein, J L; Stein, G S

1995-01-01

NMP-1 was initially identified as a nuclear matrix-associated DNA-binding factor that exhibits sequence-specific recognition for the site IV regulatory element of a histone H4 gene. This distal promoter domain is a nuclear matrix interaction site. In the present study, we show that NMP-1 is the multifunctional transcription factor YY1. Gel-shift and Western blot analyses demonstrate that NMP-1 is immunoreactive with YY1 antibody. Furthermore, purified YY1 protein specifically recognizes site IV and reconstitutes the NMP-1 complex. Western blot and gel-shift analyses indicate that YY1 is present within the nuclear matrix. In situ immunofluorescence studies show that a significant fraction of YY1 is localized in the nuclear matrix, principally but not exclusively associated with residual nucleoli. Our results confirm that NMP-1/YY1 is a ubiquitous protein that is present in both human cells and in rat osteosarcoma ROS 17/2.8 cells. The finding that NMP-1 is identical to YY1 suggests that this transcriptional regulator may mediate gene-matrix interactions. Our results are consistent with the concept that the nuclear matrix may functionally compartmentalize the eukaryotic nucleus to support regulation of gene expression. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7479833

Fine-Needle Aspiration of Metastatic Central Type Primitive Neuroectodermal Tumors in Patients with a Germ Cell Tumor.

PubMed

Chen, Shaoxiong; Idrees, Muhammad; Lin, Jingmei; Wu, Howard H

2017-01-01

Central type primitive neuroectodermal tumors (PNET) are some of the most frequent somatic type tumors derived from germ cell tumors and can metastasize. We studied the cytomorphological features of metastatic central type PNET by fine-needle aspiration (FNA). A computerized search of our laboratory information system was performed for the 9-year period from 2005 through 2014 to identify all cytology cases in which a diagnosis of metastatic central type PNET had been rendered. A total of 5 FNA cases were collected and direct smears were reexamined. All patients had a history of testicular or ovarian germ cell tumors. Direct smears displayed single and clusters of atypical round to oval cells with scant to moderate cytoplasm. Abundant naked nuclei were present in Diff-Quik-stained smears with mild to marked crushed artifacts and nuclear molding. Tumor cells showed fine granular chromatin, nuclear size variation (up to 1:3), and one or more small nucleoli. Pseudorosettes (Homer Wright-like rosette) were noticed in 1 case. Tumor cells were commonly positive for synaptophysin. Metastatic PNET can be reliably diagnosed by FNA. Differential diagnoses include Ewing sarcoma/peripheral PNET, alveolar rhabdomyosarcoma, neuroblastoma, etc. It is important to be familiar with this entity to avoid diagnostic pitfalls. © 2017 S. Karger AG, Basel.

[Morphological structure of rat epiphysis exposed to electromagnetic radiation from communication devices].

PubMed

Yashchenko, S G; Rybalko, S Yu

Pineal gland is one of the most important components of homeostasis - the supporting system of the body. It participates in the launch of stress responses, restriction of their development, prevention of adverse effects on the body. There was proved an impact of electromagnetic radiation on the epiphysis. However, morphological changes in the epiphysis under exposure to electromagnetic radiation of modern communication devices are studied not sufficiently. For the time present the population is daily exposed to electromagnetic radiation, including local irradiation on the brain. These date determined the task of this research - the study of the structure of rat pineal gland under the exposure to electromagnetic radiation from personal computers and mobile phones. These date determined the task of this research - the study of the structure of rat pineal gland under the exposure to electromagnetic radiation from personal computers and mobile phones. Performed transmission electron microscopy revealed signs of degeneration of dark and light pinealocytes. These signs were manifested in the development of a complex of general and specific morphological changes. There was revealed the appearance of signs of aging and depletion transmission electron microscopy both in light and dark pinealocytes. These signs were manifested in the accumulation of lipofuscin granules and electron-dense "brain sand", the disappearance of nucleoli, cytoplasm vacuolization and mitochondrial cristae enlightenment.

A renal epithelioid angiomyolipoma/perivascular epithelioid cell tumor with TFE3 gene break visualized by FISH.

PubMed

Ohe, Chisato; Kuroda, Naoto; Hes, Ondrej; Michal, Michal; Vanecek, Tomas; Grossmann, Petr; Tanaka, Yukichi; Tanaka, Mio; Inui, Hidekazu; Komai, Yoshihiro; Matsuda, Tadashi; Uemura, Yoshiko

2012-12-01

We present a case of renal epithelioid angiomyolipoma (eAML)/perivascular epithelioid cell tumor (PEComa) with a TFE3 gene break visible by fluorescence in situ hybridization (FISH). Histologically, the tumor was composed of mainly epithelioid cells forming solid arrangements with small foci of spindle cells. In a small portion of the tumor, neoplastic cells displayed nuclear pleomorphism, such as polygonal and enlarged vesicular nuclei with prominent nucleoli. Marked vascularity was noticeable in the background, and perivascular hyaline sclerosis was also seen. Immunohistochemically, neoplastic cells were diffusely positive for α-smooth muscle actin and melanosome in the cytoplasm. Nuclei of many neoplastic cells were positive for TFE3. FISH analysis of the TFE3 gene break using the Poseidon TFE3 (Xp11) Break probe revealed positive results. Reverse transcriptase-polymerase chain reactions (RT-PCR) for ASPL/TFE3, PRCC/TFE3, CLTC/TFE3, PSF/TFE3, and NonO/TFE3 gene fusions all revealed negative results. This is the first reported case of renal eAML/PEComa with a TFE3 gene break, and it has unique histological findings as compared to previously reported TFE3 gene fusion-positive PEComas. Pathologists should recognize that PEComa with TFE3 gene fusion can arise even in the kidney.

Laser Scanning Cytometry: Principles and Applications—An Update

PubMed Central

Pozarowski, Piotr; Holden, Elena; Darzynkiewicz, Zbigniew

2012-01-01

Laser scanning cytometer (LSC) is the microscope-based cytofluorometer that offers a plethora of unique analytical capabilities, not provided by flow cytometry (FCM). This review describes attributes of LSC and covers its numerous applications derived from plentitude of the parameters that can be measured. Among many LSC applications the following are emphasized: (a) assessment of chromatin condensation to identify mitotic, apoptotic cells, or senescent cells; (b) detection of nuclear or mitochondrial translocation of critical factors such as NF-κB, p53, or Bax; (c) semi-automatic scoring of micronuclei in mutagenicity assays; (d) analysis of fluorescence in situ hybridization (FISH) and use of the FISH analysis attribute to measure other punctuate fluorescence patterns such as γH2AX foci or receptor clustering; (e) enumeration and morphometry of nucleoli and other cell organelles; (f) analysis of progeny of individual cells in clonogenicity assay; (g) cell immunophenotyping; (h) imaging, visual examination, or sequential analysis using different probes of the same cells upon their relocation; (i) in situ enzyme kinetics, drug uptake, and other time-resolved processes; (j) analysis of tissue section architecture using fluorescent and chromogenic probes; (k) application for hypocellular samples (needle aspirate, spinal fluid, etc.); and (l) other clinical applications. Advantages and limitations of LSC are discussed and compared with FCM. PMID:23027005

Clinorotation influences rDNA and NopA100 localization in nucleoli

NASA Astrophysics Data System (ADS)

Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

Nucleolar Proteome Analysis and Proteasomal Activity Assays Reveal a Link between Nucleolus and 26S Proteasome in A. thaliana

PubMed Central

Montacié, Charlotte; Durut, Nathalie; Opsomer, Alison; Palm, Denise; Comella, Pascale; Picart, Claire; Carpentier, Marie-Christine; Pontvianne, Frederic; Carapito, Christine; Schleiff, Enrico; Sáez-Vásquez, Julio

2017-01-01

In all eukaryotic cells, the nucleolus is functionally and structurally linked to rRNA synthesis and ribosome biogenesis. This compartment contains as well factors involved in other cellular activities, but the functional interconnection between non-ribosomal activities and the nucleolus (structure and function) still remains an open question. Here, we report a novel mass spectrometry analysis of isolated nucleoli from Arabidopsis thaliana plants using the FANoS (Fluorescence Assisted Nucleolus Sorting) strategy. We identified many ribosome biogenesis factors (RBF) and proteins non-related with ribosome biogenesis, in agreement with the recognized multi-functionality of the nucleolus. Interestingly, we found that 26S proteasome subunits localize in the nucleolus and demonstrated that proteasome activity and nucleolus organization are intimately linked to each other. Proteasome subunits form discrete foci in the disorganized nucleolus of nuc1.2 plants. Nuc1.2 protein extracts display reduced proteasome activity in vitro compared to WT protein extracts. Remarkably, proteasome activity in nuc1.2 is similar to proteasome activity in WT plants treated with proteasome inhibitors (MG132 or ALLN). Finally, we show that MG132 treatment induces disruption of nucleolar structures in WT but not in nuc1.2 plants. Altogether, our data suggest a functional interconnection between nucleolus structure and proteasome activity. PMID:29104584

A nucleolus-predominant piggyBac transposase, NP-mPB, mediates elevated transposition efficiency in mammalian cells.

PubMed

Hong, Jin-Bon; Chou, Fu-Ju; Ku, Amy T; Fan, Hsiang-Hsuan; Lee, Tung-Lung; Huang, Yung-Hsin; Yang, Tsung-Lin; Su, I-Chang; Yu, I-Shing; Lin, Shu-Wha; Chien, Chung-Liang; Ho, Hong-Nerng; Chen, You-Tzung

2014-01-01

PiggyBac is a prevalent transposon system used to deliver transgenes and functionally explore the mammalian untouched genomic territory. The important features of piggyBac transposon are the relatively low insertion site preference and the ability of seamless removal from genome, which allow its potential uses in functional genomics and regenerative medicine. Efforts to increase its transposition efficiency in mammals were made through engineering the corresponding transposase (PBase) codon usage to enhance its expression level and through screening for mutant PBase variants with increased enzyme activity. To improve the safety for its potential use in regenerative medicine applications, site-specific transposition was achieved by using engineered zinc finger- and Gal4-fused PBases. An excision-prone PBase variant has also been successfully developed. Here we describe the construction of a nucleolus-predominant PBase, NP-mPB, by adding a nucleolus-predominant (NP) signal peptide from HIV-1 TAT protein to a mammalian codon-optimized PBase (mPB). Although there is a predominant fraction of the NP-mPB-tGFP fusion proteins concentrated in the nucleoli, an insertion site preference toward nucleolar organizer regions is not detected. Instead a 3-4 fold increase in piggyBac transposition efficiency is reproducibly observed in mouse and human cells.

Synchronous Double Malignant Tumors Consisting of Stomach and Hodgkin's Lymphoma with Collision between Gastric Adenocarcinoma and Hodgkin's Lymphoma in the Stomach.

PubMed

Yanagawa, Naoki; Ogata, Shin-Ya; Fukushima, Norimasa; Maeda, Kunihiko; Tamura, Gen

2012-09-01

We report the rare case of a 72-year-old man with double cancers (gastric adenocarcinoma and Hodgkin's lymphoma) with collision between gastric adenocarcinoma and Hodgkin's lymphoma. Abdominal computed tomography showed increased wall thickness in the fundus region of the stomach and multiple lymph node swellings in the lesser curvature, periceliac and left cardial regions. Upper gastrointestinal endoscopy showed an ulcer approximately 5 cm in diameter with a malignant appearance in the fundus region of the stomach. On histopathologic examination, two completely different tumors were recognized in the stomach. One tumor was a poorly differentiated adenocarcinoma characterized by poorly developed tubular structures associated with prominent lymphoid infiltration of the stroma. The other tumor was found to have proliferated in the wall of the stomach, with diffuse granulomatous lesions and bordering the adenocarcinoma. Large atypical lymphoid cells with prominent nucleoli and enlarged mononuclei or multinuclei were seen in the latter tumor. Hodgkin's lymphoma was also found in the swollen lesser curvature lymph nodes. As a result, gastric adenocarcinoma and metastasis of Hodgkin's lymphoma were collided in the stomach. In conclusion, this case might be helpful in exploring the occurrence mechanism of tumor collision between lymphoma and carcinoma.

Organ and Tissue-Specific Localisation of Selected Cell Wall Epitopes in the Zygotic Embryo of Brachypodium distachyon.

PubMed

Betekhtin, Alexander; Milewska-Hendel, Anna; Lusinska, Joanna; Chajec, Lukasz; Kurczynska, Ewa; Hasterok, Robert

2018-03-03

The plant cell wall shows a great diversity regarding its chemical composition, which may vary significantly even during different developmental stages. In this study, we analysed the distribution of several cell wall epitopes in embryos of Brachypodium distachyon (Brachypodium). We also described the variations in the nucleus shape and the number of nucleoli that occurred in some embryo cells. The use of transmission electron microscopy, and histological and immunolocalisation techniques permitted the distribution of selected arabinogalactan proteins, extensins, pectins, and hemicelluloses on the embryo surface, internal cell compartments, and in the context of the cell wall ultrastructure to be demonstrated. We revealed that the majority of arabinogalactan proteins and extensins were distributed on the cell surface and that pectins were the main component of the seed coat and other parts, such as the mesocotyl cell walls and the radicula. Hemicelluloses were localised in the cell wall and outside of the radicula protodermis, respectively. The specific arrangement of those components may indicate their significance during embryo development and seed germination, thus suggesting the importance of their protective functions. Despite the differences in the cell wall composition, we found that some of the antibodies can be used as markers to identify specific cells and the parts of the developing Brachypodium embryo.

Three-dimensional Organization of pKi-67: A Comparative Fluorescence and Electron Tomography Study Using Fluoronanogold

PubMed Central

Cheutin, Thierry; O'Donohue, Marie-Françoise; Beorchia, Adrien; Klein, Christophe; Kaplan, Hervé; Ploton, Dominique

2003-01-01

The monoclonal antibody (MAb) Ki-67 is routinely used in clinical studies to estimate the growth fraction of tumors. However, the role of pKi-67, the protein detected by the Ki-67 MAb, remains elusive, although some biochemical data strongly suggest that it might organize chromatin. To better understand the functional organization of pKi-67, we studied its three-dimensional distribution in interphase cells by confocal microscopy and electron tomography. FluoroNanogold, a single probe combining a dense marker with a fluorescent dye, was used to investigate pKi-67 organization at the optical and ultrastructural levels. Observation by confocal microscopy followed by 3D reconstruction showed that pKi-67 forms a shell around the nucleoli. Double labeling experiments revealed that pKi-67 co-localizes with perinucleolar heterochromatin. Electron microscopy studies confirmed this close association and demonstrated that pKi-67 is located neither in the fibrillar nor in the granular components of the nucleolus. Finally, spatial analyses by electron tomography showed that pKi-67 forms cords 250–300 nm in diameter, which are themselves composed of 30–50-nm-thick fibers. These detailed comparative in situ analyses strongly suggest the involvement of pKi-67 in the higher-order organization of perinucleolar chromatin. PMID:14566014

Three-dimensional organization of pKi-67: a comparative fluorescence and electron tomography study using FluoroNanogold.

PubMed

Cheutin, Thierry; O'Donohue, Marie-Françoise; Beorchia, Adrien; Klein, Christophe; Kaplan, Hervé; Ploton, Dominique

2003-11-01

The monoclonal antibody (MAb) Ki-67 is routinely used in clinical studies to estimate the growth fraction of tumors. However, the role of pKi-67, the protein detected by the Ki-67 MAb, remains elusive, although some biochemical data strongly suggest that it might organize chromatin. To better understand the functional organization of pKi-67, we studied its three-dimensional distribution in interphase cells by confocal microscopy and electron tomography. FluoroNanogold, a single probe combining a dense marker with a fluorescent dye, was used to investigate pKi-67 organization at the optical and ultrastructural levels. Observation by confocal microscopy followed by 3D reconstruction showed that pKi-67 forms a shell around the nucleoli. Double labeling experiments revealed that pKi-67 co-localizes with perinucleolar heterochromatin. Electron microscopy studies confirmed this close association and demonstrated that pKi-67 is located neither in the fibrillar nor in the granular components of the nucleolus. Finally, spatial analyses by electron tomography showed that pKi-67 forms cords 250-300 nm in diameter, which are themselves composed of 30-50-nm-thick fibers. These detailed comparative in situ analyses strongly suggest the involvement of pKi-67 in the higher-order organization of perinucleolar chromatin.

[New histological terminology of vulvar intraepithelial neoplasia].

PubMed

Bergeron, C

2008-01-01

The International Society for the Study of Vulvar Disease (ISSVD) recommends not to use a grading any more and to include in the term vulvar intraepithelial neoplasia (VIN), usual type, the previously called VIN 2 where the nuclear atypia and mitotic figures are confined to the basal half of the epithelium and VIN 3 where nuclear abnormalities and abnormal mitotic figures are present throughout most or all of the thickness of the epithelium. VIN, usual type, is related to a human papillomavirus (HPV) high-risk type infection in most of the cases. The histologic changes previously encompassed within the term VIN 1 will be described as flat condyloma or HPV effect. The less common type of VIN lesion is termed VIN, differentiated type, previously called "high grade" differentiated type or VIN simplex type. This type of VIN is a highly differentiated lesion. The atypia is confined to the basal and parabasal layers of the epithelium, where the cells have abundant cytoplasm and form abortive pearls and the nuclei are relatively uniform in size and contain coarse chromatin and prominent nucleoli. The epithelium does not contain koilocytosis because it is not associated with HPV. It is seen primarily in older women, with a previous history of lichen sclerosus. The diagnosis is often made late in association with keratinising squamous cell carcinomas.

Melanotic Translocation Renal Cell Carcinoma With a Novel ARID1B-TFE3 Gene Fusion.

PubMed

Antic, Tatjana; Taxy, Jerome B; Alikhan, Mir; Segal, Jeremy

2017-11-01

A 36-year-old male was found to have a 7.0 cm left upper pole renal mass on renal ultrasound. Following nephrectomy, the mass was grossly ill-demarcated, friable and red-brown, invading renal parenchyma, hilar fat and the renal vein. Microscopically, the tumor had a nested and papillary architecture. The cells demonstrated abundant clear and eosinophilic cytoplasm and focal intracytoplasmic melanin pigment. Nucleoli were prominent. By immunohistochemistry, the tumor was positive for TFE3; HMB-45 stained approximately 5% of tumor cells corresponding to the histologic melanin pigment, which was confirmed with Fontana-Masson stain with bleach. Immunostains for PAX8, CD10, MiTF, and CAIX were negative; keratins Cam 5.2 and AE1/AE3 were focally positive. Targeted next-generation sequencing revealed an ARID1B-TFE3 gene fusion. Melanotic Xp11 renal cell carcinoma is a rare, pigment containing translocation variant demonstrating overlapping features with melanoma and is usually associated with an SFPQ-TFE3 gene fusion. The patient is alive and without evidence of disease 7 years after his diagnosis. The combination of high grade histopathology, the presence of melanin, absent PAX8, keratin positivity, and relatively indolent clinical behavior with a unique translocation may warrant recognition as a distinct renal cell carcinoma translocation subtype.

Hepatocellular carcinoma with both fibrolamellar and classical components: an unusual morphological pattern.

PubMed

Castro-Villabón, Diana; Barrera-Herrera, Luis E; Rodríguez-Urrego, Paula A; Hudacko, Rachel; Vera, Alonso; Álvarez, Johanna; Andrade, Rafael; López, Rocío

2015-01-01

Fibrolamellar carcinoma (FLC) is an uncommon form of primary liver malignancy with unique clinical, histological, and biological characteristics. It is usually seen in young adults without underlying liver disease. Histologically, it shows large cells with abundant eosinophilic cytoplasm, large vesicular nuclei, prominent nucleoli, and lamellar type fibrosis. In contrast, classical hepatocellular carcinoma (HCC) is typically present in elderly male patients with cirrhosis. It is the most common histological subtype, and it is characterized by its resemblance to the normal liver, both in its growth pattern and its cytology. The unusual case of a liver carcinoma that presented with histological features of both FLC and classical HCC is herein reported. This was the case of a 37-year-old female complaining of diffuse abdominal discomfort and epigastric pain for two months. She was referred to us for further management after she was diagnosed with HCC in a noncirrhotic liver. She underwent a left-sided hepatectomy. A yellow nodular mass with well-defined borders and a necrotic center was present in the resection specimen. The morphological features and immunohistochemical studies were consistent with a diagnosis of FLC mixed with classical HCC. The patient was followed up for five months, and no signs of recurrence were evident.

Discrepancy between species borders at morphological and molecular levels in the genus Cochliopodium (Amoebozoa, Himatismenida), with the description of Cochliopodium plurinucleolum n. sp.

PubMed

Geisen, Stefan; Kudryavtsev, Alexander; Bonkowski, Michael; Smirnov, Alexey

2014-05-01

Amoebae of the genus Cochliopodium are characterized by a tectum that is a layer of scales covering the dorsal surface of the cell. A combination of scale structure, morphological features and, nowadays, molecular information allows species discrimination. Here we describe a soil species Cochliopodium plurinucleolum n. sp. that besides strong genetic divergence from all currently described species of Cochliopodium differs morphologically by the presence of several peripheral nucleoli in the nucleus. Further, we unambiguously show that the Golgi attachment associated with a dictyosome in Cochliopodium is a cytoplasmic microtubule organizing center (MTOC). Last, we provide detailed morphological and molecular information on the sister clade of C. plurinucleolum, containing C. minus, C. minutoidum, C. pentatrifurcatum and C. megatetrastylus. These species share nearly identical sequences of both, small subunit ribosomal RNA and partial Cox1 genes, and nearly identical structure of the scales. Scales of C. pentatrifurcatum differ, however, strongly from scales of the others while sequences of C. pentatrifurcatum and C. minus are nearly identical. These discrepancies urge for future sampling efforts to disentangle species characteristics within Cochliopdium and to investigate morphological and molecular patterns that allow reliable species differentiation. Copyright © 2014 Elsevier GmbH. All rights reserved.

Electron microscopic studies of mitosis in amebae. I. Amoeba proteus.

PubMed

ROTH, L E; OBETZ, S W; DANIELS, E W

1960-09-01

Individual organisms of Amoeba proteus have been fixed in buffered osmium tetroxide in either 0.9 per cent NaCl or 0.01 per cent CaCl(2), sectioned, and studied in the electron microscope in interphase and in several stages of mitosis. The helices typical of interphase nuclei do not coexist with condensed chromatin and thus either represent a DNA configuration unique to interphase or are not DNA at all. The membranes of the complex nuclear envelope are present in all stages observed but are discontinuous in metaphase. The inner, thick, honeycomb layer of the nuclear envelope disappears during prophase, reappearing after telophase when nuclear reconstruction is in progress. Nucleoli decrease in size and number during prophase and re-form during telophase in association with the chromatin network. In the early reconstruction nucleus, the nucleolar material forms into thin, sheet-like configurations which are closely associated with small amounts of chromatin and are closely applied to the inner, partially formed layer of the nuclear envelope. It is proposed that nucleolar material is implicated in the formation of the inner layer of the envelope and that there is a configuration of nucleolar material peculiar to this time. The plasmalemma is partially denuded of its fringe-like material during division.

ELECTRON MICROSCOPIC STUDIES OF MITOSIS IN AMEBAE

PubMed Central

Roth, L. E.; Obetz, S. W.; Daniels, E. W.

1960-01-01

Individual organisms of Amoeba proteus have been fixed in buffered osmium tetroxide in either 0.9 per cent NaCl or 0.01 per cent CaCl2, sectioned, and studied in the electron microscope in interphase and in several stages of mitosis. The helices typical of interphase nuclei do not coexist with condensed chromatin and thus either represent a DNA configuration unique to interphase or are not DNA at all. The membranes of the complex nuclear envelope are present in all stages observed but are discontinuous in metaphase. The inner, thick, honeycomb layer of the nuclear envelope disappears during prophase, reappearing after telophase when nuclear reconstruction is in progress. Nucleoli decrease in size and number during prophase and re-form during telophase in association with the chromatin network. In the early reconstruction nucleus, the nucleolar material forms into thin, sheet-like configurations which are closely associated with small amounts of chromatin and are closely applied to the inner, partially formed layer of the nuclear envelope. It is proposed that nucleolar material is implicated in the formation of the inner layer of the envelope and that there is a configuration of nucleolar material peculiar to this time. The plasmalemma is partially denuded of its fringe-like material during division. PMID:13743845

Prostate cancer detection: Fusion of cytological and textural features.

PubMed

Nguyen, Kien; Jain, Anil K; Sabata, Bikash

2011-01-01

A computer-assisted system for histological prostate cancer diagnosis can assist pathologists in two stages: (i) to locate cancer regions in a large digitized tissue biopsy, and (ii) to assign Gleason grades to the regions detected in stage 1. Most previous studies on this topic have primarily addressed the second stage by classifying the preselected tissue regions. In this paper, we address the first stage by presenting a cancer detection approach for the whole slide tissue image. We propose a novel method to extract a cytological feature, namely the presence of cancer nuclei (nuclei with prominent nucleoli) in the tissue, and apply this feature to detect the cancer regions. Additionally, conventional image texture features which have been widely used in the literature are also considered. The performance comparison among the proposed cytological textural feature combination method, the texture-based method and the cytological feature-based method demonstrates the robustness of the extracted cytological feature. At a false positive rate of 6%, the proposed method is able to achieve a sensitivity of 78% on a dataset including six training images (each of which has approximately 4,000×7,000 pixels) and 1 1 whole-slide test images (each of which has approximately 5,000×23,000 pixels). All images are at 20X magnification.

Prostate cancer detection: Fusion of cytological and textural features

PubMed Central

Nguyen, Kien; Jain, Anil K.; Sabata, Bikash

2011-01-01

A computer-assisted system for histological prostate cancer diagnosis can assist pathologists in two stages: (i) to locate cancer regions in a large digitized tissue biopsy, and (ii) to assign Gleason grades to the regions detected in stage 1. Most previous studies on this topic have primarily addressed the second stage by classifying the preselected tissue regions. In this paper, we address the first stage by presenting a cancer detection approach for the whole slide tissue image. We propose a novel method to extract a cytological feature, namely the presence of cancer nuclei (nuclei with prominent nucleoli) in the tissue, and apply this feature to detect the cancer regions. Additionally, conventional image texture features which have been widely used in the literature are also considered. The performance comparison among the proposed cytological textural feature combination method, the texture-based method and the cytological feature-based method demonstrates the robustness of the extracted cytological feature. At a false positive rate of 6%, the proposed method is able to achieve a sensitivity of 78% on a dataset including six training images (each of which has approximately 4,000×7,000 pixels) and 1 1 whole-slide test images (each of which has approximately 5,000×23,000 pixels). All images are at 20X magnification. PMID:22811959

The ultrastructure of conjunctival melanocytic tumors.

PubMed Central

Jakobiec, F A

1984-01-01

The ultrastructure of conjunctival melanocytic lesions in 49 patients was evaluated to find significant differences between benign and malignant cells. The patients studied included 9 with benign epithelial (racial) melanosis, 2 with pigmented squamous cell papillomas, 16 with conjunctival nevi, 18 with primary acquired melanosis, and 11 with invasive nodules of malignant melanoma. In benign epithelial melanosis, dendritic melanocytes were situated along the basement membrane region of the conjunctival epithelium, with one basilar dendritic melanocyte lodged among every five or six basilar keratinocytes. The dendritic melanocytes extended arborizing cellular processes between the basilar and among the suprabasilar keratinocytes, which manifested considerable uptake of melanin granules into their cytoplasm. The benign dendritic melanocytes possessed nuclei with clumped heterochromatin at the nuclear membrane, small, tightly wound nucleoli, and large, elongated, fully melaninized melanin granules. In two patients with benign hyperplasia of the dendritic melanocytes, occasional dendritic melanocytes were located in a suprabasilar position, but were always separated from each other by keratinocytes or their processes. In the two black patients with benign pigmented squamous papillomas, the benign dendritic melanocytes were located hapharzardly at all levels of the acanthotic epithelium and not just along the basement membrane region. Melanin uptake by the proliferating keratinocytes was minimal. In benign melanocytic nevi of the conjunctiva, nevus cells within the intraepithelial junctional nests displayed a more rounded cellular configuration; short villi and broader cellular processes suggestive of abortive dendrites were found. The nuclear chromatin pattern was clumped at the nuclear membrane, but the nucleoli were somewhat larger than those of benign dendritic melanocytes in epithelial melanosis. The melanosomes were smaller and rounder than those in dendritic melanocytes and exhibited more haphazard arrangements of the melanofilaments, which were only partially melaninized. Mitochondria were more numerous than in dendritic melanocytes, and monoribosomes predominated over polyribosomes. Cytoplasmic filaments were inconspicuous. Cells in the immediate subepithelial connective tissue zone had features identical to those of the cells within the junctional nests. Smaller, lymphocytoid cells with less numerous and more rudimentary melanosomes were found in the middle and deeper portions of the lesions.(ABSTRACT TRUNCATED AT 400 WORDS) Images FIGURE 21 FIGURE 22 FIGURE 42 FIGURE 67 FIGURE 1 FIGURE 62 FIGURE 26 FIGURE 29 FIGURE 37 FIGURE 11 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 27 FIGURE 28 FIGURE 30 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 FIGURE 35 FIGURE 36 FIGURE 38 FIGURE 39 FIGURE 40 FIGURE 41 FIGURE 43 FIGURE 44 FIGURE 45 FIGURE 46 FIGURE 47 FIGURE 48 FIGURE 49 FIGURE 50 FIGURE 51 FIGURE 52 FIGURE 53 FIGURE 54 FIGURE 55 FIGURE 56 FIGURE 57 FIGURE 58 FIGURE 59 FIGURE 60 FIGURE 61 FIGURE 63 FIGURE 64 FIGURE 65 FIGURE 66 FIGURE 68 FIGURE 69 FIGURE 70 FIGURE 71 FIGURE 72 FIGURE 73 FIGURE 74 FIGURE 75 FIGURE 76 FIGURE 77 FIGURE 78 FIGURE 79 FIGURE 80 FIGURE 81 FIGURE 82 FIGURE 83 FIGURE 84 FIGURE 85 FIGURE 86 FIGURE 87 FIGURE 88 FIGURE 89 PMID:6398936

Nucleolar evolution and coiled bodies during meiotic prophase in Olea europaea: differential localization of nucleic acids.

PubMed

Olmedilla, A; de Dios Alché, J; Rodríguez-García, M I

1997-10-01

We studied the ultrastructural evolution of the nucleolus during meiotic prophase in olive microsporocytes. During prophase, nuclear bodies morphologically similar to coiled bodies were observed. The nucleic acid composition of these bodies was examined in microsporocytes using electron microscopic techniques with EDTA preferential ribonucleoprotein staining, anti-DNA immunolabeling, the in situ terminal deoxynucleotidyl transferase-immunogold technique, and in situ hybridization with 18S rRNA and U3 snoRNA digoxigenin-labeled probes. The ultrastructural appearance of the meiocyte nucleolus indicated a low level of activity from the early prophase stage: the granular component was practically absent and nucleoli were constituted almost exclusively by dense fibrillar component containing large fibrillar centers that lacked chromatin inclusions. However, the appearance of reactivation vacuoles in the nucleolus during zygotene and high levels of rRNA in the nucleoplasm during pachytene support the presence of a peak in rRNA synthesis. Our results also show that the nuclear bodies that appear during prophase I are ribonucleoproteinaceous in nature; neither DNA nor ribosomal RNA were detected. The presence of U3 snoRNA, as shown by in situ hybridization in nuclear bodies from plant material, is also evidence that these structures are coiled bodies. We suggest that coiled bodies are involved not only in pre- and post-splicing events but also in the storage, transport or recycling of rRNA maturation elements.

CRM1 plays a nuclear role in transporting snoRNPs to nucleoli in higher eukaryotes.

PubMed

Verheggen, Celine; Bertrand, Edouard

2012-03-01

Here, we review the sn- and sno-RNA transport pathways in S. cerevisiae and humans, aiming at understanding how they evolved and how common factors can have distinct functions depending on the RNA they bind. We give a particular emphasis on Tgs1, the cap hypermethylase that is conserved from yeast to humans and appears to play a central role in both sn- and sno-RNA biogenesis. In yeast, Tgs1 hypermethylates sn- and sno-RNAs in the nucleolus. In humans, Tgs1 occurs in two forms: a long isoform (Tgs1 LF), which locates in the cytoplasm and Cajal bodies, which is predominantly associated with snRNAs and a short isoform (Tgs1 SF), which is nuclear and mainly associates with snoRNAs. We show that Tgs1 LF is exported by CRM1 and that interaction with CRM1 competes for binding with the C-terminal domain of the core protein Nop58, which contains the Nucleolar localization signal of Box C/D snoRNPs (NoLS). Our data suggest a model where CRM1 removes Tgs1 LF from snoRNPs, thereby promoting nucleolar targeting via activation of their NoLS. In this review, we argue that CRM1, while first described as an export receptor, can also control the composition of nucleoplasmic complexes. Thus, it could coordinate the fate of these complexes with the general nucleo-cytoplasmic trafficking.

Independent active and thermodynamic processes govern the nucleolus assembly in vivo

PubMed Central

Falahati, Hanieh; Wieschaus, Eric

2017-01-01

Membraneless organelles play a central role in the organization of protoplasm by concentrating macromolecules, which allows efficient cellular processes. Recent studies have shown that, in vitro, certain components in such organelles can assemble through phase separation. Inside the cell, however, such organelles are multicomponent, with numerous intermolecular interactions that can potentially affect the demixing properties of individual components. In addition, the organelles themselves are inherently active, and it is not clear how the active, energy-consuming processes that occur constantly within such organelles affect the phase separation behavior of the constituent macromolecules. Here, we examine the phase separation model for the formation of membraneless organelles in vivo by assessing the two features that collectively distinguish it from active assembly, namely temperature dependence and reversibility. We use a microfluidic device that allows accurate and rapid manipulation of temperature and examine the quantitative dynamics by which six different nucleolar proteins assemble into the nucleoli of Drosophila melanogaster embryos. Our results indicate that, although phase separation is the main mode of recruitment for four of the studied proteins, the assembly of the other two is irreversible and enhanced at higher temperatures, behaviors indicative of active recruitment to the nucleolus. These two subsets of components differ in their requirements for ribosomal DNA; the two actively assembling components fail to assemble in the absence of ribosomal DNA, whereas the thermodynamically driven components assemble but lose temporal and spatial precision. PMID:28115706

Time- and spectrally resolved characteristics of flavin fluorescence in U87MG cancer cells in culture

NASA Astrophysics Data System (ADS)

Horilova, Julia; Cunderlikova, Beata; Marcek Chorvatova, Alzbeta

2015-05-01

Early detection of cancer is crucial for the successful diagnostics of its presence and its subsequent treatment. To improve cancer detection, we tested the progressive multimodal optical imaging of U87MG cells in culture. A combination of steady-state spectroscopic methods with the time-resolved approach provides a new insight into the native metabolism when focused on endogenous tissue fluorescence. In this contribution, we evaluated the metabolic state of living U87MG cancer cells in culture by means of endogenous flavin fluorescence. Confocal microscopy and time-resolved fluorescence imaging were employed to gather spectrally and time-resolved images of the flavin fluorescence. We observed that flavin fluorescence in U87MG cells was predominantly localized outside the cell nucleus in mitochondria, while exhibiting a spectral maximum under 500 nm and fluorescence lifetimes under 1.4 ns, suggesting the presence of bound flavins. In some cells, flavin fluorescence was also detected inside the cell nuclei in the nucleoli, exhibiting longer fluorescence lifetimes and a red-shifted spectral maximum, pointing to the presence of free flavin. Extra-nuclear flavin fluorescence was diminished by 2-deoxyglucose, but failed to increase with 2,4-dinitrophenol, the uncoupler of oxidative phosphorylation, indicating that the cells use glycolysis, rather than oxidative phosphorylation for functioning. These gathered data are the first step toward monitoring the metabolic state of U87MG cancer cells.

Spectroscopic investigation of light-induced intracellular reactions of hydrophilic meso-tetraphenylporphyrins

NASA Astrophysics Data System (ADS)

Rueck, Angelika C.; Strauss, Wolfgang S. L.; Schneckenburger, Herbert; Steiner, Rudolf W.

1992-06-01

Light-induced reactions of different hydrophilic meso-tetraphenyl porphyrins (TPPS4, TPPC4, T4MPyP) were investigated during PDT treatment. These measurements were carried out in vitro using micro-spectrofluorometry and were correlated with measurements in buffer solutions. In the case of the anionic TPPS4, before light exposure, a neutral free base and a protonated species could be detected simultaneously in the cells. During irradiation, the protonated species first disappeared. Due to the fact that a coexistence of a protonated and unprotonated species requires a pH value around 5, TPPS4 was at first located in the lysosomes (pH 5) and was released into the cytoplasm during irradiation as a result of lysosomal rupture. Further light exposure led to a drastic fluorescence formation in the nuclei, in particular the nucleoli of the cells, which was concomitant with a renewed observation of a fluorescence emission spectrum similar to that of the protonated species. In the case of the anionic TPPC4, a similar fluorescence increase was observed during irradiation. However, the formation of a protonated species played a less important role. The cationic T4MPyP again showed fluorescence increase during irradiation. Two Soret-bands separated by about 20 nm could be detected. The red-shifted band may be due to a special intercalation of T4MPyP in nucleic acids.

Proteomic alterations in root tips of Arabidopsis thaliana seedlings under altered gravity conditions

NASA Astrophysics Data System (ADS)

Zheng, H. Q.; Wang, H.

Gravity has a profound influence on plant growth and development Removed the influence of gravitational acceleration by spaceflight caused a wide range of cellular changes in plant Whole seedling that germinated and grown on clinostats showed the absent of gravitropism At the cellular level clinostat treatment has specific effects on plant cells such as induce alterations in cell wall composition increase production of heat-soluble proteins impact on the cellular energy metabolism facilitate a uniform distribution of plastids amyloplasts and increase number and volume of nucleoli A number of recent studies have shown that the exposure of Arabidopsis seedlings and callus cells to gravity stimulation hyper g-forces or clinostat rotation induces alterations in gene expression In our previous study the proteome of the Arabidopsis thaliana callus cells were separated by high resolution two-dimensional electrophoresis 2-DE Image analysis revealed that 80 protein spots showed quantitative and qualitative variations after exposure to clinostat rotation treatment We report here a systematic proteomic approach to investigate the altered gravity responsive proteins in root tip of Arabidopsis thaliana cv Landsberg erecta Three-day-old seedlings were exposed for 12h to a horizontal clinostat rotation H simulated weightlessness altered g-forces by centrifugation 7g hypergravity a vertical clinostat rotation V clinostat control or a stationary control grown conditions Total proteins of roots were extracted

An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

PubMed Central

McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

1997-01-01

An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

Pulmonary Langerhans cell histiocytosis with cervical lymph node involvement, and coexistence with pulmonary tuberculosis and right pneumothorax: a case report and review of literature.

PubMed

Gao, Limin; Li, Huifang; Li, Gandi; Liu, Weiping; Li, Jinnan; Zhang, Wenyan

2015-01-01

We report an uncommon 22-year-old male Pulmonary Langerhans Cell Histiocytosis (PLCH) case which co-existed with pulmonary tuberculosis (TB). Unlike the common PLCH cases, this PLCH case has cervical lymph node involvement and right pneumothorax. The diagnosis was established by the imaging of lung and the biopsies of the lung and left neck lymph node. Imaging of the chest showed characteristic small nodules and thin-walled cysts and right pneumothorax. The LCH cells in the lung and left neck lymph node were characterized by large convoluted nuclei with cerebriform indentations of the nuclear envelope and longitudinal grooves. The nuclei contained small eosinophilic nucleoli and moderate amount cytoplasm. Immunohistochemically, the histiocytoid cells were positive for Langerin, CD1a and S-100. Acid-fast bacilli were found in sputum and lung biopsy tissue. To the best of our knowledge, this is the first case of PLCH with cervical lymph node involvement, and coexisted with pulmonary tuberculosis, right pneumothorax. A contribution of this case and review three of the five cases of PLCH with extrapulmonary involvement to lymph nodes resolved spontaneously after smoking cessation constitute a novel addition that it is inappropriate to regard pulmonary/nodal LCH as multi-organ or disseminated disease, and the treatment methods are the same whether the PLCH patient with lymph node involvement or not.

No differences in calcium-binding protein immunoreactivity in the posterior cingulate and visual cortex: schizophrenia and controls.

PubMed

Wheeler, David G; Dixon, Gavin; Harper, Clive G

2006-06-01

Schizophrenia-specific alterations in the densities of interneurons immunoreactive (ir) to the calcium binding proteins are reported for several cortical regions. However, no reported studies have searched for such differences within the posterior cingulate cortex using antibodies to a specific calcium binding protein, calbindin (Cb). Compare the (a) relative density of Cb-ir neurons (ratio of labeled neurons to total neurons), (b) relative width of cortical layers II/III and (c) somal areas of Cb-ir neurons in people with schizophrenia and non-psychiatric age-, gender- and postmortem index-matched controls (9 per group). Tissue from Brodmann's area (BA) 30 and 23 and an internal control region, the visual cortex (BA 18) were labeled with polyclonal Cb antibodies then Nissl counter-stained. Cb-ir neurons as well as counter-stained neurons with clearly visible nucleoli were plotted and counted within their area 1 and laminar boundaries. No qualitative or statistical differences in the relative density of Cb-ir neurons were observed. A trend towards a significant effect was detected in BA 30, the relative density of Cb-ir neurons for controls was greater than for schizophrenics (P=0.0518). There were no significant differences in the relative cortical widths or somal areas. The data from this study suggest that the posterior cingulate cortex may not be involved in schizophrenia, at least not as far as Cb-ir neurons are concerned.

Automated Segmentation of Nuclei in Breast Cancer Histopathology Images.

PubMed

Paramanandam, Maqlin; O'Byrne, Michael; Ghosh, Bidisha; Mammen, Joy John; Manipadam, Marie Therese; Thamburaj, Robinson; Pakrashi, Vikram

2016-01-01

The process of Nuclei detection in high-grade breast cancer images is quite challenging in the case of image processing techniques due to certain heterogeneous characteristics of cancer nuclei such as enlarged and irregularly shaped nuclei, highly coarse chromatin marginalized to the nuclei periphery and visible nucleoli. Recent reviews state that existing techniques show appreciable segmentation accuracy on breast histopathology images whose nuclei are dispersed and regular in texture and shape; however, typical cancer nuclei are often clustered and have irregular texture and shape properties. This paper proposes a novel segmentation algorithm for detecting individual nuclei from Hematoxylin and Eosin (H&E) stained breast histopathology images. This detection framework estimates a nuclei saliency map using tensor voting followed by boundary extraction of the nuclei on the saliency map using a Loopy Back Propagation (LBP) algorithm on a Markov Random Field (MRF). The method was tested on both whole-slide images and frames of breast cancer histopathology images. Experimental results demonstrate high segmentation performance with efficient precision, recall and dice-coefficient rates, upon testing high-grade breast cancer images containing several thousand nuclei. In addition to the optimal performance on the highly complex images presented in this paper, this method also gave appreciable results in comparison with two recently published methods-Wienert et al. (2012) and Veta et al. (2013), which were tested using their own datasets.

Automated Segmentation of Nuclei in Breast Cancer Histopathology Images

PubMed Central

Paramanandam, Maqlin; O’Byrne, Michael; Ghosh, Bidisha; Mammen, Joy John; Manipadam, Marie Therese; Thamburaj, Robinson; Pakrashi, Vikram

2016-01-01

The process of Nuclei detection in high-grade breast cancer images is quite challenging in the case of image processing techniques due to certain heterogeneous characteristics of cancer nuclei such as enlarged and irregularly shaped nuclei, highly coarse chromatin marginalized to the nuclei periphery and visible nucleoli. Recent reviews state that existing techniques show appreciable segmentation accuracy on breast histopathology images whose nuclei are dispersed and regular in texture and shape; however, typical cancer nuclei are often clustered and have irregular texture and shape properties. This paper proposes a novel segmentation algorithm for detecting individual nuclei from Hematoxylin and Eosin (H&E) stained breast histopathology images. This detection framework estimates a nuclei saliency map using tensor voting followed by boundary extraction of the nuclei on the saliency map using a Loopy Back Propagation (LBP) algorithm on a Markov Random Field (MRF). The method was tested on both whole-slide images and frames of breast cancer histopathology images. Experimental results demonstrate high segmentation performance with efficient precision, recall and dice-coefficient rates, upon testing high-grade breast cancer images containing several thousand nuclei. In addition to the optimal performance on the highly complex images presented in this paper, this method also gave appreciable results in comparison with two recently published methods—Wienert et al. (2012) and Veta et al. (2013), which were tested using their own datasets. PMID:27649496

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Transcriptional analysis of nucleolar dominance in polyploid plants: Biased expression/silencing of progenitor rRNA genes is developmentally regulated in Brassica

PubMed Central

Chen, Z. Jeffrey; Pikaard, Craig S.

1997-01-01

Nucleolar dominance is an epigenetic phenomenon that describes the formation of nucleoli around rRNA genes inherited from only one parent in the progeny of an interspecific hybrid. Despite numerous cytogenetic studies, little is known about nucleolar dominance at the level of rRNA gene expression in plants. We used S1 nuclease protection and primer extension assays to define nucleolar dominance at a molecular level in the plant genus Brassica. rRNA transcription start sites were mapped in three diploids and in three allotetraploids (amphidiploids) and one allohexaploid species derived from these diploid progenitors. rRNA transcripts of only one progenitor were detected in vegetative tissues of each polyploid. Dominance was independent of maternal effect, ploidy, or rRNA gene dosage. Natural and newly synthesized amphidiploids yielded the same results, arguing against substantial evolutionary effects. The hypothesis that nucleolar dominance in plants is correlated with physical characteristics of rRNA gene intergenic spacers is not supported in Brassica. Furthermore, in Brassica napus, rRNA genes silenced in vegetative tissues were found to be expressed in all floral organs, including sepals and petals, arguing against the hypothesis that passage through meiosis is needed to reactivate suppressed genes. Instead, the transition of inflorescence to floral meristem appears to be a developmental stage when silenced genes can be derepressed. PMID:9096413

Cell and brain tissue imaging of the flavonoid fisetin using label-free two-photon microscopy.

PubMed

Krasieva, Tatiana B; Ehren, Jennifer; O'Sullivan, Thomas; Tromberg, Bruce J; Maher, Pamela

2015-10-01

Over the last few years, we have identified an orally active, novel neuroprotective and cognition-enhancing molecule, the flavonoid fisetin. Fisetin not only has direct antioxidant activity but it can also increase the intracellular levels of glutathione, the major intracellular antioxidant. Fisetin can also activate key neurotrophic factor signaling pathways. In addition, it has anti-inflammatory activity against microglia and astrocytes and inhibits the activity of lipoxygenases, thereby reducing the production of pro-inflammatory eicosanoids and their by-products. However, key questions about its targets and brain penetration remain. In this study, we used label-free two-photon microscopy of intrinsic fisetin fluorescence to examine the localization of fisetin in living nerve cells and the brains of living mice. In cells, fisetin but not structurally related flavonols with different numbers of hydroxyl groups, localized to the nucleoli suggesting that key targets of fisetin may reside in this organelle. In the mouse brain, following intraperitoneal injection and oral administration, fisetin rapidly distributed to the blood vessels of the brain followed by a slower dispersion into the brain parenchyma. Thus, these results provide further support for the effects of fisetin on brain function. In addition, they suggest that label-free two-photon microscopy may prove useful for studying the intracellular and tissue distribution of other intrinsically-fluorescent flavonoids. Copyright © 2015 Elsevier Ltd. All rights reserved.

Role of biliary tract cytology in the evaluation of extrahepatic cholestatic jaundice

PubMed Central

Gupta, Mamta; Pai, Radha R.; Dileep, Devi; Gopal, Sandeep; Shenoy, Suresh

2013-01-01

Background: Endoscopic evaluation is critical in assessing the cause of obstructive jaundice. Cytological techniques including bile aspiration and biliary brushings have become the initial diagnostic modality. Aim: The aim of this study is to evaluate the role of endoscopic biliary tract cytology as a diagnostic tool in the evaluation of extrahepatic cholestatic jaundice. Materials and Methods: A total of 56 biliary tract specimens including 34 bile aspirations and 22 biliary brushings from 41 consecutive patients who had presented with obstructive jaundice and underwent endoscopic retrograde cholangiopancreatography (ERCP) were assessed by cytological examination. The smears prepared were analyzed for standard cytological features. Results: Cytologic diagnosis was adenocarcinoma in 13 (31.7%) cases, atypical in 2 (4.9%), reactive in 3 (7.3%) and benign changes in 19 (46.3%) cases. 4 (9.8%) cases were non-diagnostic. Serum bilirubin was significantly elevated in the malignant group. Biliary stricture was the most common finding on ERCP (68.3%). On cytological examination, presence of solitary, intact atypical cells, enlarged nuclei, irregular nuclear membrane, coarse chromatin and nucleoli were important cytologic criteria for differentiating malignant from benign biliary specimens. Conclusions: Regular use of bile cytology and brushings during ERCP evaluation of extrahepatic cholestatic jaundice is invaluable in obtaining a morphologic diagnosis. A systematic approach, use of strict cytomorphologic criteria and inclusion of significant atypia as malignant diagnosis may improve the sensitivity. PMID:24130407

Synergistic antitumor cytotoxic actions of ascorbate and menadione on human prostate (DU145) cancer cells in vitro: nucleus and other injuries preceding cell death by autoschizis.

PubMed

Gilloteaux, Jacques; Jamison, James M; Neal, Deborah; Summers, Jack L

2014-04-01

Scanning (SEM) and transmission electron microscopy (TEM) were used to characterize the cytotoxic effects of ascorbate (VC), menadione (VK3), or a VC:VK3 combination on a human prostate carcinoma cell line (DU145) following a 1-h vitamin treatment and a subsequent 24-h incubation in culture medium. Cell alterations examined by light and electron microscopy were treatment-dependent with VC + VK3 >VK3 > VC > Sham. Oxidative stress-induced damage was found in most organelles. This report describes injuries in the tumor cell nucleus (chromatin and nucleolus), mitochondria, endomembranes, lysosomal bodies (autophagocytoses) and inclusions. Morphologic alterations suggest that cytoskeleton damage is likely responsible for the superficial cytoplasmic changes, including major changes in cell shape and size and the self-excising phenomena. Unlike apoptotic bodies, the excised pieces contain ribonucleoproteins, but not organelles. These deleterious events cause a progressive, significant reduction in the tumor cell size. During nuclear alterations, the nuclei maintain their envelope during chromatolysis and karyolysis until cell death, while nucleoli undergo a characteristic segregation of their components. In addition, changes in fat and glycogen storage are consistent the cytotoxic and metabolic alterations caused by the respective treatments. All cellular ultrastructural changes are consistent with cell death by autoschizis and not apoptosis or other kinds of cell death.

Malignant melanoma with a rhabdoid phenotype: histologic, immunohistochemical, and ultrastructural study of a case and review of the literature.

PubMed

Abbott, Jared J; Amirkhan, Robin H; Hoang, Mai P

2004-06-01

Malignant melanoma is known to display tremendous histologic diversity. One rare variant is the rhabdoid phenotype, so called because of the appearance of cells resembling rhabdomyoblasts seen in malignant rhabdoid tumors of the kidney. We present the histologic, immunohistochemical, and ultrastructural features of a malignant melanoma composed entirely of rhabdoid cells. A 62-year-old man presented with a 6.5-cm lung mass. Although presumed to be a metastatic lesion, extensive workup failed to reveal a primary tumor site. Histologic sections showed a mass composed entirely of polygonal neoplastic cells with prominent nucleoli and large hyaline cytoplasmic inclusions. The tumor cells were strongly immunoreactive with S100 protein, vimentin, and CD56, and were focally reactive with Mart-1. Tumor cells were negative for Melan-A, tyrosinase, HMB-45, AE1/AE3, cytokeratin (CK) 7, CK8/ 18, CK20, CK903, CAM 5.2, epithelial membrane antigen, smooth muscle actin, desmin, leukocyte common antigen, Bcl-2, CD3, CD20, CD30, CD138, kappa and lambda light chains, CD68, CD34, factor VIII, synaptophysin, and glial fibrillary acidic protein. Electron microscopy showed cytoplasmic whorls of intermediate filaments containing entrapped rough endoplasmic reticulum, mitochondria, and lipid. Recognition of this rare variant of malignant melanoma is important in the evaluation of tumors with rhabdoid morphology.

Anti-amyloid compounds protect from silica nanoparticle-induced neurotoxicity in the nematode C. elegans

PubMed Central

Scharf, Andrea; Gührs, Karl-Heinz; von Mikecz, Anna

2016-01-01

Abstract Identifying nanomaterial-bio-interactions are imperative due to the broad introduction of nanoparticle (NP) applications and their distribution. Here, we demonstrate that silica NPs effect widespread protein aggregation in the soil nematode Caenorhabditis elegans ranging from induction of amyloid in nucleoli of intestinal cells to facilitation of protein aggregation in body wall muscles and axons of neural cells. Proteomic screening revealed that exposure of adult C. elegans with silica NPs promotes segregation of proteins belonging to the gene ontology (GO) group of “protein folding, proteolysis and stress response” to an SDS-resistant aggregome network. Candidate proteins in this group include chaperones, heat shock proteins and subunits of the 26S proteasome which are all decisively involved in protein homeostasis. The pathway of protein homeostasis was validated as a major target of silica NPs by behavioral phenotyping, as inhibitors of amyloid formation rescued NP-induced defects of locomotory patterns and egg laying. The analysis of a reporter worm for serotonergic neural cells revealed that silica NP-induced protein aggregation likewise occurs in axons of HSN neurons, where presynaptic accumulation of serotonin, e.g. disturbed axonal transport reduces the capacity for neurotransmission and egg laying. The results suggest that in C. elegans silica NPs promote a cascade of events including disturbance of protein homeostasis, widespread protein aggregation and inhibition of serotonergic neurotransmission which can be interrupted by compounds preventing amyloid fibrillation. PMID:26444998

Pyrene-nucleobase conjugates: synthesis, oligonucleotide binding and confocal bioimaging studies.

PubMed

Jabłoński, Artur; Fritz, Yannic; Wagenknecht, Hans-Achim; Czerwieniec, Rafał; Bernaś, Tytus; Trzybiński, Damian; Woźniak, Krzysztof; Kowalski, Konrad

2017-01-01

Fluorescent pyrene-linker-nucleobase (nucleobase = thymine, adenine) conjugates with carbonyl and hydroxy functionalities in the linker were synthesized and characterized. X-ray single-crystal structure analysis performed for the pyrene-C(O)CH 2 CH 2 -thymine ( 2 ) conjugate reveals dimers of molecules 2 stabilized by hydrogen bonds between the thymine moieties. The photochemical characterization showed structure-dependent fluorescence properties of the investigated compounds. The conjugates bearing a carbonyl function represent weak emitters as compared to compounds with a hydroxy function in the linker. The self-assembly properties of pyrene nucleobases were investigated in respect to their binding to single and double strand oligonucleotides in water and in buffer solution. In respect to the complementary oligothymidine T 10 template in water, compounds 3 and 5 both show a self-assembling behavior according to canonical base-base pairing. However, in buffer solution, derivative 5 was much more effective than 3 in binding to the T 10 template. Furthermore the adenine derivative 5 binds to the double-stranded (dA) 10 -T 10 template with a self-assembly ratio of 112%. Such a high value of a self-assembly ratio can be rationalized by a triple-helix-like binding, intercalation, or a mixture of both. Remarkably, compound 5 also shows dual staining pattern in living HeLa cells. Confocal microscopy confirmed that 5 predominantly stains mitochondria but it also accumulates in the nucleoli of the cells.

A nuclear F-actin scaffold stabilizes ribonucleoprotein droplets against gravity in large cells.

PubMed

Feric, Marina; Brangwynne, Clifford P

2013-10-01

The size of a typical eukaryotic cell is of the order of ∼10 μm. However, some cell types grow to very large sizes, including oocytes (immature eggs) of organisms from humans to starfish. For example, oocytes of the frog Xenopus laevis grow to a diameter ≥1 mm. They have a correspondingly large nucleus (germinal vesicle) of ∼450 μm in diameter, which is similar to smaller somatic nuclei, but contains a significantly higher concentration of actin. The form and structure of this nuclear actin remain controversial, and its potential mechanical role within these large nuclei is unknown. Here, we use a microrheology and quantitative imaging approach to show that germinal vesicles contain an elastic F-actin scaffold that mechanically stabilizes these large nuclei against gravitational forces, which are usually considered negligible within cells. We find that on actin disruption, ribonucleoprotein droplets, including nucleoli and histone locus bodies, undergo gravitational sedimentation and fusion. We develop a model that reveals how gravity becomes an increasingly potent force as cells and their nuclei grow larger than ∼10 μm, explaining the requirement for a stabilizing nuclear F-actin scaffold in large Xenopus oocytes. All life forms are subject to gravity, and our results may have broad implications for cell growth and size control.

Clinicopathological findings of primary esophageal malignant melanoma: report of six cases and review of literature.

PubMed

Zheng, Jinfeng; Mo, Haiying; Ma, Shufang; Wang, Zhenzheng

2014-01-01

We studied images and histopathological features of primary esophageal malignant melanoma to explore the clinical pathological features, diagnosis, differential diagnoses, and treatment. Immunolabelling was conducted on six cases of esophageal malignant melanoma using histological and immunohistochemical techniques. Combined with the related literature, the clinical manifestations, imaging, histopathological and immunohistochemical features, treatment, and prognosis of primary esophageal malignant melanoma were observed and analyzed. The six patients with primary esophageal malignant melanoma were all male with an average age of 63.4 years. Poor food intake was observed in all patients, and the symptoms showed progressive aggravation. Endoscopic feed tube revealed dark brown and black nodular and polypoid lesions, 1/4-1/2 loop cavity. Tumor histopathology revealed the following characteristics: tumor cells arranged in nests, sheets and cords, round or polygonal, abundant and red-stained cytoplasm, melanin granules in the cytoplasm, heterogeneous nucleus sizes, centered or deviated nuclei, clearly identifiable nucleoli, and apparent pathological mitosis. The immune phenotype was as follows: tumor cells had diffuse expression of HMB45, Melan A, and S100. The cells were CK negative, and the Ki67-positive cell number was 40%-45%. Primary esophageal malignant melanoma is rare with high malignancy and poor prognosis. Immunohistochemical staining is helpful for diagnosing this tumor. The differential diagnosis includes low differentiated carcinoma, primitive neuroectodermal tumor, esophageal sarcomatoid carcinoma, esophageal lymphoma, and other tumors.

Morphology of the Epidermis of the Neotropical Catfish Pimelodella lateristriga (Lichtenstein, 1823) with Emphasis in Club Cells

PubMed Central

Damasceno, Eduardo Medeiros; Monteiro, Juliana Castro; Duboc, Luiz Fernando; Dolder, Heidi; Mancini, Karina

2012-01-01

The epidermis of Ostariophysi fish is composed of 4 main cell types: epidermal cells (or filament containing cells), mucous cells, granular cells and club cells. The morphological analysis of the epidermis of the catfish Pimelodella lateristriga revealed the presence of only two types of cells: epidermal and club cells. The latter were evident in the middle layer of the epidermis, being the largest cells within the epithelium. Few organelles were located in the perinuclear region, while the rest of the cytoplasm was filled with a non-vesicular fibrillar substance. Club cells contained two irregular nuclei with evident nucleoli and high compacted peripheral chromatin. Histochemical analysis detected prevalence of protein within the cytoplasm other than carbohydrates, which were absent. These characteristics are similar to those described to most Ostariophysi studied so far. On the other hand, the epidermal cells differ from what is found in the literature. The present study described three distinct types, as follows: superficial, abundant and dense cells. Differences among them were restricted to their cytoplasm and nucleus morphology. Mucous cells were found in all Ostariophysi studied so far, although they were absent in P. lateristriga, along with granular cells, also typical of other catfish epidermis. The preset study corroborates the observations on club cells' morphology in Siluriformes specimens, and shows important differences in epidermis composition and cell structure of P. lateristriga regarding the literature data. PMID:23226253

Arabidopsis ASYMMETRIC LEAVES2 protein required for leaf morphogenesis consistently forms speckles during mitosis of tobacco BY-2 cells via signals in its specific sequence.

PubMed

Luo, Lilan; Ando, Sayuri; Sasabe, Michiko; Machida, Chiyoko; Kurihara, Daisuke; Higashiyama, Tetsuya; Machida, Yasunori

2012-09-01

Leaf primordia with high division and developmental competencies are generated around the periphery of stem cells at the shoot apex. Arabidopsis ASYMMETRIC-LEAVES2 (AS2) protein plays a key role in the regulation of many genes responsible for flat symmetric leaf formation. The AS2 gene, expressed in leaf primordia, encodes a plant-specific nuclear protein containing an AS2/LOB domain with cysteine repeats (C-motif). AS2 proteins are present in speckles in and around the nucleoli, and in the nucleoplasm of some leaf epidermal cells. We used the tobacco cultured cell line BY-2 expressing the AS2-fused yellow fluorescent protein to examine subnuclear localization of AS2 in dividing cells. AS2 mainly localized to speckles (designated AS2 bodies) in cells undergoing mitosis and distributed in a pairwise manner during the separation of sets of daughter chromosomes. Few interphase cells contained AS2 bodies. Deletion analyses showed that a short stretch of the AS2 amino-terminal sequence and the C-motif play negative and positive roles, respectively, in localizing AS2 to the bodies. These results suggest that AS2 bodies function to properly distribute AS2 to daughter cells during cell division in leaf primordia; and this process is controlled at least partially by signals encoded by the AS2 sequence itself.

Dynamics and three-dimensional localization of ribosomal RNA within the nucleolus.

PubMed Central

Thiry, M; Cheutin, T; O'Donohue, M F; Kaplan, H; Ploton, D

2000-01-01

Although rRNA synthesis, maturation, and assembly into preribosomal particles occur within the nucleolus, the route taken by pre-rRNAs from their synthetic sites toward the cytoplasm remains largely unexplored. Here, we employed a nondestructive method for the incorporation of BrUTP into the RNA of living cells. By using pulse-chase experiments, three-dimensional image reconstructions of confocal optical sections, and electron microscopy analysis of ultrathin sections, we were able to describe topological and spatial dynamics of rRNAs within the nucleolus. We identified the precise location and the volumic organization of four typical subdomains, in which rRNAs are successively moving towards the nucleolar periphery during their synthesis and processing steps. The incorporation of BrUTP takes place simultaneously within several tiny spheres, centered on the fibrillar centers. Then, the structures containing the newly synthesized RNAs enlarge and appear as compact ringlets disposed around the fibrillar centers. Later, they form hollow spheres surrounding the latter components and begin to fuse together. Finally, these structures widen and form large rings reaching the limits of the nucleoli. These results clearly show that the transport of pre-rRNAs within the nucleolus does not occur randomly, but appears as a radial flow starting from the fibrillar centers that form concentric rings, which finally fuse together as they progress toward the nucleolar periphery. PMID:11142375

Unsuccessful derivation of human embryonic stem cell lines from pairs of human blastomeres.

PubMed

Fong, Chui-Yee; Richards, Mark; Bongso, Ariff

2006-08-01

Human embryonic stem cells (hESC) that differentiate into all three primordial germ layers have been established. Differentiation of these cells into desirable lineages offers hope for future transplantation therapies. Currently, hESC lines are derived from the inner cell mass (ICM) of blastocysts, leading to destruction of the embryo, and thus the process is ethically controversial. Successful attempts at deriving hESC lines from blastomeres without destruction of the ensuing embryo have not been reported. One or two blastomeres are routinely biopsied from 8-cell embryos for preimplantation genetic diagnosis. In this study it was therefore attempted to derive hESC lines from paired blastomeres. Of 66 pairs of 8-cell stage blastomeres, four pairs produced two morula and two blastocyst-like structures. When plated on mitomycin-C-treated mouse embryonic fibroblasts, one morula and one blastocyst-like structure separately produced small colonies containing hESC-like cells with prominent nucleoli and high nuclear-cytoplasmic ratios. When these colonies were detached and plated onto fresh feeders, there was no further colony formation or ensuing hESC lines. The results showed that it might not be possible to derive hESC lines directly from paired blastomeres. A minimum number of blastomeres in close contact with one another may be required to successfully generate an hESC line as blastomeres, like ICM and hESC cells, may be 'social' cells.

A nuclear F-actin scaffold stabilizes RNP droplets against gravity in large cells

PubMed Central

Feric, Marina; Brangwynne, Clifford P.

2013-01-01

The size of a typical eukaryotic cell is on the order of ≈10 μm. However, some cell types grow to very large sizes, including oocytes (immature eggs) of organisms from humans to starfish. For example, oocytes of the frog X. laevis grow to a diameter ≥1 mm. They contain a correspondingly large nucleus (germinal vesicle, GV) of ≈450 μm in diameter, which is similar to smaller somatic nuclei, but contains a significantly higher concentration of actin. The form and structure of this nuclear actin remain controversial, and its potential mechanical role within these large nuclei is unknown. Here, we use a microrheology and quantitative imaging approach to show that GVs contain an elastic F-actin scaffold that mechanically stabilizes these large nuclei against gravitational forces, which are usually considered negligible within cells. We find that upon actin disruption, RNA/protein droplets, including nucleoli and histone locus bodies (HLBs), undergo gravitational sedimentation and fusion. We develop a model that reveals how gravity becomes an increasingly potent force as cells and their nuclei grow larger than ≈10 μm, explaining the requirement for a stabilizing nuclear F-actin scaffold in large X. laevis ooctyes. All life forms are subject to gravity, and our results may have broad implications for cell growth and size control. PMID:23995731

Inverse size scaling of the nucleolus by a concentration-dependent phase transition.

PubMed

Weber, Stephanie C; Brangwynne, Clifford P

2015-03-02

Just as organ size typically increases with body size, the size of intracellular structures changes as cells grow and divide. Indeed, many organelles, such as the nucleus [1, 2], mitochondria [3], mitotic spindle [4, 5], and centrosome [6], exhibit size scaling, a phenomenon in which organelle size depends linearly on cell size. However, the mechanisms of organelle size scaling remain unclear. Here, we show that the size of the nucleolus, a membraneless organelle important for cell-size homeostasis [7], is coupled to cell size by an intracellular phase transition. We find that nucleolar size directly scales with cell size in early C. elegans embryos. Surprisingly, however, when embryo size is altered, we observe inverse scaling: nucleolar size increases in small cells and decreases in large cells. We demonstrate that this seemingly contradictory result arises from maternal loading of a fixed number rather than a fixed concentration of nucleolar components, which condense into nucleoli only above a threshold concentration. Our results suggest that the physics of phase transitions can dictate whether an organelle assembles, and, if so, its size, providing a mechanistic link between organelle assembly and cell size. Since the nucleolus is known to play a key role in cell growth, this biophysical readout of cell size could provide a novel feedback mechanism for growth control. Copyright © 2015 Elsevier Ltd. All rights reserved.

Nucleolus association of chromosomal domains is largely maintained in cellular senescence despite massive nuclear reorganisation.

PubMed

Dillinger, Stefan; Straub, Tobias; Németh, Attila

2017-01-01

Mammalian chromosomes are organized in structural and functional domains of 0.1-10 Mb, which are characterized by high self-association frequencies in the nuclear space and different contact probabilities with nuclear sub-compartments. They exhibit distinct chromatin modification patterns, gene expression levels and replication timing. Recently, nucleolus-associated chromosomal domains (NADs) have been discovered, yet their precise genomic organization and dynamics are still largely unknown. Here, we use nucleolus genomics and single-cell experiments to address these questions in human embryonic fibroblasts during replicative senescence. Genome-wide mapping reveals 1,646 NADs in proliferating cells, which cover about 38% of the annotated human genome. They are mainly heterochromatic and correlate with late replicating loci. Using Hi-C data analysis, we show that interactions of NADs dominate interphase chromosome contacts in the 10-50 Mb distance range. Interestingly, only minute changes in nucleolar association are observed upon senescence. These spatial rearrangements in subdomains smaller than 100 kb are accompanied with local transcriptional changes. In contrast, large centromeric and pericentromeric satellite repeat clusters extensively dissociate from nucleoli in senescent cells. Accordingly, H3K9me3-marked heterochromatin gets remodelled at the perinucleolar space as revealed by immunofluorescence analyses. Collectively, this study identifies connections between the nucleolus, 3D genome structure, and cellular aging at the level of interphase chromosome organization.

Nucleolus association of chromosomal domains is largely maintained in cellular senescence despite massive nuclear reorganisation

PubMed Central

Dillinger, Stefan

2017-01-01

Mammalian chromosomes are organized in structural and functional domains of 0.1–10 Mb, which are characterized by high self-association frequencies in the nuclear space and different contact probabilities with nuclear sub-compartments. They exhibit distinct chromatin modification patterns, gene expression levels and replication timing. Recently, nucleolus-associated chromosomal domains (NADs) have been discovered, yet their precise genomic organization and dynamics are still largely unknown. Here, we use nucleolus genomics and single-cell experiments to address these questions in human embryonic fibroblasts during replicative senescence. Genome-wide mapping reveals 1,646 NADs in proliferating cells, which cover about 38% of the annotated human genome. They are mainly heterochromatic and correlate with late replicating loci. Using Hi-C data analysis, we show that interactions of NADs dominate interphase chromosome contacts in the 10–50 Mb distance range. Interestingly, only minute changes in nucleolar association are observed upon senescence. These spatial rearrangements in subdomains smaller than 100 kb are accompanied with local transcriptional changes. In contrast, large centromeric and pericentromeric satellite repeat clusters extensively dissociate from nucleoli in senescent cells. Accordingly, H3K9me3-marked heterochromatin gets remodelled at the perinucleolar space as revealed by immunofluorescence analyses. Collectively, this study identifies connections between the nucleolus, 3D genome structure, and cellular aging at the level of interphase chromosome organization. PMID:28575119

Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

PubMed

Stępiński, Dariusz

2016-08-01

Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

APOε2 and education in cognitively normal older subjects with high levels of AD pathology at autopsy: findings from the Nun Study.

PubMed

Iacono, Diego; Zandi, Peter; Gross, Myron; Markesbery, William R; Pletnikova, Olga; Rudow, Gay; Troncoso, Juan C

2015-06-10

Asymptomatic Alzheimer's disease (ASYMAD) subjects are individuals characterized by preserved cognition before death despite substantial AD pathology at autopsy. ASYMAD subjects show comparable levels of AD pathology, i.e. β-amyloid neuritic plaques (Aβ-NP) and tau-neurofibrillary tangles (NFT), to those observed in mild cognitive impairment (MCI) and some definite AD cases. Previous clinicopathologic studies on ASYMAD subjects have shown specific phenomena of hypertrophy in the cell bodies, nuclei, and nucleoli of hippocampal pyramidal neurons and other cerebral areas. Since it is well established that the allele APOε4 is a major genetic risk factor for AD, we examined whether specific alleles of APOE could be associated with the different clinical outcomes between ASYMAD and MCI subjects despite equivalent AD pathology. A total of 523 brains from the Nun Study were screened for this investigation. The results showed higher APOε2 frequency (p < 0.001) in ASYMAD (19.2%) vs. MCI (0%) and vs. AD (4.7%). Furthermore, higher education in ASYMAD vs. MCI and AD (p < 0.05) was found. These novel autopsy-verified findings support the hypothesis of the beneficial effect of APOε2 and education, both which seem to act as contributing factors in delaying or forestalling the clinical manifestations of AD despite consistent levels of AD pathology.

APOε2 and education in cognitively normal older subjects with high levels of AD pathology at autopsy: findings from the Nun Study

PubMed Central

Iacono, Diego; Zandi, Peter; Gross, Myron; Markesbery, William R.; Pletnikova, Olga; Rudow, Gay; Troncoso, Juan C.

2015-01-01

Asymptomatic Alzheimer's disease (ASYMAD) subjects are individuals characterized by preserved cognition before death despite substantial AD pathology at autopsy. ASYMAD subjects show comparable levels of AD pathology, i.e. β-amyloid neuritic plaques (Aβ-NP) and tau-neurofibrillary tangles (NFT), to those observed in mild cognitive impairment (MCI) and some definite AD cases. Previous clinicopathologic studies on ASYMAD subjects have shown specific phenomena of hypertrophy in the cell bodies, nuclei, and nucleoli of hippocampal pyramidal neurons and other cerebral areas. Since it is well established that the allele APOε4 is a major genetic risk factor for AD, we examined whether specific alleles of APOE could be associated with the different clinical outcomes between ASYMAD and MCI subjects despite equivalent AD pathology. A total of 523 brains from the Nun Study were screened for this investigation. The results showed higher APOε2 frequency (p < 0.001) in ASYMAD (19.2%) vs. MCI (0%) and vs. AD (4.7%). Furthermore, higher education in ASYMAD vs. MCI and AD (p < 0.05) was found. These novel autopsy-verified findings support the hypothesis of the beneficial effect of APOε2 and education, both which seem to act as contributing factors in delaying or forestalling the clinical manifestations of AD despite consistent levels of AD pathology. PMID:26101858

Morphological Analysis of Human Induced Pluripotent Stem Cells During Induced Differentiation and Reverse Programming

PubMed Central

Magniez, Aurélie; Oudrhiri, Noufissa; Féraud, Olivier; Bacci, Josette; Gobbo, Emilie; Proust, Stéphanie; Turhan, Ali G.

2014-01-01

Abstract The fine analysis of cell components during the generation of pluripotent cells and their comparison to bone fide human embryonic stem cells (hESCs) are valuable tools to understand their biological behavior. In this report, human mesenchymal cells (hMSCs) generated from the human ES cell line H9, were reprogrammed back to induced pluripotent state using Oct-4, Sox2, Nanog, and Lin28 transgenes. Human induced pluripotent stem cells (hIPSCs) were analyzed using electron microscopy and compared with regard to the original hESCs and the hMSCs from which they were derived. This analysis shows that hIPSCs and the original hESCs are morphologically undistinguishable but differ from the hMSCs with respect to the presence of several morphological features of undifferentiated cells at both the cytoplasmic (ribosomes, lipid droplets, glycogen, scarce reticulum) and nuclear levels (features of nuclear plasticity, presence of euchromatin, reticulated nucleoli). We show that hIPSC colonies generated this way presented epithelial aspects with specialized junctions highlighting morphological criteria of the mesenchymal–epithelial transition in cells engaged in a successful reprogramming process. Electron microscopic analysis revealed also specific morphological aspects of partially reprogrammed cells. These results highlight the valuable use of electron microscopy for a better knowledge of the morphological aspects of IPSC and cellular reprogramming. PMID:25371857

Nucleolin is a nuclear target of heparan sulfate derived from glypican-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Fang; Belting, Mattias; Fransson, Lars-Åke

The recycling, S-nitrosylated heparan sulfate (HS) proteoglycan glypican-1 releases anhydromannose (anMan)-containing HS chains by a nitrosothiol-catalyzed cleavage in endosomes that can be constitutive or induced by ascorbate. The HS-anMan chains are then transported to the nucleus. A specific nuclear target for HS-anMan has not been identified. We have monitored endosome-to-nucleus trafficking of HS-anMan by deconvolution and confocal immunofluorescence microscopy using an anMan-specific monoclonal antibody in non-growing, ascorbate-treated, and growing, untreated, wild-type mouse embryonic fibroblasts and hypoxia-exposed Alzheimer mouse Tg2576 fibroblasts and human U87 glioblastoma cells. In all cells, nuclear HS-anMan targeted a limited number of sites of variable size wheremore » it colocalized with DNA and nucleolin, an established marker for nucleoli. HS-anMan also colocalized with ethynyl uridine-tagged nascent RNA and two acetylated forms of histone H3. Acute hypoxia increased the formation of HS-anMan in both Tg2576 and U87 cells. A portion of HS-anMan colocalized with nucleolin at small discrete sites, while most of the nucleolin and nascent RNA was dispersed. In U87 cells, HS-anMan, nucleolin and nascent RNA reassembled after prolonged hypoxia. Nucleolar HS may modulate synthesis and/or release of rRNA.« less

Myc-induced anchorage of the rDNA IGS region to nucleolar matrix modulates growth-stimulated changes in higher-order rDNA architecture

PubMed Central

Shiue, Chiou-Nan; Nematollahi-Mahani, Amir; Wright, Anthony P.H.

2014-01-01

Chromatin domain organization and the compartmentalized distribution of chromosomal regions are essential for packaging of deoxyribonucleic acid (DNA) in the eukaryotic nucleus as well as regulated gene expression. Nucleoli are the most prominent morphological structures of cell nuclei and nucleolar organization is coupled to cell growth. It has been shown that nuclear scaffold/matrix attachment regions often define the base of looped chromosomal domains in vivo and that they are thereby critical for correct chromosome architecture and gene expression. Here, we show regulated organization of mammalian ribosomal ribonucleic acid genes into distinct chromatin loops by tethering to nucleolar matrix via the non-transcribed inter-genic spacer region of the ribosomal DNA (rDNA). The rDNA gene loop structures are induced specifically upon growth stimulation and are dependent on the activity of the c-Myc protein. Matrix-attached rDNA genes are hypomethylated at the promoter and are thus available for transcriptional activation. rDNA genes silenced by methylation are not recruited to the matrix. c-Myc, which has been shown to induce rDNA transcription directly, is physically associated with rDNA gene looping structures and the intergenic spacer sequence in growing cells. Such a role of Myc proteins in gene activation has not been reported previously. PMID:24609384

Myc-induced anchorage of the rDNA IGS region to nucleolar matrix modulates growth-stimulated changes in higher-order rDNA architecture.

PubMed

Shiue, Chiou-Nan; Nematollahi-Mahani, Amir; Wright, Anthony P H

2014-05-01

Chromatin domain organization and the compartmentalized distribution of chromosomal regions are essential for packaging of deoxyribonucleic acid (DNA) in the eukaryotic nucleus as well as regulated gene expression. Nucleoli are the most prominent morphological structures of cell nuclei and nucleolar organization is coupled to cell growth. It has been shown that nuclear scaffold/matrix attachment regions often define the base of looped chromosomal domains in vivo and that they are thereby critical for correct chromosome architecture and gene expression. Here, we show regulated organization of mammalian ribosomal ribonucleic acid genes into distinct chromatin loops by tethering to nucleolar matrix via the non-transcribed inter-genic spacer region of the ribosomal DNA (rDNA). The rDNA gene loop structures are induced specifically upon growth stimulation and are dependent on the activity of the c-Myc protein. Matrix-attached rDNA genes are hypomethylated at the promoter and are thus available for transcriptional activation. rDNA genes silenced by methylation are not recruited to the matrix. c-Myc, which has been shown to induce rDNA transcription directly, is physically associated with rDNA gene looping structures and the intergenic spacer sequence in growing cells. Such a role of Myc proteins in gene activation has not been reported previously. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

Analyzing Intracellular Binding and Diffusion with Continuous Fluorescence Photobleaching

PubMed Central

Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W.; Knoch, Tobias A.; Waldeck, Waldemar; Langowski, Jörg

2003-01-01

Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of ∼13 s. PMID:12719264

Analyzing intracellular binding and diffusion with continuous fluorescence photobleaching.

PubMed

Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W; Knoch, Tobias A; Waldeck, Waldemar; Langowski, Jörg

2003-05-01

Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of approximately 13 s.

Cell and Brain Tissue Imaging of the Flavonoid Fisetin Using Label-Free Two-Photon Microscopy

PubMed Central

Krasieva, Tatiana B.; Ehren, Jennifer; O’Sullivan, Thomas; Tromberg, Bruce J.; Maher, Pamela

2015-01-01

Over the last few years, we have identified an orally active, novel neuroprotective and cognition-enhancing molecule, the flavonoid fisetin. Fisetin not only has direct antioxidant activity but it can also increase the intracellular levels of glutathione, the major intracellular antioxidant. Fisetin can also activate key neurotrophic factor signaling pathways. In addition, it has anti-inflammatory activity against microglia and astrocytes and inhibits the activity of lipoxygenases, thereby reducing the production of pro-inflammatory eicosanoids and their byproducts. However, key questions about its targets and brain penetration remain. In this study, we used label-free two-photon microscopy of intrinsic fisetin fluorescence to examine the localization of fisetin in living nerve cells and the brains of living mice. In cells, fisetin but not structurally related flavonols with different numbers of hydroxyl groups, localized to the nucleoli suggesting that key targets of fisetin may reside in this organelle. In the mouse brain, following intraperitoneal injection and oral administration, fisetin rapidly distributed to the blood vessels of the brain followed by a slower dispersion into the brain parenchyma. Thus, these results provide further support for the effects of fisetin on brain function. In addition, they suggest that label-free two-photon microscopy may prove useful for studying the intracellular and tissue distribution of other intrinsically-fluorescent flavonoids. PMID:26271433

Mild cognitive impairment and asymptomatic Alzheimer disease subjects: equivalent β-amyloid and tau loads with divergent cognitive outcomes.

PubMed

Iacono, Diego; Resnick, Susan M; O'Brien, Richard; Zonderman, Alan B; An, Yang; Pletnikova, Olga; Rudow, Gay; Crain, Barbara; Troncoso, Juan C

2014-04-01

Older adults with intact cognition before death and substantial Alzheimer disease (AD) lesions at autopsy have been termed "asymptomatic AD subjects" (ASYMAD). We previously reported hypertrophy of neuronal cell bodies, nuclei, and nucleoli in the CA1 of the hippocampus (CA1), anterior cingulate gyrus, posterior cingulate gyrus, and primary visual cortex of ASYMAD versus age-matched Control and mild cognitive impairment (MCI) subjects. However, it was unclear whether the neuronal hypertrophy could be attributed to differences in the severity of AD pathology. Here, we performed quantitative analyses of the severity of β-amyloid (Aβ) and phosphorylated tau (tau) loads in the brains of ASYMAD, Control, MCI, and AD subjects (n = 15 per group) from the Baltimore Longitudinal Study of Aging. Tissue sections from CA1, anterior cingulate gyrus, posterior cingulate gyrus, and primary visual cortex were immunostained for Aβ and tau; the respective loads were assessed using unbiased stereology by measuring the fractional areas of immunoreactivity for each protein in each region. The ASYMAD and MCI groups did not differ in Aβ and tau loads. These data confirm that ASYMAD and MCI subjects have comparable loads of insoluble Aβ and tau in regions vulnerable to AD pathology despite divergent cognitive outcomes. These findings imply that cognitive impairment in AD may be caused or modulated by factors other than insoluble forms of Aβ and tau.

TFE3-rearranged hepatic epithelioid hemangioendothelioma-a case report with immunohistochemical and molecular study.

PubMed

Kuo, Fang-Ying; Huang, Hsuan-Ying; Chen, Chao-Long; Eng, Hock-Liew; Huang, Chao-Cheng

2017-09-01

A recurrent YAP1-TFE3 gene fusion has been identified in WWTR1-CAMTA1-negative epithelioid hemangioendotheliomas arising in soft tissue, bone, and lung, but not in liver. We present the first case of TFE3-rearranged hepatic epithelioid hemangioendothelioma in a 39-year-old Taiwanese woman. Computed tomography scan revealed multifocal, ill-defined nodules involving both hepatic lobes. She then underwent deceased donor liver transplantation. Histologically, the tumors in the liver explant showed a biphasic growth pattern. One component was composed of dilated and well-formed blood vessels lined by epithelioid cells with abundant eosinophilic cytoplasm, mimicking an alveolar pattern, whereas the other component was composed of cords and single cells, featuring intracytoplasmic vacuoles, separated by a myxoid stroma. The tumor cells showed vesicular nuclei and small indistinct nucleoli with mild to moderate cytologic atypia. Most tumor cells showed factor VIII, CD34, CD31, and TFE3 positivity in immunohistochemical study. Fluorescence in situ hybridization analysis for the tumor cells exhibited TFE3 gene rearrangement. The patient is currently alive, and no post-operative tumor recurrence developed during a 13-year follow-up. Awareness of this rare vasoformative variant and identification of the gene rearrangement would be helpful on differential diagnosis with other high-grade carcinoma and angiosarcoma of liver. © 2017 APMIS. Published by John Wiley & Sons Ltd.

Isolation and characterization of a carrot nucleolar protein with structural and sequence similarity to the vertebrate PESCADILLO protein.

PubMed

Ueda, Kenji; Xu, Zheng-Jun; Miyagi, Nobuaki; Ono, Michiyuki; Wabiko, Hiroetsu; Masuda, Kiyoshi; Inoue, Masayasu

2013-07-01

The nuclear matrix is involved in many nuclear events, but its protein architecture in plants is still not fully understood. A cDNA clone was isolated by immunoscreening with a monoclonal antibody raised against nuclear matrix proteins of Daucus carota L. Its deduced amino acid sequence showed about 40% identity with the PESCADILLO protein of zebrafish and humans. Primary structure analysis of the protein revealed a Pescadillo N-terminus domain, a single breast cancer C-terminal domain, two nuclear localization signals, and a potential coiled-coil region as also found in animal PESCADILLO proteins. Therefore, we designated this gene DcPES1. Although DcPES1 mRNA was detected in all tissues examined, its levels were highest in tissues with proliferating cells. Immunofluorescence using specific antiserum against the recombinant protein revealed that DcPES1 localized exclusively in the nucleolus. Examination of fusion proteins with green fluorescent protein revealed that the N-terminal portion was important for localization to the nucleoli of tobacco and onion cells. Moreover, when the nuclear matrix of carrot cells was immunostained with an anti-DcPES1 serum, the signal was detected in the nucleolus. Therefore, the DcPES1 protein appears to be a component of or tightly bound to components of the nuclear matrix. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Cytomorphological identification of advanced pulmonary adenocarcinoma harboring KRAS mutation in lymph node fine-needle aspiration specimens: Comparative investigation of adenocarcinoma with KRAS and EGFR mutations.

PubMed

Song, Dae Hyun; Lee, Boram; Shin, Yooju; Choi, In Ho; Ha, Sang Yun; Lee, Jae Jun; Hong, Min Eui; Choi, Yoon-La; Han, Joungho; Um, Sang-Won

2015-07-01

Kirsten rat sarcoma 2 viral oncogene homolog (KRAS) mutation in pulmonary adenocarcinoma is clinically important due to its association with resistance to EGFR inhibitors and poor prognosis. To our knowledge, there has not been a comparative study focusing on cytological nuclear features of pulmonary adenocarcinoma harboring KRAS mutation (KRAS-AD). Hence, we compared the cytomorphology of metastatic KRAS-AD and EGFR-positive adenocarcinoma (EGFR-AD) in aspiration specimens from lymph nodes. Forty lymph node aspiration specimens from forty KRAS-AD patients were collected at Samsung Medical Center (Seoul, Korea) from 2009 to 2013. As a control group, 40 EBUS-FNA lymph node specimens from 20 EGFR-AD patients were collected. EGFR-AD specimens were evaluated at Samsung Medical Center (Seoul, Korea) from 2012 to 2013. All 80 specimens were histologically confirmed to metastatic adenocarcinoma. Two pathologists performed a blinded review of all specimens. Compared with EGFR-AD, KRAS-AD exhibited more severe nuclear pleomorphism (P < 0.001), coarse chromatin (P = 0.001), cherry-red nucleoli (P < 0.001) and naked tumor cells (P = 0.002) with necrotic (P < 0.001) and neutrophilic (P = 0.008) background. Our study provides the first demonstration of cytomorphologic differentiation between metastatic KRAS-AD and metastatic EGFR-AD in lymph node aspiration specimens. © 2014 Wiley Periodicals, Inc.

Establishment and characterization of SUIT-58 pancreas cancer cell line and its subline S58-SF adapted to serum-free condition derived from metastatic liver tumor.

PubMed

Takahashi, Nobuyasu; Aoyama, Fumiyo; Ohuchida, Jiro; Sameshima, Naoki; Asada, Yujiro; Sawaguchi, Akira

2015-10-01

A new pancreas cancer cell line, SUIT-58, was established from metastatic liver tumor. The cultured cells exhibited polygonal shape, and proliferated in a form of sheet-structure showing prominent nucleoli and frequent mitotic features. Chromosome count ranged from 54 to 73 with modal chromosome numbers 72 and 73. It was noteworthy that this cell line grew in the serum-free media and maintained in this condition for 30 passages (designated as S58-SF). Both SUIT-58 and S58-SF cell lines were successfully transplanted into nude mice, and their tumor doubling times in xenografts were calculated as 5.4 and 2.8 days, respectively. Histopathologically, the xenografts formed glandular structure that resembled the original tumor. In culture media, the doubling time of SUIT-58 and S58-SF cell lines was calculated as 32 and 35.7 h, respectively. Although the cellular arrangements of SUIT-58 and S58-SF cell lines are different to some extent, their subcellular structures under electron microscope were similar with a large number of lysosomes and distinct desmosomes at cell-cell adhesion sites. The present SUIT-58 and its derivative cell line S58-SF will be applicable for biological studies to develop a new clinical treatment of refractory pancreatic cancer.

Crowding Effects on the Formation and Maintenance of Nuclear Bodies: Insights from Molecular-Dynamics Simulations of Simple Spherical Model Particles

PubMed Central

Cho, Eun Jin; Kim, Jun Soo

2012-01-01

The physics of structure formation and maintenance of nuclear bodies (NBs), such as nucleoli, Cajal bodies, promyelocytic leukemia bodies, and speckles, in a crowded nuclear environment remains largely unknown. We investigate the role of macromolecular crowding in the formation and maintenance of NBs using computer simulations of a simple spherical model, called Lennard-Jones (LJ) particles. LJ particles form a one-phase, dilute fluid when the intermolecular interaction is weaker than a critical value, above which they phase separate and form a condensed domain. We find that when volume-exclusive crowders exist in significant concentrations, domain formation is induced even for weaker intermolecular interactions, and the effect is more pronounced with increasing crowder concentration. Simulation results show that a previous experimental finding that promyelocytic leukemia bodies disappear in the less-crowded condition and reassemble in the normal crowded condition can be interpreted as a consequence of the increased intermolecular interactions between NB proteins due to crowding. Based on further analysis of the simulation results, we discuss the acceleration of macromolecular associations that occur within NBs, and the delay of diffusive transport of macromolecules within and out of NBs when the crowder concentration increases. This study suggests that in a polydisperse nuclear environment that is enriched with a variety of macromolecules, macromolecular crowding not only plays an important role in the formation and maintenance of NBs, but also may perform some regulatory functions in response to alterations in the crowding conditions. PMID:22947858

Changes in biomolecular profile in a single nucleolus during cell fixation.

PubMed

Kuzmin, Andrey N; Pliss, Artem; Prasad, Paras N

2014-11-04

Fixation of biological sample is an essential technique applied in order to "freeze" in time the intracellular molecular content. However, fixation induces changes of the cellular molecular structure, which mask physiological distribution of biomolecules and bias interpretation of results. Accurate, sensitive, and comprehensive characterization of changes in biomolecular composition, occurring during fixation, is crucial for proper analysis of experimental data. Here we apply biomolecular component analysis for Raman spectra measured in the same nucleoli of HeLa cells before and after fixation by either formaldehyde solution or by chilled ethanol. It is found that fixation in formaldehyde does not strongly affect the Raman spectra of nucleolar biomolecular components, but may significantly decrease the nucleolar RNA concentration. At the same time, ethanol fixation leads to a proportional increase (up to 40%) in concentrations of nucleolar proteins and RNA, most likely due to cell shrinkage occurring in the presence of coagulant fixative. Ethanol fixation also triggers changes in composition of nucleolar proteome, as indicated by an overall reduction of the α-helical structure of proteins and increase in the concentration of proteins containing the β-sheet conformation. We conclude that cross-linking fixation is a more appropriate protocol for mapping of proteins in situ. At the same time, ethanol fixation is preferential for studies of RNA-containing macromolecules. We supplemented our quantitative Raman spectroscopic measurements with mapping of the protein and lipid macromolecular groups in live and fixed cells using coherent anti-Stokes Raman scattering nonlinear optical imaging.

Targeted light-inactivation of the Ki-67 protein using theranostic liposomes leads to death of proliferating cells

NASA Astrophysics Data System (ADS)

Rahmanzadeh, Ramtin; Rai, Prakash; Gerdes, Johannes; Hasan, Tayyaba

2010-02-01

Nanomedicine is beginning to impact the treatment of several diseases and current research efforts include development of integrated nano-constructs (theranostics) which serve as probes for imaging and therapy in addition to delivering macromolecules intracellularly. In cancer, there is a vital unmet need for effective alternative treatments with high specificity and low systemic toxicity. This can be achieved by targeting key molecular markers associated with cancer cells with reduced effective drug doses. Here, we show an innovative proof-of-principle approach for efficient killing of proliferating ovarian cancer cells by inactivating a protein associated with cell proliferation namely, the nuclear Ki-67 protein (pKi-67), using nanotechnology-based photodynamic therapy (PDT). Antibodies against pKi-67 are widely used as prognostic tools for tumor diagnosis. In this work, anti pKi-67 antibodies were first conjugated to fluorescein isothiocyanate (FITC) and then encapsulated inside liposomes. After incubation of OVCAR-5 ovarian cancer cells with these liposomes, confocal microscopy confirmed the localization of the antibodies to the nucleoli of the cells. Irradiation with a 488 nm laser led to a significant loss of cell viability. The specificity of this approach for pKi-67 positive cells was demonstrated in confluent human lung fibroblasts (MRC-5) where only a small population of cells stain positive for pKi-67 and only minimal cell death was observed. Taken together, our findings suggest that pKi-67 targeted with nano-platform is an attractive therapeutic target in cancer therapy.

Characterization of oral precancerous lesions based on higher-harmonic generation microscopy

NASA Astrophysics Data System (ADS)

Lin, Chen-Yu; Lin, Chih-Feng; Sun, Chi-Kuang

2013-03-01

It is generally accepted that oral cancer arises in the presence of oral precancerous lesions. However, the clinical courses of these lesions are quite unpredictable, and a fundamental enigma remains that when and how these lesions turn to malignant growth. Characterization of these potentially malignant lesions is thus important and could serve as early indicators of this neoplastic transformation process, potentially facilitates the treatment outcome and improves the survival rate. Higher harmonic generation microscope (HGM), providing images with a <500nm lateral resolution at a 300μm penetration depth without leaving photodamages in the tissues, was used for this purpose. Oral cavity biopsies were obtained from 18 patients with clinical suspected oral precancerous lesions scheduled for surgical biopsy. HGM images were compared with histological images to determine the results. By visualization of subtle cellular and morphological changes, the preliminary result of this HGM image discloses excellent consistency with traditional histolopathology studies, without the need for fixation, sectioning and staining. More specifically speaking, the keratin thickness was found to be increased comparing with normal adjacent controls. In some cases, variations in cell size, nuclear size and increased nuclear/cytoplasmic ratio, and increased size of nucleoli were identified, indicating different stages of malignant transformation. These results together indicated that HGM provides the capability to characterize features of oral precancerous lesions as well as oral cancer progression, and holds the greatest potential as an ideal tool for clinical screening and surveillance of suspicious oral lesions.

Electrophoretic characterization of the Mammalian nuclear matrix proteome, nuclear envelope, nucleoli and covalently bound ADP-ribose polymers: potential applications to cancer.

PubMed

Aranda, Xavier G; Racho, Ronald G; Pacheco-Rodríguez, Gustavo; Alvarez-González, Rafael

2014-01-01

Nucleic acid metabolism is biochemically compartmentalized to the nucleus. Thus, it is necessary to define the proteome of the various macromolecular structures within this organelle. We isolated the nuclear matrix (NM) fraction from rat liver by sequential centrifugation steps at 13,000 rpm, staggered between endogenous nuclease treatment for 2 h at 37°C, followed by high-salt (H.S.; 2.0 M NaCl) and non-ionic detergent extractions (0.1%- or 1.0% Triton X-100) to eliminate the bulk of chromosomal DNA/RNA, histone proteins and the nuclear envelope (NE). Integrity of the NM and NE structures was confirmed by electron microscopy. Next, we analyzed the NM proteome on a 20% polyacrylamide gel using the PhastSystem. We observed the absence of histone proteins and the characteristic presence of the lamins by Coomassie blue staining. By contrast, upon silver staining, following electrophoretic separation with a Tris-Borate-EDTA buffer, we observed the NM-associated nucleic RNA and protein-free ADP-ribose polymers. While polymers are found in much lower concentration than RNA in NM, they were purified by affinity chromatography on boronate resin prior to electrophoresis. We observed the electrophoretic resolution of free ADP-ribose chains (5-25 units) by silver staining. The significance of our observations to cancer studies and carcinogenesis is discussed. Copyright© 2014, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

Yaba Tumor Poxvirus Synthesis In Vitro I. Cytopathological, Histochemical, and Immunofluorescent Studies

PubMed Central

Yohn, David S.; Haendiges, Victoria A.; Grace, James T.

1966-01-01

Yohn, David S. (Roswell Park Memorial Institute, Buffalo, N.Y.), Victoria A. Haendiges, and James T. Grace, Jr. Yaba tumor poxvirus synthesis in vitro. I. Cytopathological, histochemical, and immunofluorescent studies. J. Bacteriol. 91:1977–1985. 1966.—Yaba tumor poxvirus synthesis in BSC-1 cell culture was followed sequentially with light microscopy, immunofluorescent microscopy, and various histochemical stains. The first evidence of infection was detected at 24 hr when nucleoli became hypertrophic, reflecting enhanced ribonucleic acid (RNA) synthesis. At 36 hr, deoxyribonucleic acid synthesis was detected in the cytoplasm. This was immediately followed by or associated with antigen synthesis at paranuclear sites and enhanced RNA synthesis in the cytoplasm. Cytoplasmic inclusions were readily apparent at 4 days in initially infected cells. Contiguous spread of virus was judged to have occurred around the third day of infection. The time required to complete the synthetic cycle from time of infection to production of infectious progeny was estimated to be of the order of 60 hr. This cycle is 6 to 10 times longer than for vaccinia virus. By light microscopy, cytopathic effects (CPE) were detectable in 5 days in heavily infected cultures. With 100 units or less of infectious virus, CPE was not readily detected until the 10th to 14th day. At this time, focal areas of infection classified either as microtumors or microplaques were present. Secondary foci appeared during the 4th week of incubation. Images PMID:4287080

Raman spectroscopic analysis of oral squamous cell carcinoma and oral dysplasia in the high-wavenumber region

NASA Astrophysics Data System (ADS)

Carvalho, Luis Felipe C. S.; Bonnier, Franck; O'Callaghan, Kate; O'Sullivan, Jeff; Flint, Stephen; Neto, Lazaro P. M.; Soto, Cláudio A. T.; dos Santos, Laurita; Martin, Airton A.; Byrne, Hugh J.; Lyng, Fiona M.

2015-06-01

Raman spectroscopy can provide a molecular-level signature of the biochemical composition and structure of cells with excellent spatial resolution and could be useful to monitor changes in composition for early stage and non-invasive cancer diagnosis, both ex-vivo and in vivo. In particular, the fingerprint spectral region (400-1,800 cm-1) has been shown to be very promising for optical biopsy purposes. However, limitations to discrimination of dysplastic and inflammatory processes based on the fingerprint region still persist. In addition, the Raman spectral signal of dysplastic cells is one important source of misdiagnosis of normal versus pathological tissues. The high wavenumber region (2,800-3,600 cm-1) provides more specific information based on N-H, O-H and C-H vibrations and can be used to identify the subtle changes which could be important for discrimination of samples. In this study, we demonstrate the potential of the highwavenumber spectral region by collecting Raman spectra of nucleoli, nucleus and cytoplasm from oral epithelial cancer (SCC-4) and dysplastic (DOK) cell lines and from normal oral epithelial primary cells, in vitro, which were then analyzed by area under the curve as a method to discriminate the spectra. In this region, we will show the discriminatory potential of the CH vibrational modes of nucleic acids, proteins and lipids. This technique demonstrated more efficient discrimination than the fingerprint region when we compared the cell cultures.

Pyrene–nucleobase conjugates: synthesis, oligonucleotide binding and confocal bioimaging studies

PubMed Central

Jabłoński, Artur; Fritz, Yannic; Wagenknecht, Hans-Achim; Czerwieniec, Rafał; Bernaś, Tytus; Trzybiński, Damian; Woźniak, Krzysztof

2017-01-01

Fluorescent pyrene–linker–nucleobase (nucleobase = thymine, adenine) conjugates with carbonyl and hydroxy functionalities in the linker were synthesized and characterized. X-ray single-crystal structure analysis performed for the pyrene–C(O)CH2CH2–thymine (2) conjugate reveals dimers of molecules 2 stabilized by hydrogen bonds between the thymine moieties. The photochemical characterization showed structure-dependent fluorescence properties of the investigated compounds. The conjugates bearing a carbonyl function represent weak emitters as compared to compounds with a hydroxy function in the linker. The self-assembly properties of pyrene nucleobases were investigated in respect to their binding to single and double strand oligonucleotides in water and in buffer solution. In respect to the complementary oligothymidine T10 template in water, compounds 3 and 5 both show a self-assembling behavior according to canonical base–base pairing. However, in buffer solution, derivative 5 was much more effective than 3 in binding to the T10 template. Furthermore the adenine derivative 5 binds to the double-stranded (dA)10–T10 template with a self-assembly ratio of 112%. Such a high value of a self-assembly ratio can be rationalized by a triple-helix-like binding, intercalation, or a mixture of both. Remarkably, compound 5 also shows dual staining pattern in living HeLa cells. Confocal microscopy confirmed that 5 predominantly stains mitochondria but it also accumulates in the nucleoli of the cells. PMID:29259662

Subcellular localisations of the CPTI collection of YFP-tagged proteins in Drosophila embryos

PubMed Central

Lye, Claire M.; Naylor, Huw W.; Sanson, Bénédicte

2014-01-01

A key challenge in the post-genomic area is to identify the function of the genes discovered, with many still uncharacterised in all metazoans. A first step is transcription pattern characterisation, for which we now have near whole-genome coverage in Drosophila. However, we have much more limited information about the expression and subcellular localisation of the corresponding proteins. The Cambridge Protein Trap Consortium generated, via piggyBac transposition, over 600 novel YFP-trap proteins tagging just under 400 Drosophila loci. Here, we characterise the subcellular localisations and expression patterns of these insertions, called the CPTI lines, in Drosophila embryos. We have systematically analysed subcellular localisations at cellularisation (stage 5) and recorded expression patterns at stage 5, at mid-embryogenesis (stage 11) and at late embryogenesis (stages 15-17). At stage 5, 31% of the nuclear lines (41) and 26% of the cytoplasmic lines (67) show discrete localisations that provide clues on the function of the protein and markers for organelles or regions, including nucleoli, the nuclear envelope, nuclear speckles, centrosomes, mitochondria, the endoplasmic reticulum, Golgi, lysosomes and peroxisomes. We characterised the membranous/cortical lines (102) throughout stage 5 to 10 during epithelial morphogenesis, documenting their apico-basal position and identifying those secreted in the extracellular space. We identified the tricellular vertices as a specialized membrane domain marked by the integral membrane protein Sidekick. Finally, we categorised the localisation of the membranous/cortical proteins during cytokinesis. PMID:25294944

[Diagnostic and prognostic value of p53 oncogene and the selected neoplastic markers (Ki67, PCNA, DNA ploidy) of the ultrastructure in patients with laryngeal cancer].

PubMed

Golusiński, W; Szmeja, Z; Olofsson, J; Biczysko, W; Krygier-Stojałowska, A; Majewski, P

1996-01-01

A comparison was performed of staining intensity of immunohistochemical proliferating antigens (p53, PCNA, Ki67), DNA flow cytometry and ultrastructure of the carcinoma cells in 120 cases of laryngeal cancer. Clinically very advanced tumors were in majority (T3 - 43%, T4 - 18%). A 5 graded scale was adapted to evaluate the level of immunohistochemical staining of the carcinoma cell nuclei. A positive staining was obtained in 70% for p53, 57% for Ki67 and in 80(2/3) for PCNA. 62% of the cases were DNA diploid and 38% DNA aneuploid. The DNA diploid carcinomas were accompanied by the enlargement of the cell nuclei, preserving of the nuclei's wide margins of heterochromatine, enlargement of the nuclear area and increase of the number of nuclei. In the aneuploid-polyploid cancer the nuclei had a substantial polymorphism with large cleaved nuclei and with significant variation in size, and with nuclear envelope. A frequent finding was euchromatization of chromatine. Dense chromatine appeared in the form of small clumps spread over the whole area of these irregular nuclei. Enlargement and activation of nucleoli occurred. There was a positive correlation (Chi-square) between T- and N-stage and immunohistochemical staining. There was also a positive correlation in staining intensity between p53, Ki67 and PCNA. There is also strong correlation between these markers of proliferative activity and the degree of aggressiveness of the tumour.

Cyto-histopathological and outcome features of the prepuce squamous cell carcinoma of a mixed breed dog

PubMed Central

2014-01-01

Abstract Background Squamous cell carcinomas (SCCs) are uncommon, high-grade tumors, predominantly composed of round cells in the prepuce. The aim of this study is to better define the clinicopathologic features of this neoplasm. Case report We conducted cyto-histopathologic analysis on the manifestations of the prepuce SCC by H & E staining in a terrier mix dog. Grossly, tumor was large, multiple erythematous patch, and ulcerated masses frequently affecting the prepuce and deeply invading to distal prepuce out from the ventro-lateral of penis and the tumor covered by a necrotic discharge. Cytological evaluation of fine-needle aspirates from the cutaneous mass from the prepuce comprised of round nuclei, coarse chromatin pattern, distinct nucleoli and nuclear pleomorphism. Furthermore, the neoplastic cells were pleomorphic, round to caudate in shape, exhibiting prominent anisokaryosis and anisocytosis with rare mitotic features. Microscopically, the lesions were predominantly composed of atypical round cells disposed in interlacing fascicles. Frequent findings include keratin formation, horn pearls, mitoses and cellular atypia. The cells showed distinct borders, ranged from polygonal to round or elongate and had moderate amounts of eosinophilic cytoplasm. Conclusion The histopathologic features coupled with the cytopathology findings led to a diagnosis of squamous cell carcinoma. To the authors’ knowledge, this is the first time that multiple erythematous plaques have undergone malignant transformation in a terrier mix dog. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/5748771971272873 PMID:24903567

Ovarian structure and oogenesis of the extremophile viviparous teleost Poecilia mexicana (Poeciliidae) from an active sulfur spring cave in Southern Mexico.

PubMed

Torres-Martínez, Aarón; Hernández-Franyutti, Arlette; Uribe, Mari Carmen; Contreras-Sánchez, Wilfrido Miguel

2017-12-01

The structure of the ovary and oogenesis of Poecilia mexicana from an active sulfur spring cave is documented. Poecilia mexicana is the only poeciliid adapted to a subterranean environment with high hydrogen sulfide levels and extreme hypoxic conditions. Twenty females were captured throughout one year at Cueva del Azufre, located in the State of Tabasco in Southern Mexico. Ovaries were processed with histological techniques. P. mexicana has a single, ovoid ovary with ovigerous lamella that project to the ovarian lumen. The ovarian wall presents abundant loose connective tissue, numerous melanomacrophage centers and large blood vessels, possibly associated with hypoxic conditions. The germinal epithelium bordering the ovarian lumen contains somatic and germ cells forming cell nests projecting into the stroma. P. mexicana stores sperm in ovarian folds associated with follicles at different developmental phases. Oogenesis in P. mexicana consisted of the following stages: (i) oogonial proliferation, (ii) chromatin nucleolus, (iii) primary growth, subdivided into: (a) one nucleolus, (b) multiple nucleoli, (c) droplet oils-cortical alveoli steps; (iv) secondary growth, subdivided in: (a) early secondary growth, (b) late secondary growth, and (c) full grown. Follicular atresia was present in all stages of follicular development; it was characterized by oocyte degeneration, where follicle cells hypertrophy and differentiate in phagocytes. The ovary and oogenesis are similar to these seen in other poeciliids, but we found frequent atretic follicles, melanomacrophage centers, reduced fecundity and increased of offspring size. © 2017 Wiley Periodicals, Inc.

Liquid Based Preparation (LBP) cytology versus Conventional Cytology (CS) in FNA samples from breast, thyroid, salivary glands and soft tissues. Our experience in Crete (Greece).

PubMed

Mygdakos, N; Nikolaidou, Sylvia; Tzilivaki, Anna; Tamiolakis, D

2009-01-01

The improvement in quality of cytological preparations with the use of LBP methodology has been well-documented, but the cytological artifacts resulting from this technique have not been adequately described. This study describes and illustrates the cytological artifacts introduced by LBP technique when used on fine-needle aspirates (FNAs), and evaluates these artifacts as potential diagnostic pitfalls. We reviewed a total of 96 FNAs simultaneously processed by both conventional smears and LBP. FNAs were obtained from the following sites: lymph node (38), breast (28), soft-tissue sites (nine), salivary glands (six), and thyroid gland (15). The LBP smears were consistently devoid of obscuring elements, and the cells were adequately preserved and evenly dispersed. However, we noted some cytomorphological alterations that should be recognized to avoid erroneous diagnoses. The size of cell clusters was decreased, large branching sheets were fragmented, and there were more single cells, resulting in apparent discohesion. Small cells such as lymphocytes tended to aggregate. All cells were generally smaller and occasionally spindled, the chromatin detail was attenuated, and nucleoli were more prominent. Intranuclear inclusions were difficult to visualize. Background matrix was often altered in both quantity and quality. Extracellular particles, small mononuclear cells, red blood cells, and myoepithelial cells were markedly decreased in number. Cytopathologists should be careful in interpreting FNAs prepared using LBP technique if that is the only methodology employed. Familiarity with artifacts is essential to avoid misdiagnoses.

Identification of a novel TIF-IA-NF-κB nucleolar stress response pathway.

PubMed

Chen, Jingyu; Lobb, Ian T; Morin, Pierre; Novo, Sonia M; Simpson, James; Kennerknecht, Kathrin; von Kriegsheim, Alex; Batchelor, Emily E; Oakley, Fiona; Stark, Lesley A

2018-06-05

p53 as an effector of nucleolar stress is well defined, but p53 independent mechanisms are largely unknown. Like p53, the NF-κB transcription factor plays a critical role in maintaining cellular homeostasis under stress. Many stresses that stimulate NF-κB also disrupt nucleoli. However, the link between nucleolar function and activation of the NF-κB pathway is as yet unknown. Here we demonstrate that artificial disruption of the PolI complex stimulates NF-κB signalling. Unlike p53 nucleolar stress response, this effect does not appear to be linked to inhibition of rDNA transcription. We show that specific stress stimuli of NF-κB induce degradation of a critical component of the PolI complex, TIF-IA. This degradation precedes activation of NF-κB and is associated with increased nucleolar size. It is mimicked by CDK4 inhibition and is dependent upon a novel pathway involving UBF/p14ARF and S44 of the protein. We show that blocking TIF-IA degradation blocks stress effects on nucleolar size and NF-κB signalling. Finally, using ex vivo culture, we show a strong correlation between degradation of TIF-IA and activation of NF-κB in freshly resected, human colorectal tumours exposed to the chemopreventative agent, aspirin. Together, our study provides compelling evidence for a new, TIF-IA-NF-κB nucleolar stress response pathway that has in vivo relevance and therapeutic implications.

The snoRNA domain of vertebrate telomerase RNA functions to localize the RNA within the nucleus.

PubMed Central

Lukowiak, A A; Narayanan, A; Li, Z H; Terns, R M; Terns, M P

2001-01-01

Telomerase RNA is an essential component of the ribonucleoprotein enzyme involved in telomere length maintenance, a process implicated in cellular senescence and cancer. Vertebrate telomerase RNAs contain a box H/ACA snoRNA motif that is not required for telomerase activity in vitro but is essential in vivo. Using the Xenopus oocyte system, we have found that the box H/ACA motif functions in the subcellular localization of telomerase RNA. We have characterized the transport and biogenesis of telomerase RNA by injecting labeled wild-type and variant RNAs into Xenopus oocytes and assaying nucleocytoplasmic distribution, intranuclear localization, modification, and protein binding. Although yeast telomerase RNA shares characteristics of spliceosomal snRNAs, we show that human telomerase RNA is not associated with Sm proteins or efficiently imported into the nucleus. In contrast, the transport properties of vertebrate telomerase RNA resemble those of snoRNAs; telomerase RNA is retained in the nucleus and targeted to nucleoli. Furthermore, both nuclear retention and nucleolar localization depend on the box H/ACA motif. Our findings suggest that the H/ACA motif confers functional localization of vertebrate telomerase RNAs to the nucleus, the compartment where telomeres are synthesized. We have also found that telomerase RNA localizes to Cajal bodies, intranuclear structures where it is thought that assembly of various cellular RNPs takes place. Our results identify the Cajal body as a potential site of telomerase RNP biogenesis. PMID:11780638

Myoepithelial carcinoma of the parotid gland: A case of adequate fine-needle aspiration cytology specimens rendering a conclusive diagnosis possible.

PubMed

Guo, Xin; Watanabe, Jiro; Ariyasu, Sanae; Sasaguri, Yasuyuki; Kurose, Nozomu; Fukushima, Kei; Yamada, Sohsuke

2018-01-01

An 80-year-old male presented with a history of a hard right parotid mass that had gradually increased in size, with subsequent facial paralysis. A fine-needle aspiration biopsy was performed. The cytologic specimens contained a substantial number of sheet-like clusters or small groups of a mixture of plasmacytoid, oval to spindled, or large epithelioid cells having hyperchromatic pleomorphic nuclei, abundant cytoplasm with occasional inclusion body-like materials, and prominent nucleoli, in a relatively clear background. We first interpreted it as a carcinoma, suggestive of myoepithelial differentiation. Radical parotidectomy was performed, and a gross examination of the neoplasm revealed a non-capsulated and ill-defined tumor lesion, with a grayish or yellowish cut surface, associated with fat invasion. On a microscopic examination, the tumor was predominantly composed of the solid proliferation of atypical cells including a mixture of oval to spindled, plasmacytoid, or epithelioid cells, often arranged in a trabecular and reticular growth pattern with patchy eosinophilic hyalinized stroma. Immunohistochemistry showed that the carcinoma cells were specifically positive for p63, cytokeratins, and vimentin. Finally, electron microscopy demonstrated that their phenotype was consistent with a myoepithelial origin containing many bundles of variably thin actin filaments. Therefore, we finally made a diagnosis of myoepithelial carcinoma, defined as the malignant counterpart of benign myoepithelioma. We should be aware that owing to its characteristic cytological features, cytopathologists may be able to make a correct diagnosis of myoepithelial carcinoma, based on multiple and adequate samplings.

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

17-beta estradiol inhibits oxidative stress-induced accumulation of AIF into nucleolus and PARP1-dependent cell death via estrogen receptor alpha.

PubMed

Batnasan, Enkhzaya; Wang, Ruoxi; Wen, Jitao; Ke, Yueshuang; Li, Xiaoxue; Bohio, Ameer Ali; Zeng, Xianlu; Huo, Hongliang; Han, Liping; Boldogh, Istvan; Ba, Xueqing

2015-01-05

Oxidative stress-induced DNA damage results in over-activation of poly(ADP-ribose) polymerase 1 (PARP1), leading to parthanatos, a newly discovered cell elimination pathway. Inhibition of PARP1-dependent cell death has shown to improve the outcome of diseases, including stroke, heart ischemia, and neurodegenerative diseases. In the present study we aimed to detect whether estrogen plays a protective role in inhibiting parthanatos. We utilized human mammary adenocarcinoma cells (MCF7) that abundantly express the estrogen receptor alpha and beta (ERα and ERβ). Parthanatos was induced by challenging the cells with hydrogen peroxide (H2O2). Microscopic imaging and molecular biological techniques, such as Western blot analysis and RNA interference, were performed. The results showed 17β estradiol (E2) protected MCF7 cells from PARP1-dependent cell death by decreasing protein PARylation, and AIF translocation into nuclei/nucleoli. Down-regulation of ERα expression by siRNA before E2 addition resulted in the failure of the E2-mediated inhibition of H2O2-induced protein PARylation and AIF nucleolar translocation. Together these data suggest that estrogen via its alpha-type receptor inhibits oxidative stress-induced, PARP1-dependent cell death. The present study provided us insight into how to apply hormone therapy in intervention of parthanatos-implicated ischemic and degenerative diseases. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Comparison of the Cellient(™) automated cell block system and agar cell block method.

PubMed

Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

2014-12-01

To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P < 0.05). No significant difference was seen for definition of cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

Cytopathologic evaluation of patients submitted to radiotherapy for uterine cervix cancer.

PubMed

Padilha, Cátia Martins Leite; Araújo, Mário Lúcio Cordeiro; Souza, Sergio Augusto Lopes de

2017-04-01

Cervical cancer is an important public health problem. Pap smear is the leading strategy of screening programs for cervical cancer worldwide. However, delayed diagnosis leads to more aggressive and less effective treatments. Patients with uterine cervix malignancies who are referred for radiotherapy have advanced-stage disease, which results in high rates of locoregional recurrence. The use of radiotherapy as a treatment for cervical cancer causes morphological changes in neoplastic and non-neoplastic epithelial cells, as well as in stromal cells, which make it difficult to diagnose the residual lesion, resulting in a dilemma in cytopathological routine. Based on the difficulties of cytopathologic evaluation for the follow-up of patients treated with radiotherapy for cervical cancer, our objective was to describe the actinic cytopathic effects. Our paper was based on a structured review including the period from June 2015 to April 2016, aiming at an exploratory-descriptive study. Bibliographic investigations were carried out through selection and analysis of articles, list of authors and keywords, selection of new articles focused on the analysis of bibliographic references to previously selected documents, as well as textbooks of recognized merit. The most incident actinic cytopathological alterations as described in the literature are: cellular gigantism, nuclear and cytoplasmic vacuolization, dyskeratosis, bi- and multinucleated (B/M) cells, macro and multiple nucleoli, anisokaryosis, anisonucleolosis and nuclear pyknosis. To date, a protocol has not been established that can precisely differentiate the morphological characteristics between benign cells with actinic effects from recurrent malignant cells on post-radiotherapy smears.

Stratified Mucin-Producing Intraepithelial Lesion of the Cervix: Subtle Features Not to Be Missed.

PubMed

Schwock, Joerg; Ko, Hyang Mi; Dubé, Valérie; Rouzbahman, Marjan; Cesari, Matthew; Ghorab, Zeina; Geddie, William R

2016-01-01

Stratified mucin-producing intraepithelial lesion (SMILE) is an uncommon premalignant lesion of the uterine cervix. A detailed examination of preinvasive SMILE cases including a comparison of the cytologic features with usual-type adenocarcinoma in situ (AIS) and human papillomavirus (HPV) genotyping was performed. Excisions and preceding Papanicolaou (Pap) tests were retrieved from the files of 2 tertiary care centers. Histologic review estimated the lesional SMILE proportion. Pap tests were reviewed and assessed for architectural, cellular and background features. Cobas® HPV test was performed. 13 cases were identified. Mean/median patient age was 35/33 years (range 23-51 years). Concurrent high-grade squamous intraepithelial lesion was found in 10/13 (77%) and AIS in 8/13 (62%) cases. In 6 cases, SMILE was dominant (≥50%) and represented in 5/6 corresponding Pap tests. Cytology interpretations differed more often in the SMILE-dominant group (p < 0.05). SMILE and AIS had overlapping features. Feathering and prominent nucleoli were absent in SMILE. HPV DNA was detected in all 12 cases tested. HPV 18 was most common (7/12). Excisions with positive/suspicious margins were reported in 5/6 SMILE-dominant versus 3/7 nondominant cases. SMILE is best considered as an AIS variant for cytologic, etiologic and management purposes. Cytologic features overlap with AIS, but are more subtle and easily missed. HPV testing may play a role in facilitating SMILE detection. © 2016 S. Karger AG, Basel.

The Giardia lamblia genome.

PubMed

Adam, R D

2000-04-10

Giardia lamblia is a protozoan parasite of humans and other mammals that is thought to be one of the most primitive extant eukaryotic organisms. Although distinctly eukaryotic, it is notable for its lack of mitochondria, nucleoli, and perixosomes. It has been suggested that Giardia spp. are pre-mitochondriate organisms, but the identification of genes in G. lamblia thought to be of mitochondrial origin has generated controversy regarding that designation. Giardi lamblia trophozoites have two nuclei that are identical in all ways that have been studied. They are polyploid with at least four, and perhaps eight or more, copies of each of five chromosomes per organism and have an estimated genome complexity of 1.2x10(7)bp of DNA, and GC content of 46%. There is evidence for recombination at the telomeres of some of the chromosomes, and multiple size variants of single chromosomes have been identified within cloned isolates. However, the internal regions of the chromosomes demonstrate no evidence of recombination. For example, there is no evidence for control of vsp gene expression by DNA recombination, and no evidence for rapid mutation in the vsp genes. Single pass sequences of approximately 9% of the G. lamblia genome have already been obtained. An ongoing genome project plans to obtain approximately 95% of the genome by a random approach, as well as a complete physical map using a bacterial artificial chromosome library. The results will facilitate a better understanding of the biology of Giardia spp. as well as their phylogenetic relationship to other primitive organisms.