NASA Technical Reports Server (NTRS)
Gorbunova, A. V.
1980-01-01
An investigation into the effect of hypokinesia on the ribonucleic acid (RNA) content, the nucleotide composition, and dynamics of protein content in the motoneuron of the rat spinal cord anterior horns is described. Methodology and findings are presented. The study results showed that the nucleotide composition of the total cellular RNA at all the studied periods of hypokinesia remained unchanged and is characteristic for the cytoplasmic, high polymer ribosomal RNA. This means that with a change in the functional state of the neuron the newly formed RNA of the nerve cell has the same composition of bases as the original RNA that belongs to the ribosomal type.
Genomic mid-range inhomogeneity correlates with an abundance of RNA secondary structures
Bechtel, Jason M; Wittenschlaeger, Thomas; Dwyer, Trisha; Song, Jun; Arunachalam, Sasi; Ramakrishnan, Sadeesh K; Shepard, Samuel; Fedorov, Alexei
2008-01-01
Background Genomes possess different levels of non-randomness, in particular, an inhomogeneity in their nucleotide composition. Inhomogeneity is manifest from the short-range where neighboring nucleotides influence the choice of base at a site, to the long-range, commonly known as isochores, where a particular base composition can span millions of nucleotides. A separate genomic issue that has yet to be thoroughly elucidated is the role that RNA secondary structure (SS) plays in gene expression. Results We present novel data and approaches that show that a mid-range inhomogeneity (~30 to 1000 nt) not only exists in mammalian genomes but is also significantly associated with strong RNA SS. A whole-genome bioinformatics investigation of local SS in a set of 11,315 non-redundant human pre-mRNA sequences has been carried out. Four distinct components of these molecules (5'-UTRs, exons, introns and 3'-UTRs) were considered separately, since they differ in overall nucleotide composition, sequence motifs and periodicities. For each pre-mRNA component, the abundance of strong local SS (< -25 kcal/mol) was a factor of two to ten greater than a random expectation model. The randomization process preserves the short-range inhomogeneity of the corresponding natural sequences, thus, eliminating short-range signals as possible contributors to any observed phenomena. Conclusion We demonstrate that the excess of strong local SS in pre-mRNAs is linked to the little explored phenomenon of genomic mid-range inhomogeneity (MRI). MRI is an interdependence between nucleotide choice and base composition over a distance of 20–1000 nt. Additionally, we have created a public computational resource to support further study of genomic MRI. PMID:18549495
Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment
Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...
2015-04-09
Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less
Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.
Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth
2015-04-09
The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Composition for nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-08-26
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Galtier, N; Boursot, P
2000-03-01
A new, model-based method was devised to locate nucleotide changes in a given phylogenetic tree. For each site, the posterior probability of any possible change in each branch of the tree is computed. This probabilistic method is a valuable alternative to the maximum parsimony method when base composition is skewed (i.e., different from 25% A, 25% C, 25% G, 25% T): computer simulations showed that parsimony misses more rare --> common than common --> rare changes, resulting in biased inferred change matrices, whereas the new method appeared unbiased. The probabilistic method was applied to the analysis of the mutation and substitution processes in the mitochondrial control region of mouse. Distinct change patterns were found at the polymorphism (within species) and divergence (between species) levels, rejecting the hypothesis of a neutral evolution of base composition in mitochondrial DNA.
Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
The complete mitochondrial genome of the stomatopod crustacean Squilla mantis
Cook, Charles E
2005-01-01
Background Animal mitochondrial genomes are physically separate from the much larger nuclear genomes and have proven useful both for phylogenetic studies and for understanding genome evolution. Within the phylum Arthropoda the subphylum Crustacea includes over 50,000 named species with immense variation in body plans and habitats, yet only 23 complete mitochondrial genomes are available from this subphylum. Results I describe here the complete mitochondrial genome of the crustacean Squilla mantis (Crustacea: Malacostraca: Stomatopoda). This 15994-nucleotide genome, the first described from a hoplocarid, contains the standard complement of 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, and a non-coding AT-rich region that is found in most other metazoans. The gene order is identical to that considered ancestral for hexapods and crustaceans. The 70% AT base composition is within the range described for other arthropods. A single unusual feature of the genome is a 230 nucleotide non-coding region between a serine transfer RNA and the nad1 gene, which has no apparent function. I also compare gene order, nucleotide composition, and codon usage of the S. mantis genome and eight other malacostracan crustaceans. A translocation of the histidine transfer RNA gene is shared by three taxa in the order Decapoda, infraorder Brachyura; Callinectes sapidus, Portunus trituberculatus and Pseudocarcinus gigas. This translocation may be diagnostic for the Brachyura. For all nine taxa nucleotide composition is biased towards AT-richness, as expected for arthropods, and is within the range reported for other arthropods. Codon usage is biased, and much of this bias is probably due to the skew in nucleotide composition towards AT-richness. Conclusion The mitochondrial genome of Squilla mantis contains one unusual feature, a 230 base pair non-coding region has so far not been described in any other malacostracan. Comparisons with other Malacostraca show that all nine genomes, like most other mitochondrial genomes, share a bias toward AT-richness and a related bias in codon usage. The nine malacostracans included in this analysis are not representative of the diversity of the class Malacostraca, and additional malacostracan sequences would surely reveal other unusual genomic features that could be useful in understanding mitochondrial evolution in this taxon. PMID:16091132
Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D
2004-10-01
Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.
Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G
1999-09-30
We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Nishizawa, Manami; Nishizawa, Kazuhisa
2000-01-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273
Interactive computer programs for the graphic analysis of nucleotide sequence data.
Luckow, V A; Littlewood, R K; Rownd, R H
1984-01-01
A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437
Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina
2007-12-11
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser
2010-08-10
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2011-04-12
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2012-04-03
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo
2012-01-01
In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.
Blanquart, Samuel; Lartillot, Nicolas
2006-11-01
Variations of nucleotidic composition affect phylogenetic inference conducted under stationary models of evolution. In particular, they may cause unrelated taxa sharing similar base composition to be grouped together in the resulting phylogeny. To address this problem, we developed a nonstationary and nonhomogeneous model accounting for compositional biases. Unlike previous nonstationary models, which are branchwise, that is, assume that base composition only changes at the nodes of the tree, in our model, the process of compositional drift is totally uncoupled from the speciation events. In addition, the total number of events of compositional drift distributed across the tree is directly inferred from the data. We implemented the method in a Bayesian framework, relying on Markov Chain Monte Carlo algorithms, and applied it to several nucleotidic data sets. In most cases, the stationarity assumption was rejected in favor of our nonstationary model. In addition, we show that our method is able to resolve a well-known artifact. By Bayes factor evaluation, we compared our model with 2 previously developed nonstationary models. We show that the coupling between speciations and compositional shifts inherent to branchwise models may lead to an overparameterization, resulting in a lesser fit. In some cases, this leads to incorrect conclusions, concerning the nature of the compositional biases. In contrast, our compound model more flexibly adapts its effective number of parameters to the data sets under investigation. Altogether, our results show that accounting for nonstationary sequence evolution may require more elaborate and more flexible models than those currently used.
Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.
2011-01-01
We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875
NASA Astrophysics Data System (ADS)
Harms, J.
1992-03-01
Growth rate expressed as dry weight, elemetnal composition (C, N, H), protein content and nucleotide composition (ATP, ADP, AMP, CTP, GTP and UTP) as well as adenosine were measured in laboratory cultured Hyas araneus larvae fed two different diets. One group was fed freshly hatched Artemia sp. nauplii, the other the diatom Odontella (Biddulphia) sinensis. Growth rate was reduced in the O. sinensis-fed group, reaching 20 to 50% of the growth rate of Artemia-fed larvae. In all cases, some further development to the next instar occurred when larvae were fed O. sinensis, although at reduced levels compared to Artemia-fed larvae. The adenylic energy charge was quite similar for the two nutritional conditions tested and therefore does not reflect the reduced growth rate in O. sinensis-fed larvae. The individual nucleotide content was clearly reduced in O. sinensis-fed larvae, reflecting the nutritional conditions already during early developmental periods. These reduced amount of nucleotides in O. sinensis-fed larvae were most obvious when adenylic nucleotide contents were pooled. Pooled adenylic nucleotides were found to be correlated with the individual content of carbon and protein, showing significant differences at both nutritional conditions tested.
Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.
Seward, Emily A; Kelly, Steven
2016-11-15
Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.
A comprehensive bioinformatic analysis of hepatitis D virus full-length genomes.
Delfino, C M; Cerrudo, C S; Biglione, M; Oubiña, J R; Ghiringhelli, P D; Mathet, V L
2018-02-06
In association with hepatitis B virus (HBV), hepatitis delta virus (HDV) is a subviral agent that may promote severe acute and chronic forms of liver disease. Based on the percentage of nucleotide identity of the genome, HDV was initially classified into three genotypes. However, since 2006, the original classification has been further expanded into eight clades/genotypes. The intergenotype divergence may be as high as 35%-40% over the entire RNA genome, whereas sequence heterogeneity among the isolates of a given genotype is <20%; furthermore, HDV recombinants have been clearly demonstrated. The genetic diversity of HDV is related to the geographic origin of the isolates. This study shows the first comprehensive bioinformatic analysis of the complete available set of HDV sequences, using both nucleotide and protein phylogenies (based on an evolutionary model selection, gamma distribution estimation, tree inference and phylogenetic distance estimation), protein composition analysis and comparison (based on the presence of invariant residues, molecular signatures, amino acid frequencies and mono- and di-amino acid compositional distances), as well as amino acid changes in sequence evolution. Taking into account the congruent and consistent results of both nucleotide and amino acid analyses of GenBank available sequences (recorded as of January, 2017), we propose that the eight hepatitis D virus genotypes may be grouped into three large genogroups fully supported by their shared characteristics. © 2018 John Wiley & Sons Ltd.
Ratkiewicz, A; Galasinski, W
1976-01-01
The characteristics of the ribonucleic acids of Guerin tumor was the subject of this work. The effect of tumor development on the structure of the ribonucleic acids in the liver of tumor bearing rats was studied. Some differences of nucleotide compositions in RNAs isolated from subcellular fractions of liver of control and tumor bearing rats and of cancer tissue were observed. The nucleotide compositions of cancer nuclear RNA is distinctly different from liver RNA. The changes in primary structure of liver RNAs due by development of tumor in rats may be result of metabolic peculiarities of these RNAs.
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam
2014-08-05
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam Huu
2015-11-24
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
NASA Astrophysics Data System (ADS)
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof
Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser
2010-04-20
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Quantitative Understanding of SHAPE Mechanism from RNA Structure and Dynamics Analysis.
Hurst, Travis; Xu, Xiaojun; Zhao, Peinan; Chen, Shi-Jie
2018-05-10
The selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) method probes RNA local structural and dynamic information at single nucleotide resolution. To gain quantitative insights into the relationship between nucleotide flexibility, RNA 3D structure, and SHAPE reactivity, we develop a 3D Structure-SHAPE Relationship model (3DSSR) to rebuild SHAPE profiles from 3D structures. The model starts from RNA structures and combines nucleotide interaction strength and conformational propensity, ligand (SHAPE reagent) accessibility, and base-pairing pattern through a composite function to quantify the correlation between SHAPE reactivity and nucleotide conformational stability. The 3DSSR model shows the relationship between SHAPE reactivity and RNA structure and energetics. Comparisons between the 3DSSR-predicted SHAPE profile and the experimental SHAPE data show correlation, suggesting that the extracted analytical function may have captured the key factors that determine the SHAPE reactivity profile. Furthermore, the theory offers an effective method to sieve RNA 3D models and exclude models that are incompatible with experimental SHAPE data.
Morton, B R; Oberholzer, V M; Clegg, M T
1997-09-01
Substitutions occurring in noncoding sequences of the plant chloroplast genome violate the independence of sites that is assumed by substitution models in molecular evolution. The probability that a substitution at a site is a transversion, as opposed to a transition, increases significantly with increasing A + T content of the two adjacent nucleotides. In the present study, this dependency of substitutions on local context is examined further in a number of noncoding regions from the chloroplast genome of members of the grass family (Poaceae). Two features were examined; the influence of specific neighboring bases, as opposed to the general A + T content, on transversion proportion and an influence on substitutions by nucleotides other than the two immediately adjacent to the site of substitution. In both cases, a significant effect was found. In the case of specific nucleotides, transversion proportion is significantly higher at sites with a pyrimidine immediately 5' on either strand. Substitutions at sites of the type YNR, where N is the site of substitution, have the highest rate of transversion. This specific effect is secondary to the A + T content effect such that, in terms of proportion of substitutions that are transversions, the nucleotides are ranked T > A > C > G as to their effect when they are immediately 5' to the site of substitution. In the case of nucleotides other than the immediate neighbors, a significant influence on substitution dynamics is observed in the case where the two neighboring bases are both A and/or T. Thus, substitutions are primarily, but not exclusively, influenced by the composition of the two nucleotides that are immediately adjacent. These results indicate that the pattern of molecular evolution of the plant chloroplast genome is extremely complex as a result of a variety of inter-site dependencies.
Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Masaki, Shunpei; Nakayama, Hiroshi; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki
2009-11-01
We describe here a mass spectrometry (MS)-based analytical platform of RNA, which combines direct nano-flow reversed-phase liquid chromatography (RPLC) on a spray tip column and a high-resolution LTQ-Orbitrap mass spectrometer. Operating RPLC under a very low flow rate with volatile solvents and MS in the negative mode, we could estimate highly accurate mass values sufficient to predict the nucleotide composition of a approximately 21-nucleotide small interfering RNA, detect post-transcriptional modifications in yeast tRNA, and perform collision-induced dissociation/tandem MS-based structural analysis of nucleolytic fragments of RNA at a sub-femtomole level. Importantly, the method allowed the identification and chemical analysis of small RNAs in ribonucleoprotein (RNP) complex, such as the pre-spliceosomal RNP complex, which was pulled down from cultured cells with a tagged protein cofactor as bait. We have recently developed a unique genome-oriented database search engine, Ariadne, which allows tandem MS-based identification of RNAs in biological samples. Thus, the method presented here has broad potential for automated analysis of RNA; it complements conventional molecular biology-based techniques and is particularly suited for simultaneous analysis of the composition, structure, interaction, and dynamics of RNA and protein components in various cellular RNP complexes.
Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M
2014-01-01
A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays. Published by Elsevier Ireland Ltd.
Ito, Jun; Herter, Thomas; Baidoo, Edward E K; Lao, Jeemeng; Vega-Sánchez, Miguel E; Michelle Smith-Moritz, A; Adams, Paul D; Keasling, Jay D; Usadel, Björn; Petzold, Christopher J; Heazlewood, Joshua L
2014-03-01
Understanding the intricate metabolic processes involved in plant cell wall biosynthesis is limited by difficulties in performing sensitive quantification of many involved compounds. Hydrophilic interaction liquid chromatography is a useful technique for the analysis of hydrophilic metabolites from complex biological extracts and forms the basis of this method to quantify plant cell wall precursors. A zwitterionic silica-based stationary phase has been used to separate hydrophilic nucleotide sugars involved in cell wall biosynthesis from milligram amounts of leaf tissue. A tandem mass spectrometry operating in selected reaction monitoring mode was used to quantify nucleotide sugars. This method was highly repeatable and quantified 12 nucleotide sugars at low femtomole quantities, with linear responses up to four orders of magnitude to several 100pmol. The method was also successfully applied to the analysis of purified leaf extracts from two model plant species with variations in their cell wall sugar compositions and indicated significant differences in the levels of 6 out of 12 nucleotide sugars. The plant nucleotide sugar extraction procedure was demonstrated to have good recovery rates with minimal matrix effects. The approach results in a significant improvement in sensitivity when applied to plant samples over currently employed techniques. Copyright © 2013 Elsevier Inc. All rights reserved.
Nucleic acids encoding antifungal polypeptides and uses thereof
Altier, Daniel J.; Ellanskaya, I. A.; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser
2010-11-02
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include an amino acid sequence, and variants and fragments thereof, for an antipathogenic polypeptide that was isolated from a fungal fermentation broth. Nucleic acid molecules that encode the antipathogenic polypeptides of the invention, and antipathogenic domains thereof, are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Panwar, Bharat; Raghava, Gajendra P S
2015-04-01
The RNA-protein interactions play a diverse role in the cells, thus identification of RNA-protein interface is essential for the biologist to understand their function. In the past, several methods have been developed for predicting RNA interacting residues in proteins, but limited efforts have been made for the identification of protein-interacting nucleotides in RNAs. In order to discriminate protein-interacting and non-interacting nucleotides, we used various classifiers (NaiveBayes, NaiveBayesMultinomial, BayesNet, ComplementNaiveBayes, MultilayerPerceptron, J48, SMO, RandomForest, SMO and SVM(light)) for prediction model development using various features and achieved highest 83.92% sensitivity, 84.82 specificity, 84.62% accuracy and 0.62 Matthew's correlation coefficient by SVM(light) based models. We observed that certain tri-nucleotides like ACA, ACC, AGA, CAC, CCA, GAG, UGA, and UUU preferred in protein-interaction. All the models have been developed using a non-redundant dataset and are evaluated using five-fold cross validation technique. A web-server called RNApin has been developed for the scientific community (http://crdd.osdd.net/raghava/rnapin/). Copyright © 2015 Elsevier Inc. All rights reserved.
Dass, J Febin Prabhu; Sudandiradoss, C
2012-07-15
5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.
Saeed, Isaam; Tang, Sen-Lin; Halgamuge, Saman K.
2012-01-01
An approach to infer the unknown microbial population structure within a metagenome is to cluster nucleotide sequences based on common patterns in base composition, otherwise referred to as binning. When functional roles are assigned to the identified populations, a deeper understanding of microbial communities can be attained, more so than gene-centric approaches that explore overall functionality. In this study, we propose an unsupervised, model-based binning method with two clustering tiers, which uses a novel transformation of the oligonucleotide frequency-derived error gradient and GC content to generate coarse groups at the first tier of clustering; and tetranucleotide frequency to refine these groups at the secondary clustering tier. The proposed method has a demonstrated improvement over PhyloPythia, S-GSOM, TACOA and TaxSOM on all three benchmarks that were used for evaluation in this study. The proposed method is then applied to a pyrosequenced metagenomic library of mud volcano sediment sampled in southwestern Taiwan, with the inferred population structure validated against complementary sequencing of 16S ribosomal RNA marker genes. Finally, the proposed method was further validated against four publicly available metagenomes, including a highly complex Antarctic whale-fall bone sample, which was previously assumed to be too complex for binning prior to functional analysis. PMID:22180538
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu
2018-05-09
The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.
NASA Astrophysics Data System (ADS)
Mackiewicz, P.; Gierlik, A.; Kowalczuk, M.; Szczepanik, D.; Dudek, M. R.; Cebrat, S.
1999-12-01
We have analysed protein coding and intergenic sequences in the Borrelia burgdorferi (the Lyme disease bacterium) genome using different kinds of DNA walks. Genes occupying the leading strand of DNA have significantly different nucleotide composition from genes occupying the lagging strand. Nucleotide compositional bias of the two DNA strands reflects the aminoacid composition of proteins. 96% of genes coding for ribosomal proteins lie on the leading DNA strand, which suggests that the positions of these as well as other genes are non-random. In the B. burgdorferi genome, the asymmetry in intergenic DNA sequences is lower than the asymmetry in the third positions in codons. All these characters of the B. burgdorferi genome suggest that both replication-associated mutational pressure and recombination mechanisms have established the specific structure of the genome and now any recombination leading to inversion of a gene in respect to the direction of replication is forbidden. This property of the genome allows us to assume that it is in a steady state, which enables us to fix some parameters for simulations of DNA evolution.
DNA Asymmetric Strand Bias Affects the Amino Acid Composition of Mitochondrial Proteins
Min, Xiang Jia; Hickey, Donal A.
2007-01-01
Abstract Variations in GC content between genomes have been extensively documented. Genomes with comparable GC contents can, however, still differ in the apportionment of the G and C nucleotides between the two DNA strands. This asymmetric strand bias is known as GC skew. Here, we have investigated the impact of differences in nucleotide skew on the amino acid composition of the encoded proteins. We compared orthologous genes between animal mitochondrial genomes that show large differences in GC and AT skews. Specifically, we compared the mitochondrial genomes of mammals, which are characterized by a negative GC skew and a positive AT skew, to those of flatworms, which show the opposite skews for both GC and AT base pairs. We found that the mammalian proteins are highly enriched in amino acids encoded by CA-rich codons (as predicted by their negative GC and positive AT skews), whereas their flatworm orthologs were enriched in amino acids encoded by GT-rich codons (also as predicted from their skews). We found that these differences in mitochondrial strand asymmetry (measured as GC and AT skews) can have very large, predictable effects on the composition of the encoded proteins. PMID:17974594
Higher-level phylogeny of paraneopteran insects inferred from mitochondrial genome sequences
Li, Hu; Shao, Renfu; Song, Nan; Song, Fan; Jiang, Pei; Li, Zhihong; Cai, Wanzhi
2015-01-01
Mitochondrial (mt) genome data have been proven to be informative for animal phylogenetic studies but may also suffer from systematic errors, due to the effects of accelerated substitution rate and compositional heterogeneity. We analyzed the mt genomes of 25 insect species from the four paraneopteran orders, aiming to better understand how accelerated substitution rate and compositional heterogeneity affect the inferences of the higher-level phylogeny of this diverse group of hemimetabolous insects. We found substantial heterogeneity in base composition and contrasting rates in nucleotide substitution among these paraneopteran insects, which complicate the inference of higher-level phylogeny. The phylogenies inferred with concatenated sequences of mt genes using maximum likelihood and Bayesian methods and homogeneous models failed to recover Psocodea and Hemiptera as monophyletic groups but grouped, instead, the taxa that had accelerated substitution rates together, including Sternorrhyncha (a suborder of Hemiptera), Thysanoptera, Phthiraptera and Liposcelididae (a family of Psocoptera). Bayesian inference with nucleotide sequences and heterogeneous models (CAT and CAT + GTR), however, recovered Psocodea, Thysanoptera and Hemiptera each as a monophyletic group. Within Psocodea, Liposcelididae is more closely related to Phthiraptera than to other species of Psocoptera. Furthermore, Thysanoptera was recovered as the sister group to Hemiptera. PMID:25704094
Replication-associated mutational asymmetry in the human genome.
Chen, Chun-Long; Duquenne, Lauranne; Audit, Benjamin; Guilbaud, Guillaume; Rappailles, Aurélien; Baker, Antoine; Huvet, Maxime; d'Aubenton-Carafa, Yves; Hyrien, Olivier; Arneodo, Alain; Thermes, Claude
2011-08-01
During evolution, mutations occur at rates that can differ between the two DNA strands. In the human genome, nucleotide substitutions occur at different rates on the transcribed and non-transcribed strands that may result from transcription-coupled repair. These mutational asymmetries generate transcription-associated compositional skews. To date, the existence of such asymmetries associated with replication has not yet been established. Here, we compute the nucleotide substitution matrices around replication initiation zones identified as sharp peaks in replication timing profiles and associated with abrupt jumps in the compositional skew profile. We show that the substitution matrices computed in these regions fully explain the jumps in the compositional skew profile when crossing initiation zones. In intergenic regions, we observe mutational asymmetries measured as differences between complementary substitution rates; their sign changes when crossing initiation zones. These mutational asymmetries are unlikely to result from cryptic transcription but can be explained by a model based on replication errors and strand-biased repair. In transcribed regions, mutational asymmetries associated with replication superimpose on the previously described mutational asymmetries associated with transcription. We separate the substitution asymmetries associated with both mechanisms, which allows us to determine for the first time in eukaryotes, the mutational asymmetries associated with replication and to reevaluate those associated with transcription. Replication-associated mutational asymmetry may result from unequal rates of complementary base misincorporation by the DNA polymerases coupled with DNA mismatch repair (MMR) acting with different efficiencies on the leading and lagging strands. Replication, acting in germ line cells during long evolutionary times, contributed equally with transcription to produce the present abrupt jumps in the compositional skew. These results demonstrate that DNA replication is one of the major processes that shape human genome composition.
Simple sequence repeats in Escherichia coli: abundance, distribution, composition, and polymorphism.
Gur-Arie, R; Cohen, C J; Eitan, Y; Shelef, L; Hallerman, E M; Kashi, Y
2000-01-01
Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.
1994-12-31
Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less
Phenomenological Partial Specific Volumes for G-Quadruplex DNAs
Hellman, Lance M.; Rodgers, David W.; Fried, Michael G.
2009-01-01
Accurate partial specific volume (ν̄) values are required for sedimentation velocity and sedimentation equilibrium analyses. For nucleic acids, the estimation of these values is complicated by the fact that ν̄ depends on base composition, secondary structure, solvation and the concentrations and identities of ions in the surrounding buffer. Here we describe sedimentation equilibrium measurements of the apparent isopotential partial specific volume φ′ for two G-quadruplex DNAs and a single-stranded DNA of similar molecular weight and base composition. The G-quadruplex DNAs are a 22 nucleotide fragment of the human telomere consensus sequence and a 27 nucleotide fragment from the human c-myc promoter. The single-stranded DNA is 26 nucleotides long and is designed to have low propensity to form secondary structures. Parallel measurements were made in buffers containing NaCl and in buffers containing KCl, spanning the range 0.09M ≤ [salt] ≤ 2.3M. Limiting values of φ′, extrapolated to [salt] = 0M, were: 22-mer (NaCl-form), 0.525 ± 0.004 mL/g; 22-mer (KCl-form), 0.531 ± 0.006 mL/g; 27-mer (NaCl-form), 0.548 ± 0.005 mL/g; 27-mer (KCl-form), 0.557 ± 0.006 mL/g; 26-mer (NaCl-form), 0.555 ± 0.004 mL/g; 26-mer (KCl-form), 0.564 ± 0.006 mL/g. Small changes in φ′ with [salt] suggest that large changes in counterion association or hydration are unlikely to take place over these concentration ranges. PMID:19238377
Advances and prospects on biomolecules functionalized carbon nanotubes.
Cui, Daxiang
2007-01-01
In recent years, functionalization of carbon nanotubes (CNTs) with biomolecules such as nucleotide acids, proteins, and polymers as well as cells have emerged as a new exciting field. Theoretical and experimental studies of structure and function of bio-inspired CNT composites have made great advances. The importance of nucleic acids, proteins, and polymers to the fundamental developments in CNT-based bio-nano-composites or devices has been recognized. In particular, biomechanics, biochemistry, thermodynamics, electronic, optical, and magnetic properties of the bio-inspired CNT composites have become a new interdisciplinary frontier in life science and nanomaterial science. Here we review some of the main advances in this field over the past few years, explore the application prospects, and discuss the issues, approaches, and challenges, with the aim of stimulating a broader interest in developing CNT-based bio-nanotechnology.
Switchgrass ubiquitin promoter (PVUBI2) and uses thereof
Stewart, C. Neal; Mann, David George James
2013-12-10
The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.
Nucleotide composition analysis of tRNA from leukemia patient cell samples and human cell lines.
Agris, P F
1975-01-01
A technique developed for analysis of less than microgram quantities of tRNA has been applied to the study of human leukemia. Leucocytes from peripheal blood and bone marrow samples of six, untreated leukemia patients and cells of five different established human cell lines were maintained for 18 hours in media containing (32P)-phosphate. Incorporation of radioactive phosphate into the cells from the patient samples was slightly less than that of the cell lines. Likewise, incorporation of (32P)-phosphate into the tRNA of the patient samples (approximately 5 x 106 DPM/mug tRNA) was also less then that incorporated into the tRNA of the cell lines. The major and minor nucleotide compositions of the unfractionated tRNA preparations from each patient sample and each cell line were determined and compared. Similarities and differences in the major and minor nucleotide compositions of the tRNA preparations are discussed with reference to types of leukemia and the importance of patient sample analysis versus analysis of cultured human cells. PMID:1057159
Lin, Chung-Jian; Huang, Chi-Chung; Huang, Chao-Ching; Chiang, Yu-Chung; Chiang, Tzen-Yuh
2012-01-01
Background Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central–marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. Methodology/Principal Findings We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central–marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. Conclusions/Significance The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record. PMID:22952747
Manipulation of lignin composition in plants using a tissue-specific promoter
Chapple, Clinton C. S.
2003-08-26
The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.
Predicting protein-binding regions in RNA using nucleotide profiles and compositions.
Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook
2017-03-14
Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .
Zhou, Shuai; Tang, Qing-Jiu; Zhang, Zhong; Li, Chuan-hua; Cao, Hui; Yang, Yan; Zhang, Jing-Song
2015-01-01
The nutritional composition of three recently domesticated culinary-medicinal mushroom species (Oudemansiella sudmusida, Lentinus squarrosulus, and Tremella aurantialba) was evaluated for contents of protein, fiber, fat, total sugar content, amino acid, carbohydrate, and nucleotide components. The data indicated that fruiting bodies of these three mushroom species contained abundant nutritional substances. The protein contents of L. squarrosulus and O. submucida were 26.32% and 14.70%, which could be comparable to other commercially cultivated species. T. aurantialba contained 74.11% of carbohydrate, of which soluble polysaccharide was 40.55%. Oudemansiella sudmusida contained 15.95% of arabitol as the highest sugar alcohol in three mushrooms. These mushrooms also possessed distinct taste by their flavor component composition. Among them, L. squarrosulus contained 10.68% and 9.25% of monosodium glutamate-like and sweet amino acids, which were higher than the other two mushrooms. However, the nucleotide amounts of the three mushrooms were all lower than those of other commercially cultivated mushrooms. Among them, L. squarrosulus contained the highest amount of flavor nucleotides, which was 1.01‰. Results revealed that these three mushroom species are potentially suitable resources for commercial cultivation and healthy food.
Vieira, Elsa; Brandão, Tiago; Ferreira, Isabel M P L V O
2013-09-18
The present work evaluates the influence of serial yeast repitching on nucleotide composition of brewer's spent yeast extracts produced without addition of exogenous enzymes. Two procedures for disrupting cell walls were compared, and the conditions for low-cost and efficient RNA hydrolysis were selected. A HILIC methodology was validated for the quantification of nucleotides and nucleosides in yeast extracts. Thirty-seven samples of brewer's spent yeast ( Saccharomyces pastorianus ) organized according to the number of serial repitchings were analyzed. Nucleotides accounted for 71.1-88.2% of the RNA products; 2'AMP was the most abundant (ranging between 0.08 and 2.89 g/100 g dry yeast). 5'GMP content ranged between 0.082 and 0.907 g/100 g dry yeast. The sum of 5'GMP, 5'IMP, and 5'AMP represented between 25 and 32% of total nucleotides. This works highlights for the first time that although serial repitching influences the content of monophosphate nucleotides and nucleosides, the profiles of these RNA hydrolysis products are not affected.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Methods for making nucleotide probes for sequencing and synthesis
Church, George M; Zhang, Kun; Chou, Joseph
2014-07-08
Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided.
Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism
Gur-Arie, Riva; Cohen, Cyril J.; Eitan, Yuval; Shelef, Leora; Hallerman, Eric M.; Kashi, Yechezkel
2000-01-01
Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AF209020–209030 and AF209508–209518.] PMID:10645951
Compositional searching of CpG islands in the human genome
NASA Astrophysics Data System (ADS)
Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón
2005-06-01
We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.
Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen
2015-04-15
In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Hu, Xiao-di; Gao, Li-zhi
2016-01-01
In this study, we determined the complete mitochondrial (mt) genome of eastern lowland gorilla, Gorilla beringei graueri for the first time. The total genome was 16,416 bp in length. It contained a total of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and 1 control region (D-loop region). The base composition was A (30.88%), G (13.10%), C (30.89%) and T (25.13%), indicating that the percentage of A+T (56.01%) was higher than G+C (43.99%). Comparisons with the other publicly available Gorilla mitogenome showed the conservation of gene order and base compositions but a bunch of nucleotide diversity. This complete mitochondrial genome sequence will provide valuable genetic information for further studies on conservation genetics of eastern lowland gorilla.
Updating Our View of Organelle Genome Nucleotide Landscape
Smith, David Roy
2012-01-01
Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299
Lee, Sheila; McMullen, D.; Brown, G. L.; Stokes, A. R.
1965-01-01
1. A theoretical analysis of the errors in multicomponent spectrophotometric analysis of nucleoside mixtures, by a least-squares procedure, has been made to obtain an expression for the error coefficient, relating the error in calculated concentration to the error in extinction measurements. 2. The error coefficients, which depend only on the `library' of spectra used to fit the experimental curves, have been computed for a number of `libraries' containing the following nucleosides found in s-RNA: adenosine, guanosine, cytidine, uridine, 5-ribosyluracil, 7-methylguanosine, 6-dimethylaminopurine riboside, 6-methylaminopurine riboside and thymine riboside. 3. The error coefficients have been used to determine the best conditions for maximum accuracy in the determination of the compositions of nucleoside mixtures. 4. Experimental determinations of the compositions of nucleoside mixtures have been made and the errors found to be consistent with those predicted by the theoretical analysis. 5. It has been demonstrated that, with certain precautions, the multicomponent spectrophotometric method described is suitable as a basis for automatic nucleotide-composition analysis of oligonucleotides containing nine nucleotides. Used in conjunction with continuous chromatography and flow chemical techniques, this method can be applied to the study of the sequence of s-RNA. PMID:14346087
Liu, Bin; Long, Ren; Chou, Kuo-Chen
2016-08-15
Regulatory DNA elements are associated with DNase I hypersensitive sites (DHSs). Accordingly, identification of DHSs will provide useful insights for in-depth investigation into the function of noncoding genomic regions. In this study, using the strategy of ensemble learning framework, we proposed a new predictor called iDHS-EL for identifying the location of DHS in human genome. It was formed by fusing three individual Random Forest (RF) classifiers into an ensemble predictor. The three RF operators were respectively based on the three special modes of the general pseudo nucleotide composition (PseKNC): (i) kmer, (ii) reverse complement kmer and (iii) pseudo dinucleotide composition. It has been demonstrated that the new predictor remarkably outperforms the relevant state-of-the-art methods in both accuracy and stability. For the convenience of most experimental scientists, a web server for iDHS-EL is established at http://bioinformatics.hitsz.edu.cn/iDHS-EL, which is the first web-server predictor ever established for identifying DHSs, and by which users can easily get their desired results without the need to go through the mathematical details. We anticipate that IDHS-EL: will become a very useful high throughput tool for genome analysis. bliu@gordonlifescience.org or bliu@insun.hit.edu.cn Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Optimization of protein buffer cocktails using Thermofluor.
Reinhard, Linda; Mayerhofer, Hubert; Geerlof, Arie; Mueller-Dieckmann, Jochen; Weiss, Manfred S
2013-02-01
The stability and homogeneity of a protein sample is strongly influenced by the composition of the buffer that the protein is in. A quick and easy approach to identify a buffer composition which increases the stability and possibly the conformational homogeneity of a protein sample is the fluorescence-based thermal-shift assay (Thermofluor). Here, a novel 96-condition screen for Thermofluor experiments is presented which consists of buffer and additive parts. The buffer screen comprises 23 different buffers and the additive screen includes small-molecule additives such as salts and nucleotide analogues. The utilization of small-molecule components which increase the thermal stability of a protein sample frequently results in a protein preparation of higher quality and quantity and ultimately also increases the chances of the protein crystallizing.
The complete mitochondrial genome of Cricetulus kamensis (Rodentia: Cricetidae).
Kang, Chunlan; Yue, Hao; Liu, Mengyao; Huang, Ting; Liu, Yang; Zhang, Xiuyue; Yue, Bisong; Zeng, Tao; Liu, Shaoying
2016-01-01
The Cricetulus kamensis is endemic to China and is popular as pet. In the present study, the complete mitogenome of C. kamensis was first determined. It was 16,270 bp in length and the composition and arrangement of its genes are analogous to most other mammals. The overall base composition of heavy strand is 33.2% A, 26.8% T, 27.2% C and 12.7% G. The sequence is highly G-C poor (∼40%) and A is the most numerous nucleotide followed by T >C >G, which is similar to other mammalian mitochondrial genomes. It is notable that three extra bases "CAT" were inserted in cytb at the 3' end position and no stop codon was found for this coding region. The mitogenome sequence of C. kamensis could contribute to a better solution of its phylogenetic position and phylogenetic relationship within Cricetinae in the future.
The mitochondrial genome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae).
Xin, Tianrong; Li, Lei; Yao, Chengyi; Wang, Yayu; Zou, Zhiwen; Wang, Jing; Xia, Bin
2016-07-01
We present the complete mitogenome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae) in this article. The mitogenome was a circle molecular consisting of 15,286 nucleotides, 37 genes, and an A + T-rich region. The order of 37 genes was typical of insect mitochondrial DNA sequences described to date. The overall base composition of the genome is A (37.41%), T (42.80%), C (11.87%), and G (7.91%) with an A + T-rich hallmark as that of other invertebrate mitochondrial genomes. The start codon was mainly ATA in most of the mitochondrial protein-coding genes such as ND2, COI, ATP8, ND3, ND5, ND4, ND6, and ND1, but COII, ATP6, COIII, ND4L, and Cob genes employing ATG. The stop codon was TAA in all the protein-coding genes. The A + T region is located between 12S rRNA and tRNA(M)(et). The phylogenetic relationships of Lepidoptera species were constructed based on the nucleotides sequences of 13 PCGs of mitogenomes using the neighbor-joining method. The molecular-based phylogeny supported the traditional morphological classification on relationships within Lepidoptera species.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Lim, Chun Shen; Brown, Chris M
2016-09-01
Many viruses contain RNA elements that modulate splicing and/or promote nuclear export of their RNAs. The RNAs of the major human pathogen, hepatitis B virus (HBV) contain a large (~600 bases) composite cis-acting 'post-transcriptional regulatory element' (PRE). This element promotes expression from these naturally intronless transcripts. Indeed, the related woodchuck hepadnavirus PRE (WPRE) is used to enhance expression in gene therapy and other expression vectors. These PRE are likely to act through a combination of mechanisms, including promotion of RNA nuclear export. Functional components of both the HBV PRE and WPRE are 2 conserved RNA cis-acting stem-loop (SL) structures, SLα and SLβ. They are within the coding regions of polymerase (P) gene, and both P and X genes, respectively. Based on previous studies using mutagenesis and/or nuclear magnetic resonance (NMR), here we propose 2 covariance models for SLα and SLβ. The model for the 30-nucleotide SLα contains a G-bulge and a CNGG(U) apical loop of which the first and the fourth loop residues form a CG pair and the fifth loop residue is bulged out, as observed in the NMR structure. The model for the 23-nucleotide SLβ contains a 7-base-pair stem and a 9-nucleotide loop. Comparison of the models with other RNA structural elements, as well as similarity searches of human transcriptome and viral genomes demonstrate that SLα and SLβ are specific to HBV transcripts. However, they are well conserved among the hepadnaviruses of non-human primates, the woodchuck and ground squirrel.
Lim, Chun Shen; Brown, Chris M.
2016-01-01
ABSTRACT Many viruses contain RNA elements that modulate splicing and/or promote nuclear export of their RNAs. The RNAs of the major human pathogen, hepatitis B virus (HBV) contain a large (~600 bases) composite cis-acting 'post-transcriptional regulatory element' (PRE). This element promotes expression from these naturally intronless transcripts. Indeed, the related woodchuck hepadnavirus PRE (WPRE) is used to enhance expression in gene therapy and other expression vectors. These PRE are likely to act through a combination of mechanisms, including promotion of RNA nuclear export. Functional components of both the HBV PRE and WPRE are 2 conserved RNA cis-acting stem-loop (SL) structures, SLα and SLβ. They are within the coding regions of polymerase (P) gene, and both P and X genes, respectively. Based on previous studies using mutagenesis and/or nuclear magnetic resonance (NMR), here we propose 2 covariance models for SLα and SLβ. The model for the 30-nucleotide SLα contains a G-bulge and a CNGG(U) apical loop of which the first and the fourth loop residues form a CG pair and the fifth loop residue is bulged out, as observed in the NMR structure. The model for the 23-nucleotide SLβ contains a 7-base-pair stem and a 9-nucleotide loop. Comparison of the models with other RNA structural elements, as well as similarity searches of human transcriptome and viral genomes demonstrate that SLα and SLβ are specific to HBV transcripts. However, they are well conserved among the hepadnaviruses of non-human primates, the woodchuck and ground squirrel. PMID:27031749
Improved nucleic acid descriptors for siRNA efficacy prediction.
Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V
2013-02-01
Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.
Composition bias and the origin of ORFan genes
Yomtovian, Inbal; Teerakulkittipong, Nuttinee; Lee, Byungkook; Moult, John; Unger, Ron
2010-01-01
Motivation: Intriguingly, sequence analysis of genomes reveals that a large number of genes are unique to each organism. The origin of these genes, termed ORFans, is not known. Here, we explore the origin of ORFan genes by defining a simple measure called ‘composition bias’, based on the deviation of the amino acid composition of a given sequence from the average composition of all proteins of a given genome. Results: For a set of 47 prokaryotic genomes, we show that the amino acid composition bias of real proteins, random ‘proteins’ (created by using the nucleotide frequencies of each genome) and ‘proteins’ translated from intergenic regions are distinct. For ORFans, we observed a correlation between their composition bias and their relative evolutionary age. Recent ORFan proteins have compositions more similar to those of random ‘proteins’, while the compositions of more ancient ORFan proteins are more similar to those of the set of all proteins of the organism. This observation is consistent with an evolutionary scenario wherein ORFan genes emerged and underwent a large number of random mutations and selection, eventually adapting to the composition preference of their organism over time. Contact: ron@biocoml.ls.biu.ac.il Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20231229
Biological nanopore MspA for DNA sequencing
NASA Astrophysics Data System (ADS)
Manrao, Elizabeth A.
Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.
MAGGIO, R; SIEKEVITZ, P; PALADE, G E
1963-08-01
This paper describes the subfractionation of nuclei isolated from guinea pig liver by the procedure presented in the first article of the series (8). Centrifugation in a density gradient system of nuclear fractions disrupted by sonication permits the isolation of the following subfractions: (a) a nucleolar subfraction which consists mainly of nucleoli surrounded by a variable amount of nucleolus-associated chromatin and contaminated by chromatin blocks derived primarily from von Kupffer cell nuclei; (b) and (c), two nucleoplasmic subfractions (I and II) which consist mainly of chromatin threads in a coarser (I) or finer (II) degree of fragmentation. The protein, RNA, and DNA content of these subfractions was determined, and their RNA's characterized in terms of NaCl-solubility, nucleotide composition, and in vivo nucleotide turnover, using inorganic (32)P as a marker. The results indicate that there are at least three types of RNA in the nucleus (one in the nucleolus and two in the nucleoplasm or chromatin), which differ from one another in NaCl-solubility, nucleotide composition, turnover, and possibly sequence. Possible relations among these RNA's and those of the cytoplasm are discussed.
Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika
2014-12-12
GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.
Prediction of siRNA potency using sparse logistic regression.
Hu, Wei; Hu, John
2014-06-01
RNA interference (RNAi) can modulate gene expression at post-transcriptional as well as transcriptional levels. Short interfering RNA (siRNA) serves as a trigger for the RNAi gene inhibition mechanism, and therefore is a crucial intermediate step in RNAi. There have been extensive studies to identify the sequence characteristics of potent siRNAs. One such study built a linear model using LASSO (Least Absolute Shrinkage and Selection Operator) to measure the contribution of each siRNA sequence feature. This model is simple and interpretable, but it requires a large number of nonzero weights. We have introduced a novel technique, sparse logistic regression, to build a linear model using single-position specific nucleotide compositions which has the same prediction accuracy of the linear model based on LASSO. The weights in our new model share the same general trend as those in the previous model, but have only 25 nonzero weights out of a total 84 weights, a 54% reduction compared to the previous model. Contrary to the linear model based on LASSO, our model suggests that only a few positions are influential on the efficacy of the siRNA, which are the 5' and 3' ends and the seed region of siRNA sequences. We also employed sparse logistic regression to build a linear model using dual-position specific nucleotide compositions, a task LASSO is not able to accomplish well due to its high dimensional nature. Our results demonstrate the superiority of sparse logistic regression as a technique for both feature selection and regression over LASSO in the context of siRNA design.
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Enzymatic Incorporation of Modified Purine Nucleotides in DNA.
Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet
2017-12-14
A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Cuomo, Francesca; Mosca, Monica; Murgia, Sergio; Avino, Pasquale; Ceglie, Andrea; Lopez, Francesco
2013-11-15
In this work, the interaction of nucleotide-monophosphates (NMPs) with unilamellar liposomes made of 1,2-Dioleoyl-3-Trimethylammonium-Propane (DOTAP) and 1,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine (DOPE) was investigated. Here, we demonstrate how adsorption is affected by the type of nucleotide-monophosphate. Dynamic light scattering (DLS) results revealed, for each NMP, that a distinguishable concentration exists at which a significant growth of the aggregates occurs. Adenosine 5'-monophosphate (AMP) and guanosine 5'-monophosphate (GMP) have shown a higher propensity to induce liposome aggregation process and in particular GMP appears to be the most effective. From ζ-potential experiments we found that liposomes loaded with purine based nucleotides (AMP and GMP) are able to decrease the ζ-potential values to a greater extent in comparison with the pyrimidine based nucleotides thimydine 5'-monophosphate (TMP) and uridine 5'-monophosphate (UMP). Moreover, a careful analysis of nucleotide-liposome interactions revealed that nucleotides have different capacity to induce the formation of nucleotide-liposome complexes, and purine based nucleotides have higher affinities with lipid membranes. On the whole, the data emphasize that the mechanisms driving the interactions between liposomes and NMPs are also influenced by the existence of hydrophobic forces. Copyright © 2013 Elsevier Inc. All rights reserved.
Yu-Han, Qian; Hai-Yan, Wu; Xiao-Yu, Ji; Wei-Wei, Yu; Yu-Zhou, Du
2014-01-01
This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848–15651) and stem-loop 2 (15965–15998). The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera. PMID:24466028
Yu-Han, Qian; Hai-Yan, Wu; Xiao-Yu, Ji; Wei-Wei, Yu; Yu-Zhou, Du
2014-01-01
This study determined the mitochondrial genome sequence of the stonefly, Kamimuria wangi. In order to investigate the relatedness of stonefly to other members of Neoptera, a phylogenetic analysis was undertaken based on 13 protein-coding genes of mitochondrial genomes in 13 representative insects. The mitochondrial genome of the stonefly is a circular molecule consisting of 16,179 nucleotides and contains the 37 genes typically found in other insects. A 10-bp poly-T stretch was observed in the A+T-rich region of the K. wangi mitochondrial genome. Downstream of the poly-T stretch, two regions were located with potential ability to form stem-loop structures; these were designated stem-loop 1 (positions 15848-15651) and stem-loop 2 (15965-15998). The arrangement of genes and nucleotide composition of the K. wangi mitogenome are similar to those in Pteronarcys princeps, suggesting a conserved genome evolution within the Plecoptera. Phylogenetic analysis using maximum likelihood and Bayesian inference of 13 protein-coding genes supported a novel relationship between the Plecoptera and Ephemeroptera. The results contradict the existence of a monophyletic Plectoptera and Plecoptera as sister taxa to Embiidina, and thus requires further analyses with additional mitogenome sampling at the base of the Neoptera.
2012-01-01
Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225
High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions
Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.
2014-01-01
In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853
Gasowska, A
2005-08-01
The interactions between pyrimidine nucleotides: cytidine-5'-diphosphate (CDP) and cytidine-5'-triphosphate (CTP) and Cu(II) ions, spermine (Spm) and 1,11-diamino-4,8-diazaundecane (3,3,3-tet) have been studied. The composition and stability constants of the complexes formed have been determined by means of the potentiometric method, while the centres of interactions in the ligands have been identified by the spectral methods (UV-Vis, Ultraviolet and Visible spectroscopy; EPR, electron spin resonance; NMR). In the systems without metal, formation of the molecular complexes nucleotide-polyamine with the interaction centres at the endocyclic nitrogen atom of purine ring N3, the oxygen atoms of the phosphate group from the nucleotide and protonated nitrogen atoms of the polyamine have been detected. Significant differences have been found in the metallation between the systems with Spm and with 3,3,3-tet. In the systems with spermine, mainly protonated species are formed with the phosphate group of the nucleotide and deprotonated nitrogen atoms of the polyamine making the coordination centres, while the donor nitrogen atom of the nucleotide N3 is involved in the intramolecular interligand interactions, additionally stabilising the complex. In the systems with 3,3,3-tet, the MLL' type species are formed in which the oxygen atoms of the phosphate group and nitrogen atoms of the polyamine are involved in metallation, whereas the N3 atom from the pyrimidine ring of the nucleotide is located outside the inner coordination sphere of copper ion. The main centre of Cu(II) interaction in the nucleotide, both in the system with Spm and 3,3,3-tet is the phosphate group of the nucleotide.
Changes in base composition bias of nuclear and mitochondrial genes in lice (Insecta: Psocodea).
Yoshizawa, Kazunori; Johnson, Kevin P
2013-12-01
While it is well known that changes in the general processes of molecular evolution have occurred on a variety of timescales, the mechanisms underlying these changes are less well understood. Parasitic lice ("Phthiraptera") and their close relatives (infraorder Nanopsocetae of the insect order Psocodea) are a group of insects well known for their unusual features of molecular evolution. We examined changes in base composition across parasitic lice and bark lice. We identified substantial differences in percent GC content between the clade comprising parasitic lice plus closely related bark lice (=Nanopsocetae) versus all other bark lice. These changes occurred for both nuclear and mitochondrial protein coding and ribosomal RNA genes, often in the same direction. To evaluate whether correlations in base composition change also occurred within lineages, we used phylogenetically controlled comparisons, and in this case few significant correlations were identified. Examining more constrained sites (first/second codon positions and rRNA) revealed that, in comparison to the other bark lice, the GC content of parasitic lice and close relatives tended towards 50 % either up from less than 50 % GC or down from greater than 50 % GC. In contrast, less constrained sites (third codon positions) in both nuclear and mitochondrial genes showed less of a consistent change of base composition in parasitic lice and very close relatives. We conclude that relaxed selection on this group of insects is a potential explanation of the change in base composition for both mitochondrial and nuclear genes, which could lead to nucleotide frequencies closer to random expectation (i.e., 50 % GC) in the absence of any mutation bias. Evidence suggests this relaxed selection arose once in the non-parasitic common ancestor of Phthiraptera + Nanopsocetae and is not directly related to the evolution of the parasitism in lice.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun
2016-10-01
As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.
The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.
Schnitzler, P; Handermann, M; Szépe, O; Darai, G
1991-06-01
The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-06-06
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-05-30
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Beddows, Amanda; Patel, Nikesh; Finger, L David; Atack, John M; Williams, David M; Grasby, Jane A
2012-09-14
Flap endonucleases (FENs) are proposed to select their target phosphate diester by unpairing the two terminal nucleotides of duplex. Interstrand disulfide crosslinks, introduced by oxidation of thiouracil and thioguanine bases, abolished the specificity of human FEN1 for hydrolysis one nucleotide into the 5'-duplex.
Torshin, Ivan Y.
2004-01-01
Ribozymes are functionally diverse RNA molecules with intrinsic catalytic activity. Multiple structural and biochemical studies are required to establish which nucleotide bases are involved in the catalysis. The relative energetic properties of the nucleotide bases have been analyzed in a set of the known ribozyme structures. It was found that many of the known catalytic nucleotides can be identified using only the structure without any additional biochemical data. The results of the calculations compare well with the available biochemical data on RNA stability. Extensive in silico mutagenesis suggests that most of the nucleotides in ribozymes stabilize the RNA. The calculations show that relative contribution of the catalytic bases to RNA stability observably differs from contributions of the noncatalytic bases. Distinction between the concepts of “relative stability” and “mutational stability” is suggested. As results of prediction for several models of ribozymes appear to be in agreement with the published data on the potential active site regions, the method can potentially be used for prediction of functional nucleotides from nucleic sequence. PMID:15105962
Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter
2014-01-13
Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.
Ibarbalz, Federico M.; Orellana, Esteban; Figuerola, Eva L. M.
2016-01-01
ABSTRACT This study was conducted to investigate whether functions encoded in the metagenome could improve our ability to understand the link between microbial community structures and functions in activated sludge. By analyzing data sets from six industrial and six municipal wastewater treatment plants (WWTPs), covering different configurations, operational conditions, and geographic regions, we found that wastewater influent composition was an overriding factor shaping the metagenomic composition of the activated sludge samples. Community GC content profiles were conserved within treatment plants on a time scale of years and between treatment plants with similar influent wastewater types. Interestingly, GC contents of the represented phyla covaried with the average GC contents of the corresponding WWTP metagenome. This suggests that the factors influencing nucleotide composition act similarly across taxa and thus the variation in nucleotide contents is driven by environmental differences between WWTPs. While taxonomic richness and functional richness were correlated, shotgun metagenomics complemented taxon-based analyses in the task of classifying microbial communities involved in wastewater treatment systems. The observed taxonomic dissimilarity between full-scale WWTPs receiving influent types with varied compositions, as well as the inferred taxonomic and functional assignment of recovered genomes from each metagenome, were consistent with underlying differences in the abundance of distinctive sets of functional categories. These conclusions were robust with respect to plant configuration, operational and environmental conditions, and even differences in laboratory protocols. IMPORTANCE This work contributes to the elucidation of drivers of microbial community assembly in wastewater treatment systems. Our results are significant because they provide clear evidence that bacterial communities in WWTPs assemble mainly according to influent wastewater characteristics. Differences in bacterial community structures between WWTPs were consistent with differences in the abundance of distinctive sets of functional categories, which were related to the metabolic potential that would be expected according to the source of the wastewater. PMID:27316957
Kristián, Tibor; Weatherby, Tina M; Bates, Timothy E; Fiskum, Gary
2002-12-01
Calcium overload of neural cell mitochondria plays a key role in excitotoxic and ischemic brain injury. This study tested the hypothesis that brain mitochondria consist of subpopulations with differential sensitivity to calcium-induced inner membrane permeability transition, and that this sensitivity is greatly reduced by physiological levels of adenine nucleotides. Isolated non-synaptosomal rat brain mitochondria were incubated in a potassium-based medium in the absence or presence of ATP or ADP. Measurements were made of medium and intramitochondrial free calcium, light scattering, mitochondrial ultrastructure, and the elemental composition of electron-opaque deposits within mitochondria treated with calcium. In the absence of adenine nucleotides, calcium induced a partial decrease in light scattering, accompanied by three distinct ultrastructural morphologies, including large-amplitude swelling, matrix vacuolization and a normal appearance. In the presence of ATP or ADP the mitochondrial calcium uptake capacity was greatly enhanced and calcium induced an increase rather than a decrease in mitochondrial light scattering. Approximately 10% of the mitochondria appeared damaged and the rest contained electron-dense precipitates that contained calcium, as determined by electron-energy loss spectroscopy. These results indicate that brain mitochondria are heterogeneous in their response to calcium. In the absence of adenine nucleotides, approximately 20% of the mitochondrial population exhibit morphological alterations consistent with activation of the permeability transition, but less than 10% exhibit evidence of osmotic swelling and membrane disruption in the presence of ATP or ADP.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2015-01-01
The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000
Lakshmanan, Lakshmi Narayanan; Gruber, Jan; Halliwell, Barry; Gunawan, Rudiyanto
2015-01-01
Non D-loop direct repeats (DRs) in mitochondrial DNA (mtDNA) have been commonly implicated in the mutagenesis of mtDNA deletions associated with neuromuscular disease and ageing. Further, these DRs have been hypothesized to put a constraint on the lifespan of mammals and are under a negative selection pressure. Using a compendium of 294 mammalian mtDNA, we re-examined the relationship between species lifespan and the mutagenicity of such DRs. Contradicting the prevailing hypotheses, we found no significant evidence that long-lived mammals possess fewer mutagenic DRs than short-lived mammals. By comparing DR counts in human mtDNA with those in selectively randomized sequences, we also showed that the number of DRs in human mtDNA is primarily determined by global mtDNA properties, such as the bias in synonymous codon usage (SCU) and nucleotide composition. We found that SCU bias in mtDNA positively correlates with DR counts, where repeated usage of a subset of codons leads to more frequent DR occurrences. While bias in SCU and nucleotide composition has been attributed to nucleotide mutational bias, mammalian mtDNA still exhibit higher SCU bias and DR counts than expected from such mutational bias, suggesting a lack of negative selection against non D-loop DRs. PMID:25855815
Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide
Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; ...
2014-11-17
Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2’-deoxyguanosine found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate E. coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerase discriminates between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities,more » nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine (Cy) and 8-oxodGTP(syn) utilizes its Hoogsteen edge to base pair with adenine (Ad). Here in this paper we utilized time-lapse crystallography to follow 8-oxo-dGTP insertion opposite Ad or Cy with human DNA pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxodGTP utilizes charge modulation during insertion that can lead to a blocked DNA repair intermediate.« less
Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide
NASA Astrophysics Data System (ADS)
Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.
2015-01-01
Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2014 CFR
2014-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2013 CFR
2013-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2012 CFR
2012-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
Marasco, Michelle; Li, Weiyi; Lynch, Michael
2017-01-01
Abstract All eukaryotes have three essential nuclear multisubunit RNA polymerases, abbreviated as Pol I, Pol II and Pol III. Plants are remarkable in having two additional multisubunit RNA polymerases, Pol IV and Pol V, which synthesize noncoding RNAs that coordinate RNA-directed DNA methylation for silencing of transposons and a subset of genes. Based on their subunit compositions, Pols IV and V clearly evolved as specialized forms of Pol II, but their catalytic properties remain undefined. Here, we show that Pols IV and V differ from one another, and Pol II, in nucleotide incorporation rate, transcriptional accuracy and the ability to discriminate between ribonucleotides and deoxyribonucleotides. Pol IV transcription is considerably more error-prone than Pols II or V, which may be tolerable in its synthesis of short RNAs that serve as precursors for siRNAs targeting non-identical members of transposon families. By contrast, Pol V exhibits high fidelity transcription, similar to Pol II, suggesting a need for Pol V transcripts to faithfully reflect the DNA sequence of target loci to which siRNA–Argonaute silencing complexes are recruited. PMID:28977461
Heterozygote PCR product melting curve prediction.
Dwight, Zachary L; Palais, Robert; Kent, Jana; Wittwer, Carl T
2014-03-01
Melting curve prediction of PCR products is limited to perfectly complementary strands. Multiple domains are calculated by recursive nearest neighbor thermodynamics. However, the melting curve of an amplicon containing a heterozygous single-nucleotide variant (SNV) after PCR is the composite of four duplexes: two matched homoduplexes and two mismatched heteroduplexes. To better predict the shape of composite heterozygote melting curves, 52 experimental curves were compared with brute force in silico predictions varying two parameters simultaneously: the relative contribution of heteroduplex products and an ionic scaling factor for mismatched tetrads. Heteroduplex products contributed 25.7 ± 6.7% to the composite melting curve, varying from 23%-28% for different SNV classes. The effect of ions on mismatch tetrads scaled to 76%-96% of normal (depending on SNV class) and averaged 88 ± 16.4%. Based on uMelt (www.dna.utah.edu/umelt/umelt.html) with an expanded nearest neighbor thermodynamic set that includes mismatched base pairs, uMelt HETS calculates helicity as a function of temperature for homoduplex and heteroduplex products, as well as the composite curve expected from heterozygotes. It is an interactive Web tool for efficient genotyping design, heterozygote melting curve prediction, and quality control of melting curve experiments. The application was developed in Actionscript and can be found online at http://www.dna.utah.edu/hets/. © 2013 WILEY PERIODICALS, INC.
Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.
Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka
2014-01-01
Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.
Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra
2017-11-01
Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.
Goncearenco, Alexander; Ma, Bin-Guang; Berezovsky, Igor N
2014-03-01
DNA, RNA and proteins are major biological macromolecules that coevolve and adapt to environments as components of one highly interconnected system. We explore here sequence/structure determinants of mechanisms of adaptation of these molecules, links between them, and results of their mutual evolution. We complemented statistical analysis of genomic and proteomic sequences with folding simulations of RNA molecules, unraveling causal relations between compositional and sequence biases reflecting molecular adaptation on DNA, RNA and protein levels. We found many compositional peculiarities related to environmental adaptation and the life style. Specifically, thermal adaptation of protein-coding sequences in Archaea is characterized by a stronger codon bias than in Bacteria. Guanine and cytosine load in the third codon position is important for supporting the aerobic life style, and it is highly pronounced in Bacteria. The third codon position also provides a tradeoff between arginine and lysine, which are favorable for thermal adaptation and aerobicity, respectively. Dinucleotide composition provides stability of nucleic acids via strong base-stacking in ApG dinucleotides. In relation to coevolution of nucleic acids and proteins, thermostability-related demands on the amino acid composition affect the nucleotide content in the second codon position in Archaea.
Goncearenco, Alexander; Ma, Bin-Guang; Berezovsky, Igor N.
2014-01-01
DNA, RNA and proteins are major biological macromolecules that coevolve and adapt to environments as components of one highly interconnected system. We explore here sequence/structure determinants of mechanisms of adaptation of these molecules, links between them, and results of their mutual evolution. We complemented statistical analysis of genomic and proteomic sequences with folding simulations of RNA molecules, unraveling causal relations between compositional and sequence biases reflecting molecular adaptation on DNA, RNA and protein levels. We found many compositional peculiarities related to environmental adaptation and the life style. Specifically, thermal adaptation of protein-coding sequences in Archaea is characterized by a stronger codon bias than in Bacteria. Guanine and cytosine load in the third codon position is important for supporting the aerobic life style, and it is highly pronounced in Bacteria. The third codon position also provides a tradeoff between arginine and lysine, which are favorable for thermal adaptation and aerobicity, respectively. Dinucleotide composition provides stability of nucleic acids via strong base-stacking in ApG dinucleotides. In relation to coevolution of nucleic acids and proteins, thermostability-related demands on the amino acid composition affect the nucleotide content in the second codon position in Archaea. PMID:24371267
Jiang, Shao-Tong; Hong, Gui-Yun; Yu, Miao; Li, Na; Yang, Ying; Liu, Yan-Qun; Wei, Zhao-Jun
2009-05-22
The complete mitochondrial genome (mitogenome) of Eriogyna pyretorum (Lepidoptera: Saturniidae) was determined as being composed of 15,327 base pairs (bp), including 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The arrangement of the PCGs is the same as that found in the other sequenced lepidopteran. The AT skewness for the E. pyretorum mitogenome is slightly negative (-0.031), indicating the occurrence of more Ts than As. The nucleotide composition of the E. pyretorum mitogenome is also biased toward A + T nucleotides (80.82%). All PCGs are initiated by ATN codons, except for cytochrome c oxidase subunit 1 and 2 (cox1 and cox2). Two of the 13 PCGs harbor the incomplete termination codon by T. All tRNA genes have a typical clover-leaf structure of mitochondrial tRNA, with the exception of trnS1(AGN) and trnS2(UCN). Phylogenetic analysis among the available lepidopteran species supports the current morphology-based hypothesis that Bombycoidea, Geometroidea, Notodontidea, Papilionoidea and Pyraloidea are monophyletic. As has been previously suggested, Bombycidae (Bombyx mori and Bombyx mandarina), Sphingoidae (Manduca sexta) and Saturniidae (Antheraea pernyi, Antheraea yamamai, E. pyretorum and Caligula boisduvalii) formed a group.
Jiang, Shao-Tong; Hong, Gui-Yun; Yu, Miao; Li, Na; Yang, Ying; Liu, Yan-Qun; Wei, Zhao-Jun
2009-01-01
The complete mitochondrial genome (mitogenome) of Eriogyna pyretorum (Lepidoptera: Saturniidae) was determined as being composed of 15,327 base pairs (bp), including 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The arrangement of the PCGs is the same as that found in the other sequenced lepidopteran. The AT skewness for the E. pyretorum mitogenome is slightly negative (-0.031), indicating the occurrence of more Ts than As. The nucleotide composition of the E. pyretorum mitogenome is also biased toward A + T nucleotides (80.82%). All PCGs are initiated by ATN codons, except for cytochrome c oxidase subunit 1 and 2 (cox1 and cox2). Two of the 13 PCGs harbor the incomplete termination codon by T. All tRNA genes have a typical clover-leaf structure of mitochondrial tRNA, with the exception of trnS1(AGN) and trnS2(UCN). Phylogenetic analysis among the available lepidopteran species supports the current morphology-based hypothesis that Bombycoidea, Geometroidea, Notodontidea, Papilionoidea and Pyraloidea are monophyletic. As has been previously suggested, Bombycidae (Bombyx mori and Bombyx mandarina), Sphingoidae (Manduca sexta) and Saturniidae (Antheraea pernyi, Antheraea yamamai, E. pyretorum and Caligula boisduvalii) formed a group. PMID:19471586
Traceability of Plant Diet Contents in Raw Cow Milk Samples
Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego
2009-01-01
The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982
Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.
Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen
2014-04-15
In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hao, Juan-Juan; Hao, Jia-Sheng; Sun, Xiao-Yan; Zhang, Lan-Lan; Yang, Qun
2014-01-01
Abstract The complete mitochondrial genomes of Leptidea morsei Fenton (Lepidoptera: Pieridae: Dis-morphiinae) and Catopsilia pomona (F.) (Lepidoptera: Pieridae: Coliadinae) were determined to be 15,122 and 15,142 bp in length, respectively, with that of L . morsei being the smallest among all known butterflies. Both mitogenomes contained 37 genes and an A+T-rich region, with the gene order identical to those of other butterflies, except for the presence of a tRNA-like insertion, tRNA Leu (UUR), in C . pomona . The nucleotide compositions of both genomes were higher in A and T (80.2% for L . morsei and 81.3% for C . pomona ) than C and G; the A+T bias had a significant effect on the codon usage and the amino acid composition. The protein-coding genes utilized the standard mitochondrial start codon ATN, except the COI gene using CGA as the initiation codon, as reported in other butterflies. The intergenic spacer sequence between the tRNA Ser (UCN) and ND1 genes contained the ATACTAA motif. The A+T-rich region harbored a poly-T stretch and a conserved ATAGA motif located at the end of the region. In addition, there was a triplicated 23 bp repeat and a microsatellite-like (TA) 9 (AT) 3 element in the A+T-rich region of the L. morsei mitogenome , while in C . pomona, there was a duplicated 24 bp repeat element and a microsatellite-like (TA) 9 element. The phylogenetic trees of the main butterfly lineages (Hesperiidae, Papilionidae, Pieridae, Nymphalidae, Lycaenidae, and Riodinidae) were reconstructed with maximum likelihood and Bayesian inference methods based on the 13 concatenated nucleotide sequences of protein-coding genes, and both trees showed that the Pieridae family is sister to Lycaenidae. Although this result contradicts the traditional morphologically based views, it agrees with other recent studies based on mitochondrial genomic data. PMID:25368074
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Liu, Xiaoming; Fu, Yun-Xin; Maxwell, Taylor J.; Boerwinkle, Eric
2010-01-01
It is known that sequencing error can bias estimation of evolutionary or population genetic parameters. This problem is more prominent in deep resequencing studies because of their large sample size n, and a higher probability of error at each nucleotide site. We propose a new method based on the composite likelihood of the observed SNP configurations to infer population mutation rate θ = 4Neμ, population exponential growth rate R, and error rate ɛ, simultaneously. Using simulation, we show the combined effects of the parameters, θ, n, ɛ, and R on the accuracy of parameter estimation. We compared our maximum composite likelihood estimator (MCLE) of θ with other θ estimators that take into account the error. The results show the MCLE performs well when the sample size is large or the error rate is high. Using parametric bootstrap, composite likelihood can also be used as a statistic for testing the model goodness-of-fit of the observed DNA sequences. The MCLE method is applied to sequence data on the ANGPTL4 gene in 1832 African American and 1045 European American individuals. PMID:19952140
Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators
Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.
2015-01-01
Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267
Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis
Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai
2010-01-01
The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817
Ryu, Jihye; Lee, Chaeyoung
2014-12-01
Positive selection not only increases beneficial allele frequency but also causes augmentation of allele frequencies of sequence variants in close proximity. Signals for positive selection were detected by the statistical differences in subsequent allele frequencies. To identify selection signatures in Korean cattle, we applied a composite log-likelihood (CLL)-based method, which calculates a composite likelihood of the allelic frequencies observed across sliding windows of five adjacent loci and compares the value with the critical statistic estimated by 50,000 permutations. Data for a total of 11,799 nucleotide polymorphisms were used with 71 Korean cattle and 209 foreign beef cattle. As a result, 147 signals were identified for Korean cattle based on CLL estimates (P < 0.01). The signals might be candidate genetic factors for meat quality by which the Korean cattle have been selected. Further genetic association analysis with 41 intragenic variants in the selection signatures with the greatest CLL for each chromosome revealed that marbling score was associated with five variants. Intensive association studies with all the selection signatures identified in this study are required to exclude signals associated with other phenotypes or signals falsely detected and thus to identify genetic markers for meat quality. © 2014 Stichting International Foundation for Animal Genetics.
2014-01-01
Background Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Results Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. Conclusion The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification. PMID:24418292
Voltage-gated calcium channel and antisense oligonucleotides thereto
NASA Technical Reports Server (NTRS)
Friedman, Peter A. (Inventor); Duncan, Randall L. (Inventor); Hruska, Keith A. (Inventor); Barry, Elizabeth L. R. (Inventor)
1998-01-01
An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.
Wang, Aishuai; Sun, Yuena; Wu, Changwen
2016-11-01
The complete mitochondrial genome of the Cheilodactylus quadricornis was firstly determined in the present study. The mitochondrial genome of C. quadricornis is 16 521 nucleotides, comprising 13 protein-coding genes and 2 ribosomal RNA genes, 22 tRNA genes and 2 main non-coding regions (the control region and the origin of the light-strand replication). The overall base composition was T, 26.3%; C, 29.6%; A, 27.8% and G, 16.3%. The gene arrangement, base composition, and tRNA structures of the complete mitochondrial genome of C. quadricornis is similar to other teleosts. Only two central conserved sequence blocks (CSB-2 and CSB-3) were identified in the control region. In addition, the conserved motif 5'-GCCGG-3' was identified in the origin of light-strand replication of C. quadricornis. The complete mitochondrial genome of C. quadricornis was used to construct phylogenetic tree, which shows that C. quadricornis and C. variegatus clustered in a clade and formed a sister relationship. This mitogenome sequence data would play an important role in population genetics and phylogenetic analysis of the Cheilodactylidae.
A detailed analysis of codon usage patterns and influencing factors in Zika virus.
Singh, Niraj K; Tyagi, Anuj
2017-07-01
Recent outbreaks of Zika virus (ZIKV) in Africa, Latin America, Europe, and Southeast Asia have resulted in serious health concerns. To understand more about evolution and transmission of ZIKV, detailed codon usage analysis was performed for all available strains. A high effective number of codons (ENC) value indicated the presence of low codon usage bias in ZIKV. The effect of mutational pressure on codon usage bias was confirmed by significant correlations between nucleotide compositions at third codon positions and ENCs. Correlation analysis between Gravy values, Aroma values and nucleotide compositions at third codon positions also indicated some influence of natural selection. However, the low codon adaptation index (CAI) value of ZIKV with reference to human and mosquito indicated poor adaptation of ZIKV codon usage towards its hosts, signifying that natural selection has a weaker influence than mutational pressure. Additionally, relative dinucleotide frequencies, geographical distribution, and evolutionary processes also influenced the codon usage pattern to some extent.
NASA Astrophysics Data System (ADS)
Schechinger, Linda Sue
I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators. These coordinators organize the program and provide continuity to the program. The success of UCICOP can be measured by the high praise and gratitude expressed by the teachers, students and volunteers.
Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou
2011-01-01
DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738
Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng
2016-02-11
An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Conservation/Mutation in the Splice Sites of Mitochondrial Solute Carrier Genes of Vertebrates.
Calvello, Rosa; Panaro, Maria A; Salvatore, Rosaria; Mitolo, Vincenzo; Cianciulli, Antonia
2016-10-01
The "canonical" introns begin by the dinucleotide GT and end by the dinucleotide AG. GT, together with a few downstream nucleotides, and AG, with a few of the immediately preceding nucleotides, are thought to be the strongest splicing signals (5'ss and 3'ss, respectively). We examined the composition of the intronic initial and terminal hexanucleotides of the mitochondrial solute carrier genes (SLC25A's) of zebrafish, chicken, mouse, and human. These genes are orthologous and we selected the transcripts in which the arrangement of exons and introns was superimposable in the species considered. Both 5'ss and 3'ss were highly polymorphic, with 104 and 126 different configurations, respectively, in our sample. In the line of evolution from zebrafish to chicken, as well as in that from zebrafish to mammals, the average nucleotide conservation in the four variable nucleotides was about 50 % at 5' and 40 % at 3'. In the divergent evolution of mouse and human, the conservation was about 80 % at 5' and 70 % at 3'. Despite these changes, the splicing signals remain strong enough to operate at the same site. At both 5' and 3', the frequency of a nucleotide at a given position in the zebrafish sequence is positively correlated with its conservation in chicken and mammals, suggesting that selection continued to operate in birds and mammals along similar lines.
Seligmann, Hervé
2013-05-07
GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.
Superstatistical model of bacterial DNA architecture
NASA Astrophysics Data System (ADS)
Bogachev, Mikhail I.; Markelov, Oleg A.; Kayumov, Airat R.; Bunde, Armin
2017-02-01
Understanding the physical principles that govern the complex DNA structural organization as well as its mechanical and thermodynamical properties is essential for the advancement in both life sciences and genetic engineering. Recently we have discovered that the complex DNA organization is explicitly reflected in the arrangement of nucleotides depicted by the universal power law tailed internucleotide interval distribution that is valid for complete genomes of various prokaryotic and eukaryotic organisms. Here we suggest a superstatistical model that represents a long DNA molecule by a series of consecutive ~150 bp DNA segments with the alternation of the local nucleotide composition between segments exhibiting long-range correlations. We show that the superstatistical model and the corresponding DNA generation algorithm explicitly reproduce the laws governing the empirical nucleotide arrangement properties of the DNA sequences for various global GC contents and optimal living temperatures. Finally, we discuss the relevance of our model in terms of the DNA mechanical properties. As an outlook, we focus on finding the DNA sequences that encode a given protein while simultaneously reproducing the nucleotide arrangement laws observed from empirical genomes, that may be of interest in the optimization of genetic engineering of long DNA molecules.
On fuzzy semantic similarity measure for DNA coding.
Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin
2016-02-01
A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lomozik, L; Gasowska, A; Krzysko, G
2006-11-01
The interactions of Cu(II) ions with adenosine-5'-monophosphate (AMP), cytidine-5'-monophosphate (CMP) and 1,12-diamino-4,9-dioxadodecane (OSpm) were studied. A potentiometric method was applied to determine the composition and stability constants of complexes formed, while the mode of interactions was analysed by spectral methods (ultraviolet and visible spectroscopy (UV-Vis), electron paramagnetic resonance (EPR), (13)C NMR, (31)P NMR). In metal-free systems, molecular complexes nucleotide-polyamine (NMP)H(x)(OSpm) were formed. The endocyclic nitrogen atoms of the purine ring N(1), N(7), the nitrogen atom of the pyrimidine ring N(3), the oxygen atoms of the phosphate group of the nucleotide and the protonated nitrogen atoms of the polyamine were the reaction centres. The mode of interaction of the metal ion with OSpm and the nucleotides (AMP or CMP) in the coordination compounds was established. In the system Cu(II)/OSpm the dinuclear complex Cu(2)(OSpm) forms, while in the ternary systems Cu(II)/nucleotide/OSpm the species type MH(x)LL' and MLL' appear. In the MH(x)LL' type species, the main centres of copper (II) ion binding in the nucleotide are the phosphate groups. The protonated amino groups of OSpm are involved in non-covalent interaction with the nitrogen atoms N(1), N(7) or N(3) of the purine or pyrimidine ring, whereas at higher pH, deprotonated nitrogen atoms of polyamine are engaged in metallation in MLL' species.
NASA Technical Reports Server (NTRS)
Holmquist, R.; Pearl, D.
1980-01-01
Theoretical equations are derived for molecular divergence with respect to gene and protein structure in the presence of genetic events with unequal probabilities: amino acid and base compositions, the frequencies of nucleotide replacements, the usage of degenerate codons, the distribution of fixed base replacements within codons and the distribution of fixed base replacements among codons. Results are presented in the form of tables relating the probabilities of given numbers of codon base changes with respect to the original codon for the alpha hemoglobin, beta hemoglobin, myoglobin, cytochrome c and parvalbumin group gene families. Application of the calculations to the rabbit alpha and beta hemoglobin mRNAs and proteins indicates that the genes are separated by about 425 fixed based replacements distributed over 114 codon sites, which is a factor of two greater than previous estimates. The theoretical results also suggest that many more base replacements are required to effect a given gene or protein structural change than previously believed.
USDA-ARS?s Scientific Manuscript database
Nucleotide-activated sugars are essential substrates for plant cell wall carbohydrate-polymer biosynthetic glycosyltransferase enzymes. The most prevalent sugars in grass cell walls include glucose (Glc), xylose (Xyl), and arabinose (Ara). These sugars are biosynthetically related via the uridine di...
USDA-ARS?s Scientific Manuscript database
Plant cell-wall polysaccharide biosynthesis requires nucleotide-activated sugars. The prominent grass cell wall sugars, glucose (Glc), xylose (Xyl), and arabinose (Ara), are biosynthetically related via the UDP-sugar interconversion pathway. RNA-seq analysis of Brachypodium distachyon UDP-sugar inte...
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
2017-01-01
Synthetic analogs of natural nucleotides have long been utilized for structural studies of canonical and noncanonical nucleic acids, including the extensively investigated polymorphic G-quadruplexes (GQs). Dependence on the sequence and nucleotide modifications of the folding landscape of GQs has been reviewed by several recent studies. Here, an overview is compiled on the thermodynamic stability of the modified GQ folds and on how the stereochemical preferences of more than 70 synthetic and natural derivatives of nucleotides substituting for natural ones determine the stability as well as the conformation. Groups of nucleotide analogs only stabilize or only destabilize the GQ, while the majority of analogs alter the GQ stability in both ways. This depends on the preferred syn or anti N-glycosidic linkage of the modified building blocks, the position of substitution, and the folding architecture of the native GQ. Natural base lesions and epigenetic modifications of GQs explored so far also stabilize or destabilize the GQ assemblies. Learning the effect of synthetic nucleotide analogs on the stability of GQs can assist in engineering a required stable GQ topology, and exploring the in vitro action of the single and clustered natural base damage on GQ architectures may provide indications for the cellular events. PMID:29181193
Wu, Eugene Y.; Beese, Lorena S.
2011-01-01
To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established “open” and “closed” states. In this “ajar” conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation. PMID:21454515
Lühr, B; Scheller, J; Meyer, P; Kramer, W
1998-02-01
We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.
The emergence and evolution of life in a "fatty acid world" based on quantum mechanics.
Tamulis, Arvydas; Grigalavicius, Mantas
2011-02-01
Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Helfenbein, Kevin G.; Brown, Wesley M.; Boore, Jeffrey L.
We have sequenced the complete mitochondrial DNA (mtDNA) of the articulate brachiopod Terebratalia transversa. The circular genome is 14,291 bp in size, relatively small compared to other published metazoan mtDNAs. The 37 genes commonly found in animal mtDNA are present; the size decrease is due to the truncation of several tRNA, rRNA, and protein genes, to some nucleotide overlaps, and to a paucity of non-coding nucleotides. Although the gene arrangement differs radically from those reported for other metazoans, some gene junctions are shared with two other articulate brachiopods, Laqueus rubellus and Terebratulina retusa. All genes in the T. transversa mtDNA,more » unlike those in most metazoan mtDNAs reported, are encoded by the same strand. The A+T content (59.1 percent) is low for a metazoan mtDNA, and there is a high propensity for homopolymer runs and a strong base-compositional strand bias. The coding strand is quite G+T-rich, a skew that is shared by the confamilial (laqueid) specie s L. rubellus, but opposite to that found in T. retusa, a cancellothyridid. These compositional skews are strongly reflected in the codon usage patterns and the amino acid compositions of the mitochondrial proteins, with markedly different usage observed between T. retusa and the two laqueids. This observation, plus the similarity of the laqueid non-coding regions to the reverse complement of the non-coding region of the cancellothyridid, suggest that an inversion that resulted in a reversal in the direction of first-strand replication has occurred in one of the two lineages. In addition to the presence of one non-coding region in T. transversa that is comparable to those in the other brachiopod mtDNAs, there are two others with the potential to form secondary structures; one or both of these may be involved in the process of transcript cleavage.« less
Photoinitiator Nucleotide for Quantifying Nucleic Acid Hybridization
Johnson, Leah M.; Hansen, Ryan R.; Urban, Milan; Kuchta, Robert D.; Bowman, Christopher N.
2010-01-01
This first report of a photoinitiator-nucleotide conjugate demonstrates a novel approach for sensitive, rapid and visual detection of DNA hybridization events. This approach holds potential for various DNA labeling schemes and for applications benefiting from selective DNA-based polymerization initiators. Here, we demonstrate covalent, enzymatic incorporation of an eosin-photoinitiator 2′-deoxyuridine-5′-triphosphate (EITC-dUTP) conjugate into surface-immobilized DNA hybrids. Subsequent radical chain photoinitiation from these sites using an acrylamide/bis-acrylamide formulation yields a dynamic detection range between 500pM and 50nM of DNA target. Increasing EITC-nucleotide surface densities leads to an increase in surface-based polymer film heights until achieving a film height plateau of 280nm ±20nm at 610 ±70 EITC-nucleotides/μm2. Film heights of 10–20 nm were obtained from eosin surface densities of approximately 20 EITC-nucleotides/μm2 while below the detection limit of ~10 EITC-nucleotides/μm2, no detectable films were formed. This unique threshold behavior is utilized for instrument-free, visual quantification of target DNA concentration ranges. PMID:20337438
Selection of hammerhead ribozymes for optimum cleavage of interleukin 6 mRNA.
Hendrix, C; Anné, J; Joris, B; Van Aerschot, A; Herdewijn, P
1996-01-01
Four GUC triplets in the coding region of the MRNA of interleukin 6 (IL-6) were examined for their suitabilty to serve as a target for hammerhead ribozome-mediated cleavage. This selection procedure was performed with the intention to downregulate IL-6 production as a potential treatment of those diseases in which IL-6 overexpression is involved. Hammerhead ribozymes and their respective short synthetic substrates (19-mers) were synthesized for these four GUC triplets. Notwithstanding the identical catalytic core sequences, the difference in base composition of the helices involved in substrate binding caused substantial variation in cleavage activity. The cleavage reactions on the 1035 nucleotide IL-6 mRNA transcript revealed that two ribozymes were able to cleave this substrate, showing a decrease in catalytic efficiency to 1/30 and 1/300 of the short substrate. This study indicates that the GUC triplet located at nucleotide 510 of the mRNA of IL-6 is the best site for hammerhead ribozyme-mediated cleavage. We suggest that in future targeting of chemically modified hammerhead ribosomes for cleavage of IL-6 RNA should be directed at this location. PMID:8670082
Marasco, Michelle; Li, Weiyi; Lynch, Michael; Pikaard, Craig S
2017-11-02
All eukaryotes have three essential nuclear multisubunit RNA polymerases, abbreviated as Pol I, Pol II and Pol III. Plants are remarkable in having two additional multisubunit RNA polymerases, Pol IV and Pol V, which synthesize noncoding RNAs that coordinate RNA-directed DNA methylation for silencing of transposons and a subset of genes. Based on their subunit compositions, Pols IV and V clearly evolved as specialized forms of Pol II, but their catalytic properties remain undefined. Here, we show that Pols IV and V differ from one another, and Pol II, in nucleotide incorporation rate, transcriptional accuracy and the ability to discriminate between ribonucleotides and deoxyribonucleotides. Pol IV transcription is considerably more error-prone than Pols II or V, which may be tolerable in its synthesis of short RNAs that serve as precursors for siRNAs targeting non-identical members of transposon families. By contrast, Pol V exhibits high fidelity transcription, similar to Pol II, suggesting a need for Pol V transcripts to faithfully reflect the DNA sequence of target loci to which siRNA-Argonaute silencing complexes are recruited. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Discrete RNA libraries from pseudo-torsional space
Humphris-Narayanan, Elisabeth
2012-01-01
The discovery that RNA molecules can fold into complex structures and carry out diverse cellular roles has led to interest in developing tools for modeling RNA tertiary structure. While significant progress has been made in establishing that the RNA backbone is rotameric, few libraries of discrete conformations specifically for use in RNA modeling have been validated. Here, we present six libraries of discrete RNA conformations based on a simplified pseudo-torsional notation of the RNA backbone, comparable to phi and psi in the protein backbone. We evaluate the ability of each library to represent single nucleotide backbone conformations and we show how individual library fragments can be assembled into dinucleotides that are consistent with established RNA backbone descriptors spanning from sugar to sugar. We then use each library to build all-atom models of 20 test folds and we show how the composition of a fragment library can limit model quality. Despite the limitations inherent in using discretized libraries, we find that several hundred discrete fragments can rebuild RNA folds up to 174 nucleotides in length with atomic-level accuracy (<1.5Å RMSD). We anticipate the libraries presented here could easily be incorporated into RNA structural modeling, analysis, or refinement tools. PMID:22425640
Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.
Mitra, Sanga; Das, Pijush; Samadder, Arpa; Das, Smarajit; Betai, Rupal; Chakrabarti, Jayprokas
2015-01-01
During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.
DNA barcoding commercially important aquatic invertebrates of Turkey.
Keskin, Emre; Atar, Hasan Hüseyin
2013-08-01
DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.
Khan, A S
1984-01-01
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017
NASA Technical Reports Server (NTRS)
Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.
1986-01-01
The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.
Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C
1985-01-01
Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663
Srinivasan, A R; Yathindra, N
1977-01-01
A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206
Oxidized nucleotide insertion by pol β confounds ligation during base excision repair
Çağlayan, Melike; Horton, Julie K.; Dai, Da-Peng; Stefanick, Donna F.; Wilson, Samuel H.
2017-01-01
Oxidative stress in cells can lead to accumulation of reactive oxygen species and oxidation of DNA precursors. Oxidized purine nucleotides can be inserted into DNA during replication and repair. The main pathway for correcting oxidized bases in DNA is base excision repair (BER), and in vertebrates DNA polymerase β (pol β) provides gap filling and tailoring functions. Here we report that the DNA ligation step of BER is compromised after pol β insertion of oxidized purine nucleotides into the BER intermediate in vitro. These results suggest the possibility that BER mediated toxic strand breaks are produced in cells under oxidative stress conditions. We observe enhanced cytotoxicity in oxidizing-agent treated pol β expressing mouse fibroblasts, suggesting formation of DNA strand breaks under these treatment conditions. Increased cytotoxicity following MTH1 knockout or treatment with MTH1 inhibitor suggests the oxidation of precursor nucleotides. PMID:28067232
Sequence, Structure, and Context Preferences of Human RNA Binding Proteins.
Dominguez, Daniel; Freese, Peter; Alexis, Maria S; Su, Amanda; Hochman, Myles; Palden, Tsultrim; Bazile, Cassandra; Lambert, Nicole J; Van Nostrand, Eric L; Pratt, Gabriel A; Yeo, Gene W; Graveley, Brenton R; Burge, Christopher B
2018-06-07
RNA binding proteins (RBPs) orchestrate the production, processing, and function of mRNAs. Here, we present the affinity landscapes of 78 human RBPs using an unbiased assay that determines the sequence, structure, and context preferences of these proteins in vitro by deep sequencing of bound RNAs. These data enable construction of "RNA maps" of RBP activity without requiring crosslinking-based assays. We found an unexpectedly low diversity of RNA motifs, implying frequent convergence of binding specificity toward a relatively small set of RNA motifs, many with low compositional complexity. Offsetting this trend, however, we observed extensive preferences for contextual features distinct from short linear RNA motifs, including spaced "bipartite" motifs, biased flanking nucleotide composition, and bias away from or toward RNA structure. Our results emphasize the importance of contextual features in RNA recognition, which likely enable targeting of distinct subsets of transcripts by different RBPs that recognize the same linear motif. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species
Di Giallonardo, Francesca; Schlub, Timothy E.; Shi, Mang
2017-01-01
ABSTRACT Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and whether dinucleotide composition can be used to accurately predict host species. Using a comparative analysis, we show that dinucleotide composition has a strong phylogenetic association across different RNA virus families, such that dinucleotide composition can predict the family from which a virus sequence has been isolated. Conversely, dinucleotide composition has a poorer predictive power for the different host species within a virus family and across different virus families, indicating that the host has a relatively small impact on the dinucleotide composition of a virus genome. PMID:28148785
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
NASA Astrophysics Data System (ADS)
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
Moghaddar, N; van der Werf, J H J
2017-12-01
The objectives of this study were to estimate the additive and dominance variance component of several weight and ultrasound scanned body composition traits in purebred and combined cross-bred sheep populations based on single nucleotide polymorphism (SNP) marker genotypes and then to investigate the effect of fitting additive and dominance effects on accuracy of genomic evaluation. Additive and dominance variance components were estimated in a mixed model equation based on "average information restricted maximum likelihood" using additive and dominance (co)variances between animals calculated from 48,599 SNP marker genotypes. Genomic prediction was based on genomic best linear unbiased prediction (GBLUP), and the accuracy of prediction was assessed based on a random 10-fold cross-validation. Across different weight and scanned body composition traits, dominance variance ranged from 0.0% to 7.3% of the phenotypic variance in the purebred population and from 7.1% to 19.2% in the combined cross-bred population. In the combined cross-bred population, the range of dominance variance decreased to 3.1% and 9.9% after accounting for heterosis effects. Accounting for dominance effects significantly improved the likelihood of the fitting model in the combined cross-bred population. This study showed a substantial dominance genetic variance for weight and ultrasound scanned body composition traits particularly in cross-bred population; however, improvement in the accuracy of genomic breeding values was small and statistically not significant. Dominance variance estimates in combined cross-bred population could be overestimated if heterosis is not fitted in the model. © 2017 Blackwell Verlag GmbH.
High speed nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2011-05-17
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.
Bacterial nucleotide-based second messengers.
Pesavento, Christina; Hengge, Regine
2009-04-01
In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...
Szilágyi, András; Zachar, István; Szathmáry, Eörs
2013-01-01
Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
Sorimachi, Kenji; Okayasu, Teiji
2015-01-01
The complete vertebrate mitochondrial genome consists of 13 coding genes. We used this genome to investigate the existence of natural selection in vertebrate evolution. From the complete mitochondrial genomes, we predicted nucleotide contents and then separated these values into coding and non-coding regions. When nucleotide contents of a coding or non-coding region were plotted against the nucleotide content of the complete mitochondrial genomes, we obtained linear regression lines only between homonucleotides and their analogs. On every plot using G or A content purine, G content in aquatic vertebrates was higher than that in terrestrial vertebrates, while A content in aquatic vertebrates was lower than that in terrestrial vertebrates. Based on these relationships, vertebrates were separated into two groups, terrestrial and aquatic. However, using C or T content pyrimidine, clear separation between these two groups was not obtained. The hagfish (Eptatretus burgeri) was further separated from both terrestrial and aquatic vertebrates. Based on these results, nucleotide content relationships predicted from the complete vertebrate mitochondrial genomes reveal the existence of natural selection based on evolutionary separation between terrestrial and aquatic vertebrate groups. In addition, we propose that separation of the two groups might be linked to ammonia detoxification based on high G and low A contents, which encode Glu rich and Lys poor proteins.
Arvier, Matthieu; Lagoutte, Laëtitia; Johnson, Gyasi; Dumas, Jean-François; Sion, Benoit; Grizard, Genevieve; Malthièry, Yves; Simard, Gilles; Ritz, Patrick
2007-11-01
The composition of the mitochondrial inner membrane and uncoupling protein [such as adenine nucleotide translocator (ANT)] contents are the main factors involved in the energy-wasting proton leak. This leak is increased by glucocorticoid treatment under nonphosphorylating conditions. The aim of this study was to investigate mechanisms involved in glucocorticoid-induced proton leak and to evaluate the consequences in more physiological conditions (between states 4 and 3). Isolated liver mitochondria, obtained from dexamethasone-treated rats (1.5 mg.kg(-1).day(-1)), were studied by polarography, Western blotting, and high-performance thin-layer chromatography. We confirmed that dexamethasone treatment in rats induces a proton leak in state 4 that is associated with an increased ANT content, although without any change in membrane surface or lipid composition. Between states 4 and 3, dexamethasone stimulates ATP synthesis by increasing both the mitochondrial ANT and F1-F0 ATP synthase content. In conclusion, dexamethasone increases mitochondrial capacity to generate ATP by modifying ANT and ATP synthase. The side effect is an increased leak in nonphosphorylating conditions.
1988-01-01
Biotinylated nucleotides (bio-11-dCTP, bio-11-dUTP, and bio-7-dATP) were microinjected into unfertilized and fertilized Xenopus laevis eggs. The amounts introduced were comparable to in vivo deoxy- nucleoside triphosphate pools. At various times after microinjection, DNA was extracted from eggs or embryos and subjected to electrophoresis on agarose gels. Newly synthesized biotinylated DNA was analyzed by Southern transfer and visualized using either the BluGENE or Detek-hrp streptavidin-based nucleic acid detection systems. Quantitation of the amount of biotinylated DNA observed at various times showed that the microinjected biotinylated nucleotides were efficiently incorporated in vivo, both into replicating endogenous chromosomal DNA and into replicating microinjected exogenous plasmid DNA. At least one biotinylated nucleotide could be incorporated in vivo for every eight nucleotides of DNA synthesized. Control experiments also showed that heavily biotinylated DNA was not subjected to detectable DNA repair during early embryogenesis (for at least 5 h after activation of the eggs). The incorporated biotinylated nucleotides were visualized by electron microscopy by using streptavidin-colloidal gold or streptavidin-ferritin conjugates to bind specifically to the biotin groups projecting from the newly replicated DNA. The incorporated biotinylated nucleotides were thus made visible as electron-dense spots on the underlying DNA molecules. Biotinylated nucleotides separated by 20-50 bases could be resolved. We conclude that nascent DNA synthesized in vivo in Xenopus laevis eggs can be visualized efficiently and specifically using the techniques described. PMID:3392102
Organizational heterogeneity of vertebrate genomes.
Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham
2012-01-01
Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.
Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.
Gapsys, Vytautas; de Groot, Bert L
2017-12-12
Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .
Dietary nucleotides prevent decrease in cellular immunity in ground-based microgravity analog
NASA Technical Reports Server (NTRS)
Yamauchi, Keiko; Hales, Nathan W.; Robinson, Sandra M.; Niehoff, Michael L.; Ramesh, Vani; Pellis, Neal R.; Kulkarni, Anil D.
2002-01-01
Microgravity and stress of spaceflights result in immune dysfunction. The role of nutrition, especially nucleotide supplementation, has become an area of intensive research and significant interest in immunomodulation for maintenance of cellular immune responses. The studies presented here evaluate the plausibility of administering nucleotides to obviate immune dysfunction in an Earth-based in vivo analog of microgravity as studied in anti-orthostatic tail suspension (AOS) of mice. Mice were divided into three housing groups: group, isolation, and AOS. Mice were fed either control chow diet (CD), or RNA-, adenine-, or uracil-supplemented CD for the 1-wk duration of the experiments. In AOS mice, supplemental nucleotides significantly increased in vivo lymph node proliferation and ex vivo lymphoproliferation response to alloantigen and mitogens, respectively, and interleukin-2 and interferon-gamma production. A lower corticosterone level was observed in uracil-supplemented CD compared with CD. These results suggest that exogenous nucleotide supplementation, especially uracil, of normal diet is beneficial in the maintenance and restoration of the immune response during the microgravity analog conditions.
Genomic diversity of the human intestinal parasite Entamoeba histolytica
2012-01-01
Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046
VarDetect: a nucleotide sequence variation exploratory tool
Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades
2008-01-01
Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032
Nucleotide exchange and excision technology DNA shuffling and directed evolution.
Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M
2011-01-01
Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.
Nyaga, Martin M.; Stucker, Karla M.; Esona, Mathew D.; Jere, Khuzwayo C.; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N.; Adolfine, Hokororo; Halpin, Rebecca A.; Roy, Sunando; Stockwell, Timothy B.; Berejena, Chipo; Seheri, Mapaseka L.; Mwenda, Jason M.; Steele, A. Duncan; Wentworth, David E.
2018-01-01
Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007–2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio’s clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7–100 % and 90.6–100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa. PMID:24952422
Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W
1993-12-01
Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.
Yu, Danna; Fang, Xindong; Storey, Kenneth B; Zhang, Yongpu; Zhang, Jiayong
2016-05-01
The complete mitochondrial genomes of the yellow-bellied slider (Trachemys scripta scripta) and anoxia tolerant red-eared slider (Trachemys scripta elegans) turtles were sequenced to analyze gene arrangement. The complete mt genomes of T. s. scripta and elegans were circular molecules of 16,791 bp and 16,810 bp in length, respectively, and included an A + 1 frameshift insertion in ND3 and ND4L genes. The AT content of the overall base composition of scripta and elegans was 61.2%. Nucleotide sequence divergence of the mt-genome (p distance) between scripta and elegans was 0.4%. A detailed comparison between the mitochondrial genomes of the two subspecies is shown.
Comparative Mitogenomic Analysis of Species Representing Six Subfamilies in the Family Tenebrionidae
Zhang, Hong-Li; Liu, Bing-Bing; Wang, Xiao-Yang; Han, Zhi-Ping; Zhang, Dong-Xu; Su, Cai-Na
2016-01-01
To better understand the architecture and evolution of the mitochondrial genome (mitogenome), mitogenomes of ten specimens representing six subfamilies in Tenebrionidae were selected, and comparative analysis of these mitogenomes was carried out in this study. Ten mitogenomes in this family share a similar gene composition, gene order, nucleotide composition, and codon usage. In addition, our results show that nucleotide bias was strongly influenced by the preference of codon usage for A/T rich codons which significantly correlated with the G + C content of protein coding genes (PCGs). Evolutionary rate analyses reveal that all PCGs have been subjected to a purifying selection, whereas 13 PCGs displayed different evolution rates, among which ATPase subunit 8 (ATP8) showed the highest evolutionary rate. We inferred the secondary structure for all RNA genes of Tenebrio molitor (Te2) and used this as the basis for comparison with the same genes from other Tenebrionidae mitogenomes. Some conserved helices (stems) and loops of RNA structures were found in different domains of ribosomal RNAs (rRNAs) and the cloverleaf structure of transfer RNAs (tRNAs). With regard to the AT-rich region, we analyzed tandem repeat sequences located in this region and identified some essential elements including T stretches, the consensus motif at the flanking regions of T stretch, and the secondary structure formed by the motif at the 3′ end of T stretch in major strand, which are highly conserved in these species. Furthermore, phylogenetic analyses using mitogenomic data strongly support the relationships among six subfamilies: ((Tenebrionidae incertae sedis + (Diaperinae + Tenebrioninae)) + (Pimeliinae + Lagriinae)), which is consistent with phylogenetic results based on morphological traits. PMID:27258256
PseKNC: a flexible web server for generating pseudo K-tuple nucleotide composition.
Chen, Wei; Lei, Tian-Yu; Jin, Dian-Chuan; Lin, Hao; Chou, Kuo-Chen
2014-07-01
The pseudo oligonucleotide composition, or pseudo K-tuple nucleotide composition (PseKNC), can be used to represent a DNA or RNA sequence with a discrete model or vector yet still keep considerable sequence order information, particularly the global or long-range sequence order information, via the physicochemical properties of its constituent oligonucleotides. Therefore, the PseKNC approach may hold very high potential for enhancing the power in dealing with many problems in computational genomics and genome sequence analysis. However, dealing with different DNA or RNA problems may need different kinds of PseKNC. Here, we present a flexible and user-friendly web server for PseKNC (at http://lin.uestc.edu.cn/pseknc/default.aspx) by which users can easily generate many different modes of PseKNC according to their need by selecting various parameters and physicochemical properties. Furthermore, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the current web server to generate their desired PseKNC without the need to follow the complicated mathematical equations, which are presented in this article just for the integrity of PseKNC formulation and its development. It is anticipated that the PseKNC web server will become a very useful tool in computational genomics and genome sequence analysis. Copyright © 2014 Elsevier Inc. All rights reserved.
2012-01-01
Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411
A history of the DNA repair and mutagenesis field: The discovery of base excision repair.
Friedberg, Errol C
2016-01-01
This article reviews the early history of the discovery of an DNA repair pathway designated as base excision repair (BER), since in contrast to the enzyme-catalyzed removal of damaged bases from DNA as nucleotides [called nucleotide excision repair (NER)], BER involves the removal of damaged or inappropriate bases, such as the presence of uracil instead of thymine, from DNA as free bases. Copyright © 2015. Published by Elsevier B.V.
Ishida, Hisashi; Matsumoto, Atsushi
2016-09-01
In order to understand how MutS recognizes mismatched DNA and induces the reaction of DNA repair using ATP, the dynamics of the complexes of MutS (bound to the ADP and ATP nucleotides, or not) and DNA (with mismatched and matched base-pairs) were investigated using molecular dynamics simulations. As for DNA, the structure of the base-pairs of the homoduplex DNA which interacted with the DNA recognition site of MutS was intermittently disturbed, indicating that the homoduplex DNA was unstable. As for MutS, the disordered loops in the ATPase domains, which are considered to be necessary for the induction of DNA repair, were close to (away from) the nucleotide-binding sites in the ATPase domains when the nucleotides were (not) bound to MutS. This indicates that the ATPase domains changed their structural stability upon ATP binding using the disordered loop. Conformational analysis by principal component analysis showed that the nucleotide binding changed modes which have structurally solid ATPase domains and the large bending motion of the DNA from higher to lower frequencies. In the MutS-mismatched DNA complex bound to two nucleotides, the bending motion of the DNA at low frequency modes may play a role in triggering the formation of the sliding clamp for the following DNA-repair reaction step. Moreover, MM-PBSA/GBSA showed that the MutS-homoduplex DNA complex bound to two nucleotides was unstable because of the unfavorable interactions between MutS and DNA. This would trigger the ATP hydrolysis or separation of MutS and DNA to continue searching for mismatch base-pairs. Proteins 2016; 84:1287-1303. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities
NASA Astrophysics Data System (ADS)
Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.
2016-09-01
The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.
Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.
Wood-Bouwens, Christina M; Ji, Hanlee P
2018-01-01
Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.
Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.
Ermert, Susanne; Marx, Andreas; Hacker, Stephan M
2017-04-01
Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.
Codon usage bias and phylogenetic analysis of mitochondrial ND1 gene in pisces, aves, and mammals.
Uddin, Arif; Choudhury, Monisha Nath; Chakraborty, Supriyo
2018-01-01
The mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 1 (MT-ND1) gene is a subunit of the respiratory chain complex I and involved in the first step of the electron transport chain of oxidative phosphorylation (OXPHOS). To understand the pattern of compositional properties, codon usage and expression level of mitochondrial ND1 genes in pisces, aves, and mammals, we used bioinformatic approaches as no work was reported earlier. In this study, a perl script was used for calculating nucleotide contents and different codon usage bias parameters. The codon usage bias of MT-ND1 was low but the expression level was high as revealed from high ENC and CAI value. Correspondence analysis (COA) suggests that the pattern of codon usage for MT-ND1 gene is not same across species and that compositional constraint played an important role in codon usage pattern of this gene among pisces, aves, and mammals. From the regression equation of GC12 on GC3, it can be inferred that the natural selection might have played a dominant role while mutation pressure played a minor role in influencing the codon usage patterns. Further, ND1 gene has a discrepancy with cytochrome B (CYB) gene in preference of codons as evident from COA. The codon usage bias was low. It is influenced by nucleotide composition, natural selection, mutation pressure, length (number) of amino acids, and relative dinucleotide composition. This study helps in understanding the molecular biology, genetics, evolution of MT-ND1 gene, and also for designing a synthetic gene.
Bhatt, Vaibhav D; Dande, Suchitra S; Patil, Nitin V; Joshi, Chaitanya G
2013-04-01
Rumen microorganisms play an important role in ruminant digestion and absorption of nutrients and have great potential applications in the field of rumen adjusting, food fermentation and biomass utilization etc. In order to investigate the composition of microorganisms in the rumen of camel (Camelus dromedarius), this study delves in the microbial diversity by culture-independent approach. It includes comparison of rumen samples investigated in the present study to other currently available metagenomes to reveal potential differences in rumen microbial systems. Pyrosequencing based metagenomics was applied to analyze phylogenetic and metabolic profiles by MG-RAST, a web based tool. Pyrosequencing of camel rumen sample yielded 8,979,755 nucleotides assembled to 41,905 sequence reads with an average read length of 214 nucleotides. Taxonomic analysis of metagenomic reads indicated Bacteroidetes (55.5 %), Firmicutes (22.7 %) and Proteobacteria (9.2 %) phyla as predominant camel rumen taxa. At a finer phylogenetic resolution, Bacteroides species dominated the camel rumen metagenome. Functional analysis revealed that clustering-based subsystem and carbohydrate metabolism were the most abundant SEED subsystem representing 17 and 13 % of camel metagenome, respectively. A high taxonomic and functional similarity of camel rumen was found with the cow metagenome which is not surprising given the fact that both are mammalian herbivores with similar digestive tract structures and functions. Combined pyrosequencing approach and subsystems-based annotations available in the SEED database allowed us access to understand the metabolic potential of these microbiomes. Altogether, these data suggest that agricultural and animal husbandry practices can impose significant selective pressures on the rumen microbiota regardless of rumen type. The present study provides a baseline for understanding the complexity of camel rumen microbial ecology while also highlighting striking similarities and differences when compared to other animal gastrointestinal environments.
Advances in targeting cyclic nucleotide phosphodiesterases
Maurice, Donald H.; Ke, Hengming; Ahmad, Faiyaz; Wang, Yousheng; Chung, Jay; Manganiello, Vincent C.
2014-01-01
Cyclic nucleotide phosphodiesterases (PDEs) catalyse the hydrolysis of cyclic AMP and cyclic GMP, thereby regulating the intracellular concentrations of these cyclic nucleotides, their signalling pathways and, consequently, myriad biological responses in health and disease. Currently, a small number of PDE inhibitors are used clinically for treating the pathophysiological dysregulation of cyclic nucleotide signalling in several disorders, including erectile dysfunction, pulmonary hypertension, acute refractory cardiac failure, intermittent claudication and chronic obstructive pulmonary disease. However, pharmaceutical interest in PDEs has been reignited by the increasing understanding of the roles of individual PDEs in regulating the subcellular compartmentalization of specific cyclic nucleotide signalling pathways, by the structure-based design of novel specific inhibitors and by the development of more sophisticated strategies to target individual PDE variants. PMID:24687066
Small Cofactors May Assist Protein Emergence from RNA World: Clues from RNA-Protein Complexes
Shen, Liang; Ji, Hong-Fang
2011-01-01
It is now widely accepted that at an early stage in the evolution of life an RNA world arose, in which RNAs both served as the genetic material and catalyzed diverse biochemical reactions. Then, proteins have gradually replaced RNAs because of their superior catalytic properties in catalysis over time. Therefore, it is important to investigate how primitive functional proteins emerged from RNA world, which can shed light on the evolutionary pathway of life from RNA world to the modern world. In this work, we proposed that the emergence of most primitive functional proteins are assisted by the early primitive nucleotide cofactors, while only a minority are induced directly by RNAs based on the analysis of RNA-protein complexes. Furthermore, the present findings have significant implication for exploring the composition of primitive RNA, i.e., adenine base as principal building blocks. PMID:21789260
Montes-Pérez, Rubén C; García, Adán W Echeverría; Castro, Jorge Zavala; Gamboa, Militza G Alfaro
2006-09-01
The objective of this work was to estimate the nucleotidic variation between two groups of tepezcuintles (Agouti paca) from the states of Campeche and Quintana Roo, Mexico and within members of each group. Blood samples were collected from eleven A. paca kept in captivity. DNA from leukocytic cells was used for Ramdom Amplification of DNA Polimorphism (RAPD). The primers three 5'-d(GTAGACCCGT)- 3' and six 5'-d(CCCGTCAGCA)- 3' were selected from de Amersham kit (Ready.To.Go. RAPD Analysis Beads, Amersham Pharmacia Biotech), because they produced an adequate number of bands. The electrophoretic pattern of bands obtained was analyzed using software for phylogenetic analysis based on the UPGMA method, to estimate the units of nucleotidic variation. The phylogenetic tree obtained with primer three reveals a dicotomic grouping between the animals from both states in the Yucatan Peninsula showing a divergent value of 1.983 nucleotides per hundred. Animals from Quintana Roo show a grouping with primer six; an additional grouping was observed with animals from Campeche. Nucleotidic variation between both groups was 2.118 nucleotides per hundred. The nucleotidic variation for the two primers within the groups from both states, showed fluctuating values from 0.46 to 1.68 nucleotides per hundred, which indicates that nucleotidic variation between the two groups of animals is around two nucleotides per hundred and, within the groups, less than 1.7 nucleotides per hundred.
Bienertova-Vasku, Julie; Bienert, Petr; Slovackova, Lenka; Sablikova, Lenka; Piskackova, Zlata; Forejt, Martin; Splichal, Zbynek; Zlamal, Filip; Vasku, Anna
2012-07-01
The endocannabinoid receptor 1 (CB1) is encoded by the CNR1 gene and has been recently recognized to play an important role in the regulation of satiety and feeding behaviour with a huge potential of modulating metabolic response and feeding control. The aim of the study was to investigate the potential of three selected single nucleotide polymorphisms (SNPs) in the CNR1 locus on native dietary composition in the Central-European Caucasian population. A total of 258 unrelated individuals originating from the Central-European Caucasian population were enrolled into the study and rs1049353, rs12720071, and rs806368 polymorphisms in CNR1 locus were examined in these individuals using PCR-based methodology. Body composition was assessed using a bioimpedance method, various anthropometric parameters were investigated (waist and hip circumference, skin folds), and native dietary composition was analysed using 7-day food records as well as a food frequency questionnaire. Allelic variations and common haplotypes in the CNR1 gene were associated with the daily intake of proteins, fluids, and fibre, regardless of the physical activity of the individuals. The common haplotype in the CNR1 gene was associated with self-reported smoking (number of cigarettes per day, smoking years). Our results indicate that specific genetic variations in the CNR1 gene may act as susceptibility markers for specific dietary composition in the Central-European population.
Jiang, Chao; Yuan, Yuan; Yang, Guang; Jin, Yan; Liu, Libing; Zhao, Yuyang; Huang, Luqi
2016-10-21
Inaccurate labeling of materials used in herbal products may compromise the therapeutic efficacy and may pose a threat to medicinal safety. In this paper, a rapid (within 3 h), sensitive and visual colorimetric method for identifying substitutions in terminal market products was developed using cationic conjugated polymer-based fluorescence resonance energy transfer (CCP-based FRET). Chinese medicinal materials with similar morphology and chemical composition were clearly distinguished by the single-nucleotide polymorphism (SNP) genotyping method. Assays using CCP-based FRET technology showed a high frequency of adulterants in Lu-Rong (52.83%) and Chuan-Bei-Mu (67.8%) decoction pieces, and patented Chinese drugs (71.4%, 5/7) containing Chuan-Bei-Mu ingredients were detected in the terminal herbal market. In comparison with DNA sequencing, this protocol simplifies procedures by eliminating the cumbersome workups and sophisticated instruments, and only a trace amount of DNA is required. The CCP-based method is particularly attractive because it can detect adulterants in admixture samples with high sensitivity. Therefore, the CCP-based detection system shows great potential for routine terminal market checks and drug safety controls.
Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito
2002-01-01
Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471
Neugebauer, Tomasz; Bordeleau, Eric; Burrus, Vincent; Brzezinski, Ryszard
2015-01-01
Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.
Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.
2008-01-01
Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843
Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder
ERIC Educational Resources Information Center
Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.
2012-01-01
Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…
Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences
Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao
2016-01-01
The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species’ genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976
NASA Astrophysics Data System (ADS)
Zhou, Li; Li, Zhenhua; Liu, Zhen; Yin, Meili; Ren, Jinsong; Qu, Xiaogang
2014-01-01
A simple and ``green'' strategy has been reported for the first time to fabricate upconversion nanoparticles (UCNPs) by utilizing nucleotides as bio-templates. The influence of the functionalities present on the nucleotide on the production of nanoparticles was investigated in detail. Through the effects of nucleotides, the obtained nanoparticles possessed a porous structure. The use of the as-prepared UCNPs for cell imaging, drug delivery and versatile therapy applications were demonstrated. In view of the bright up-conversion luminescence as well as the excellent biocompatibility, and the good colloidal stability of the as-prepared UCNPs, we envision that our synthesis protocol might advance both the fields of UCNPs and biomolecule-based nanotechnology for future studies.A simple and ``green'' strategy has been reported for the first time to fabricate upconversion nanoparticles (UCNPs) by utilizing nucleotides as bio-templates. The influence of the functionalities present on the nucleotide on the production of nanoparticles was investigated in detail. Through the effects of nucleotides, the obtained nanoparticles possessed a porous structure. The use of the as-prepared UCNPs for cell imaging, drug delivery and versatile therapy applications were demonstrated. In view of the bright up-conversion luminescence as well as the excellent biocompatibility, and the good colloidal stability of the as-prepared UCNPs, we envision that our synthesis protocol might advance both the fields of UCNPs and biomolecule-based nanotechnology for future studies. Electronic supplementary information (ESI) available: Supporting figures. See DOI: 10.1039/c3nr04255c
Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species.
Di Giallonardo, Francesca; Schlub, Timothy E; Shi, Mang; Holmes, Edward C
2017-04-15
Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and whether dinucleotide composition can be used to accurately predict host species. Using a comparative analysis, we show that dinucleotide composition has a strong phylogenetic association across different RNA virus families, such that dinucleotide composition can predict the family from which a virus sequence has been isolated. Conversely, dinucleotide composition has a poorer predictive power for the different host species within a virus family and across different virus families, indicating that the host has a relatively small impact on the dinucleotide composition of a virus genome. Copyright © 2017 American Society for Microbiology.
Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel
Eriksson, Anders; Manica, Andrea
2011-01-01
Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358
De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim
2016-10-28
Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Prebiotic chemistry and nucleic acid replication
NASA Technical Reports Server (NTRS)
Orgel, L. E.; Lohrmann, R.
1974-01-01
Recent work is reviewed on some reactions that could have occurred on the primitive earth and that could have played a part in the evolution of a self-replicating system. The transition from the primitive atmosphere to the simplest replicating molecules is considered in four stages: (1) the formation of a 'prebiotic soup' of organic precursors, including the purine and pyrimidine bases and the pentose sugars; (2) the condensation of these precursors and inorganic phosphate to form monomeric nucleotides and activated nucleotide derivatives; (3) the polymerization of nucleotide derivatives to oligonucleotides; and (4) the complementary replication of oligonucleotides in a template-directed process that depends on Watson-Crick base pairing.
Bohlin, Jon; Eldholm, Vegard; Pettersson, John H O; Brynildsrud, Ola; Snipen, Lars
2017-02-10
The core genome consists of genes shared by the vast majority of a species and is therefore assumed to have been subjected to substantially stronger purifying selection than the more mobile elements of the genome, also known as the accessory genome. Here we examine intragenic base composition differences in core genomes and corresponding accessory genomes in 36 species, represented by the genomes of 731 bacterial strains, to assess the impact of selective forces on base composition in microbes. We also explore, in turn, how these results compare with findings for whole genome intragenic regions. We found that GC content in coding regions is significantly higher in core genomes than accessory genomes and whole genomes. Likewise, GC content variation within coding regions was significantly lower in core genomes than in accessory genomes and whole genomes. Relative entropy in coding regions, measured as the difference between observed and expected trinucleotide frequencies estimated from mononucleotide frequencies, was significantly higher in the core genomes than in accessory and whole genomes. Relative entropy was positively associated with coding region GC content within the accessory genomes, but not within the corresponding coding regions of core or whole genomes. The higher intragenic GC content and relative entropy, as well as the lower GC content variation, observed in the core genomes is most likely associated with selective constraints. It is unclear whether the positive association between GC content and relative entropy in the more mobile accessory genomes constitutes signatures of selection or selective neutral processes.
NASA Technical Reports Server (NTRS)
Sokolova, Z. A.
1980-01-01
The influence of sinusoidal modulated currents was studied and physical loads on the nucleic acid content and the nucleotide composition of the total RNA in muscles of rats of various ages under conditions of hypodynamia were measured. Methodology utilized is described and conclusions are presented.
Vertebrate codon bias indicates a highly GC-rich ancestral genome.
Nabiyouni, Maryam; Prakash, Ashwin; Fedorov, Alexei
2013-04-25
Two factors are thought to have contributed to the origin of codon usage bias in eukaryotes: 1) genome-wide mutational forces that shape overall GC-content and create context-dependent nucleotide bias, and 2) positive selection for codons that maximize efficient and accurate translation. Particularly in vertebrates, these two explanations contradict each other and cloud the origin of codon bias in the taxon. On the one hand, mutational forces fail to explain GC-richness (~60%) of third codon positions, given the GC-poor overall genomic composition among vertebrates (~40%). On the other hand, positive selection cannot easily explain strict regularities in codon preferences. Large-scale bioinformatic assessment, of nucleotide composition of coding and non-coding sequences in vertebrates and other taxa, suggests a simple possible resolution for this contradiction. Specifically, we propose that the last common vertebrate ancestor had a GC-rich genome (~65% GC). The data suggest that whole-genome mutational bias is the major driving force for generating codon bias. As the bias becomes prominent, it begins to affect translation and can result in positive selection for optimal codons. The positive selection can, in turn, significantly modulate codon preferences. Copyright © 2013 Elsevier B.V. All rights reserved.
Ahmad, Muneer; Jung, Low Tan; Bhuiyan, Al-Amin
2017-10-01
Digital signal processing techniques commonly employ fixed length window filters to process the signal contents. DNA signals differ in characteristics from common digital signals since they carry nucleotides as contents. The nucleotides own genetic code context and fuzzy behaviors due to their special structure and order in DNA strand. Employing conventional fixed length window filters for DNA signal processing produce spectral leakage and hence results in signal noise. A biological context aware adaptive window filter is required to process the DNA signals. This paper introduces a biological inspired fuzzy adaptive window median filter (FAWMF) which computes the fuzzy membership strength of nucleotides in each slide of window and filters nucleotides based on median filtering with a combination of s-shaped and z-shaped filters. Since coding regions cause 3-base periodicity by an unbalanced nucleotides' distribution producing a relatively high bias for nucleotides' usage, such fundamental characteristic of nucleotides has been exploited in FAWMF to suppress the signal noise. Along with adaptive response of FAWMF, a strong correlation between median nucleotides and the Π shaped filter was observed which produced enhanced discrimination between coding and non-coding regions contrary to fixed length conventional window filters. The proposed FAWMF attains a significant enhancement in coding regions identification i.e. 40% to 125% as compared to other conventional window filters tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. This study proves that conventional fixed length window filters applied to DNA signals do not achieve significant results since the nucleotides carry genetic code context. The proposed FAWMF algorithm is adaptive and outperforms significantly to process DNA signal contents. The algorithm applied to variety of DNA datasets produced noteworthy discrimination between coding and non-coding regions contrary to fixed window length conventional filters. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†
Comer, Jeffrey
2016-01-01
Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233
NASA Technical Reports Server (NTRS)
Orenberg, J. B.; Kjos, K. M.; Winkler, R.; Link, J.; Lawless, J. G.
1982-01-01
The interactions of Ni(II) cation with a representative suite of purine bases and the respective nucleosides and nucleotides have been studied by ultraviolet difference spectroscopy. Apparent association constants were determined for each system at pH 7.0, using computer linear regression coupled with an iteration technique. The specificity of binding of Ni(2+) for the purine nucleotides studied at pH 7.0 was 5-prime-GMP greater than 5-prime-AMP; a similar ordering was also found for the respective nucleosides and bases. In this study binding was not observed for the suite of pyramidines used, although an Ni(2+) -cytidine complex has been observed (Fiskin and Beer, 1965). It was also found that Ni(2+) bound more strongly to the purine 5-prime-nucleotides than to the respective nucleosides and bases. These trends are explained in terms of metal-ligand bonds and available bonding positions on the ligands. A role for metal-ion-nucleotide types of complexes is suggested in the processes that might have given rise to the origin of life.
Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603
Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro
2010-04-27
To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be caused by a recent human selection in rice breeding. The definition of pedigree haplotypes by means of genome-wide SNPs will facilitate next-generation breeding of rice and other crops.
The complete mitochondrial genome of domestic sheep, Ovis aries.
Hu, Xiao-di; Gao, Li-zhi
2016-01-01
In this study, we report a complete mitochondrial (mt) genome sequence of the Texel ewe, Ovis aries. The total genome is 16,615 bp in length and its overall base composition was estimated to be 33.68% for A, 27.36% for T, 25.86% for C, and 13.10% for G indicating an AT-rich (61.04%) feature in the O. aries mtgenome. It contains a total of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and a control region (D-loop region). Comparisons with other publicly available sheep mitogenomes revealed a bunch of nucleotide diversity. This complete mitgenome sequence would enlarge useful genomic information for further studies on sheep evolution and domestication that will enhance germplasm conservation and breeding programs of O. aries.
Gardner, Andrew F; Wang, Jinchun; Wu, Weidong; Karouby, Jennifer; Li, Hong; Stupi, Brian P; Jack, William E; Hersh, Megan N; Metzker, Michael L
2012-08-01
Recent developments of unique nucleotide probes have expanded our understanding of DNA polymerase function, providing many benefits to techniques involving next-generation sequencing (NGS) technologies. The cyclic reversible termination (CRT) method depends on efficient base-selective incorporation of reversible terminators by DNA polymerases. Most terminators are designed with 3'-O-blocking groups but are incorporated with low efficiency and fidelity. We have developed a novel class of 3'-OH unblocked nucleotides, called Lightning Terminators™, which have a terminating 2-nitrobenzyl moiety attached to hydroxymethylated nucleobases. A key structural feature of this photocleavable group displays a 'molecular tuning' effect with respect to single-base termination and improved nucleotide fidelity. Using Therminator DNA polymerase, we demonstrate that these 3'-OH unblocked terminators exhibit superior enzymatic performance compared to two other reversible terminators, 3'-O-amino-TTP and 3'-O-azidomethyl-TTP. Lightning Terminators show maximum incorporation rates (k(pol)) that range from 35 to 45 nt/s, comparable to the fastest NGS chemistries, yet with catalytic efficiencies (k(pol)/K(D)) comparable to natural nucleotides. Pre-steady-state kinetic studies of thymidine analogs revealed that the major determinant for improved nucleotide selectivity is a significant reduction in k(pol) by >1000-fold over TTP misincorporation. These studies highlight the importance of structure-function relationships of modified nucleotides in dictating polymerase performance.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Hijaz, Faraj; Manthey, John A.; Van der Merwe, Deon; Killiny, Nabil
2016-01-01
ABSTRACT Currently, the global citrus production is declining due to the spread of Huanglongbing (HLB). HLB, otherwise known as citrus greening, is caused by Candidatus Liberibacter asiaticus (CLas) and is transmitted by the Asian citrus psyllids (ACP), Diaphorina citri Kuwayama. ACP transmits CLas bacterium while feeding on the citrus phloem sap. Multiplication of CLas in the phloem of citrus indicates that the sap contains all the essential nutrients needed for CLas. In this study, we investigated the micro- and macro-nutrients, nucleotides, and others secondary metabolites of phloem sap from pineapple sweet orange. The micro- and macro-nutrients were analyzed using inductively coupled plasma-mass spectroscopy (ICP-MS) and inductively coupled plasma-optical emission spectroscopy (ICP-OES). Nucleotides and other secondary metabolites analysis was accomplished by reversed phase HPLC coupled with UV, fluorescence detection, or negative mode electrospray ionization mass spectrometry (ESI-MS). Calcium (89 mM) was the highest element followed by potassium (38.8 mM) and phosphorous (24 mM). Magnesium and sulfur were also abundant and their concentrations were 15 and 9 mM, respectively. The rest of the elements were found in low amounts (< 2mM). The concentrations of ATP, ADP, and AMP were 16, 31, and 3 µ mole/Kg fwt, respectively. GTP, GMP. NAD, FMN, FAD, and riboflavin were found at concentrations below (3 µ mole/Kg fwt). The phloem was rich in nomilin 124 mM and limonin 176 µ mole/Kg fwt. Hesperidin, vicenin-2, sinensetin, and nobiletin were the most predominant flavonoids. In addition, several hydroxycinnamates were detected. The results of this study will increase our knowledge about the nature and the chemical composition of citrus phloem sap. PMID:27171979
Bamorovat, Mehdi; Sharifi, Iraj; Mohammadi, Mohammad Ali; Eybpoosh, Sana; Nasibi, Saeid; Aflatoonian, Mohammad Reza; Khosravi, Ahmad
2018-03-01
The precise identification of the parasite species causing leishmaniasis is essential for selecting proper treatment modality. The present study aims to compare the nucleotide variations of the ITS1, 7SL RNA, and Hsp70 sequences between non-healed and healed anthroponotic cutaneous leishmaniasis (ACL) patients in major foci in Iran. A case-control study was carried out from September 2015 to October 2016 in the cities of Kerman and Bam, in the southeast of Iran. Randomly selected skin-scraping lesions of 40 patients (20 non-healed and 20 healed) were examined and the organisms were grown in a culture medium. Promastigotes were collected by centrifugation and kept for further molecular examinations. The extracted DNA was amplified and sequenced. After global sequence alignment with BioEdit software, maximum likelihood phylogenetic analysis was performed in PhyML for typing of Leishmania isolates. Nucleotide composition of each genetic region was also compared between non-healed and healed patients. Our results showed that all isolates belonged to the Leishmania tropica complex, with their genetic composition in the ITS1 region being different among non-healed and healed patients. 7SL RNA and Hsp70 regions were genetically identical between both groups. Variability in nucleotide patterns observed between both groups in the ITS1 region may serve to encourage future research on the function of these polymorphisms and may improve our understanding of the role of parasite genome properties on patients' response to Leishmania treatment. Our results also do not support future use of 7SL RNA and Hsp70 regions of the parasite for comparative genomic analyses. Copyright © 2018 Elsevier Ltd. All rights reserved.
Hijaz, Faraj; Manthey, John A; Van der Merwe, Deon; Killiny, Nabil
2016-06-02
Currently, the global citrus production is declining due to the spread of Huanglongbing (HLB). HLB, otherwise known as citrus greening, is caused by Candidatus Liberibacter asiaticus (CLas) and is transmitted by the Asian citrus psyllids (ACP), Diaphorina citri Kuwayama. ACP transmits CLas bacterium while feeding on the citrus phloem sap. Multiplication of CLas in the phloem of citrus indicates that the sap contains all the essential nutrients needed for CLas. In this study, we investigated the micro- and macro-nutrients, nucleotides, and others secondary metabolites of phloem sap from pineapple sweet orange. The micro- and macro-nutrients were analyzed using inductively coupled plasma-mass spectroscopy (ICP-MS) and inductively coupled plasma-optical emission spectroscopy (ICP-OES). Nucleotides and other secondary metabolites analysis was accomplished by reversed phase HPLC coupled with UV, fluorescence detection, or negative mode electrospray ionization mass spectrometry (ESI-MS). Calcium (89 mM) was the highest element followed by potassium (38.8 mM) and phosphorous (24 mM). Magnesium and sulfur were also abundant and their concentrations were 15 and 9 mM, respectively. The rest of the elements were found in low amounts (< 2mM). The concentrations of ATP, ADP, and AMP were 16, 31, and 3 µ mole/Kg fwt, respectively. GTP, GMP. NAD, FMN, FAD, and riboflavin were found at concentrations below (3 µ mole/Kg fwt). The phloem was rich in nomilin 124 mM and limonin 176 µ mole/Kg fwt. Hesperidin, vicenin-2, sinensetin, and nobiletin were the most predominant flavonoids. In addition, several hydroxycinnamates were detected. The results of this study will increase our knowledge about the nature and the chemical composition of citrus phloem sap.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
NASA Astrophysics Data System (ADS)
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
A versatile microsatellite instability reporter system in human cells.
Koole, Wouter; Schäfer, Henning S; Agami, Reuven; van Haaften, Gijs; Tijsterman, Marcel
2013-09-01
Here, we report the investigation of microsatellite instability (MSI) in human cells with a newly developed reporter system based on fluorescence. We composed a vector into which microsatellites of different lengths and nucleotide composition can be introduced between a functional copy of the fluorescent protein mCherry and an out-of-frame copy of EGFP; in vivo frameshifting will lead to EGFP expression, which can be quantified by fluorescence activated cell sorting (FACS). Via targeted recombineering, single copy reporters were introduced in HEK293 and MCF-7 cells. We found predominantly -1 and +1 base pair frameshifts, the levels of which are kept in tune by mismatch repair. We show that tract length and composition greatly influences MSI. In contrast, a tracts' potential to form a G-quadruplex structure, its strand orientation or its transcriptional status is not affecting MSI. We further validated the functionality of the reporter system for screening microsatellite mutagenicity of compounds and for identifying modifiers of MSI: using a retroviral miRNA expression library, we identified miR-21, which targets MSH2, as a miRNA that induces MSI when overexpressed. Our data also provide proof of principle for the strategy of combining fluorescent reporters with next-generation sequencing technology to identify genetic factors in specific pathways.
Solution structure of an ATP-binding RNA aptamer reveals a novel fold.
Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J
1996-01-01
In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.
Kirillova, Svetlana; Carugo, Oliviero
2011-10-19
Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures
2011-01-01
Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380
MGAS: a powerful tool for multivariate gene-based genome-wide association analysis.
Van der Sluis, Sophie; Dolan, Conor V; Li, Jiang; Song, Youqiang; Sham, Pak; Posthuma, Danielle; Li, Miao-Xin
2015-04-01
Standard genome-wide association studies, testing the association between one phenotype and a large number of single nucleotide polymorphisms (SNPs), are limited in two ways: (i) traits are often multivariate, and analysis of composite scores entails loss in statistical power and (ii) gene-based analyses may be preferred, e.g. to decrease the multiple testing problem. Here we present a new method, multivariate gene-based association test by extended Simes procedure (MGAS), that allows gene-based testing of multivariate phenotypes in unrelated individuals. Through extensive simulation, we show that under most trait-generating genotype-phenotype models MGAS has superior statistical power to detect associated genes compared with gene-based analyses of univariate phenotypic composite scores (i.e. GATES, multiple regression), and multivariate analysis of variance (MANOVA). Re-analysis of metabolic data revealed 32 False Discovery Rate controlled genome-wide significant genes, and 12 regions harboring multiple genes; of these 44 regions, 30 were not reported in the original analysis. MGAS allows researchers to conduct their multivariate gene-based analyses efficiently, and without the loss of power that is often associated with an incorrectly specified genotype-phenotype models. MGAS is freely available in KGG v3.0 (http://statgenpro.psychiatry.hku.hk/limx/kgg/download.php). Access to the metabolic dataset can be requested at dbGaP (https://dbgap.ncbi.nlm.nih.gov/). The R-simulation code is available from http://ctglab.nl/people/sophie_van_der_sluis. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.
Species Based Synonymous Codon Usage in Fusion Protein Gene of Newcastle Disease Virus
Kumar, Chandra Shekhar; Kumar, Sachin
2014-01-01
Newcastle disease is highly pathogenic to poultry and many other avian species. However, the Newcastle disease virus (NDV) has also been reported from many non-avian species. The NDV fusion protein (F) is a major determinant of its pathogenicity and virulence. The functionalities of F gene have been explored for the development of vaccine and diagnostics against NDV. Although the F protein is well studied but the codon usage and its nucleotide composition from NDV isolated from different species have not yet been explored. In present study, we have analyzed the factors responsible for the determination of codon usage in NDV isolated from four major avian host species. The F gene of NDV is analyzed for its base composition and its correlation with the bias in codon usage. Our result showed that random mutational pressure is responsible for codon usage bias in F protein of NDV isolates. Aromaticity, GC3s, and aliphatic index were not found responsible for species based synonymous codon usage bias in F gene of NDV. Moreover, the low amount of codon usage bias and expression level was further confirmed by a low CAI value. The phylogenetic analysis of isolates was found in corroboration with the relatedness of species based on codon usage bias. The relationship between the host species and the NDV isolates from the host does not represent a significant correlation in our study. The present study provides a basic understanding of the mechanism involved in codon usage among species. PMID:25479071
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.
2011-01-01
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D
2011-11-15
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Amit; Park, HaJeung; Fang, Pengfei
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less
Improved treatment of nucleosides and nucleotides in the OPLS-AA force field
NASA Astrophysics Data System (ADS)
Robertson, Michael J.; Tirado-Rives, Julian; Jorgensen, William L.
2017-09-01
DFT calculations have been used to develop improved descriptions of the torsional energetics for nucleosides and nucleotides in the OPLS-AA force field. Scans of nucleotide dihedral angles (γ, χ, and β) and methyl phosphates provided the bases for the new torsional parameters. In addition, the angle-bending parameters of phosphodiesters and ribose were updated, and adjustments were made to existing carbohydrate torsions to better capture the sugar puckering landscape of ribose. MD simulations of nucleosides with the new parameters demonstrate a significant improvement in the ribose sugar puckering and χ angle distributions. Additionally, energy-minimization of protein-nucleotide crystal structures with the new parameters produced accurate poses.
NASA Astrophysics Data System (ADS)
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
McKernan, Kevin J.; Spangler, Jessica; Zhang, Lei; Tadigotla, Vasisht; McLaughlin, Stephen; Warner, Jason; Zare, Amir; Boles, Richard G.
2014-01-01
We have developed a PCR method, coined Déjà vu PCR, that utilizes six nucleotides in PCR with two methyl specific restriction enzymes that respectively digest these additional nucleotides. Use of this enzyme-and-nucleotide combination enables what we term a “DNA diode”, where DNA can advance in a laboratory in only one direction and cannot feedback into upstream assays. Here we describe aspects of this method that enable consecutive amplification with the introduction of a 5th and 6th base while simultaneously providing methylation dependent mitochondrial DNA enrichment. These additional nucleotides enable a novel DNA decontamination technique that generates ephemeral and easy to decontaminate DNA. PMID:24788618
Biswas, Sovan; Sen, Suman; Im, JongOne; Biswas, Sudipta; Krstic, Predrag; Ashcroft, Brian; Borges, Chad; Zhao, Yanan; Lindsay, Stuart; Zhang, Peiming
2016-12-27
A reader molecule, which recognizes all the naturally occurring nucleobases in an electron tunnel junction, is required for sequencing DNA by a recognition tunneling (RT) technique, referred to as a universal reader. In the present study, we have designed a series of heterocyclic carboxamides based on hydrogen bonding and a large-sized pyrene ring based on a π-π stacking interaction as universal reader candidates. Each of these compounds was synthesized to bear a thiolated linker for attachment to metal electrodes and examined for their interactions with naturally occurring DNA nucleosides and nucleotides by 1 H NMR, ESI-MS, computational calculations, and surface plasmon resonance. RT measurements were carried out in a scanning tunnel microscope. All of these molecules generated electrical signals with DNA nucleotides in tunneling junctions under physiological conditions (phosphate buffered aqueous solution, pH 7.4). Using a support vector machine as a tool for data analysis, we found that these candidates distinguished among naturally occurring DNA nucleotides with the accuracy of pyrene (by π-π stacking interactions) > azole carboxamides (by hydrogen-bonding interactions). In addition, the pyrene reader operated efficiently in a larger tunnel junction. However, the azole carboxamide could read abasic (AP) monophosphate, a product from spontaneous base hydrolysis or an intermediate of base excision repair. Thus, we envision that sequencing DNA using both π-π stacking and hydrogen-bonding-based universal readers in parallel should generate more comprehensive genome sequences than sequencing based on either reader molecule alone.
Valenzuela, Carlos Y
2010-01-01
Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA), the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9) was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.
Information Entropy Analysis of the H1N1 Genetic Code
NASA Astrophysics Data System (ADS)
Martwick, Andy
2010-03-01
During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.
2010-01-01
We examined the analysis of nucleotides and nucleotide sugars by chromatography on porous graphitic carbon with mass spectrometric detection, a method that evades contamination of the MS instrument with ion pairing reagent. At first, adenosine triphosphate (ATP) and other triphosphate nucleotides exhibited very poor chromatographic behavior on new columns and could hardly be eluted from columns previously cleaned with trifluoroacetic acid. Satisfactory performance of both new and older columns could, however, be achieved by treatment with reducing agent and, unexpectedly, hydrochloric acid. Over 40 nucleotides could be detected in cell extracts including many isobaric compounds such as ATP, deoxyguanosine diphosphate (dGTP), and phospho-adenosine-5′-phosphosulfate or 3′,5′-cyclic adenosine 5'-monophosphate (AMP) and its much more abundant isomer 2′,3′-cylic AMP. A fast sample preparation procedure based on solid-phase extraction on carbon allowed detection of very short-lived analytes such as cytidine 5'-monophosphate (CMP)-2-keto-deoxy-octulosonic acid. In animal cells and plant tissues, about 35 nucleotide sugars were detected, among them rarely considered metabolites such as uridine 5'-diphosphate (UDP)-l-arabinopyranose, UDP-l-arabinofuranose, guanosine 5'-diphosphate (GDP)-l-galactofuranose, UDP-l-rhamnose, and adenosine diphosphate (ADP)-sugars. Surprisingly, UDP-arabinopyranose was also found in Chinese hamster ovary (CHO) cells. Due to the unique structural selectivity of graphitic carbon, the method described herein distinguishes more nucleotides and nucleotide sugars than previously reported approaches. PMID:21043458
2012-01-01
Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies) and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and bioinformatic protocols were successfully implemented to identify 125 nuclear SNPs that are capable of differentiating most subspecies of cutthroat trout from one another. The ability to use this suite of SNPs to identify individuals of unknown genetic background to subspecies can be a valuable tool for management agencies in their efforts to evaluate the genetic structure of cutthroat trout populations prior to constructing and implementing conservation plans. PMID:23259499
Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten
2013-01-01
Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002
Jin, Zhinan; Johnson, Kenneth A.
2011-01-01
A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284
Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi
2017-04-01
Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.
Sung, Nuri; Lee, Jungsoon; Kim, Ji-Hyun; Chang, Changsoo; Joachimiak, Andrzej; Lee, Sukyeong; Tsai, Francis T. F.
2016-01-01
Heat-shock protein of 90 kDa (Hsp90) is an essential molecular chaperone that adopts different 3D structures associated with distinct nucleotide states: a wide-open, V-shaped dimer in the apo state and a twisted, N-terminally closed dimer with ATP. Although the N domain is known to mediate ATP binding, how Hsp90 senses the bound nucleotide and facilitates dimer closure remains unclear. Here we present atomic structures of human mitochondrial Hsp90N (TRAP1N) and a composite model of intact TRAP1 revealing a previously unobserved coiled-coil dimer conformation that may precede dimer closure and is conserved in intact TRAP1 in solution. Our structure suggests that TRAP1 normally exists in an autoinhibited state with the ATP lid bound to the nucleotide-binding pocket. ATP binding displaces the ATP lid that signals the cis-bound ATP status to the neighboring subunit in a highly cooperative manner compatible with the coiled-coil intermediate state. We propose that TRAP1 is a ligand-activated molecular chaperone, which couples ATP binding to dramatic changes in local structure required for protein folding. PMID:26929380
Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.
2015-01-01
Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Huang, Yi-Chen; Lin, Chun-Chi; Liu, Chuen-Ying
2004-02-01
A molecularly imprinted polymer (MIP) comprising 9-ethyladenine was polymerized in situ inside the capillary for the electrochromatographic separation of nucleotide bases. The capillary wall was first functionalized with 3-trimethoxysilylpropyl methacrylate (10% v/v) and 1,1-diphenyl-2-picrylhydrazyl (0.01% w/v) in toluene. Following this treatment, the capillary was filled with acetonitrile containing 9-ethyladenine, methacrylic acid, ethylene glycol dimethacrylate, and initiator. After polymerization, the MIP was shrunk into a film against the inner wall of the capillary with the syringe pump. The template was then removed with methanol under nitrogen flow. For evaluation the feasibility of the MIP column for the separation of nucleotide bases, some parameters including the pH, concentration of the background electrolyte, the applied voltage as well as the effect of organic modifier were studied. The migration behavior of nucleotide bases on the MIP column was also compared with that on the bare fused-silica column. The results indicated that the MIP columns demonstrated better recognition properties at a pH range of 6-8. The efficiency (plates/m) at pH 8 for the nonimprinted analyte was 75,300 for cytosine, 50,200 for thymine, and 14,800 for guanine. However, the efficiency for the imprinted analyte, adenine, was quite low. This was evidenced by the broad peak, yielding only 2600 plates/m.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides.
Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M
2003-02-27
Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.
Tabler, M; Homann, M; Tzortzakaki, S; Sczakiel, G
1994-01-01
Trans-cleaving hammerhead ribozymes with long target-specific antisense sequences flanking the catalytic domain share some features with conventional antisense RNA and are therefore termed 'catalytic antisense RNAs'. Sequences 5' to the catalytic domain form helix I and sequences 3' to it form helix III when complexed with the target RNA. A catalytic antisense RNA of more than 400 nucleotides, and specific for the human immunodeficiency virus type 1 (HIV-1), was systematically truncated within the arm that constituted originally a helix I of 128 base pairs. The resulting ribozymes formed helices I of 13, 8, 5, 3, 2, 1 and 0 nucleotides, respectively, and a helix III of about 280 nucleotides. When their in vitro cleavage activity was compared with the original catalytic antisense RNA, it was found that a helix I of as little as three nucleotides was sufficient for full endonucleolytic activity. The catalytically active constructs inhibited HIV-1 replication about four-fold more effectively than the inactive ones when tested in human cells. A conventional hammerhead ribozyme having helices of just 8 nucleotides on either side failed to cleave the target RNA in vitro when tested under the conditions for catalytic antisense RNA. Cleavage activity could only be detected after heat-treatment of the ribozyme substrate mixture which indicates that hammerhead ribozymes with short arms do not associate as efficiently to the target RNA as catalytic antisense RNA. The requirement of just a three-nucleotide helix I allows simple PCR-based generation strategies for asymmetric hammerhead ribozymes. Advantages of an asymmetric design will be discussed. Images PMID:7937118
Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.
Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A
2010-08-01
Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver
2017-01-01
Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes. PMID:28341698
Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver
2017-05-05
Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade + reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2 FEN1 Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe , but contributes to DNA repeat stability in MMR-independent processes. Copyright © 2017 Villahermosa et al.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Solution to a gene divergence problem under arbitrary stable nucleotide transition probabilities
NASA Technical Reports Server (NTRS)
Holmquist, R.
1976-01-01
A nucleic acid chain, L nucleotides in length, with the specific base sequence B(1)B(2) ... B(L) is defined by the L-dimensional vector B = (B(1), B(2), ..., B(L)). For twelve given constant non-negative transition probabilities that, in a specified position, the base B is replaced by the base B' in a single step, an exact analytical expression is derived for the probability that the position goes from base B to B' in X steps. Assuming that each base mutates independently of the others, an exact expression is derived for the probability that the initial gene sequence B goes to a sequence B' = (B'(1), B'(2), ..., B'(L)) after X = (X(1), X(2), ..., X(L)) base replacements. The resulting equations allow a more precise accounting for the effects of Darwinian natural selection in molecular evolution than does the idealized (biologically less accurate) assumption that each of the four nucleotides is equally likely to mutate to and be fixed as one of the other three. Illustrative applications of the theory to some problems of biological evolution are given.
Purifying Selection on Exonic Splice Enhancers in Intronless Genes
Savisaar, Rosina; Hurst, Laurence D.
2016-01-01
Exonic splice enhancers (ESEs) are short nucleotide motifs, enriched near exon ends, that enhance the recognition of the splice site and thus promote splicing. Are intronless genes under selection to avoid these motifs so as not to attract the splicing machinery to an mRNA that should not be spliced, thereby preventing the production of an aberrant transcript? Consistent with this possibility, we find that ESEs in putative recent retrocopies are at a higher density and evolving faster than those in other intronless genes, suggesting that they are being lost. Moreover, intronless genes are less dense in putative ESEs than intron-containing ones. However, this latter difference is likely due to the skewed base composition of intronless sequences, a skew that is in line with the general GC richness of few exon genes. Indeed, after controlling for such biases, we find that both intronless and intron-containing genes are denser in ESEs than expected by chance. Importantly, nucleotide-controlled analysis of evolutionary rates at synonymous sites in ESEs indicates that the ESEs in intronless genes are under purifying selection in both human and mouse. We conclude that on the loss of introns, some but not all, ESE motifs are lost, the remainder having functions beyond a role in splice promotion. These results have implications for the design of intronless transgenes and for understanding the causes of selection on synonymous sites. PMID:26802218
Liu, Qiu-Ning; Chai, Xin-Yue; Bian, Dan-Dan; Zhou, Chun-Lin; Tang, Bo-Ping
2016-01-01
The mitochondrial (mt) genome can provide important information for the understanding of phylogenetic relationships. The complete mt genome of Plodia interpunctella (Lepidoptera: Pyralidae) has been sequenced. The circular genome is 15 287 bp in size, encoding 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The AT skew of this mt genome is slightly negative, and the nucleotide composition is biased toward A+T nucleotides (80.15%). All PCGs start with the typical ATN (ATA, ATC, ATG, and ATT) codons, except for the cox1 gene which may start with the CGA codon. Four of the 13 PCGs harbor the incomplete termination codon T or TA. All the tRNA genes are folded into the typical clover-leaf structure of mitochondrial tRNA, except for trnS1 (AGN) in which the DHU arm fails to form a stable stem-loop structure. The overlapping sequences are 35 bp in total and are found in seven different locations. A total of 240 bp of intergenic spacers are scattered in 16 regions. The control region of the mt genome is 327 bp in length and consisted of several features common to the sequenced lepidopteran insects. Phylogenetic analysis based on 13 PCGs using the Maximum Likelihood method shows that the placement of P. interpunctella was within the Pyralidae.
Tanaka, Masayuki; Wali, Ullah Md; Nakayashiki, Hitoshi; Fukuda, Tatsuya; Mizumoto, Hiroyuki; Ohnishi, Kouhei; Kiba, Akinori; Hikichi, Yasufumi
2011-01-01
Pseudomonas cichorii harbors the hrp genes. hrp-mutants lose their virulence on eggplant but not on lettuce. A phosphinothricin N-acetyltransferase gene (pat) is located between hrpL and an aldehyde dehydrogenase gene (aldH) in the genome of P. cichorii. Comparison of nucleotide sequences and composition of the genes among pseudomonads suggests a common ancestor of hrp and pat between P. cichorii strains and P. viridiflava strains harboring the single hrp pathogenicity island. In contrast, phylogenetic diversification of aldH corresponded to species diversification amongst pseudomonads. In this study, the involvement of aldH and pat in P. cichorii virulence was analyzed. An aldH-deleted mutant (ΔaldH) and a pat-deleted mutant (Δpat) lost their virulence on eggplant but not on lettuce. P. cichorii expressed both genes in eggplant leaves, independent of HrpL, the transcriptional activator for the hrp. Inoculation into Asteraceae species susceptible to P. cichorii showed that the involvement of hrp, pat and aldH in P. cichorii virulence is independent of each other and has no relationship with the phylogeny of Asteraceae species based on the nucleotide sequences of ndhF and rbcL. It is thus thought that not only the hrp genes but also pat and aldH are implicated in the diversity of P. cichorii virulence on susceptible host plant species. PMID:24704843
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Thurlow, D L; Ehresmann, C; Ehresmann, B
1983-01-01
Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037
Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.
Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S
2017-09-01
We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.
Investigation of the Solubility and Enzymatic Activity of a Thioredoxin-Gelonin Fusion Protein
1997-05-01
1992). Figure lb is a diagram based on nuclear magnetic resonance data (NMR) of a 29-nucleotide RNA sequence containing the 17-nucleotide S/R loop and...Battalion Chemical Officer, Nuclear , Biological, Chancl Recoassanm Platoon Leader, Chemical Company Executive Officer, US Army Chemical Officer Advanced
Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...
Kawaguchi, Fuki; Kigoshi, Hiroto; Nakajima, Ayaka; Matsumoto, Yuta; Uemoto, Yoshinobu; Fukushima, Moriyuki; Yoshida, Emi; Iwamoto, Eiji; Akiyama, Takayuki; Kohama, Namiko; Kobayashi, Eiji; Honda, Takeshi; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji
2018-05-17
Fatty acid composition is an important indicator of beef quality. The objective of this study was to search the potential candidate region for fatty acid composition. We performed pool-based genome-wide association studies (GWAS) for oleic acid percentage (C18:1) in a Japanese Black cattle population from the Hyogo prefecture. GWAS analysis revealed two novel candidate regions on BTA9 and BTA14. The most significant single nucleotide polymorphisms (SNPs) in each region were genotyped in a population (n = 899) to verify their effect on C18:1. Statistical analysis revealed that both SNPs were significantly associated with C18:1 (p = .0080 and .0003), validating the quantitative trait loci (QTLs) detected in GWAS. We subsequently selected VNN1 and LYPLA1 genes as candidate genes from each region on BTA9 and BTA14, respectively. We sequenced full-length coding sequence (CDS) of these genes in eight individuals and identified a nonsynonymous SNP T66M on VNN1 gene as a putative candidate polymorphism. The polymorphism was also significantly associated with C18:1, but the p value (p = .0162) was higher than the most significant SNP on BTA9, suggesting that it would not be responsible for the QTL. Although further investigation will be needed to determine the responsible gene and polymorphism, our findings would contribute to development of selective markers for fatty acid composition in the Japanese Black cattle of Hyogo. © 2018 Japanese Society of Animal Science.
Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua
2016-09-22
The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.
Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua
2016-01-01
The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575
Redefining the genetics of Murine Gammaherpesvirus 68 via transcriptome-based annotation
Johnson, L. Steven; Willert, Erin K.; Virgin, Herbert W.
2010-01-01
Summary Viral genetic studies often focus on large open reading frames (ORFs) identified during genome annotation (ORF-based annotation). Here we provide a tool and software set for defining gene expression by murine gammaherpesvirus 68 (γHV68) nucleotide-by-nucleotide across the 119,450 basepair (bp) genome. These tools allowed us to determine that viral RNA expression was significantly more complex than predicted from ORF-based annotation, including over 73,000 nucleotides of unexpected transcription within 30 expressed genomic regions (EGRs). Approximately 90% of this RNA expression was antisense to genomic regions containing known large ORFs. We verified the existence of novel transcripts in three EGRs using standard methods to validate the approach and determined which parts of the transcriptome depend on protein or viral DNA synthesis. This redefines the genetic map of γHV68, indicates that herpesviruses contain significantly more genetic complexity than predicted from ORF-based genome annotations, and provides new tools and approaches for viral genetic studies. PMID:20542255
Ranking of Prokaryotic Genomes Based on Maximization of Sortedness of Gene Lengths
Bolshoy, A; Salih, B; Cohen, I; Tatarinova, T
2014-01-01
How variations of gene lengths (some genes become longer than their predecessors, while other genes become shorter and the sizes of these factions are randomly different from organism to organism) depend on organismal evolution and adaptation is still an open question. We propose to rank the genomes according to lengths of their genes, and then find association between the genome rank and variousproperties, such as growth temperature, nucleotide composition, and pathogenicity. This approach reveals evolutionary driving factors. The main purpose of this study is to test effectiveness and robustness of several ranking methods. The selected method of evaluation is measuring of overall sortedness of the data. We have demonstrated that all considered methods give consistent results and Bubble Sort and Simulated Annealing achieve the highest sortedness. Also, Bubble Sort is considerably faster than the Simulated Annealing method. PMID:26146586
Ranking of Prokaryotic Genomes Based on Maximization of Sortedness of Gene Lengths.
Bolshoy, A; Salih, B; Cohen, I; Tatarinova, T
How variations of gene lengths (some genes become longer than their predecessors, while other genes become shorter and the sizes of these factions are randomly different from organism to organism) depend on organismal evolution and adaptation is still an open question. We propose to rank the genomes according to lengths of their genes, and then find association between the genome rank and variousproperties, such as growth temperature, nucleotide composition, and pathogenicity. This approach reveals evolutionary driving factors. The main purpose of this study is to test effectiveness and robustness of several ranking methods. The selected method of evaluation is measuring of overall sortedness of the data. We have demonstrated that all considered methods give consistent results and Bubble Sort and Simulated Annealing achieve the highest sortedness. Also, Bubble Sort is considerably faster than the Simulated Annealing method.
A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties
Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.
2017-01-01
Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129
Organization of Nucleotides in Different Environments and the Formation of Pre-Polymers
NASA Astrophysics Data System (ADS)
Himbert, Sebastian; Chapman, Mindy; Deamer, David W.; Rheinstädter, Maikel C.
2016-08-01
RNA is a linear polymer of nucleotides linked by a ribose-phosphate backbone. Polymerization of nucleotides occurs in a condensation reaction in which phosphodiester bonds are formed. However, in the absence of enzymes and metabolism there has been no obvious way for RNA-like molecules to be produced and then encapsulated in cellular compartments. We investigated 5‧-adenosine monophosphate (AMP) and 5‧-uridine monophosphate (UMP) molecules confined in multi-lamellar phospholipid bilayers, nanoscopic films, ammonium chloride salt crystals and Montmorillonite clay, previously proposed to promote polymerization. X-ray diffraction was used to determine whether such conditions imposed a degree of order on the nucleotides. Two nucleotide signals were observed in all matrices, one corresponding to a nearest neighbour distance of 4.6 Å attributed to nucleotides that form a disordered, glassy structure. A second, smaller distance of 3.4 Å agrees well with the distance between stacked base pairs in the RNA backbone, and was assigned to the formation of pre-polymers, i.e., the organization of nucleotides into stacks of about 10 monomers. Such ordering can provide conditions that promote the nonenzymatic polymerization of RNA strands under prebiotic conditions. Experiments were modeled by Monte-Carlo simulations, which provide details of the molecular structure of these pre-polymers.
Non-uniqueness of factors constraint on the codon usage in Bombyx mori.
Jia, Xian; Liu, Shuyu; Zheng, Hao; Li, Bo; Qi, Qi; Wei, Lei; Zhao, Taiyi; He, Jian; Sun, Jingchen
2015-05-06
The analysis of codon usage is a good way to understand the genetic and evolutionary characteristics of an organism. However, there are only a few reports related with the codon usage of the domesticated silkworm, Bombyx mori (B. mori). Hence, the codon usage of B. mori was analyzed here to reveal the constraint factors and it could be helpful to improve the bioreactor based on B. mori. A total of 1,097 annotated mRNA sequences from B. mori were analyzed, revealing there is only a weak codon bias. It also shows that the gene expression level is related to the GC content, and the amino acids with higher general average hydropathicity (GRAVY) and aromaticity (Aromo). And the genes on the primary axis are strongly positively correlated with the GC content, and GC3s. Meanwhile, the effective number of codons (ENc) is strongly correlated with codon adaptation index (CAI), gene length, and Aromo values. However, the ENc values are correlated with the second axis, which indicates that the codon usage in B. mori is affected by not only mutation pressure and natural selection, but also nucleotide composition and the gene expression level. It is also associated with Aromo values, and gene length. Additionally, B. mori has a greater relative discrepancy in codon preferences with Drosophila melanogaster (D. melanogaster) or Saccharomyces cerevisiae (S. cerevisiae) than with Arabidopsis thaliana (A. thaliana), Escherichia coli (E. coli), or Caenorhabditis elegans (C. elegans). The codon usage bias in B. mori is relatively weak, and many influence factors are found here, such as nucleotide composition, mutation pressure, natural selection, and expression level. Additionally, it is also associated with Aromo values, and gene length. Among them, natural selection might play a major role. Moreover, the "optimal codons" of B. mori are all encoded by G and C, which provides useful information for enhancing the gene expression in B. mori through codon optimization.
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki
2009-04-01
We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kirouac, Kevin N.; Ling, Hong; UWO)
Human DNA polymerase iota (pol iota) is a unique member of Y-family polymerases, which preferentially misincorporates nucleotides opposite thymines (T) and halts replication at T bases. The structural basis of the high error rates remains elusive. We present three crystal structures of pol complexed with DNA containing a thymine base, paired with correct or incorrect incoming nucleotides. A narrowed active site supports a pyrimidine to pyrimidine mismatch and excludes Watson-Crick base pairing by pol. The template thymine remains in an anti conformation irrespective of incoming nucleotides. Incoming ddATP adopts a syn conformation with reduced base stacking, whereas incorrect dGTP andmore » dTTP maintain anti conformations with normal base stacking. Further stabilization of dGTP by H-bonding with Gln59 of the finger domain explains the preferential T to G mismatch. A template 'U-turn' is stabilized by pol and the methyl group of the thymine template, revealing the structural basis of T stalling. Our structural and domain-swapping experiments indicate that the finger domain is responsible for pol's high error rates on pyrimidines and determines the incorporation specificity.« less
NASA Astrophysics Data System (ADS)
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Huang, Xuhui; Wang, Dong; Weiss, Dahlia R.; Bushnell, David A.; Kornberg, Roger D.; Levitt, Michael
2010-01-01
A structurally conserved element, the trigger loop, has been suggested to play a key role in substrate selection and catalysis of RNA polymerase II (pol II) transcription elongation. Recently resolved X-ray structures showed that the trigger loop forms direct interactions with the β-phosphate and base of the matched nucleotide triphosphate (NTP) through residues His1085 and Leu1081, respectively. In order to understand the role of these two critical residues in stabilizing active site conformation in the dynamic complex, we performed all-atom molecular dynamics simulations of the wild-type pol II elongation complex and its mutants in explicit solvent. In the wild-type complex, we found that the trigger loop is stabilized in the “closed” conformation, and His1085 forms a stable interaction with the NTP. Simulations of point mutations of His1085 are shown to affect this interaction; simulations of alternative protonation states, which are inaccessible through experiment, indicate that only the protonated form is able to stabilize the His1085-NTP interaction. Another trigger loop residue, Leu1081, stabilizes the incoming nucleotide position through interaction with the nucleotide base. Our simulations of this Leu mutant suggest a three-component mechanism for correctly positioning the incoming NTP in which (i) hydrophobic contact through Leu1081, (ii) base stacking, and (iii) base pairing work together to minimize the motion of the incoming NTP base. These results complement experimental observations and provide insight into the role of the trigger loop on transcription fidelity. PMID:20798057
Chavarria, Delia; Ramos-Serrano, Andrea; Hirao, Ichiro; Berdis, Anthony J.
2011-01-01
O6-methylguanine is a miscoding DNA lesion arising from the alkylation of guanine. This report uses the bacteriophage T4 DNA polymerase as a model to probe the roles hydrogen-bonding interactions, shape/size, and nucleobase desolvation during the replication of this miscoding lesion. This was accomplished by using transient kinetic techniques to monitor the kinetic parameters for incorporating and extending natural and non-natural nucleotides. In general, the efficiency of nucleotide incorporation does not depend on the hydrogen-bonding potential of the incoming nucleotide. Instead, nucleobase hydrophobicity and shape complementarity appear to be the preeminent factors controlling nucleotide incorporation. In addition, shape complementarity plays a large role in controlling the extension of various mispairs containing O6-methylguanine. This is evident as the rate constants for extension correlate with proper interglycosyl distances and symmetry between the base angles of the formed mispair. Base pairs not conforming to an acceptable geometry within the polymerase’s active site are refractory to elongation and are processed via exonuclease proofreading. The collective data set encompassing nucleotide incorporation, extension, and excision is used to generate a model accounting for the mutagenic potential of O6-methylguanine observed in vivo. In addition, kinetic studies monitoring the incorporation and extension of non-natural nucleotides identified an analog that displays high selectivity for incorporation opposite O6-methylguanine compared to unmodified purines. The unusual selectivity of this analog for replicating damaged DNA provides a novel biochemical tool to study translesion DNA synthesis. PMID:21819995
[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].
Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V
2012-04-01
Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.
The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development
Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng; ...
2016-07-06
Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi andmore » is required for proper plant growth and development.« less
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-01-01
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053
The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng
Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi andmore » is required for proper plant growth and development.« less
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development
Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng; Stonebloom, Solomon; Smith-Moritz, Andreia M.; Pauly, Markus; Orellana, Ariel; Scheller, Henrik Vibe; Heazlewood, Joshua L.
2016-01-01
Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi and is required for proper plant growth and development. PMID:27381418
The Arabidopsis Golgi-localized GDP-L-fucose transporter is required for plant development.
Rautengarten, Carsten; Ebert, Berit; Liu, Lifeng; Stonebloom, Solomon; Smith-Moritz, Andreia M; Pauly, Markus; Orellana, Ariel; Scheller, Henrik Vibe; Heazlewood, Joshua L
2016-07-06
Nucleotide sugar transport across Golgi membranes is essential for the luminal biosynthesis of glycan structures. Here we identify GDP-fucose transporter 1 (GFT1), an Arabidopsis nucleotide sugar transporter that translocates GDP-L-fucose into the Golgi lumen. Using proteo-liposome-based transport assays, we show that GFT preferentially transports GDP-L-fucose over other nucleotide sugars in vitro, while GFT1-silenced plants are almost devoid of L-fucose in cell wall-derived xyloglucan and rhamnogalacturonan II. Furthermore, these lines display reduced L-fucose content in N-glycan structures accompanied by severe developmental growth defects. We conclude that GFT1 is the major nucleotide sugar transporter for import of GDP-L-fucose into the Golgi and is required for proper plant growth and development.
Error correction and diversity analysis of population mixtures determined by NGS
Burroughs, Nigel J.; Evans, David J.; Ryabov, Eugene V.
2014-01-01
The impetus for this work was the need to analyse nucleotide diversity in a viral mix taken from honeybees. The paper has two findings. First, a method for correction of next generation sequencing error in the distribution of nucleotides at a site is developed. Second, a package of methods for assessment of nucleotide diversity is assembled. The error correction method is statistically based and works at the level of the nucleotide distribution rather than the level of individual nucleotides. The method relies on an error model and a sample of known viral genotypes that is used for model calibration. A compendium of existing and new diversity analysis tools is also presented, allowing hypotheses about diversity and mean diversity to be tested and associated confidence intervals to be calculated. The methods are illustrated using honeybee viral samples. Software in both Excel and Matlab and a guide are available at http://www2.warwick.ac.uk/fac/sci/systemsbiology/research/software/, the Warwick University Systems Biology Centre software download site. PMID:25405074
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Varik, Vallo; Oliveira, Sofia Raquel Alves; Hauryliuk, Vasili; Tenson, Tanel
2017-09-08
Here we describe an HPLC-based method to quantify bacterial housekeeping nucleotides and the signaling messengers ppGpp and pppGpp. We have replicated and tested several previously reported HPLC-based approaches and assembled a method that can process 50 samples in three days, thus making kinetically resolved experiments feasible. The method combines cell harvesting by rapid filtration, followed by acid extraction, freeze-drying with chromatographic separation. We use a combination of C18 IPRP-HPLC (GMP unresolved and co-migrating with IMP; GDP and GTP; AMP, ADP and ATP; CTP; UTP) and SAX-HPLC in isocratic mode (ppGpp and pppGpp) with UV detection. The approach is applicable to bacteria without the requirement of metabolic labelling with 32P-labelled radioactive precursors. We applied our method to quantify nucleotide pools in Escherichia coli BW25113 K12-strain both throughout the growth curve and during acute stringent response induced by mupirocin. While ppGpp and pppGpp levels vary drastically (40- and ≥8-fold, respectively) these changes are decoupled from the quotients of the housekeeping pool and guanosine and adenosine housekeeping nucleotides: NTP/NDP/NMP ratio remains stable at 6/1/0.3 during both normal batch culture growth and upon acute amino acid starvation.
Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.
Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A
2018-06-01
Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.
Moreira, Bernardo G; You, Yong; Owczarzy, Richard
2015-03-01
Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.
Dubey, Bhawna; Meganathan, P R; Haque, Ikramul
2012-07-01
This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.
Functional analysis of regulatory single-nucleotide polymorphisms.
Pampín, Sandra; Rodríguez-Rey, José C
2007-04-01
The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.
Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M
1998-01-01
The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.
Yuri, Tamaki; Kimball, Rebecca T.; Harshman, John; Bowie, Rauri C. K.; Braun, Michael J.; Chojnowski, Jena L.; Han, Kin-Lan; Hackett, Shannon J.; Huddleston, Christopher J.; Moore, William S.; Reddy, Sushma; Sheldon, Frederick H.; Steadman, David W.; Witt, Christopher C.; Braun, Edward L.
2013-01-01
Insertion/deletion (indel) mutations, which are represented by gaps in multiple sequence alignments, have been used to examine phylogenetic hypotheses for some time. However, most analyses combine gap data with the nucleotide sequences in which they are embedded, probably because most phylogenetic datasets include few gap characters. Here, we report analyses of 12,030 gap characters from an alignment of avian nuclear genes using maximum parsimony (MP) and a simple maximum likelihood (ML) framework. Both trees were similar, and they exhibited almost all of the strongly supported relationships in the nucleotide tree, although neither gap tree supported many relationships that have proven difficult to recover in previous studies. Moreover, independent lines of evidence typically corroborated the nucleotide topology instead of the gap topology when they disagreed, although the number of conflicting nodes with high bootstrap support was limited. Filtering to remove short indels did not substantially reduce homoplasy or reduce conflict. Combined analyses of nucleotides and gaps resulted in the nucleotide topology, but with increased support, suggesting that gap data may prove most useful when analyzed in combination with nucleotide substitutions. PMID:24832669
Uncoupling protein 1 binds one nucleotide per monomer and is stabilized by tightly bound cardiolipin
Lee, Yang; Willers, Chrissie; Kunji, Edmund R. S.; Crichton, Paul G.
2015-01-01
Uncoupling protein 1 (UCP1) catalyzes fatty acid-activated, purine nucleotide-sensitive proton leak across the mitochondrial inner membrane of brown adipose tissue to produce heat, and could help combat obesity and metabolic disease in humans. Studies over the last 30 years conclude that the protein is a dimer, binding one nucleotide molecule per two proteins, and unlike the related mitochondrial ADP/ATP carrier, does not bind cardiolipin. Here, we have developed novel methods to purify milligram amounts of UCP1 from native sources by using covalent chromatography that, unlike past methods, allows the protein to be prepared in defined conditions, free of excess detergent and lipid. Assessment of purified preparations by TLC reveal that UCP1 retains tightly bound cardiolipin, with a lipid phosphorus content equating to three molecules per protein, like the ADP/ATP carrier. Cardiolipin stabilizes UCP1, as demonstrated by reconstitution experiments and thermostability assays, indicating that the lipid has an integral role in the functioning of the protein, similar to other mitochondrial carriers. Furthermore, we find that UCP1 is not dimeric but monomeric, as indicated by size exclusion analysis, and has a ligand titration profile in isothermal calorimetric measurements that clearly shows that one nucleotide binds per monomer. These findings reveal the fundamental composition of UCP1, which is essential for understanding the mechanism of the protein. Our assessment of the properties of UCP1 indicate that it is not unique among mitochondrial carriers and so is likely to use a common exchange mechanism in its primary function in brown adipose tissue mitochondria. PMID:26038550
Expansion of the Genetic Alphabet: A Chemist's Approach to Synthetic Biology.
Feldman, Aaron W; Romesberg, Floyd E
2018-02-20
The information available to any organism is encoded in a four nucleotide, two base pair genetic code. Since its earliest days, the field of synthetic biology has endeavored to impart organisms with novel attributes and functions, and perhaps the most fundamental approach to this goal is the creation of a fifth and sixth nucleotide that pair to form a third, unnatural base pair (UBP) and thus allow for the storage and retrieval of increased information. Achieving this goal, by definition, requires synthetic chemistry to create unnatural nucleotides and a medicinal chemistry-like approach to guide their optimization. With this perspective, almost 20 years ago we began designing unnatural nucleotides with the ultimate goal of developing UBPs that function in vivo, and thus serve as the foundation of semi-synthetic organisms (SSOs) capable of storing and retrieving increased information. From the beginning, our efforts focused on the development of nucleotides that bear predominantly hydrophobic nucleobases and thus that pair not based on the complementary hydrogen bonds that are so prominent among the natural base pairs but rather via hydrophobic and packing interactions. It was envisioned that such a pairing mechanism would provide a basal level of selectivity against pairing with natural nucleotides, which we expected would be the greatest challenge; however, this choice mandated starting with analogs that have little or no homology to their natural counterparts and that, perhaps not surprisingly, performed poorly. Progress toward their optimization was driven by the construction of structure-activity relationships, initially from in vitro steady-state kinetic analysis, then later from pre-steady-state and PCR-based assays, and ultimately from performance in vivo, with the results augmented three times with screens that explored combinations of the unnatural nucleotides that were too numerous to fully characterize individually. The structure-activity relationship data identified multiple features required by the UBP, and perhaps most prominent among them was a substituent ortho to the glycosidic linkage that is capable of both hydrophobic packing and hydrogen bonding, and nucleobases that stably stack with flanking natural nucleobases in lieu of the potentially more stabilizing stacking interactions afforded by cross strand intercalation. Most importantly, after the examination of hundreds of unnatural nucleotides and thousands of candidate UBPs, the efforts ultimately resulted in the identification of a family of UBPs that are well recognized by DNA polymerases when incorporated into DNA and that have been used to create SSOs that store and retrieve increased information. In addition to achieving a longstanding goal of synthetic biology, the results have important implications for our understanding of both the molecules and forces that can underlie biological processes, so long considered the purview of molecules benefiting from eons of evolution, and highlight the promise of applying the approaches and methodologies of synthetic and medical chemistry in the pursuit of synthetic biology.
Burroughs, A. Maxwell; Zhang, Dapeng; Schäffer, Daniel E.; Iyer, Lakshminarayan M.; Aravind, L.
2015-01-01
Cyclic di- and linear oligo-nucleotide signals activate defenses against invasive nucleic acids in animal immunity; however, their evolutionary antecedents are poorly understood. Using comparative genomics, sequence and structure analysis, we uncovered a vast network of systems defined by conserved prokaryotic gene-neighborhoods, which encode enzymes generating such nucleotides or alternatively processing them to yield potential signaling molecules. The nucleotide-generating enzymes include several clades of the DNA-polymerase β-like superfamily (including Vibrio cholerae DncV), a minimal version of the CRISPR polymerase and DisA-like cyclic-di-AMP synthetases. Nucleotide-binding/processing domains include TIR domains and members of a superfamily prototyped by Smf/DprA proteins and base (cytokinin)-releasing LOG enzymes. They are combined in conserved gene-neighborhoods with genes for a plethora of protein superfamilies, which we predict to function as nucleotide-sensors and effectors targeting nucleic acids, proteins or membranes (pore-forming agents). These systems are sometimes combined with other biological conflict-systems such as restriction-modification and CRISPR/Cas. Interestingly, several are coupled in mutually exclusive neighborhoods with either a prokaryotic ubiquitin-system or a HORMA domain-PCH2-like AAA+ ATPase dyad. The latter are potential precursors of equivalent proteins in eukaryotic chromosome dynamics. Further, components from these nucleotide-centric systems have been utilized in several other systems including a novel diversity-generating system with a reverse transcriptase. We also found the Smf/DprA/LOG domain from these systems to be recruited as a predicted nucleotide-binding domain in eukaryotic TRPM channels. These findings point to evolutionary and mechanistic links, which bring together CRISPR/Cas, animal interferon-induced immunity, and several other systems that combine nucleic-acid-sensing and nucleotide-dependent signaling. PMID:26590262
Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne
2012-01-01
Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761
Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne
2012-11-01
Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.
Song, Fan; Shi, Aimin; Zhou, Xuguo; Cai, Wanzhi
2012-01-01
Background Nabidae, a family of predatory heteropterans, includes two subfamilies and five tribes. We previously reported the complete mitogenome of Alloeorhynchus bakeri, a representative of the tribe Prostemmatini in the subfamily Prostemmatinae. To gain a better understanding of architecture and evolution of mitogenome in Nabidae, mitogenomes of five species representing two tribes (Gorpini and Nabini) in the subfamily Nabinae were sequenced, and a comparative mitogenomic analysis of three nabid tribes in two subfamilies was carried out. Methodology/Principal Findings Nabid mitogenomes share a similar nucleotide composition and base bias, except for the control region, where differences are observed at the subfamily level. In addition, the pattern of codon usage is influenced by the GC content and consistent with the standard invertebrate mitochondrial genetic code and the preference for A+T-rich codons. The comparison among orthologous protein-coding genes shows that different genes have been subject to different rates of molecular evolution correlated with the GC content. The stems and anticodon loops of tRNAs are extremely conserved, and the nucleotide substitutions are largely restricted to TψC and DHU loops and extra arms, with insertion-deletion polymorphisms. Comparative analysis shows similar rates of substitution between the two rRNAs. Long non-coding regions are observed in most Gorpini and Nabini mtDNAs in-between trnI-trnQ and/or trnS2-nad1. The lone exception, Nabis apicalis, however, has lost three tRNAs. Overall, phylogenetic analysis using mitogenomic data is consistent with phylogenies constructed mainly form morphological traits. Conclusions/Significance This comparative mitogenomic analysis sheds light on the architecture and evolution of mitogenomes in the family Nabidae. Nucleotide diversity and mitogenomic traits are phylogenetically informative at subfamily level. Furthermore, inclusion of a broader range of samples representing various taxonomic levels is critical for the understanding of mitogenomic evolution in damsel bugs. PMID:23029320
Evidence of codon usage in the nearest neighbor spacing distribution of bases in bacterial genomes
NASA Astrophysics Data System (ADS)
Higareda, M. F.; Geiger, O.; Mendoza, L.; Méndez-Sánchez, R. A.
2012-02-01
Statistical analysis of whole genomic sequences usually assumes a homogeneous nucleotide density throughout the genome, an assumption that has been proved incorrect for several organisms since the nucleotide density is only locally homogeneous. To avoid giving a single numerical value to this variable property, we propose the use of spectral statistics, which characterizes the density of nucleotides as a function of its position in the genome. We show that the cumulative density of bases in bacterial genomes can be separated into an average (or secular) plus a fluctuating part. Bacterial genomes can be divided into two groups according to the qualitative description of their secular part: linear and piecewise linear. These two groups of genomes show different properties when their nucleotide spacing distribution is studied. In order to analyze genomes having a variable nucleotide density, statistically, the use of unfolding is necessary, i.e., to get a separation between the secular part and the fluctuations. The unfolding allows an adequate comparison with the statistical properties of other genomes. With this methodology, four genomes were analyzed Burkholderia, Bacillus, Clostridium and Corynebacterium. Interestingly, the nearest neighbor spacing distributions or detrended distance distributions are very similar for species within the same genus but they are very different for species from different genera. This difference can be attributed to the difference in the codon usage.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gelb, Bruce D; Tartaglia, Marco; Pennacchio, Len
Diagnostic and therapeutic applications for Noonan Syndrome are described. The diagnostic and therapeutic applications are based on certain mutations in a RAS-specific guanine nucleotide exchange factor gene SOS1 or its expression product. The diagnostic and therapeutic applications are also based on certain mutations in a serine/threonine protein kinase gene RAF1 or its expression product thereof. Also described are nucleotide sequences, amino acid sequences, probes, and primers related to RAF1 or SOS1, and variants thereof, as well as host cells expressing such variants.
Li, Yunlang; Schlick, Tamar
2013-01-01
Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTP
Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K
2014-04-01
Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.
Choi, Suk-Ho
2016-01-01
Airag, alcoholic sour-tasting beverage, has been traditionally prepared by Mongolian nomads who naturally ferment fresh mares' milk. Biochemical and microbiological compositions of airag samples collected in Ulaanbaatar, Mongolia and physiological characteristics of isolated lactic acid bacteria were investigated. Protein composition and biochemical composition were determined using sodium dodecyl sulfate-gel electrophoresis and high performance liquid chromatography, respectively. Lactic acid bacteria were identified based on nucleotide sequence of 16S rRNA gene. Carbohydrate fermentation, acid survival, bile resistance and acid production in skim milk culture were determined. Equine whey proteins were present in airag samples more than caseins. The airag samples contained 0.10-3.36 % lactose, 1.44-2.33 % ethyl alcohol, 1.08-1.62 % lactic acid and 0.12-0.22 % acetic acid. Lactobacillus (L.) helveticus were major lactic acid bacteria consisting of 9 isolates among total 18 isolates of lactic acid bacteria. L. helveticus survived strongly in PBS, pH 3.0 but did not grow in MRS broth containing 0.1 % oxgall. A couple of L. helveticus isolates lowered pH of skim milk culture to less than 4.0 and produced acid up to more than 1.0 %. Highly variable biochemical compositions of the airag samples indicated inconsistent quality due to natural fermentation. Airag with low lactose content should be favorable for nutrition, considering that mares' milk with high lactose content has strong laxative effect. The isolates of L. helveticus which produced acid actively in skim milk culture might have a major role in production of airag.
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
USDA-ARS?s Scientific Manuscript database
Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...
Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya
2017-09-01
The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.
MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2016-03-01
Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.
Su, Yingjuan; Wang, Ting; Zheng, Bo; Jiang, Yu; Chen, Guopei; Gu, Hongya
2004-11-01
Sequences of chloroplast DNA (cpDNA) atpB- rbcL intergenic spacers of individuals of a tree fern species, Alsophila spinulosa, collected from ten relict populations distributed in the Hainan and Guangdong provinces, and the Guangxi Zhuang region in southern China, were determined. Sequence length varied from 724 bp to 731 bp, showing length polymorphism, and base composition was with high A+T content between 63.17% and 63.95%. Sequences were neutral in terms of evolution (Tajima's criterion D=-1.01899, P>0.10 and Fu and Li's test D*=-1.39008, P>0.10; F*=-1.49775, P>0.10). A total of 19 haplotypes were identified based on nucleotide variation. High levels of haplotype diversity (h=0.744) and nucleotide diversity (Dij=0.01130) were detected in A. spinulosa, probably associated with its long evolutionary history, which has allowed the accumulation of genetic variation within lineages. Both the minimum spanning network and neighbor-joining trees generated for haplotypes demonstrated that current populations of A. spinulosa existing in Hainan, Guangdong, and Guangxi were subdivided into two geographical groups. An analysis of molecular variance indicated that most of the genetic variation (93.49%, P<0.001) was partitioned among regions. Wright's isolation by distance model was not supported across extant populations. Reduced gene flow by the Qiongzhou Strait and inbreeding may result in the geographical subdivision between the Hainan and Guangdong + Guangxi populations (FST=0.95, Nm=0.03). Within each region, the star-like pattern of phylogeography of haplotypes implied a population expansion process during evolutionary history. Gene genealogies together with coalescent theory provided significant information for uncovering phylogeography of A. spinulosa.
Ge, Liya; Yong, Jean Wan Hong; Tan, Swee Ngin; Yang, Xin Hao; Ong, Eng Shi
2006-11-10
A method based on solid-phase extraction (SPE) and capillary zone electrophoresis-tandem mass spectrometry (CZE-MS/MS) is described for the separation and determination of six cytokinin nucleotides in coconut water. The best CZE separation for the six cytokinin nucleotide standards was achieved using a 25 mM ammonium formate/formic acid buffer (pH 3.8) and 2% (v/v) methanol with an applied gradient separation voltage (25 kV for 32 min, and then a linear gradient to 30 kV in 5 min, finally 30 kV to the end of separation) in less than 60 min. MS/MS with multiple reaction monitoring (MRM) detection was carried out to obtain sufficient selectivity and sensitivity for the cytokinin nucleotides. The combined use of on-line sample stacking and CZE-MS/MS achieved limits of detection (LODs) in the range of 0.06-0.19 microM for the six cytokinin nucleotides at a signal-to-noise ratio of 3. Furthermore, a novel dual-step SPE procedure was developed for the pre-concentration and purification of cytokinin nucleotides using Oasis HLB and Oasis MAX cartridges. The recoveries of the cytokinin nucleotides after the dual-step SPE were in the range of 44-71%. The combination of off-line SPE, on-line sample stacking and CZE-MS/MS approach was successfully applied to screen for endogenous cytokinin nucleotides present in coconut water sample. trans-Zeatin riboside-5'-monophosphate (ZMP) was detected and quantified in coconut water by CZE-MS/MS after SPE and on-line sample stacking.
Kuwahara, Masayasu; Obika, Satoshi; Nagashima, Jun-ichi; Ohta, Yuki; Suto, Yoshiyuki; Ozaki, Hiroaki; Sawai, Hiroaki; Imanishi, Takeshi
2008-08-01
In order to systematically analyze the effects of nucleoside modification of sugar moieties in DNA polymerase reactions, we synthesized 16 modified templates containing 2',4'-bridged nucleotides and three types of 2',4'-bridged nucleoside-5'-triphospates with different bridging structures. Among the five types of thermostable DNA polymerases used, Taq, Phusion HF, Vent(exo-), KOD Dash and KOD(exo-), the KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the modified templates containing 2'-O,4'-C-methylene-linked nucleotides at intervals of a few nucleotides, even at standard enzyme concentrations for 5 min. Although the Vent(exo-) DNA polymerase also read through these modified templates, kinetic study indicates that the KOD(exo-) DNA polymerase was found to be far superior to the Vent(exo-) DNA polymerase in accurate incorporation of nucleotides. When either of the DNA polymerase was used, the presence of 2',4'-bridged nucleotides on a template strand substantially decreased the reaction rates of nucleotide incorporations. The modified templates containing sequences of seven successive 2',4'-bridged nucleotides could not be completely transcribed by any of the DNA polymerases used; yields of longer elongated products decreased in the order of steric bulkiness of the modified sugars. Successive incorporation of 2',4'-bridged nucleotides into extending strands using 2',4'-bridged nucleoside-5'-triphospates was much more difficult. These data indicate that the sugar modification would have a greater effect on the polymerase reaction when it is adjacent to the elongation terminus than when it is on the template as well, as in base modification.
Binding of DNA hairpins to an assembler-strand as part of a primordial translation device
NASA Astrophysics Data System (ADS)
Baumann, Ulrich
1987-09-01
A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.
A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.
Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie
2011-06-15
A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.
Mechanism of mismatch recognition revealed by human MutSβ bound to unpaired DNA loops
Gupta, Shikha; Gellert, Martin; Yang, Wei
2011-01-01
DNA mismatch repair corrects replication errors, thus reducing mutation rates and microsatellite instability. Genetic defects in this pathway cause Lynch Syndrome and various cancers in humans. Binding of a mispaired or unpaired base by bacterial MutS and eukaryotic MutSα is well characterized. We report here crystal structures of human MutSβ complexed with DNA containing insertion-deletion loops (IDL) of 2, 3, 4, or 6 unpaired nucleotides. In contrast to eukaryotic MutSα and bacterial MutS, which bind the base of a mismatched nucleotide, MutSβ binds three phosphates in an IDL. DNA is severely bent at the IDL; unpaired bases are flipped out into the major groove and partially exposed to solvent. A normal downstream basepair can become unpaired; thereby a single unpaired base can be converted to an IDL of 2 nucleotides and recognized by MutSβ. The C-terminal dimerization domains form an integral part of the MutS structure and coordinate asymmetrical ATP hydrolysis by Msh2 and Msh3 with mismatch binding to signal for repair. PMID:22179786
Nguyen, Thao T.B.; Arimatsu, Yuji; Hong, Sung-Jong; Brindley, Paul J.; Blair, David; Laha, Thewarach; Sripa, Banchob
2015-01-01
Clonorchis sinensis is an important carcinogenic human liver fluke endemic in East and Southeast Asia. There are several conventional molecular markers have been used for identification and genetic diversity, however, no information about microsatellites of this liver fluke published so far. We here report microsatellite characterization and marker development for genetic diversity study in C. sinensis using genome-wide bioinformatics approach. Based on our search criteria, a total of 256,990 microsatellites (≥ 12 base pairs) were identified from genome database of C. sinensis with hexa-nucleotide motif being the most abundant (51%) followed by penta-nucleotide (18.3%) and tri-nucleotide (12.7%). The tetra-nucleotide, di-nucleotide and mononucleotide motifs accounted for 9.75 %, 7.63% and 0.14%, respectively. The total length of all microsatellites accounts for 0. 72 % of 547 Mb of the whole genome size and the frequency of microsatellites were found to be one microsatellite in every 2.13 kb of DNA. For the di-, tri, and tetra-nucleotide, the repeat numbers redundant are six (28%), four (45%) and three (76%), respectively. The ATC repeat is the most abundant microsatellites followed by AT, AAT and AC, respectively. Within 40 microsatellite loci developed, 24 microsatellite markers showed potential to differentiate between C. sinensis and O. viverrini. Seven out of 24 loci showed heterozygous with observed heterozygosity ranged from 0.467 to 1. Four-primer sets could amplify both C. sinensis and O. viverrini DNA with different sizes. This study provides basic information of C. sinensis microsatellites and the genome-wide markers developed may be a useful tool for genetic study of C. sinensis. PMID:25782682
Heinz, Eva; Hacker, Christian; Dean, Paul; Mifsud, John; Goldberg, Alina V.; Williams, Tom A.; Nakjang, Sirintra; Gregory, Alison; Hirt, Robert P.; Lucocq, John M.; Kunji, Edmund R. S.; Embley, T. Martin
2014-01-01
Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT) proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT) is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes), consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP) when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis. PMID:25474405
DOE Office of Scientific and Technical Information (OSTI.GOV)
Singh, Harkewal; Schuermann, Jonathan P.; Reilly, Thomas J.
2010-12-08
The e (P4) phosphatase from Haemophilus influenzae functions in a vestigial NAD{sup +} utilization pathway by dephosphorylating nicotinamide mononucleotide to nicotinamide riboside. P4 is also the prototype of class C acid phosphatases (CCAPs), which are nonspecific 5{prime},3{prime}-nucleotidases localized to the bacterial outer membrane. To understand substrate recognition by P4 and other class C phosphatases, we have determined the crystal structures of a substrate-trapping mutant P4 enzyme complexed with nicotinamide mononucleotide, 5{prime}-AMP, 3{prime}-AMP, and 2{prime}-AMP. The structures reveal an anchor-shaped substrate-binding cavity comprising a conserved hydrophobic box that clamps the nucleotide base, a buried phosphoryl binding site, and three solvent-filled pocketsmore » that contact the ribose and the hydrogen-bonding edge of the base. The span between the hydrophobic box and the phosphoryl site is optimal for recognizing nucleoside monophosphates, explaining the general preference for this class of substrate. The base makes no hydrogen bonds with the enzyme, consistent with an observed lack of base specificity. Two solvent-filled pockets flanking the ribose are key to the dual recognition of 5{prime}-nucleotides and 3{prime}-nucleotides. These pockets minimize the enzyme's direct interactions with the ribose and provide sufficient space to accommodate 5{prime} substrates in an anti conformation and 3{prime} substrates in a syn conformation. Finally, the structures suggest that class B acid phosphatases and CCAPs share a common strategy for nucleotide recognition.« less
Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.
2007-12-04
The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Dynamically correlated mutations drive human Influenza A evolution.
Tria, F; Pompei, S; Loreto, V
2013-01-01
Human Influenza A virus undergoes recurrent changes in the hemagglutinin (HA) surface protein, primarily involved in the human antibody recognition. Relevant antigenic changes, enabling the virus to evade host immune response, have been recognized to occur in parallel to multiple mutations at antigenic sites in HA. Yet, the role of correlated mutations (epistasis) in driving the molecular evolution of the virus still represents a challenging puzzle. Further, though circulation at a global geographic level is key for the survival of Influenza A, its role in shaping the viral phylodynamics remains largely unexplored. Here we show, through a sequence based epidemiological model, that epistatic effects between amino acids substitutions, coupled with a reservoir that mimics worldwide circulating viruses, are key determinants that drive human Influenza A evolution. Our approach explains all the up-to-date observations characterizing the evolution of H3N2 subtype, including phylogenetic properties, nucleotide fixation patterns, and composition of antigenic clusters.
Mitochondrial genomes of parasitic flatworms.
Le, Thanh H; Blair, David; McManus, Donald P
2002-05-01
Complete or near-complete mitochondrial genomes are now available for 11 species or strains of parasitic flatworms belonging to the Trematoda and the Cestoda. The organization of these genomes is not strikingly different from those of other eumetazoans, although one gene (atp8) commonly found in other phyla is absent from flatworms. The gene order in most flatworms has similarities to those seen in higher protostomes such as annelids. However, the gene order has been drastically altered in Schistosoma mansoni, which obscures this possible relationship. Among the sequenced taxa, base composition varies considerably, creating potential difficulties for phylogeny reconstruction. Long non-coding regions are present in all taxa, but these vary in length from only a few hundred to approximately 10000 nucleotides. Among Schistosoma spp., the long non-coding regions are rich in repeats and length variation among individuals is known. Data from mitochondrial genomes are valuable for studies on species identification, phylogenies and biogeography.
Temporal Stability of the Human Skin Microbiome.
Oh, Julia; Byrd, Allyson L; Park, Morgan; Kong, Heidi H; Segre, Julia A
2016-05-05
Biogeography and individuality shape the structural and functional composition of the human skin microbiome. To explore these factors' contribution to skin microbial community stability, we generated metagenomic sequence data from longitudinal samples collected over months and years. Analyzing these samples using a multi-kingdom, reference-based approach, we found that despite the skin's exposure to the external environment, its bacterial, fungal, and viral communities were largely stable over time. Site, individuality, and phylogeny were all determinants of stability. Foot sites exhibited the most variability; individuals differed in stability; and transience was a particular characteristic of eukaryotic viruses, which showed little site-specificity in colonization. Strain and single-nucleotide variant-level analysis showed that individuals maintain, rather than reacquire, prevalent microbes from the environment. Longitudinal stability of skin microbial communities generates hypotheses about colonization resistance and empowers clinical studies exploring alterations observed in disease states. Copyright © 2016 Elsevier Inc. All rights reserved.
Novel methodologies for spectral classification of exon and intron sequences
NASA Astrophysics Data System (ADS)
Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.
2012-12-01
Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.
Jiang, Jianping; Gao, Yahui; Hou, Yali; Li, Wenhui; Zhang, Shengli; Zhang, Qin; Sun, Dongxiao
2016-01-01
The use of whole-genome resequencing to obtain more information on genetic variation could produce a range of benefits for the dairy cattle industry, especially with regard to increasing milk production and improving milk composition. In this study, we sequenced the genomes of eight Holstein bulls from four half- or full-sib families, with high and low estimated breeding values (EBVs) of milk protein percentage and fat percentage at an average effective depth of 10×, using Illumina sequencing. Over 0.9 million nonredundant short insertions and deletions (indels) [1-49 base pairs (bp)] were obtained. Among them, 3,625 indels that were polymorphic between the high and low groups of bulls were revealed and subjected to further analysis. The vast majority (76.67%) of these indels were novel. Follow-up validation assays confirmed that most (70%) of the randomly selected indels represented true variations. The indels that were polymorphic between the two groups were annotated based on the cattle genome sequence assembly (UMD3.1.69); as a result, nearly 1,137 of them were found to be located within 767 annotated genes, only 5 (0.138%) of which were located in exons. Then, by integrated analysis of the 767 genes with known quantitative trait loci (QTL); significant single-nucleotide polymorphisms (SNPs) previously identified by genome-wide association studies (GWASs) to be associated with bovine milk protein and fat traits; and the well-known pathways involved in protein, fat synthesis, and metabolism, we identified a total of 11 promising candidate genes potentially affecting milk composition traits. These were FCGR2B, CENPE, RETSAT, ACSBG2, NFKB2, TBC1D1, NLK, MAP3K1, SLC30A2, ANGPT1 and UGDH. Our findings provide a basis for further study and reveal key genes for milk composition traits in dairy cattle.
Mechanism of mismatch recognition revealed by human MutS[beta] bound to unpaired DNA loops
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta, Shikha; Gellert, Martin; Yang, Wei
2012-04-17
DNA mismatch repair corrects replication errors, thus reducing mutation rates and microsatellite instability. Genetic defects in this pathway cause Lynch syndrome and various cancers in humans. Binding of a mispaired or unpaired base by bacterial MutS and eukaryotic MutS{alpha} is well characterized. We report here crystal structures of human MutS{beta} in complex with DNA containing insertion-deletion loops (IDL) of two, three, four or six unpaired nucleotides. In contrast to eukaryotic MutS{alpha} and bacterial MutS, which bind the base of a mismatched nucleotide, MutS{beta} binds three phosphates in an IDL. DNA is severely bent at the IDL; unpaired bases are flippedmore » out into the major groove and partially exposed to solvent. A normal downstream base pair can become unpaired; a single unpaired base can thereby be converted to an IDL of two nucleotides and recognized by MutS{beta}. The C-terminal dimerization domains form an integral part of the MutS structure and coordinate asymmetrical ATP hydrolysis by Msh2 and Msh3 with mismatch binding to signal for repair.« less
Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen
2012-09-04
A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
Genotyping by Sequencing in Almond: SNP Discovery, Linkage Mapping, and Marker Design
Goonetilleke, Shashi N.; March, Timothy J.; Wirthensohn, Michelle G.; Arús, Pere; Walker, Amanda R.; Mather, Diane E.
2017-01-01
In crop plant genetics, linkage maps provide the basis for the mapping of loci that affect important traits and for the selection of markers to be applied in crop improvement. In outcrossing species such as almond (Prunus dulcis Mill. D. A. Webb), application of a double pseudotestcross mapping approach to the F1 progeny of a biparental cross leads to the construction of a linkage map for each parent. Here, we report on the application of genotyping by sequencing to discover and map single nucleotide polymorphisms in the almond cultivars “Nonpareil” and “Lauranne.” Allele-specific marker assays were developed for 309 tag pairs. Application of these assays to 231 Nonpareil × Lauranne F1 progeny provided robust linkage maps for each parent. Analysis of phenotypic data for shell hardness demonstrated the utility of these maps for quantitative trait locus mapping. Comparison of these maps to the peach genome assembly confirmed high synteny and collinearity between the peach and almond genomes. The marker assays were applied to progeny from several other Nonpareil crosses, providing the basis for a composite linkage map of Nonpareil. Applications of the assays to a panel of almond clones and a panel of rootstocks used for almond production demonstrated the broad applicability of the markers and provide subsets of markers that could be used to discriminate among accessions. The sequence-based linkage maps and single nucleotide polymorphism assays presented here could be useful resources for the genetic analysis and genetic improvement of almond. PMID:29141988
Yang, Ming Ru; Zhou, Zhi Jun; Chang, Yan Lin; Zhao, Le Hong
2012-08-01
To help determine whether the typical arthropod arrangement was a synapomorphy for the whole Tettigoniidae, we sequenced the mitochondrial genome (mitogenome) of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae). The 16,166-bp nucleotide sequences of X. fascipes mitogenome contains the typical gene content, gene order, base composition, and codon usage found in arthropod mitogenomes. As a whole, the X. fascipes mitogenome contains a lower A+T content (70.2%) found in the complete orthopteran mitogenomes determined to date. All protein-coding genes started with a typical ATN codon. Ten of the 13 protein-coding genes have a complete termination codon, but the remaining three genes (COIII, ND5 and ND4) terminate with incomplete T. All tRNAs have the typical clover-leaf structure of mitogenome tRNA, except for tRNA(Ser(AGN)), in which lengthened anticodon stem (9 bp) with a bulged nuleotide in the middle, an unusual T-stem (6 bp in constrast to the normal 5 bp), a mini DHU arm (2 bp) and no connector nucleotides. In the A+T-rich region, two (TA)n conserved blocks that were previously described in Ensifera and two 150-bp tandem repeats plus a partial copy of the composed at 61 bp of the beginning were present. Phylogenetic analysis found: i) the monophyly of Conocephalinae was interrupted by Elimaea cheni from Phaneropterinae; and ii) Meconematinae was the most basal group among these five subfamilies.
Kurath, Gael; Dodds, J. Allan
1994-01-01
The type strain of satellite tobacco mosaic virus (STMV) contains two major variants, designated type 5 (T5) and type 6 (T6), which can be easily distinguished by RNase protection analyses. Clones containing cDNA of representative T5 and T6 STMV genomes have only five single-base differences in the entire 1059-nucleotide genome, and RNA transcribed from each clone is highly infectious when inoculated onto tobacco plants. The different RNase protection assay patterns can be used as genetic markers to identify individual STMV variants and to follow the interactions of variants and their progeny during coinfections in plants. The study described here investigated the effects of coinoculation and various delayed inoculations of T5 and T6 variants on the composition of the progeny STMV populations in systemically infected tobacco tissues. When T5 and T6 STMV RNAs were coinoculated or inoculated with 1-hr delays, the progeny from individual plants most often contained a mixture of T5 and T6 genomes. However, when there was a 24-hr delay between inoculations, the balance of T5 and T6 components in the progeny populations shifted toward predominance of the first variant inoculated. With delays of 3 or 7 days only the first variant was evident in the progeny populations, indicating that established replication of one STMV variant interferes with replication of another in a manner similar to the cross protection phenomenon.
Lin, Hao; Deng, En-Ze; Ding, Hui; Chen, Wei; Chou, Kuo-Chen
2014-01-01
The σ54 promoters are unique in prokaryotic genome and responsible for transcripting carbon and nitrogen-related genes. With the avalanche of genome sequences generated in the postgenomic age, it is highly desired to develop automated methods for rapidly and effectively identifying the σ54 promoters. Here, a predictor called ‘iPro54-PseKNC’ was developed. In the predictor, the samples of DNA sequences were formulated by a novel feature vector called ‘pseudo k-tuple nucleotide composition’, which was further optimized by the incremental feature selection procedure. The performance of iPro54-PseKNC was examined by the rigorous jackknife cross-validation tests on a stringent benchmark data set. As a user-friendly web-server, iPro54-PseKNC is freely accessible at http://lin.uestc.edu.cn/server/iPro54-PseKNC. For the convenience of the vast majority of experimental scientists, a step-by-step protocol guide was provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics that were presented in this paper just for its integrity. Meanwhile, we also discovered through an in-depth statistical analysis that the distribution of distances between the transcription start sites and the translation initiation sites were governed by the gamma distribution, which may provide a fundamental physical principle for studying the σ54 promoters. PMID:25361964
2011-01-01
Theileria parasites cause a benign infection of cattle in parts of Australia where they are endemic, but have, in recent years, been suspected of being responsible for a number of outbreaks of disease in cattle near the coast of New South Wales. The objective of this study was to identify and characterize the species of Theileria in cattle on six farms in New South Wales where disease outbreaks have occurred, and compare with Theileria from three disease-free farms in Queensland that is endemic for Theileria. Special reference was made to sub-typing of T. orientalis by type-specific PCR and sequencing of the small subunit (SSU) rRNA gene, and sequence analysis of the gene encoding a polymorphic merozoite/piroplasm surface protein (MPSP) that may be under immune selection. Nucleotide sequencing of SSU rRNA and MPSP genes revealed the presence of four Theileria genotypes: T. orientalis (buffeli), T. orientalis (ikeda), T. orientalis (chitose) and T. orientalis type 4 (MPSP) or type C (SSU rRNA). The majority of animals showed mixed infections while a few showed single infection. When MPSP nucleotide sequences were translated into amino acids, base transition did not change amino acid composition of the protein product, suggesting possible silent polymorphism. The occurrence of ikeda and type 4 (type C) previously not reported to occur and silent mutation is thought to have enhanced parasite evasion of the host immune response causing the outbreak. PMID:21338493
Origin of the polymorphism of the involucrin gene in Asians.
Djian, P; Delhomme, B; Green, H
1995-01-01
The involucrin gene, encoding a protein of the terminally differentiated keratinocyte, is polymorphic in the human. There is polymorphism of marker nucleotides a two positions in the coding region, and there are over eight polymorphic forms based on the number and kind of 10-codon tandem repeats in that part of the coding region most recently added in the human lineage. The involucrin alleles of Caucasians and Africans differ in both nucleotides and repeat patterns. We show that the involucrin alleles of East Asians (Chinese and Japanese) can be divided into two populations according to whether they possess the two marker nucleotides typical of Africans or Caucasians. The Asian population bearing Caucasian-type marker nucleotides has repeat patterns similar to those of Caucasians, whereas Asians bearing African-type marker nucleotides have repeat patterns that resemble those of Africans more than those of Caucasians. The existence of two populations of East Asian involucrin alleles gives support for the existence of a Eurasian stem lineage from which Caucasians and a part of the Asian population originated. PMID:7762559
Purine metabolism in Toxoplasma gondii
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krug, E.C.; Marr, J.J.; Berens, R.L.
1989-06-25
We have studied the incorporation and interconversion of purines into nucleotides by freshly isolated Toxoplasma gondii. They did not synthesize nucleotides from formate, glycine, or serine. The purine bases hypoxanthine, xanthine, guanine, and adenine were incorporated at 9.2, 6.2, 5.1, and 4.3 pmol/10(7) cells/h, respectively. The purine nucleosides adenosine, inosine, guanosine, and xanthosine were incorporated at 110, 9.0, 2.7, and 0.3 pmol/10(7) cells/h, respectively. Guanine, xanthine, and their respective nucleosides labeled only guanine nucleotides. Inosine, hypoxanthine, and adenine labeled both adenine and guanine nucleotide pools at nearly equal ratios. Adenosine kinase was greater than 10-fold more active than the nextmore » most active enzyme in vitro. This is consistent with the metabolic data in vivo. No other nucleoside kinase or phosphotransferase activities were found. Phosphorylase activities were detected for guanosine and inosine; no other cleavage activities were detected. Deaminases were found for adenine and guanine. Phosphoribosyltransferase activities were detected for all four purine nucleobases. Interconversion occurs only in the direction of adenine to guanine nucleotides.« less
DNA Nucleotides Detection via capacitance properties of Graphene
NASA Astrophysics Data System (ADS)
Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash
2016-05-01
In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.
Gushchin, Ivan Y; Gordeliy, Valentin I; Grudinin, Sergei
2012-09-01
Cyclic nucleotide binding domain (CNBD) is a ubiquitous domain of effector proteins involved in signalling cascades of prokaryota and eukaryota. CNBD activation by cyclic nucleotide monophosphate (cNMP) is studied well in the case of several proteins. However, this knowledge is hardly applicable to cNMP-modulated cation channels. Despite the availability of CNBD crystal structures of bacterial cyclic nucleotide-gated (CNG) and mammalian hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels in presence and absence of the cNMP, the full understanding of CNBD conformational changes during activation is lacking. Here, we describe a novel CNBD dimerization interface found in crystal structures of bacterial CNG channel MlotiK1 and mammalian cAMP-activated guanine nucleotide-exchange factor Epac2. Molecular dynamics simulations show that the found interface is stable on the studied timescale of 100 ns, in contrast to the dimerization interface, reported previously. Comparisons with cN-bound structures of CNBD show that the dimerization is incompatible with cAMP binding. Thus, the cAMP-dependent monomerization of CNBD may be an alternative mechanism of the cAMP sensing. Based on these findings, we propose a model of the bacterial CNG channel modulation by cAMP.
Schachner, Anna; Marek, Ana; Grafl, Beatrice; Hess, Michael
2016-04-15
Forty-eight fowl aviadenoviruses (FAdVs) isolated from recent IBH outbreaks across Europe were investigated, by utilizing for the first time the two major adenoviral antigenic domains, hexon loop-1 and fiber, for compound molecular characterization of IBH-associated FAdVs. Successful target gene amplification, following virus isolation in cell culture or from FTA-card samples, demonstrated presence of FAdVs in all cases indicative for IBH. Based on hexon loop-1 analysis, 31 European field isolates exhibited highest nucleotide identity (>97.2%) to reference strains FAdV-2 or -11 representing FAdV-D, while 16 and one European isolates shared >96.0% nucleotide identity with FAdV-8a and -8b, or FAdV-7, the prototype strains representing FAdV-E. These results extend recognition of specific FAdV-D and FAdV-E affiliate genotypes as causative agents of IBH to the European continent. In all isolates, species specificity determined by fiber gene analysis correlated with hexon-based typing. A threshold of 72.0% intraspecies nucleotide identity between fibers from investigated prototype and field strains corresponded with demarcation criteria proposed for hexon, suggesting fiber-based analysis as a complementary tool for molecular FAdV typing. A limited number of strains exhibited inconsistencies between hexon and fiber subclustering, indicating potential constraints for single-gene based typing of those FAdVs. Within FAdV-D, field isolate fibers shared a high degree of nucleotide (>96.7%) and aa (>95.8%) identity, while FAdV-E field isolate fibers displayed greater nucleotide divergence of up to 22.6%, resulting in lower aa identities of >81.7%. Furthermore, comparison with FAdVs from IBH outbreaks outside Europe revealed close genetic relationship in the fiber, independent of the strains' geographic origin. Copyright © 2016 Elsevier B.V. All rights reserved.
Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N
1991-11-20
A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.
MSuPDA: A memory efficient algorithm for sequence alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2015-01-16
Space complexity is a million dollar question in DNA sequence alignments. In this regards, MSuPDA (Memory Saving under Pushdown Automata) can help to reduce the occupied spaces in computer memory. Our proposed process is that Anchor Seed (AS) will be selected from given data set of Nucleotides base pairs for local sequence alignment. Quick Splitting (QS) techniques will separate the Anchor Seed from all the DNA genome segments. Selected Anchor Seed will be placed to pushdown Automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. Anchor Seed from input unit will be matched with the DNA genome segments from stack of PDA. Whatever matches, mismatches or Indel, of Nucleotides will be POP from the stack under the control of control unit of Pushdown Automata. During the POP operation on stack it will free the memory cell occupied by the Nucleotide base pair.
Van Kreijl, C F; Bos, J L
1977-01-01
The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740
Mung bean nuclease: mode of action and specificity vs synthetic esters of 3′-nucleotides
Kole, R.; Sierakowska, Halina; Szemplińska, Halina; Shugar, D.
1974-01-01
Mung bean nuclease hydrolyzes synthetic esters of 3′-nucleotides to nucleosides and phosphate esters; esters of 2′-nucleotides, and 2′→ 5′ internucleotide linkages, are resistant. Esters of ribonucleotides are cleaved at 100-fold the rate for deoxyribonucleotides, the increased rate being due to presence of the 2′-hydroxyl and not to differences in conformation. Introduction of a 5′-substituent leads to a 3-fold increase in rate. The rates of hydrolysis vary up to 10-fold with the nature of the base, in the order adenine > hypoxanthine > uracil; and up to 6-fold with the nature of the ester radical. This form of cleavage of esters of 3′-nucleotides is also characteristic for nuclease-3′-nucleotidase activities from potato tubers and wheat, suggesting that one type of enzyme is responsible for all these activities. PMID:10793750
Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.
Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C
2015-03-13
To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
NASA Technical Reports Server (NTRS)
Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.
1986-01-01
Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.
Souza, Tatiana A C B; Trindade, Daniel M; Tonoli, Celisa C C; Santos, Camila R; Ward, Richard J; Arni, Raghuvir K; Oliveira, Arthur H C; Murakami, Mário T
2011-07-01
Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.
Imincan, Gülnur; Pei, Fen; Yu, Lijia; Jin, Hongwei; Zhang, Liangren; Yang, Xiaoda; Zhang, Lihe; Tang, XinJing
2016-04-19
2'-O-(1-Pyrenylmethyl)uridine modified oligoribonucleotides provide highly sensitive pyrene fluorescent probes for detecting specific nucleotide mutation of RNA targets. To develop more stable and cost-effective oligonucleotide probes, we investigated the local microenvironmental effects of nearby nucleobases on pyrene fluorescence in duplexes of RNAs and 2'-O-(1-pyrenylmethyl)uridine modified oligonucleotides. By incorporation of deoxyribonucleotides, ribonucleotides, 2'-MeO-nucleotides and 2'-F-nucleotides at both sides of 2'-O-(1-pyrenylmethyl)uridine (U(p)) in oligodeoxynucleotide probes, we synthesized a series of pyrene modified oligonucleotide probes. Their pyrene fluorescence emission spectra indicated that only two proximal nucleotides have a substantial effect on the pyrene fluorescence properties of these oligonucleotide probes hybridized with target RNA with an order of fluorescence sensitivity of 2'-F-nucleotides > 2'-MeO-nucleotides > ribonucleotides ≫ deoxyribonucleotides. While based on circular dichroism spectra, overall helix conformations (either A- or B-form) of the duplexes have marginal effects on the sensitivity of the probes. Instead, the local substitution reflected the propensity of the nucleotide sugar ring to adopt North type conformation and, accordingly, shifted their helix geometry toward a more A-type like conformation in local microenvironments. Thus, higher enhancement of pyrene fluorescence emission favored local A-type helix structures and more polar and hydrophobic environments (F > MeO > OH at 2' substitution) of duplex minor grooves of probes with the target RNA. Further dynamic simulation revealed that local microenvironmental effect of 2'-F-nucleotides or ribonucleotides was enough for pyrene moiety to move out of nucleobases to the minor groove of duplexes; in addition, 2'-F-nucleotide had less effect on π-stack of pyrene-modified uridine with upstream and downstream nucleobases. The present oligonucleotide probes successfully distinguished target RNA from single-mutated RNA analyte during an in vitro assay of RNA synthesis.
Herath, Damayanthi; Tang, Sen-Lin; Tandon, Kshitij; Ackland, David; Halgamuge, Saman Kumara
2017-12-28
In metagenomics, the separation of nucleotide sequences belonging to an individual or closely matched populations is termed binning. Binning helps the evaluation of underlying microbial population structure as well as the recovery of individual genomes from a sample of uncultivable microbial organisms. Both supervised and unsupervised learning methods have been employed in binning; however, characterizing a metagenomic sample containing multiple strains remains a significant challenge. In this study, we designed and implemented a new workflow, Coverage and composition based binning of Metagenomes (CoMet), for binning contigs in a single metagenomic sample. CoMet utilizes coverage values and the compositional features of metagenomic contigs. The binning strategy in CoMet includes the initial grouping of contigs in guanine-cytosine (GC) content-coverage space and refinement of bins in tetranucleotide frequencies space in a purely unsupervised manner. With CoMet, the clustering algorithm DBSCAN is employed for binning contigs. The performances of CoMet were compared against four existing approaches for binning a single metagenomic sample, including MaxBin, Metawatt, MyCC (default) and MyCC (coverage) using multiple datasets including a sample comprised of multiple strains. Binning methods based on both compositional features and coverages of contigs had higher performances than the method which is based only on compositional features of contigs. CoMet yielded higher or comparable precision in comparison to the existing binning methods on benchmark datasets of varying complexities. MyCC (coverage) had the highest ranking score in F1-score. However, the performances of CoMet were higher than MyCC (coverage) on the dataset containing multiple strains. Furthermore, CoMet recovered contigs of more species and was 18 - 39% higher in precision than the compared existing methods in discriminating species from the sample of multiple strains. CoMet resulted in higher precision than MyCC (default) and MyCC (coverage) on a real metagenome. The approach proposed with CoMet for binning contigs, improves the precision of binning while characterizing more species in a single metagenomic sample and in a sample containing multiple strains. The F1-scores obtained from different binning strategies vary with different datasets; however, CoMet yields the highest F1-score with a sample comprised of multiple strains.
A phylogenetic Kalman filter for ancestral trait reconstruction using molecular data.
Lartillot, Nicolas
2014-02-15
Correlation between life history or ecological traits and genomic features such as nucleotide or amino acid composition can be used for reconstructing the evolutionary history of the traits of interest along phylogenies. Thus far, however, such ancestral reconstructions have been done using simple linear regression approaches that do not account for phylogenetic inertia. These reconstructions could instead be seen as a genuine comparative regression problem, such as formalized by classical generalized least-square comparative methods, in which the trait of interest and the molecular predictor are represented as correlated Brownian characters coevolving along the phylogeny. Here, a Bayesian sampler is introduced, representing an alternative and more efficient algorithmic solution to this comparative regression problem, compared with currently existing generalized least-square approaches. Technically, ancestral trait reconstruction based on a molecular predictor is shown to be formally equivalent to a phylogenetic Kalman filter problem, for which backward and forward recursions are developed and implemented in the context of a Markov chain Monte Carlo sampler. The comparative regression method results in more accurate reconstructions and a more faithful representation of uncertainty, compared with simple linear regression. Application to the reconstruction of the evolution of optimal growth temperature in Archaea, using GC composition in ribosomal RNA stems and amino acid composition of a sample of protein-coding genes, confirms previous findings, in particular, pointing to a hyperthermophilic ancestor for the kingdom. The program is freely available at www.phylobayes.org.
Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.
2007-01-01
A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.
Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong
2016-03-15
A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.
Using a Euclid distance discriminant method to find protein coding genes in the yeast genome.
Zhang, Chun-Ting; Wang, Ju; Zhang, Ren
2002-02-01
The Euclid distance discriminant method is used to find protein coding genes in the yeast genome, based on the single nucleotide frequencies at three codon positions in the ORFs. The method is extremely simple and may be extended to find genes in prokaryotic genomes or eukaryotic genomes with less introns. Six-fold cross-validation tests have demonstrated that the accuracy of the algorithm is better than 93%. Based on this, it is found that the total number of protein coding genes in the yeast genome is less than or equal to 5579 only, about 3.8-7.0% less than 5800-6000, which is currently widely accepted. The base compositions at three codon positions are analyzed in details using a graphic method. The result shows that the preference codons adopted by yeast genes are of the RGW type, where R, G and W indicate the bases of purine, non-G and A/T, whereas the 'codons' in the intergenic sequences are of the form NNN, where N denotes any base. This fact constitutes the basis of the algorithm to distinguish between coding and non-coding ORFs in the yeast genome. The names of putative non-coding ORFs are listed here in detail.
Ghavami, Raouf; Salimi, Abdollah; Navaee, Aso
2011-05-15
For the first time a novel and simple electrochemical method was used for simultaneous detection of DNA bases (guanine, adenine, thymine and cytosine) without any pretreatment or separation process. Glassy carbon electrode modified with silicon carbide nanoparticles (SiCNP/GC), have been used for electrocatalytic oxidation of purine (guanine and adenine) and pyrimidine bases (thymine and cytosine) nucleotides. Field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) techniques were used to examine the structure of the SiCNP/GC modified electrode. The modified electrode shows excellent electrocatalytic activity toward guanine, adenine, thymine and cytosine. Differential pulse voltammetry (DPV) was proposed for simultaneous determination of four DNA bases. The effects of different parameters such as the thickness of SiC layer, pulse amplitude, scan rate, supporting electrolyte composition and pH were optimized to obtain the best peak potential separation and higher sensitivity. Detection limit, sensitivity and linear concentration range of the modified electrode toward proposed analytes were calculated for, guanine, adenine, thymine and cytosine, respectively. As shown this sensor can be used for nanomolar or micromolar detection of different DNA bases simultaneously or individually. This sensor also exhibits good stability, reproducibility and long lifetime. Copyright © 2011 Elsevier B.V. All rights reserved.
MicroRNA Targeting Specificity in Mammals: Determinants Beyond Seed Pairing
Grimson, Andrew; Farh, Kyle Kai-How; Johnston, Wendy K.; Garrett-Engele, Philip; Lim, Lee P.; Bartel, David P.
2013-01-01
Summary Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are ~7-nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for co-expressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13–16, and positioning within the 3'UTR at least 15 nt from the stop codon and away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets. PMID:17612493
Zhao, Ying-Tao; Wang, Meng; Fu, San-Xiong; Yang, Wei-Cai; Qi, Cun-Kou; Wang, Xiu-Jie
2012-02-01
MicroRNAs (miRNAs) and small interfering RNAs are important regulators of plant development and seed formation, yet their population and abundance in the oil crop Brassica napus are still not well understood, especially at different developmental stages and among cultivars with varied seed oil contents. Here, we systematically analyzed the small RNA expression profiles of Brassica napus seeds at early embryonic developmental stages in high-oil-content and low-oil-content B. napus cultivars, both cultured in two environments. A total of 50 conserved miRNAs and 9 new miRNAs were identified, together with some new miRNA targets. Expression analysis revealed some miRNAs with varied expression levels in different seed oil content cultivars or at different embryonic developmental stages. A large number of 23-nucleotide small RNAs with specific nucleotide composition preferences were also identified, which may present new classes of functional small RNAs.
Inter- and intraspecific mitochondrial DNA variation in North American bears (Ursus)
Cronin, Matthew A.; Amstrup, Steven C.; Garner, Gerald W.; Vyse, Ernest R.
1991-01-01
We assessed mitochondrial DNA variation in North American black bears (Ursus americanus), brown bears (Ursus arctos), and polar bears (Ursus maritimus). Divergent mitochondrial DNA haplotypes (0.05 base substitutions per nucleotide) were identified in populations of black bears from Montana and Oregon. In contrast, very similar haplotypes occur in black bears across North America. This discordance of haplotype phylogeny and geographic distribution indicates that there has been maintenance of polymorphism and considerable gene flow throughout the history of the species. Intraspecific mitochondrial DNA sequence divergence in brown bears and polar bears is lower than in black bears. The two morphological forms of U. arctos, grizzly and coastal brown bears, are not in distinct mtDNA lineages. Interspecific comparisons indicate that brown bears and polar bears share similar mitochondrial DNA (0.023 base substitutions per nucleotide) which is quite divergent (0.078 base substitutions per nucleotide) from that of black bears. High mitochondrial DNA divergence within black bears and paraphyletic relationships of brown and polar bear mitochondrial DNA indicate that intraspecific variation across species' ranges should be considered in phylogenetic analyses of mitochondrial DNA.
NMR structure of the 101-nucleotide core encapsidation signal of the Moloney murine leukemia virus.
D'Souza, Victoria; Dey, Anwesha; Habib, Dina; Summers, Michael F
2004-03-19
The full length, positive-strand genome of the Moloney Murine Leukemia Virus contains a "core encapsidation signal" that is essential for efficient genome packaging during virus assembly. We have determined the structure of a 101-nucleotide RNA that contains this signal (called mPsi) using a novel isotope-edited NMR approach. The method is robust and should be generally applicable to larger RNAs. mPsi folds into three stem loops, two of which (SL-C and SL-D) co-stack to form an extended helix. The third stem loop (SL-B) is connected to SL-C by a flexible, four-nucleotide linker. The structure contains five mismatched base-pairs, an unusual C.CG base-triple platform, and a novel "A-minor K-turn," in which unpaired adenosine bases A340 and A341 of a GGAA bulge pack in the minor groove of a proximal stem, and a bulged distal uridine (U319) forms a hydrogen bond with the phosphodiester of A341. Phylogenetic analyses indicate that these essential structural elements are conserved among the murine C-type retroviruses.
Worrell, V E; Nagle, D P
1990-01-01
The enzymes involved in the purine interconversion pathway of wild-type and purine analog-resistant strains of Methanobacterium thermoautotrophicum Marburg were assayed by radiometric and spectrophotometric methods. Wild-type cells incorporated labeled adenine, guanine, and hypoxanthine, whereas mutant strains varied in their ability to incorporate these bases. Adenine, guanine, hypoxanthine, and xanthine were activated by phosphoribosyltransferase activities present in wild-type cell extracts. Some mutant strains simultaneously lost the ability to convert both guanine and hypoxanthine to the respective nucleotide, suggesting that the same enzyme activates both bases. Adenosine, guanosine, and inosine phosphorylase activities were detected for the conversion of base to nucleoside. Adenine deaminase activity was detected at low levels. Guanine deaminase activity was not detected. Nucleoside kinase activities for the conversion of adenosine, guanosine, and inosine to the respective nucleotides were detected by a new assay. The nucleotide-interconverting enzymes AMP deaminase, succinyl-AMP synthetase, succinyl-AMP lyase, IMP dehydrogenase, and GMP synthetase were present in extracts; GMP reductase was not detected. The results indicate that this autotrophic methanogen has a complex system for the utilization of exogenous purines. PMID:2345148
Stoddard, Colby D.; Widmann, Jeremy; Trausch, Jeremiah J.; Marcano-Velázquez, Joan G.; Knight, Rob; Batey, Robert T.
2013-01-01
Direct sensing of intracellular metabolite concentrations by riboswitch RNAs provides an economical and rapid means to maintain metabolic homeostasis. Since many organisms employ the same class of riboswitch to control different genes or transcription units, it is likely that functional variation exists in riboswitches such that activity is tuned to meet cellular needs. Using a bioinformatic approach, we have identified a region of the purine riboswitch aptamer domain that displays conservation patterns linked to riboswitch activity. Aptamer domain compositions within this region can be divided into nine classes that display a spectrum of activities. Naturally occurring compositions in this region favor rapid association rate constants and slow dissociation rate constants for ligand binding. Using X-ray crystallography and chemical probing, we demonstrate that both the free and bound states are influenced by the composition of this region and that modest sequence alterations have a dramatic impact on activity. The introduction of non-natural compositions result in the inability to regulate gene expression in vivo, suggesting that aptamer domain activity is highly plastic and thus readily tunable to meet cellular needs. PMID:23485418
Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel
2014-01-01
Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104
He, Daniel; Lorenz, Robin; Kim, Choel; Herberg, Friedrich W; Lim, Chinten James
2017-12-15
The cyclic adenosine monophosphate (cAMP)- and cyclic guanosine monophosphate (cGMP)-dependent protein kinases (PKA and PKG) are key effectors of cyclic nucleotide signaling. Both share structural features that include tandem cyclic nucleotide-binding (CNB) domains, CNB-A and CNB-B, yet their functions are separated through preferential activation by either cAMP or cGMP. Based on structural studies and modeling, key CNB contact residues have been identified for both kinases. In this study, we explored the requirements for conversion of PKA activation from cAMP-dependent to cGMP-dependent. The consequences of the residue substitutions T192R/A212T within CNB-A or G316R/A336T within CNB-B of PKA-RIα on cyclic nucleotide binding and holoenzyme activation were assessed in vitro using purified recombinant proteins, and ex vivo using RIα-deficient mouse embryonic fibroblasts genetically reconstituted with wild-type or mutant PKA-RIα. In vitro, a loss of binding and activation selectivity was observed when residues in either one of the CNB domains were mutated, while mutations in both CNB domains resulted in a complete switch of selectivity from cAMP to cGMP. The switch in selectivity was also recapitulated ex vivo, confirming their functional roles in cells. Our results highlight the importance of key cyclic nucleotide contacts within each CNB domain and suggest that these domains may have evolved from an ancestral gene product to yield two distinct cyclic nucleotide-dependent protein kinases.
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*
Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis
2014-01-01
The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514
Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.
Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis
2014-09-12
The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark
2017-01-24
Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.
Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA
Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan
2017-01-01
The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416
Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.
Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris
2004-07-14
With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.
Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H
2017-04-15
Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification
Sinclair, Robert M.; Ravantti, Janne J.
2017-01-01
ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979
Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki
2013-01-01
DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956
Microbiome-Metabolome Responses in the Cecum and Colon of Pig to a High Resistant Starch Diet.
Sun, Yue; Su, Yong; Zhu, Weiyun
2016-01-01
Currently, knowledge about the impact of long-term intake of high resistant starch diet on pig hindgut microbiota and metabolite profile is limited. In this study, a combination of the pyrosequencing and the mass spectrometry (MS)-based metabolomics techniques were used to investigate the effects of a raw potato starch (RPS, high in resistant starch) diet on microbial composition and microbial metabolites in the hindgut of pig. The results showed that Coprococcus, Ruminococcus, and Turicibacter increased significantly, while Sarcina and Clostridium decreased in relative abundances in the hindgut of pigs fed RPS. The metabolimic analysis revealed that RPS significantly affected starch and sucrose metabolites, amino acid turnover or protein biosynthesis, lipid metabolites, glycolysis, the pentose phosphate pathway, inositol phosphate metabolism, and nucleotide metabolism. Furthermore, a Pearson's correlation analysis showed that Ruminococcus and Coprococcus were positively correlated with glucose-6-phosphate, maltose, arachidonic acid, 9, 12-octadecadienoic acid, oleic acid, phosphate, but negatively correlated with α-aminobutyric acid. However, the correlation of Clostridium and Sarcina with these compounds was in the opposite direction. The results suggest that RPS not only alters the composition of the gut microbial community but also modulates the metabolic pathway of microbial metabolism, which may further affect the hindgut health of the host.
Microbiome-Metabolome Responses in the Cecum and Colon of Pig to a High Resistant Starch Diet
Sun, Yue; Su, Yong; Zhu, Weiyun
2016-01-01
Currently, knowledge about the impact of long-term intake of high resistant starch diet on pig hindgut microbiota and metabolite profile is limited. In this study, a combination of the pyrosequencing and the mass spectrometry (MS)-based metabolomics techniques were used to investigate the effects of a raw potato starch (RPS, high in resistant starch) diet on microbial composition and microbial metabolites in the hindgut of pig. The results showed that Coprococcus, Ruminococcus, and Turicibacter increased significantly, while Sarcina and Clostridium decreased in relative abundances in the hindgut of pigs fed RPS. The metabolimic analysis revealed that RPS significantly affected starch and sucrose metabolites, amino acid turnover or protein biosynthesis, lipid metabolites, glycolysis, the pentose phosphate pathway, inositol phosphate metabolism, and nucleotide metabolism. Furthermore, a Pearson's correlation analysis showed that Ruminococcus and Coprococcus were positively correlated with glucose-6-phosphate, maltose, arachidonic acid, 9, 12-octadecadienoic acid, oleic acid, phosphate, but negatively correlated with α-aminobutyric acid. However, the correlation of Clostridium and Sarcina with these compounds was in the opposite direction. The results suggest that RPS not only alters the composition of the gut microbial community but also modulates the metabolic pathway of microbial metabolism, which may further affect the hindgut health of the host. PMID:27303373
Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V
2016-01-01
The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)
Bruno, Rosaria; Marino, Nadia; Bartella, Lucia; Di Donna, Leonardo; De Munno, Giovanni; Pardo, Emilio; Armentano, Donatella
2018-06-05
We report a new chiral coordination polymer, prepared from the cytidine 5'-monophosphate (CMP) nucleotide, capable of separating efficiently (enantiomeric excess of ca. 100%) racemic mixtures of l- and d-Asp in a temperature-dependent manner. The crystal structure of the host-guest adsorbate, with the d-Asp guest molecules loaded within its channels, could be solved allowing a direct visualization of the chiral recognition process.
Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison
2012-01-01
Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198
Analysis of correlation structures in the Synechocystis PCC6803 genome.
Wu, Zuo-Bing
2014-12-01
Transfer of nucleotide strings in the Synechocystis sp. PCC6803 genome is investigated to exhibit periodic and non-periodic correlation structures by using the recurrence plot method and the phase space reconstruction technique. The periodic correlation structures are generated by periodic transfer of several substrings in long periodic or non-periodic nucleotide strings embedded in the coding regions of genes. The non-periodic correlation structures are generated by non-periodic transfer of several substrings covering or overlapping with the coding regions of genes. In the periodic and non-periodic transfer, some gaps divide the long nucleotide strings into the substrings and prevent their global transfer. Most of the gaps are either the replacement of one base or the insertion/reduction of one base. In the reconstructed phase space, the points generated from two or three steps for the continuous iterative transfer via the second maximal distance can be fitted by two lines. It partly reveals an intrinsic dynamics in the transfer of nucleotide strings. Due to the comparison of the relative positions and lengths, the substrings concerned with the non-periodic correlation structures are almost identical to the mobile elements annotated in the genome. The mobile elements are thus endowed with the basic results on the correlation structures. Copyright © 2014 Elsevier Ltd. All rights reserved.
Chen, M J; Chu, C C; Shyr, M H; Lin, C L; Lin, P Y; Yang, K L
2010-02-01
HLA-B*5214, a novel rare allele of HLA-B*52 variant, was found in a Taiwanese volunteer bone marrow donor by sequence-based typing method. The sequence of B*5214 is identical to that of B*520101 in exon 2 but differs from B*520101 in exon 3 at nucleotide positions 419 A-->T and 435 A-->G. Alteration of these two nucleotides resulted an amino acid substitution at amino acid residue 116 Y-->F ( TAC-->TTC) and a silent exchange at residue 121 K-->K (AAA-->AAG).
Posada, David
2006-01-01
ModelTest server is a web-based application for the selection of models of nucleotide substitution using the program ModelTest. The server takes as input a text file with likelihood scores for the set of candidate models. Models can be selected with hierarchical likelihood ratio tests, or with the Akaike or Bayesian information criteria. The output includes several statistics for the assessment of model selection uncertainty, for model averaging or to estimate the relative importance of model parameters. The server can be accessed at . PMID:16845102
NASA Technical Reports Server (NTRS)
Kawamura, K.; Ferris, J. P.
1999-01-01
The montmorillonite clay catalyzed condensation of activated monocleotides to oligomers of RNA is a possible first step in the formation of the proposed RNA world. The rate constants for the condensation of the phosphorimidazolide of adenosine were measured previously and these studies have been extended to the phosphorimidazolides of inosine and uridine in the present work to determine of substitution of neutral heterocycles for the basic adenine ring changes the reaction rate or regioselectivity. The oligomerization reactions of the 5'-phosphoromidazolides of uridine (ImpU) and inosine (ImpI) on montmorillonite yield oligo(U)s and oligo(I)s as long as heptamers. The rate constants for oligonucleotide formation were determined by measuring the rates of formation of the oligomers by HPLC. Both the apparent rate constants in the reaction mixture and the rate constants on the clay surface were calculated using the partition coefficients of the oligomers between the aqueous and clay phases. The rate constants for trimer formation are much greater than those dimer synthesis but there was little difference in the rate constants for the formation of trimers and higher oligomers. The overall rates of oligomerization of the phosphorimidazolides of purine and pyrimidine nucleosides in the presence of montmorillonite clay are the same suggesting that RNA formed on the primitive Earth could have contained a variety of heterocyclic bases. The rate constants for oligomerization of pyrimidine nucleotides on the clay surface are significantly higher than those of purine nucleotides since the pyrimidine nucleotides bind less strongly to the clay than do the purine nucleotides. The differences in the binding is probably due to Van der Waals interactions between the purine bases and the clay surface. Differences in the basicity of the heterocyclic ring in the nucleotide have little effect on the oligomerization process.
Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin
2017-02-01
Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.
Correlation approach to identify coding regions in DNA sequences
NASA Technical Reports Server (NTRS)
Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.
1994-01-01
Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.
Copertino, D W; Christopher, D A; Hallick, R B
1991-01-01
The splicing of a 409 nucleotide intron from the Euglena gracilis chloroplast ribosomal protein S3 gene (rps3) was examined by cDNA cloning and sequencing, and northern hybridization. Based on the characterization of a partially spliced pre-mRNA, the intron was characterized as a 'mixed' twintron, composed of a 311 nucleotide group II intron internal to a 98 nucleotide group III intron. Twintron excision is via a 2-step sequential splicing pathway, with removal of the internal group II intron preceding excision of the external group III intron. Based on secondary structural analysis of the twintron, we propose that group III introns may represent highly degenerate versions of group II introns. The existence of twintrons is interpreted as evidence that group II introns were inserted during the evolution of Euglena chloroplast genes from a common ancestor with eubacteria, archaebacteria, cyanobacteria, and other chloroplasts. Images PMID:1721702
Detecting Single-Nucleotide Substitutions Induced by Genome Editing.
Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R
2016-08-01
The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.
Comparison of the acid-base properties of ribose and 2'-deoxyribose nucleotides.
Mucha, Ariel; Knobloch, Bernd; Jezowska-Bojczuk, Małgorzata; Kozłowski, Henryk; Sigel, Roland K O
2008-01-01
The extent to which the replacement of a ribose unit by a 2'-deoxyribose unit influences the acid-base properties of nucleotides has not hitherto been determined in detail. In this study, by potentiometric pH titrations in aqueous solution, we have measured the acidity constants of the 5'-di- and 5'-triphosphates of 2'-deoxyguanosine [i.e., of H(2)(dGDP)(-) and H(2)(dGTP)(2-)] as well as of the 5'-mono-, 5'-di-, and 5'-triphosphates of 2'-deoxyadenosine [i.e., of H(2)(dAMP)(+/-), H(2)(dADP)(-), and H(2)(dATP)(2-)]. These 12 acidity constants (of the 56 that are listed) are compared with those of the corresponding ribose derivatives (published data) measured under the same experimental conditions. The results show that all protonation sites in the 2'-deoxynucleotides are more basic than those in their ribose counterparts. The influence of the 2'-OH group is dependent on the number of 5'-phosphate groups as well as on the nature of the purine nucleobase. The basicity of N7 in guanine nucleotides is most significantly enhanced (by about 0.2 pK units), while the effect on the phosphate groups and the N1H or N1H(+) sites is less pronounced but clearly present. In addition, (1)H NMR chemical shift change studies in dependence on pD in D(2)O have been carried out for the dAMP, dADP, and dATP systems, which confirmed the results from the potentiometric pH titrations and showed the nucleotides to be in their anti conformations. Overall, our results are not only of relevance for metal ion binding to nucleotides or nucleic acids, but also constitute an exact basis for the calculation, determination, and understanding of perturbed pK(a) values in DNAzymes and ribozymes, as needed for the delineation of acid-base mechanisms in catalysis.
Recognition of dual targets by a molecular beacon-based sensor: subtyping of influenza A virus.
Lee, Chun-Ching; Liao, Yu-Chieh; Lai, Yu-Hsuan; Lee, Chang-Chun David; Chuang, Min-Chieh
2015-01-01
A molecular beacon (MB)-based sensor to offer a decisive answer in combination with information originated from dual-target inputs is designed. The system harnesses an assistant strand and thermodynamically favored designation of unpaired nucleotides (UNs) to process the binary targets in "AND-gate" format and report fluorescence in "off-on" mechanism via a formation of a DNA four-way junction (4WJ). By manipulating composition of the UNs, the dynamic fluorescence difference between the binary targets-coexisting circumstance and any other scenario was maximized. Characteristic equilibrium constant (K), change of entropy (ΔS), and association rate constant (k) between the association ("on") and dissociation ("off") states of the 4WJ were evaluated to understand unfolding behavior of MB in connection to its sensing capability. Favorable MB and UNs were furthermore designed toward analysis of genuine genetic sequences of hemagglutinin (HA) and neuraminidase (NA) in an influenza A H5N2 isolate. The MB-based sensor was demonstrated to yield a linear calibration range from 1.2 to 240 nM and detection limit of 120 pM. Furthermore, high-fidelity subtyping of influenza virus was implemented in a sample of unpurified amplicons. The strategy opens an alternative avenue of MB-based sensors for dual targets toward applications in clinical diagnosis.
Xiao, P; Niu, L L; Zhao, Q J; Chen, X Y; Wang, L J; Li, L; Zhang, H P; Guo, J Z; Xu, H Y; Zhong, T
2017-11-16
The origins and phylogeny of different sheep breeds has been widely studied using polymorphisms within the mitochondrial hypervariable region. However, little is known about the mitochondrial DNA (mtDNA) content and phylogeny based on mtDNA protein-coding genes. In this study, we assessed the phylogeny and copy number of the mtDNA in eight indigenous (population size, n=184) and three introduced (n=66) sheep breeds in China based on five mitochondrial coding genes (COX1, COX2, ATP8, ATP6 and COX3). The mean haplotype and nucleotide diversities were 0.944 and 0.00322, respectively. We identified a correlation between the lineages distribution and the genetic distance, whereby Valley-type Tibetan sheep had a closer genetic relationship with introduced breeds (Dorper, Poll Dorset and Suffolk) than with other indigenous breeds. Similarly, the Median-joining profile of haplotypes revealed the distribution of clusters according to genetic differences. Moreover, copy number analysis based on the five mitochondrial coding genes was affected by the genetic distance combining with genetic phylogeny; we also identified obvious non-synonymous mutations in ATP6 between the different levels of copy number expressions. These results imply that differences in mitogenomic compositions resulting from geographical separation lead to differences in mitochondrial function.
Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L
2006-01-15
Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.
Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina
NASA Astrophysics Data System (ADS)
Arora, Avnish Kumar; Kamaluddin
2009-03-01
Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.
Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L
2015-05-01
Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Cooper-Dehoff, Rhonda M; Hou, Wei; Weng, Liming; Baillie, Rebecca A; Beitelshees, Amber L; Gong, Yan; Shahin, Mohamed H A; Turner, Stephen T; Chapman, Arlene; Gums, John G; Boyle, Stephen H; Zhu, Hongjie; Wikoff, William R; Boerwinkle, Eric; Fiehn, Oliver; Frye, Reginald F; Kaddurah-Daouk, Rima; Johnson, Julie A
2014-04-01
The 5-amino acid (AA) signature, including isoleucine, leucine, valine, tyrosine, and phenylalanine, has been associated with incident diabetes mellitus and insulin resistance. We investigated whether this same AA signature, single-nucleotide polymorphisms in genes in their catabolic pathway, was associated with development of impaired fasting glucose (IFG) after atenolol treatment. Among 234 European American participants enrolled in the Pharmacogenomic Evaluation of Antihypertensive Responses (PEAR) study and treated with atenolol for 9 weeks, we prospectively followed a nested cohort that had both metabolomics profiling and genotype data available for the development of IFG. We assessed the association between baseline circulating levels of isoleucine, leucine, valine, tyrosine, and phenylalanine, as well as single-nucleotide polymorphisms in branched-chain amino-acid transaminase 1 (BCAT1) and phenylalanine hydroxylase (PAH) with development of IFG. All baseline AA levels were strongly associated with IFG development. Each increment in standard deviation of the 5 AAs was associated with the following odds ratio and 95% confidence interval for IFG based on a fully adjusted model: isoleucine 2.29 (1.31-4.01), leucine 1.80 (1.10-2.96), valine 1.77 (1.07-2.92), tyrosine 2.13 (1.20-3.78), and phenylalanine 2.04 (1.16-3.59). The composite P value was 2×10(-5). Those with PAH (rs2245360) AA genotype had the highest incidence of IFG (P for trend=0.0003). Our data provide important insight into the metabolic and genetic mechanisms underlying atenolol-associated adverse metabolic effects. Clinical Trial Registration- http://www.clinicaltrials.gov; Unique Identifier: NCT00246519.
Penno, Christophe; Sharma, Virag; Coakley, Arthur; O'Connell Motherway, Mary; van Sinderen, Douwe; Lubkowska, Lucyna; Kireeva, Maria L; Kashlev, Mikhail; Baranov, Pavel V; Atkins, John F
2015-04-21
Escherichia coli and yeast DNA-dependent RNA polymerases are shown to mediate efficient nascent transcript stem loop formation-dependent RNA-DNA hybrid realignment. The realignment was discovered on the heteropolymeric sequence T5C5 and yields transcripts lacking a C residue within a corresponding U5C4. The sequence studied is derived from a Roseiflexus insertion sequence (IS) element where the resulting transcriptional slippage is required for transposase synthesis. The stability of the RNA structure, the proximity of the stem loop to the slippage site, the length and composition of the slippage site motif, and the identity of its 3' adjacent nucleotides (nt) are crucial for transcripts lacking a single C. In many respects, the RNA structure requirements for this slippage resemble those for hairpin-dependent transcription termination. In a purified in vitro system, the slippage efficiency ranges from 5% to 75% depending on the concentration ratios of the nucleotides specified by the slippage sequence and the 3' nt context. The only previous proposal of stem loop mediated slippage, which was in Ebola virus expression, was based on incorrect data interpretation. We propose a mechanical slippage model involving the RNAP translocation state as the main motor in slippage directionality and efficiency. It is distinct from previously described models, including the one proposed for paramyxovirus, where following random movement efficiency is mainly dependent on the stability of the new realigned hybrid. In broadening the scope for utilization of transcription slippage for gene expression, the stimulatory structure provides parallels with programmed ribosomal frameshifting at the translation level.
Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko
2016-01-01
Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Genotyping by Sequencing in Almond: SNP Discovery, Linkage Mapping, and Marker Design.
Goonetilleke, Shashi N; March, Timothy J; Wirthensohn, Michelle G; Arús, Pere; Walker, Amanda R; Mather, Diane E
2018-01-04
In crop plant genetics, linkage maps provide the basis for the mapping of loci that affect important traits and for the selection of markers to be applied in crop improvement. In outcrossing species such as almond ( Prunus dulcis Mill. D. A. Webb), application of a double pseudotestcross mapping approach to the F 1 progeny of a biparental cross leads to the construction of a linkage map for each parent. Here, we report on the application of genotyping by sequencing to discover and map single nucleotide polymorphisms in the almond cultivars "Nonpareil" and "Lauranne." Allele-specific marker assays were developed for 309 tag pairs. Application of these assays to 231 Nonpareil × Lauranne F 1 progeny provided robust linkage maps for each parent. Analysis of phenotypic data for shell hardness demonstrated the utility of these maps for quantitative trait locus mapping. Comparison of these maps to the peach genome assembly confirmed high synteny and collinearity between the peach and almond genomes. The marker assays were applied to progeny from several other Nonpareil crosses, providing the basis for a composite linkage map of Nonpareil. Applications of the assays to a panel of almond clones and a panel of rootstocks used for almond production demonstrated the broad applicability of the markers and provide subsets of markers that could be used to discriminate among accessions. The sequence-based linkage maps and single nucleotide polymorphism assays presented here could be useful resources for the genetic analysis and genetic improvement of almond. Copyright © 2018 Goonetilleke et al.
2013-01-01
Background Rapid and reliable identification of quarantine pests is essential for plant inspection services to prevent introduction of invasive species. For insects, this may be a serious problem when dealing with morphologically similar cryptic species complexes and early developmental stages that lack distinctive characters useful for taxonomic identification. DNA based barcoding could solve many of these problems. The standard barcode fragment, an approx. 650 base pairs long sequence of the 5′end of the mitochondrial cytochrome oxidase I (COI), enables differentiation of a very wide range of arthropods. However, problems remain in some taxa, such as Tephritidae, where recent genetic differentiation among some of the described species hinders accurate molecular discrimination. Results In order to explore the full species discrimination potential of COI, we sequenced the barcoding region of the COI gene of a range of economically important Tephritid species and complemented these data with all GenBank and BOLD entries for the systematic group available as of January 2012. We explored the limits of species delimitation of this barcode fragment among 193 putative Tephritid species and established operational taxonomic units (OTUs), between which discrimination is reliably possible. Furthermore, to enable future development of rapid diagnostic assays based on this sequence information, we characterized all single nucleotide polymorphisms (SNPs) and established “near-minimal” sets of SNPs that differentiate among all included OTUs with at least three and four SNPs, respectively. Conclusions We found that although several species cannot be differentiated based on the genetic diversity observed in COI and hence form composite OTUs, 85% of all OTUs correspond to described species. Because our SNP panels are developed based on all currently available sequence information and rely on a minimal pairwise difference of three SNPs, they are highly reliable and hence represent an important resource for developing taxon-specific diagnostic assays. For selected cases, possible explanations that may cause composite OTUs are discussed. PMID:23718854
In-Depth Analysis of HA and NS1 Genes in A(H1N1)pdm09 Infected Patients.
Caglioti, Claudia; Selleri, Marina; Rozera, Gabriella; Giombini, Emanuela; Zaccaro, Paola; Valli, Maria Beatrice; Capobianchi, Maria Rosaria
2016-01-01
In March/April 2009, a new pandemic influenza A virus (A(H1N1)pdm09) emerged and spread rapidly via human-to-human transmission, giving rise to the first pandemic of the 21th century. Influenza virus may be present in the infected host as a mixture of variants, referred to as quasi-species, on which natural and immune-driven selection operates. Since hemagglutinin (HA) and non-structural 1 (NS1) proteins are relevant in respect of adaptive and innate immune responses, the present study was aimed at establishing the intra-host genetic heterogeneity of HA and NS1 genes, applying ultra-deep pyrosequencing (UDPS) to nasopharyngeal swabs (NPS) from patients with confirmed influenza A(H1N1)pdm09 infection. The intra-patient nucleotide diversity of HA was significantly higher than that of NS1 (median (IQR): 37.9 (32.8-42.3) X 10-4 vs 30.6 (27.4-33.6) X 10-4 substitutions/site, p = 0.024); no significant correlation for nucleotide diversity of NS1 and HA was observed (r = 0.319, p = 0.29). Furthermore, a strong inverse correlation between nucleotide diversity of NS1 and viral load was observed (r = - 0.74, p = 0.004). For both HA and NS1, the variants appeared scattered along the genes, thus indicating no privileged mutation site. Known polymorphisms, S203T (HA) and I123V (NS1), were observed as dominant variants (>98%) in almost all patients; three HA and two NS1 further variants were observed at frequency >40%; a number of additional variants were detected at frequency <6% (minority variants), of which three HA and four NS1 variants were novel. In few patients multiple variants were observed at HA residues 203 and 222. According to the FLUSURVER tool, some of these variants may affect immune recognition and host range; however, these inferences are based on H5N1, and their extension to A(H1N1)pdm09 requires caution. More studies are necessary to address the significance of the composite nature of influenza virus quasi-species within infected patients.
Sequence-specific bias correction for RNA-seq data using recurrent neural networks.
Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru
2017-01-25
The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.
Phylogeny of mitochondrial DNA clones in tassel-eared squirrels Sciurus aberti.
Wettstein, P J; Lager, P; Jin, L; States, J; Lamb, T; Chakraborty, R
1994-12-01
The tassel-eared squirrel, Sciurus aberti, includes six subspecies which occupy restrictive and apparently identical habitats in Ponderosa pine forests in the south-western United States and Mexico; the strict habitat requirement of this species is based on dietary requirements which are only fulfilled in these forests. To examine evolutionary relationships among certain subspecies of S. aberti, we obtained estimates of nucleotide diversity within subspecies as well as nucleotide divergence between subspecies using mitochondrial DNA (mtDNA) analysis. Restriction site polymorphisms were identified in samples of the four US subspecies: S. a. aberti (Abert), S. a. kaibabensis (Kaibab), S. a. ferreus (Ferreus), and S. a. chuscensis (Chuska) Fourteen mtDNA clones were resolved that were, with one exception, uniquely subspecific. Dendrograms constructed by neighbour-joining and maximum parsimony methods revealed two major assemblages: (1) an Abert/Kaibab group; and (2) a Ferreus/Chuska group. The Abert vs. Ferreus clones exhibited the greatest net nucleotide divergence, with a lineage separation estimate approximating 572,000 years ago assuming a nucleotide substitution rate of 7.15 x 10(-9)/year/site. Five out of ten Chuska squirrels shared a clone with one Abert sample; the relative sizes of these two populations and their respective ranges as well as their close proximity support the proposal for relatively recent intermixing of Abert and Chuska populations resulting in what appears to be Abert-->Chuska migration. Nucleotide diversity within subspecies ranked as Kaibab < Ferreus < Abert < Chuska; the relatively high diversity for the Chuska sample is based on the apparent introgression of Abert mtDNA. The relative diversity exhibited by Kaibab, Ferreus and Aberti samples corresponds to the range size of the respective subspecies.
NASA Technical Reports Server (NTRS)
Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.
2003-01-01
We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.
Multiple regions of Harvey sarcoma virus RNA can dimerize in vitro.
Feng, Y X; Fu, W; Winter, A J; Levin, J G; Rein, A
1995-01-01
Retroviruses contain a dimeric RNA consisting of two identical molecules of plus-strand genomic RNA. The structure of the linkage between the two monomers is not known, but they are believed to be joined near their 5' ends. Darlix and coworkers have reported that transcripts of retroviral RNA sequences can dimerize spontaneously in vitro (see, for example, E. Bieth, C. Gabus, and J. L. Darlix, Nucleic Acids Res. 18:119-127, 1990). As one approach to identification of sequences which might participate in the linkage, we have mapped sequences derived from the 5' 378 bases of Harvey sarcoma virus (HaSV) RNA which can dimerize in vitro. We found that at least three distinct regions, consisting of nucleotides 37 to 229, 205 to 272, and 271 to 378, can form these dimers. Two of these regions contain nucleotides 205 to 226; computer analysis suggests that this region can form a stem-loop with an inverted repeat in the loop. We propose that this hypothetical structure is involved in dimer formation by these two transcripts. We also compared the thermal stabilities of each of these dimers with that of HaSV viral RNA. Dimers of nucleotides 37 to 229 and 205 to 272 both exhibited melting temperatures near that of viral RNA, while dimers of nucleotides 271 to 378 are quite unstable. We also found that dimers of nucleotides 37 to 378 formed at 37 degrees C are less thermostable than dimers of the same RNA formed at 55 degrees C. It seems possible that bases from all of these regions participate in the dimer linkage present in viral RNA. PMID:7884897
Multiple regions of Harvey sarcoma virus RNA can dimerize in vitro.
Feng, Y X; Fu, W; Winter, A J; Levin, J G; Rein, A
1995-04-01
Retroviruses contain a dimeric RNA consisting of two identical molecules of plus-strand genomic RNA. The structure of the linkage between the two monomers is not known, but they are believed to be joined near their 5' ends. Darlix and coworkers have reported that transcripts of retroviral RNA sequences can dimerize spontaneously in vitro (see, for example, E. Bieth, C. Gabus, and J. L. Darlix, Nucleic Acids Res. 18:119-127, 1990). As one approach to identification of sequences which might participate in the linkage, we have mapped sequences derived from the 5' 378 bases of Harvey sarcoma virus (HaSV) RNA which can dimerize in vitro. We found that at least three distinct regions, consisting of nucleotides 37 to 229, 205 to 272, and 271 to 378, can form these dimers. Two of these regions contain nucleotides 205 to 226; computer analysis suggests that this region can form a stem-loop with an inverted repeat in the loop. We propose that this hypothetical structure is involved in dimer formation by these two transcripts. We also compared the thermal stabilities of each of these dimers with that of HaSV viral RNA. Dimers of nucleotides 37 to 229 and 205 to 272 both exhibited melting temperatures near that of viral RNA, while dimers of nucleotides 271 to 378 are quite unstable. We also found that dimers of nucleotides 37 to 378 formed at 37 degrees C are less thermostable than dimers of the same RNA formed at 55 degrees C. It seems possible that bases from all of these regions participate in the dimer linkage present in viral RNA.
Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi
2016-12-01
The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.
Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†
Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai
2010-01-01
Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555
Singh, Vinod Kumar; Krishnamachari, Annangarachari
2016-09-01
Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel
2013-10-01
Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.
Wienholz, Franziska; Vermeulen, Wim
2017-01-01
Abstract Nucleotide excision repair (NER) comprises two damage recognition pathways: global genome NER (GG-NER) and transcription-coupled NER (TC-NER), which remove a wide variety of helix-distorting lesions including UV-induced damage. During NER, a short stretch of single-stranded DNA containing damage is excised and the resulting gap is filled by DNA synthesis in a process called unscheduled DNA synthesis (UDS). UDS is measured by quantifying the incorporation of nucleotide analogues into repair patches to provide a measure of NER activity. However, this assay is unable to quantitatively determine TC-NER activity due to the low contribution of TC-NER to the overall NER activity. Therefore, we developed a user-friendly, fluorescence-based single-cell assay to measure TC-NER activity. We combined the UDS assay with tyramide-based signal amplification to greatly increase the UDS signal, thereby allowing UDS to be quantified at low UV doses, as well as DNA-repair synthesis of other excision-based repair mechanisms such as base excision repair and mismatch repair. Importantly, we demonstrated that the amplified UDS is sufficiently sensitive to quantify TC-NER-derived repair synthesis in GG-NER-deficient cells. This assay is important as a diagnostic tool for NER-related disorders and as a research tool for obtaining new insights into the mechanism and regulation of excision repair. PMID:28088761
Sung, W L
1981-01-01
5'-0-Dimethoxytritylthymidine (2) was phosphorylated and base-modified simultaneously to yield the 4-triazolopyrimidinone nucleotide (3). Coupling between (3) and other common deoxyribonucleotides gave a fully protected nonamer (4). Deblocking under different conditions yielded the nonamer as phosphodiester with concomitant conversion of 4-triazolopyrimidinone to 5-methylcytosine (aqueous ammonia) or thymine (N1,N1,N3,N3-tetramethyl-guanidinium syn-4-nitrobenzaldoximate solution). Images PMID:7312633
Fungal Taxa Target Different Carbon Substrates in Harvard Forest Soils
NASA Astrophysics Data System (ADS)
Hanson, C. A.; Allison, S. D.; Wallenstein, M. D.; Mellilo, J. M.; Treseder, K. K.
2006-12-01
The mineralization of soil organic carbon is a major component of the global carbon cycle and is largely controlled by soil microbial communities. However, little is known about the functional roles of soil microbes or whether different microbial taxa target different carbon substrates under natural conditions. To examine this possibility, we assessed the community composition of active fungi by using a novel nucleotide analog technique in soils from the Harvard Forest. We hypothesized that fungal community composition would shift in response to the addition of different substrates and that specific fungal taxa would respond differentially to particular carbon sources. To test this hypothesis, we added a nucleotide analog probe directly to soils in conjunction with one of five carbon compounds of increasing recalcitrance: glycine, sucrose, cellulose, tannin-protein complex, and lignin. During 48 hour incubations, the nucleotide analog was incorporated into newly replicated DNA of soil organisms that proliferated following the addition of the substrates. In this way, we labeled the DNA of microbes that respond to a particular carbon source. Labeled DNA was isolated and fungal Internal Transcribed Spacer (ITS) regions of ribosomal DNA (rDNA) were sequenced and analyzed to identify active fungi to near-species resolution. Diversity analyses at the ≥97% sequence similarity level indicated that taxonomic richness was greater under cellulose (Shannon Index: 3.23 ± 0.11 with ± 95% CI) and lignin (2.87 ± 0.15) additions than the other treatments (2.34 ± 0.16 to 2.64 ± 0.13). In addition, community composition of active fungi shifted under glycine, sucrose, and cellulose additions. Specifically, the community under glycine was significantly different from communities under control, cellulose, and tannin-protein (P<0.05). Additionally, the sucrose and cellulose communities were marginally different from the control community (P = 0.059 and 0.054, respectively) and each other (P = 0.058). Together these results support our hypothesis that fungal communities change in response to different carbon sources. We found 11 fungal operational taxonomic units (OTUs) whose relative abundances differed at least marginally significantly among substrates. One OTU related to Mortierella increased in abundance under cellulose, but was absent or rare under the other substrates. Another OTU related to an unidentified Basidiomycete was only present under lignin addition, while yet another OTU closely related to Mortierella macrocystis greatly increased in abundance under tannin-protein and slightly increased in response to lignin and sucrose. This confirms our hypothesis that particular taxa respond differently to specific carbon substrates and suggests that some fungal taxa may specialize in the break-down of particular carbon sources in soils. Overall, our results imply that microbes have varying roles in the mineralization of soil carbon, and thus microbial community composition may be an important control over ecosystem carbon dynamics and storage, especially in relation to global change.
Karaulov, Alexander; Aleshkin, Vladimir; Slobodenyuk, Vladimir; Grechishnikova, Olga; Afanasyev, Stanislav; Lapin, Boris; Dzhikidze, Eteri; Nesvizhsky, Yuriy; Evsegneeva, Irina; Voropayeva, Elena; Afanasyev, Maxim; Aleshkin, Andrei; Metelskaya, Valeria; Yegorova, Ekaterina; Bayrakova, Alexandra
2010-01-01
Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S-23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S-23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga) have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration.
An extended sequence specificity for UV-induced DNA damage.
Chung, Long H; Murray, Vincent
2018-01-01
The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.
Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N
2016-11-01
The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.
Tambong, J T; Xu, R; Sadiku, A; Chen, Q; Badiss, A; Yu, Q
2014-04-01
Serratia marcescens strains isolated from entomopathogenic nematodes (Rhabditis sp.) were examined for their pathogenicity and establishment in wax moth (Galleria mellonella) larvae. All the Serratia strains were potently pathogenic to G. mellonella larvae, leading to death within 48 h. The strains were shown to possess a metalloprotease gene encoding for a novel serralysin-like protein. Rapid establishment of the bacteria in infected larvae was confirmed by specific polymerase chain reaction (PCR) detection of a DNA fragment encoding for this protein. Detection of the viable Serratia strains in infected larvae was validated using the SYBR Green reverse transcriptase real-time PCR assay targeting the metalloprotease gene. Nucleotide sequences of the metalloprotease gene obtained in our study showed 72 single nucleotide polymorphisms (SNP) and 3 insertions compared with the metalloprotease gene of S. marcescens E-15. The metalloprotease gene had 60 synonymous and 8 nonsynonymous substitutions relative to the closest GenBank entry, S. marcescens E-15. A comparison of the amino acid composition of the new serralysin-like protein with that of the serralysin protein of S. marcescens E-15 revealed differences at 11 positions and a new aspartic acid residue. Analysis of the effect of protein variation suggests that a new aspartic acid residue resulting from nonsynonymous nucleotide mutations in the protein structure could have the most significant effect on its biological function. The new metalloprotease gene and (or) its product could have applications in plant agricultural biotechnology.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Musi, Elgilda; Islam, Naziba; Drosopoulos, Joan H F
2007-05-01
Human CD39/NTPDase1 is an endothelial cell membrane-associated nucleotidase. Its large extracellular domain rapidly metabolizes nucleotides, especially ADP released from activated platelets, inhibiting further platelet activation/recruitment. Previous studies using our recombinant soluble CD39 demonstrated the importance of residues S57, D54, and D213 for enzymatic/biological activity. We now report effects of S57A, D54A, and D213A mutations on full-length (FL)CD39 function. Enzymatic activity of alanine modified FLCD39s was less than wild-type, contrasting the enhanced activity of their soluble counterparts. Furthermore, conservative substitutions D54E and D213E led to enzymes with activities greater than the alanine modified FLCD39s, but less than wild-type. Reductions in mutant activities were primarily associated with reduced catalytic rates. Differences in enzymatic activity were not attributable to gross changes in the nucleotide binding pocket or the enzyme's ability to multimerize. Thus, composition of the active site of wild-type CD39 appears optimized for ADPase function in the context of the transmembrane domains.
Gorzkiewicz, Michał; Buczkowski, Adam; Appelhans, Dietmar; Voit, Brigitte; Pułaski, Łukasz; Pałecz, Bartłomiej; Klajnert-Maculewicz, Barbara
2018-06-10
Adenosine analogue drugs (such as fludarabine or cladribine) require transporter-mediated uptake into cells and subsequent phosphorylation for anticancer activity. Therefore, application of nanocarrier systems for direct delivery of active triphosphate forms has been proposed. Here, we applied isothermal titration calorimetry and zeta potential titration to determine the stoichiometry and thermodynamic parameters of interactions between 4th generation poly(propyleneimine) dendrimers (unmodified or sugar-modified for increased biocompatibility) and ATP as a model adenosine nucleotide. We showed that glycodendrimers have the ability to efficiently interact with nucleoside triphosphates and to form stable complexes via electrostatic interactions between the ionized phosphate and amino groups on the nucleotide and the dendrimer, respectively. The complexation process is spontaneous, enthalpy-driven and depends on buffer composition (strongest interactions in organic buffer) and pH (more binding sites in acidic pH). These properties allow us to consider maltose-modified dendrimers as especially promising carriers for adenosine analogues. Copyright © 2018 Elsevier B.V. All rights reserved.
CNG site-specific and methyl-sensitive endonuclease WEN1 from wheat seedlings.
Fedoreyeva, L I; Vanyushin, B F
2011-06-01
Endonuclease WEN1 with apparent molecular mass about 27 kDa isolated from cytoplasmic vesicular fraction of aging coleoptiles of wheat seedlings has expressed site specificity action. This is a first detection and isolation of a site-specific endonuclease from higher eukaryotes, in general, and higher plants, in particular. The enzyme hydrolyzes deoxyribooligonucleotides of different composition on CNG (N is G, A, C, or T) sites by splitting the phosphodiester bond between C and N nucleotide residues in CNG sequence independent from neighbor nucleotide context except for CCCG. WEN1 prefers to hydrolyze methylated λ phage DNA and double-stranded deoxyribooligonucleotides containing 5-methylcytosine sites (m(5)CAG, m(5)CTG) compared with unmethylated substrates. The enzyme is also able to hydrolyze single-stranded substrates, but in this case it splits unmethylated substrates predominantly. Detection in wheat seedlings of WEN1 endonuclease that is site specific, sensitive to the substrate methylation status, and modulated with S-adenosyl-L-methionine indicates that in higher plants restriction--modification systems or some of their elements, at least, may exist.
Kaneko, Kentaro; Takamatsu, Takeshi; Inomata, Takuya; Oikawa, Kazusato; Itoh, Kimiko; Hirose, Kazuko; Amano, Maho; Nishimura, Shin-Ichiro; Toyooka, Kiminori; Matsuoka, Ken; Pozueta-Romero, Javier; Mitsui, Toshiaki
2016-01-01
Nucleotide pyrophosphatase/phosphodiesterases (NPPs) are widely distributed N-glycosylated enzymes that catalyze the hydrolytic breakdown of numerous nucleotides and nucleotide sugars. In many plant species, NPPs are encoded by a small multigene family, which in rice are referred to NPP1–NPP6. Although recent investigations showed that N-glycosylated NPP1 is transported from the endoplasmic reticulum (ER)–Golgi system to the chloroplast through the secretory pathway in rice cells, information on N-glycan composition and subcellular localization of other NPPs is still lacking. Computer-assisted analyses of the amino acid sequences deduced from different Oryza sativa NPP-encoding cDNAs predicted all NPPs to be secretory glycoproteins. Confocal fluorescence microscopy observation of cells expressing NPP2 and NPP6 fused with green fluorescent protein (GFP) revealed that NPP2 and NPP6 are plastidial proteins. Plastid targeting of NPP2–GFP and NPP6–GFP was prevented by brefeldin A and by the expression of ARF1(Q71L), a dominant negative mutant of ADP-ribosylation factor 1 that arrests the ER to Golgi traffic, indicating that NPP2 and NPP6 are transported from the ER–Golgi to the plastidial compartment. Confocal laser scanning microscopy and high-pressure frozen/freeze-substituted electron microscopy analyses of transgenic rice cells ectopically expressing the trans-Golgi marker sialyltransferase fused with GFP showed the occurrence of contact of Golgi-derived membrane vesicles with cargo and subsequent absorption into plastids. Sensitive and high-throughput glycoblotting/mass spectrometric analyses showed that complex-type and paucimannosidic-type glycans with fucose and xylose residues occupy approximately 80% of total glycans of NPP1, NPP2 and NPP6. The overall data strongly indicate that the trans-Golgi compartments participate in the Golgi to plastid trafficking and targeting mechanism of NPPs. PMID:27335351
Katahira, Riko; Ashihara, Hiroshi
2009-12-01
As part of a research program on nucleotide metabolism in potato tubers (Solanum tuberosum L.), profiles of pyridine (nicotinamide) metabolism were examined based on the in situ metabolic fate of radio-labelled precursors and the in vitro activities of enzymes. In potato tubers, [(3)H]quinolinic acid, which is an intermediate of de novo pyridine nucleotide synthesis, and [(14)C]nicotinamide, a catabolite of NAD, were utilised for pyridine nucleotide synthesis. The in situ tracer experiments and in vitro enzyme assays suggest the operation of multiple pyridine nucleotide cycles. In addition to the previously proposed cycle consisting of seven metabolites, we found a new cycle that includes newly discovered nicotinamide riboside deaminase which is also functional in potato tubers. This cycle bypasses nicotinamide and nicotinic acid; it is NAD --> nicotinamide mononucleotide --> nicotinamide riboside --> nicotinic acid riboside --> nicotinic acid mononucleotide --> nicotinic acid adenine dinucleotide --> NAD. Degradation of the pyridine ring was extremely low in potato tubers. Nicotinic acid glucoside is formed from nicotinic acid in potato tubers. Comparative studies of [carboxyl-(14)C]nicotinic acid metabolism indicate that nicotinic acid is converted to nicotinic acid glucoside in all organs of potato plants. Trigonelline synthesis from [carboxyl-(14)C]nicotinic acid was also found. Conversion was greater in green parts of plants, such as leaves and stem, than in underground parts of potato plants. Nicotinic acid utilised for the biosynthesis of these conjugates seems to be derived not only from the pyridine nucleotide cycle, but also from the de novo synthesis of nicotinic acid mononucleotide.
NASA Astrophysics Data System (ADS)
Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.
2018-04-01
Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nilforoushan, Arman; Furrer, Antonia; Wyss, Laura A; van Loon, Barbara; Sturla, Shana J
2015-04-15
Human DNA polymerase η (hPol η) contributes to anticancer drug resistance by catalyzing the replicative bypass of DNA adducts formed by the widely used chemotherapeutic agent cis-diamminedichloroplatinum (cisplatin). A chemical basis for overcoming bypass-associated resistance requires greater knowledge of how small molecules influence the hPol η-catalyzed bypass of DNA adducts. In this study, we demonstrated how synthetic nucleoside triphosphates act as hPol η substrates and characterized their influence on hPol η-mediated DNA synthesis over unmodified and platinated DNA. The single nucleotide incorporation efficiency of the altered nucleotides varied by more than 10-fold and the higher incorporation rates appeared to be attributable to the presence of an additional hydrogen bond between incoming dNTP and templating base. Finally, full-length DNA synthesis in the presence of increasing concentrations of synthetic nucleotides reduced the amount of DNA product independent of the template, representing the first example of hPol η inhibition in the presence of a platinated DNA template.
Hetmann, Anna; Wujak, Magdalena; Bolibok, Paulina; Zięba, Wojciech; Wiśniewski, Marek; Roszek, Katarzyna
2018-07-01
In this study graphene oxide (GO), carbon quantum dots (CQD) and carbon nanoonions (CNO) have been characterized and applied for the first time as a matrix for recombinant adenylate kinase (AK, EC 2.7.4.3) immobilization. AK is an enzyme fulfilling a key role in metabolic processes. This phosphotransferase catalyzes the interconversion of adenine nucleotides (ATP, ADP and AMP) and thereby participates in nucleotide homeostasis, monitors a cellular energy charge as well as acts as a component of purinergic signaling system. The AK activity in all obtained biocatalytic systems was higher as compared to the free enzyme. We have found that the immobilization on carbon nanostructures increased both activity and stability of AK. Moreover, the biocatalytic systems consisting of AK immobilized on carbon nanostructures can be easily and efficiently lyophilized without risk of desorption or decrease in the catalytic activity of the investigated enzyme. The positive action of AK-GO biocatalytic system in maintaining the nucleotide balance in in vitro cell culture was proved. Copyright © 2018 Elsevier B.V. All rights reserved.
Major, Peter; Embley, T. Martin
2017-01-01
Plasma membrane-located nucleotide transport proteins (NTTs) underpin the lifestyle of important obligate intracellular bacterial and eukaryotic pathogens by importing energy and nucleotides from infected host cells that the pathogens can no longer make for themselves. As such their presence is often seen as a hallmark of an intracellular lifestyle associated with reductive genome evolution and loss of primary biosynthetic pathways. Here, we investigate the phylogenetic distribution of NTT sequences across the domains of cellular life. Our analysis reveals an unexpectedly broad distribution of NTT genes in both host-associated and free-living prokaryotes and eukaryotes. We also identify cases of within-bacteria and bacteria-to-eukaryote horizontal NTT transfer, including into the base of the oomycetes, a major clade of parasitic eukaryotes. In addition to identifying sequences that retain the canonical NTT structure, we detected NTT gene fusions with HEAT-repeat and cyclic nucleotide binding domains in Cyanobacteria, pathogenic Chlamydiae and Oomycetes. Our results suggest that NTTs are versatile functional modules with a much wider distribution and a broader range of potential roles than has previously been appreciated. PMID:28164241
Single-molecule comparison of DNA Pol I activity with native and analog nucleotides
NASA Astrophysics Data System (ADS)
Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip
2014-03-01
DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.
The EMBL nucleotide sequence database
Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann
2001-01-01
The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039
Valenzuela, Carlos Y
2017-02-13
Direct tests of the random or non-random distribution of nucleotides on genomes have been devised to test the hypothesis of neutral, nearly-neutral or selective evolution. These tests are based on the direct base distribution and are independent of the functional (coding or non-coding) or structural (repeated or unique sequences) properties of the DNA. The first approach described the longitudinal distribution of bases in tandem repeats under the Bose-Einstein statistics. A huge deviation from randomness was found. A second approach was the study of the base distribution within dinucleotides whose bases were separated by 0, 1, 2… K nucleotides. Again an enormous difference from the random distribution was found with significances out of tables and programs. These test values were periodical and included the 16 dinucleotides. For example a high "positive" (more observed than expected dinucleotides) value, found in dinucleotides whose bases were separated by (3K + 2) sites, was preceded by two smaller "negative" (less observed than expected dinucleotides) values, whose bases were separated by (3K) or (3K + 1) sites. We examined mtDNAs, prokaryote genomes and some eukaryote chromosomes and found that the significant non-random interactions and periodicities were present up to 1000 or more sites of base separation and in human chromosome 21 until separations of more than 10 millions sites. Each nucleotide has its own significant value of its distance to neutrality; this yields 16 hierarchical significances. A three dimensional table with the number of sites of separation between the bases and the 16 significances (the third dimension is the dinucleotide, individual or taxon involved) gives directly an evolutionary state of the analyzed genome that can be used to obtain phylogenies. An example is provided.
Synthesis of cytidine ribonucleotides by stepwise assembly of the heterocycle on a sugar phosphate.
Ingar, Abdul-Aziz; Luke, Richard W A; Hayter, Barry R; Sutherland, John D
2003-06-06
Although various syntheses of the nucleic acid bases exist and ribose is a product of the formose reaction, no prebiotically plausible methods for attaching pyrimidine bases to ribose to give nucleosides have been described. Kinetic and thermodynamic factors are thought to mitigate against such condensation reactions in aqueous solution. This inability to produce pyrimidine nucleosides and hence nucleotides is a major stumbling block of the "RNA World" hypothesis and has led to suggestions of alternative nucleic acids as evolutionary precursors to RNA. Here, we show that a process in which the base is assembled in stages on a sugar phosphate can produce cytidine nucleotides. The sequential action of cyanamide and cyanoacetylene on arabinose-3-phosphate produces cytidine-2',3'-cyclophosphate and arabinocytidine-3'-phosphate.
A Structural Model for the Single-Stranded DNA Genome of Filamentous Bacteriophage Pf1†
Tsuboi, Masamichi; Tsunoda, Masaru; Overman, Stacy A.; Benevides, James M.; Thomas, George J.
2010-01-01
The filamentous bacteriophage Pf1, which infects strain PAK of Pseudomonas aeruginosa, is a flexible filament (~2000 × 6.5 nm) consisting of a covalently closed DNA loop of 7349 nucleotides sheathed by 7350 copies of a 46-residue α-helical subunit. The subunit α-helices, which are inclined at a small average angle (~16°) from the virion axis, are arranged compactly around the DNA core. Orientations of the Pf1 DNA nucleotides with respect to the filament axis are not known. In this work we report and interpret the polarized Raman spectra of oriented Pf1 filaments. We demonstrate that the polarizations of DNA Raman band intensities establish that the nucleotide bases of packaged Pf1 DNA are well ordered within the virion and that the base planes are positioned close to parallel to the filament axis. The present results are combined with a previously proposed projection of the intraviral path of Pf1 DNA (1) to develop a novel molecular model for the Pf1 assembly. PMID:20078135
An uracil-linked hydroxyflavone probe for the recognition of ATP
Bojtár, Márton; Janzsó-Berend, Péter Zoltán; Mester, Dávid; Hessz, Dóra; Kállay, Mihály; Kubinyi, Miklós
2018-01-01
Background: Nucleotides are essential molecules in living systems due to their paramount importance in various physiological processes. In the past years, numerous attempts were made to selectively recognize and detect these analytes, especially ATP using small-molecule fluorescent chemosensors. Despite the various solutions, the selective detection of ATP is still challenging due to the structural similarity of various nucleotides. In this paper, we report the conjugation of a uracil nucleobase to the known 4’-dimethylamino-hydroxyflavone fluorophore. Results: The complexation of this scaffold with ATP is already known. The complex is held together by stacking and electrostatic interactions. To achieve multi-point recognition, we designed the uracil-appended version of this probe to include complementary base-pairing interactions. The theoretical calculations revealed the availability of multiple complex structures. The synthesis was performed using click chemistry and the nucleotide recognition properties of the probe were evaluated using fluorescence spectroscopy. Conclusions: The first, uracil-containing fluorescent ATP probe based on a hydroxyflavone fluorophore was synthesized and evaluated. A selective complexation with ATP was observed and a ratiometric response in the excitation spectrum. PMID:29719572
Reference genotype and exome data from an Australian Aboriginal population for health-based research
Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.
2016-01-01
Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114
Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M
2016-04-12
Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.
Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai
2010-01-01
Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Li, Wei; Zhang, Xin-Cheng; Zhao, Jian; Shi, Yan; Zhu, Xin-Ping
2015-01-25
Cuora trifasciata has become one of the most critically endangered species in the world. The complete mitochondrial genome of C. trifasciata (Chinese three-striped box turtle) was determined in this study. Its mitochondrial genome is a 16,575-bp-long circular molecule that consists of 37 genes that are typically found in other vertebrates. And the basic characteristics of the C. trifasciata mitochondrial genome were also determined. Moreover, a comparison of C. trifasciata with Cuora cyclornata, Cuora pani and Cuora aurocapitata indicated that the four mitogenomics differed in length, codons, overlaps, 13 protein-coding genes (PCGs), ND3, rRNA genes, control region, and other aspects. Phylogenetic analysis with Bayesian inference and maximum likelihood based on 12 protein-coding genes of the genus Cuora indicated the phylogenetic position of C. trifasciata within Cuora. The phylogenetic analysis also showed that C. trifasciata from Vietnam and China formed separate monophyletic clades with different Cuora species. The results of nucleotide base compositions, protein-coding genes and phylogenetic analysis showed that C. trifasciata from these two countries may represent different Cuora species. Copyright © 2014 Elsevier B.V. All rights reserved.
Traverse, Charles C.
2017-01-01
ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848
Global Shifts in Genome and Proteome Composition Are Very Tightly Coupled
Brbić, Maria; Warnecke, Tobias; Kriško, Anita; Supek, Fran
2015-01-01
The amino acid composition (AAC) of proteomes differs greatly between microorganisms and is associated with the environmental niche they inhabit, suggesting that these changes may be adaptive. Similarly, the oligonucleotide composition of genomes varies and may confer advantages at the DNA/RNA level. These influences overlap in protein-coding sequences, making it difficult to gauge their relative contributions. We disentangle these effects by systematically evaluating the correspondence between intergenic nucleotide composition, where protein-level selection is absent, the AAC, and ecological parameters of 909 prokaryotes. We find that G + C content, the most frequently used measure of genomic composition, cannot capture diversity in AAC and across ecological contexts. However, di-/trinucleotide composition in intergenic DNA predicts amino acid frequencies of proteomes to the point where very little cross-species variability remains unexplained (91% of variance accounted for). Qualitatively similar results were obtained for 49 fungal genomes, where 80% of the variability in AAC could be explained by the composition of introns and intergenic regions. Upon factoring out oligonucleotide composition and phylogenetic inertia, the residual AAC is poorly predictive of the microbes’ ecological preferences, in stark contrast with the original AAC. Moreover, highly expressed genes do not exhibit more prominent environment-related AAC signatures than lowly expressed genes, despite contributing more to the effective proteome. Thus, evolutionary shifts in overall AAC appear to occur almost exclusively through factors shaping the global oligonucleotide content of the genome. We discuss these results in light of contravening evidence from biophysical data and further reading frame-specific analyses that suggest that adaptation takes place at the protein level. PMID:25971281
Genome-Wide Association Studies of the Human Gut Microbiota.
Davenport, Emily R; Cusanovich, Darren A; Michelini, Katelyn; Barreiro, Luis B; Ober, Carole; Gilad, Yoav
2015-01-01
The bacterial composition of the human fecal microbiome is influenced by many lifestyle factors, notably diet. It is less clear, however, what role host genetics plays in dictating the composition of bacteria living in the gut. In this study, we examined the association of ~200K host genotypes with the relative abundance of fecal bacterial taxa in a founder population, the Hutterites, during two seasons (n = 91 summer, n = 93 winter, n = 57 individuals collected in both). These individuals live and eat communally, minimizing variation due to environmental exposures, including diet, which could potentially mask small genetic effects. Using a GWAS approach that takes into account the relatedness between subjects, we identified at least 8 bacterial taxa whose abundances were associated with single nucleotide polymorphisms in the host genome in each season (at genome-wide FDR of 20%). For example, we identified an association between a taxon known to affect obesity (genus Akkermansia) and a variant near PLD1, a gene previously associated with body mass index. Moreover, we replicate a previously reported association from a quantitative trait locus (QTL) mapping study of fecal microbiome abundance in mice (genus Lactococcus, rs3747113, P = 3.13 x 10-7). Finally, based on the significance distribution of the associated microbiome QTLs in our study with respect to chromatin accessibility profiles, we identified tissues in which host genetic variation may be acting to influence bacterial abundance in the gut.
Rangannan, Vetriselvi; Bansal, Manju
2009-12-01
The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool PromPredict. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...
2016-09-07
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L
2012-06-27
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.
Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L
2012-01-01
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140
A novel model for DNA sequence similarity analysis based on graph theory.
Qi, Xingqin; Wu, Qin; Zhang, Yusen; Fuller, Eddie; Zhang, Cun-Quan
2011-01-01
Determination of sequence similarity is one of the major steps in computational phylogenetic studies. As we know, during evolutionary history, not only DNA mutations for individual nucleotide but also subsequent rearrangements occurred. It has been one of major tasks of computational biologists to develop novel mathematical descriptors for similarity analysis such that various mutation phenomena information would be involved simultaneously. In this paper, different from traditional methods (eg, nucleotide frequency, geometric representations) as bases for construction of mathematical descriptors, we construct novel mathematical descriptors based on graph theory. In particular, for each DNA sequence, we will set up a weighted directed graph. The adjacency matrix of the directed graph will be used to induce a representative vector for DNA sequence. This new approach measures similarity based on both ordering and frequency of nucleotides so that much more information is involved. As an application, the method is tested on a set of 0.9-kb mtDNA sequences of twelve different primate species. All output phylogenetic trees with various distance estimations have the same topology, and are generally consistent with the reported results from early studies, which proves the new method's efficiency; we also test the new method on a simulated data set, which shows our new method performs better than traditional global alignment method when subsequent rearrangements happen frequently during evolutionary history.
From milk to diet: feed recognition for milk authenticity.
Ponzoni, E; Gianì, S; Mastromauro, F; Breviario, D
2009-11-01
The presence of plastidial DNA fragments of plant origin in animal milk samples has been confirmed. An experimental plan was arranged with 4 groups of goats, each provided with a different monophytic diet: 3 fresh forages (oats, ryegrass, and X-triticosecale) and one 2-wk-old silage (X-triticosecale). Feed-derived rubisco (ribulose bisphosphate carboxylase, rbcL) DNA fragments were detected in 100% of the analyzed goat milk samples, and the nucleotide sequence of the PCR-amplified fragments was found to be 100% identical to the corresponding fragments amplified from the plant species consumed in the diet. Two additional chloroplast-based molecular markers were used to set up an assay for distinctiveness, conveniently based on a simple PCR. In one case, differences in single nucleotides occurring within the gene encoding for plant maturase K (matK) were exploited. In the other, plant species recognition was based on the difference in the length of the intron present within the transfer RNA leucine (trnL) gene. The presence of plastidial plant DNA, ascertained by the PCR-based amplification of the rbcL fragment, was also assessed in raw cow milk samples collected directly from stock farms or taken from milk sold on the commercial market. In this case, the nucleotide sequence of the amplified DNA fragments reflected the multiple forages present in the diet fed to the animals.
Regulation of DNA repair in serum-stimulated xeroderma pigmentosum cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gupta, P.K.; Sirover, M.A.
1984-10-01
The regulation of DNA repair during serum stimulation of quiescent cells was examined in normal human cells, in fibroblasts from three xeroderma pigmentosum complementation groups (A, C, and D), in xeroderma pigmentosum variant cells, and in ataxia telangiectasia cells. The regulation of nucleotide excision repair was examined by exposing cells to ultraviolet irradiation at discrete intervals after cell stimulation. Similarly, base excision repair was quantitated after exposure to methylmethane sulfonate. WI-38 normal human diploid fibroblasts, xeroderma pigmentosum variant cells, as well as ataxia telangiectasia cells enhanced their capacity for both nucleotide excision repair and for base excision repair prior tomore » their enhancement of DNA synthesis. Further, in each cell strain, the base excision repair enzyme uracil DNA glycosylase was increased prior to the induction of DNA polymerase using the identical cells to quantitate each activity. In contrast, each of the three xeroderma complementation groups that were examined failed to increase their capacity for nucleotide excision repair above basal levels at any interval examined. This result was observed using either unscheduled DNA synthesis in the presence of 10 mM hydroxyurea or using repair replication in the absence of hydroxyurea to quantitate DNA repair. However, each of the three complementation groups normally regulated the enhancement of base excision repair after methylmethane sulfonate exposure and each induced the uracil DNA glycosylase prior to DNA synthesis. 62 references, 3 figures, 2 tables.« less
Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki
2013-09-23
Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.
Du, Le-Yue; Qian, Da-Wei; Jiang, Shu; Shang, Er-Xin; Guo, Jian-Ming; Liu, Pei; Su, Shu-Lan; Duan, Jin-Ao; Zhao, Min
2015-12-01
Nucleotides, nucleosides and nucleobases have been proven as important bioactive compounds related to many physiological processes. Abelmoschus manihot (L.) Medicus from the family of Malvaceae is an annual herbal plant of folk medicine widely distributed in Oceania and Asia. However, up to now, no detailed information could be available for the types and contents of nucleotides, nucleosides and nucleobases contained in A. manihot roots, stems, leaves as well as the flowers. In the present study, an UPLC-TQ-MS/MS method was established for detection of the twelve nucleotides, nucleosides and nucleobases. The validated method was successfully applied to identify the 12 analytes in different parts of A. manihot harvested at ten growth periods. 2'-deoxyinosine was not detected in all of the A. manihot samples. The data demonstrated that the distribution and concentration of the 12 compounds in A. manihot four parts were arranged in a decreasing order as leaf>flower>stem>root. Based on the results, the leaves and flowers of A. manihot could be developed as health products possessed nutraceutical and bioactive properties in the future. This method might also be utilized for the quality control of the A. manihot leaves and other herbal medicines being rich in nucleotides, nucleosides and nulecobases. Copyright © 2015 Elsevier B.V. All rights reserved.
Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan
2014-01-01
The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084
Mechanism of the Exchange Reaction in HRAS from Multiscale Modeling
Kapoor, Abhijeet; Travesset, Alex
2014-01-01
HRAS regulates cell growth promoting signaling processes by cycling between active (GTP-bound) and inactive (GDP-bound) states. Understanding the transition mechanism is central for the design of small molecules to inhibit the formation of RAS-driven tumors. Using a multiscale approach involving coarse-grained (CG) simulations, all-atom classical molecular dynamics (CMD; total of 3.02 µs), and steered molecular dynamics (SMD) in combination with Principal Component Analysis (PCA), we identified the structural features that determine the nucleotide (GDP) exchange reaction. We show that weakening the coupling between the SwitchI (residues 25–40) and SwitchII (residues 59–75) accelerates the opening of SwitchI; however, an open conformation of SwitchI is unstable in the absence of guanine nucleotide exchange factors (GEFs) and rises up towards the bound nucleotide to close the nucleotide pocket. Both I21 and Y32, play a crucial role in SwitchI transition. We show that an open SwitchI conformation is not necessary for GDP destabilization but is required for GDP/Mg escape from the HRAS. Further, we present the first simulation study showing displacement of GDP/Mg away from the nucleotide pocket. Both SwitchI and SwitchII, delays the escape of displaced GDP/Mg in the absence of GEF. Based on these results, a model for the mechanism of GEF in accelerating the exchange process is hypothesized. PMID:25272152
Evaluation of the reliability of maize reference assays for GMO quantification.
Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel
2010-03-01
A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.
Electron attachment to DNA single strands: gas phase and aqueous solution.
Gu, Jiande; Xie, Yaoming; Schaefer, Henry F
2007-01-01
The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage.
Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.
Ohno, T; Takamatsu, N; Meshi, T; Okada, Y
1983-01-01
The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412
Telling apart Felidae and Ursidae from the distribution of nucleotides in mitochondrial DNA
NASA Astrophysics Data System (ADS)
Rovenchak, Andrij
2018-02-01
Rank-frequency distributions of nucleotide sequences in mitochondrial DNA are defined in a way analogous to the linguistic approach, with the highest-frequent nucleobase serving as a whitespace. For such sequences, entropy and mean length are calculated. These parameters are shown to discriminate the species of the Felidae (cats) and Ursidae (bears) families. From purely numerical values we are able to see in particular that giant pandas are bears while koalas are not. The observed linear relation between the parameters is explained using a simple probabilistic model. The approach based on the non-additive generalization of the Bose distribution is used to analyze the frequency spectra of the nucleotide sequences. In this case, the separation of families is not very sharp. Nevertheless, the distributions for Felidae have on average longer tails comparing to Ursidae.
Beste, Kerstin Y; Seifert, Roland
2013-02-01
Adenosine 3',5'-cyclic monophosphate and guanosine 3',5'-cyclic monophosphate are second messengers that regulate multiple physiological functions. The existence of additional cyclic nucleotides in mammalian cells was postulated many years ago, but technical problems hampered development of the field. Using highly specific and sensitive mass spectrometry methods, soluble guanylyl cyclase has recently been shown to catalyze the formation of several cyclic nucleotides in vitro. This minireview discusses the broad substrate-specificity of soluble guanylyl cyclase and the possible second messenger roles of cyclic nucleotides other than adenosine 3',5'-cyclic monophosphate and guanosine 3',5'-cyclic monophosphate. We hope that this article stimulates productive and critical research in an area that has been neglected for many years.
Detecting and Analyzing Genetic Recombination Using RDP4.
Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev
2017-01-01
Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.
Parker, K A; Steitz, J A
1987-01-01
The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855
ADEPT, a dynamic next generation sequencing data error-detection program with trimming
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng, Shihai; Lo, Chien-Chi; Li, Po-E
Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less
ADEPT, a dynamic next generation sequencing data error-detection program with trimming
Feng, Shihai; Lo, Chien-Chi; Li, Po-E; ...
2016-02-29
Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less
Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan
2014-05-04
The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.
NASA Astrophysics Data System (ADS)
Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie
2015-11-01
Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine. Electronic supplementary information (ESI) available: Details of the data analysis; Fig. S1-S5 histograms of rupture lengths; histograms for Au-adenine and Au-amine interactions; Force-extension curve for MCH-Au interactions; normalized force-extension curves; theoretical length of the DNA oligomers. See DOI: 10.1039/c5nr05695k
Horiguchi, Sayaka; Nakayama, Kazuhiro; Iwamoto, Sadahiko; Ishijima, Akiko; Minezaki, Takayuki; Baba, Mamiko; Kontai, Yoshiko; Horikawa, Chika; Kawashima, Hiroshi; Shibata, Hiroshi; Kagawa, Yasuo; Kawabata, Terue
2016-02-01
We investigated whether the single nucleotide polymorphism rs174547 (T/C) of the fatty acid desaturase-1 gene, FADS1, is associated with changes in erythrocyte membrane and plasma phospholipid (PL) long-chain polyunsaturated fatty acid (LCPUFA) composition in elderly Japanese participants (n=124; 65 years or older; self-feeding and oral intake). The rs174547 C-allele carriers had significantly lower arachidonic acid (ARA; n-6 PUFA) and higher linoleic acid (LA, n-6 PUFA precursor) levels in erythrocyte membrane and plasma PL (15% and 6% ARA reduction, respectively, per C-allele), suggesting a low LA to ARA conversion rate in erythrocyte membrane and plasma PL of C-allele carriers. α-linolenic acid (n-3 PUFA precursor) levels were higher in the plasma PL of C-allele carriers, whereas levels of the n-3 LCPUFAs eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA) were unchanged in erythrocyte membrane and plasma PL. Thus, rs174547 genotypes were significantly associated with different ARA compositions of the blood of elderly Japanese. Copyright © 2015 Elsevier Ltd. All rights reserved.
Dillon, Marcus M; Sung, Way; Sebra, Robert; Lynch, Michael; Cooper, Vaughn S
2017-01-01
The vast diversity in nucleotide composition and architecture among bacterial genomes may be partly explained by inherent biases in the rates and spectra of spontaneous mutations. Bacterial genomes with multiple chromosomes are relatively unusual but some are relevant to human health, none more so than the causative agent of cholera, Vibrio cholerae Here, we present the genome-wide mutation spectra in wild-type and mismatch repair (MMR) defective backgrounds of two Vibrio species, the low-%GC squid symbiont V. fischeri and the pathogen V. cholerae, collected under conditions that greatly minimize the efficiency of natural selection. In apparent contrast to their high diversity in nature, both wild-type V. fischeri and V. cholerae have among the lowest rates for base-substitution mutations (bpsms) and insertion-deletion mutations (indels) that have been measured, below 10 - 3 /genome/generation. Vibrio fischeri and V. cholerae have distinct mutation spectra, but both are AT-biased and produce a surprising number of multi-nucleotide indels. Furthermore, the loss of a functional MMR system caused the mutation spectra of these species to converge, implying that the MMR system itself contributes to species-specific mutation patterns. Bpsm and indel rates varied among genome regions, but do not explain the more rapid evolutionary rates of genes on chromosome 2, which likely result from weaker purifying selection. More generally, the very low mutation rates of Vibrio species correlate inversely with their immense population sizes and suggest that selection may not only have maximized replication fidelity but also optimized other polygenic traits relative to the constraints of genetic drift. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Hughes, Laura B; Reynolds, Richard J; Brown, Elizabeth E; Kelley, James M; Thomson, Brian; Conn, Doyt L; Jonas, Beth L; Westfall, Andrew O; Padilla, Miguel A; Callahan, Leigh F; Smith, Edwin A; Brasington, Richard D; Edberg, Jeffrey C; Kimberly, Robert P; Moreland, Larry W; Plenge, Robert M; Bridges, S Louis
2010-12-01
Large-scale genetic association studies have identified >20 rheumatoid arthritis (RA) risk alleles among individuals of European ancestry. The influence of these risk alleles has not been comprehensively studied in African Americans. We therefore sought to examine whether these validated RA risk alleles are associated with RA risk in an African American population. Twenty-seven candidate single-nucleotide polymorphisms (SNPs) were genotyped in 556 autoantibody-positive African Americans with RA and 791 healthy African American control subjects. Odds ratios (ORs) and 95% confidence intervals (95% CIs) for each SNP were compared with previously published ORs for RA patients of European ancestry. We then calculated a composite genetic risk score (GRS) for each individual based on the sum of all risk alleles. Overlap of the ORs and 95% CIs between the European and African American populations was observed for 24 of the 27 candidate SNPs. Conversely, 3 of the 27 SNPs (CCR6 rs3093023, TAGAP rs394581, and TNFAIP3 rs6920220) demonstrated ORs in the opposite direction from those reported for RA patients of European ancestry. The GRS analysis indicated a small but highly significant probability that African American patients relative to control subjects were enriched for the risk alleles validated in European RA patients (P = 0.00005). The majority of RA risk alleles previously validated for RA patients of European ancestry showed similar ORs in our population of African Americans with RA. Furthermore, the aggregate GRS supports the hypothesis that these SNPs are risk alleles for RA in the African American population. Future large-scale genetic studies are needed to validate these risk alleles and identify novel RA risk alleles in African Americans. Copyright © 2010 by the American College of Rheumatology.
Stukenbrock, Eva H.; Dutheil, Julien Y.
2018-01-01
Meiotic recombination is an important driver of evolution. Variability in the intensity of recombination across chromosomes can affect sequence composition, nucleotide variation, and rates of adaptation. In many organisms, recombination events are concentrated within short segments termed recombination hotspots. The variation in recombination rate and positions of recombination hotspot can be studied using population genomics data and statistical methods. In this study, we conducted population genomics analyses to address the evolution of recombination in two closely related fungal plant pathogens: the prominent wheat pathogen Zymoseptoria tritici and a sister species infecting wild grasses Z. ardabiliae. We specifically addressed whether recombination landscapes, including hotspot positions, are conserved in the two recently diverged species and if recombination contributes to rapid evolution of pathogenicity traits. We conducted a detailed simulation analysis to assess the performance of methods of recombination rate estimation based on patterns of linkage disequilibrium, in particular in the context of high nucleotide diversity. Our analyses reveal overall high recombination rates, a lack of suppressed recombination in centromeres, and significantly lower recombination rates on chromosomes that are known to be accessory. The comparison of the recombination landscapes of the two species reveals a strong correlation of recombination rate at the megabase scale, but little correlation at smaller scales. The recombination landscapes in both pathogen species are dominated by frequent recombination hotspots across the genome including coding regions, suggesting a strong impact of recombination on gene evolution. A significant but small fraction of these hotspots colocalize between the two species, suggesting that hotspot dynamics contribute to the overall pattern of fast evolving recombination in these species. PMID:29263029
Stukenbrock, Eva H; Dutheil, Julien Y
2018-03-01
Meiotic recombination is an important driver of evolution. Variability in the intensity of recombination across chromosomes can affect sequence composition, nucleotide variation, and rates of adaptation. In many organisms, recombination events are concentrated within short segments termed recombination hotspots. The variation in recombination rate and positions of recombination hotspot can be studied using population genomics data and statistical methods. In this study, we conducted population genomics analyses to address the evolution of recombination in two closely related fungal plant pathogens: the prominent wheat pathogen Zymoseptoria tritici and a sister species infecting wild grasses Z. ardabiliae We specifically addressed whether recombination landscapes, including hotspot positions, are conserved in the two recently diverged species and if recombination contributes to rapid evolution of pathogenicity traits. We conducted a detailed simulation analysis to assess the performance of methods of recombination rate estimation based on patterns of linkage disequilibrium, in particular in the context of high nucleotide diversity. Our analyses reveal overall high recombination rates, a lack of suppressed recombination in centromeres, and significantly lower recombination rates on chromosomes that are known to be accessory. The comparison of the recombination landscapes of the two species reveals a strong correlation of recombination rate at the megabase scale, but little correlation at smaller scales. The recombination landscapes in both pathogen species are dominated by frequent recombination hotspots across the genome including coding regions, suggesting a strong impact of recombination on gene evolution. A significant but small fraction of these hotspots colocalize between the two species, suggesting that hotspot dynamics contribute to the overall pattern of fast evolving recombination in these species. Copyright © 2018 Stukenbrock and Dutheil.
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Root, D. D.; Reisler, E.
1992-01-01
Recent publication of the atomic structure of G-actin (Kabsch, W., Mannherz, H. G., Suck, D., Pai, E. F., & Holmes, K. C., 1990, Nature 347, 37-44) raises questions about how the conformation of actin changes upon its polymerization. In this work, the effects of various quenchers of etheno-nucleotides bound to G- and F-actin were examined in order to assess polymerization-related changes in the nucleotide phosphate site. The Mg(2+)-induced polymerization of actin quenched the fluorescence of the etheno-nucleotides by approximately 20% simultaneously with the increase in light scattering by actin. A conformational change at the nucleotide binding site was also indicated by greater accessibility of F-actin than G-actin to positively, negatively, and neutrally charged collisional quenchers. The difference in accessibility between G- and F-actin was greatest for I-, indicating that the environment of the etheno group is more positively charged in the polymerized form of actin. Based on calculations of the change in electric potential of the environment of the etheno group, specific polymerization-related movements of charged residues in the atomic structure of G-actin are suggested. The binding of S-1 to epsilon-ATP-G-actin increased the accessibility of the etheno group to I- even over that in Mg(2+)-polymerized actin. The quenching of the etheno group by nitromethane was, however, unaffected by the binding of S-1 to actin. Thus, the binding of S-1 induces conformational changes in the cleft region of actin that are different from those caused by Mg2+ polymerization of actin.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1304380
Yoshida, Keisuke; Hisabori, Toru
2016-06-01
Mitochondrial metabolism is important for sustaining cellular growth and maintenance; however, the regulatory mechanisms underlying individual processes in plant mitochondria remain largely uncharacterized. Previous redox-proteomics studies have suggested that mitochondrial malate dehydrogenase (mMDH), a key enzyme in the tricarboxylic acid (TCA) cycle and redox shuttling, is under thiol-based redox regulation as a target candidate of thioredoxin (Trx). In addition, the adenine nucleotide status may be another factor controlling mitochondrial metabolism, as respiratory ATP production in mitochondria is believed to be influenced by several environmental stimuli. Using biochemical and reverse-genetic approaches, we addressed the redox- and adenine nucleotide-dependent regulation of mMDH in Arabidopsis thaliana. Recombinant mMDH protein formed intramolecular disulfide bonds under oxidative conditions, but these bonds did not have a considerable effect on mMDH activity. Mitochondria-localized o-type Trx (Trx-o) did not facilitate re-reduction of oxidized mMDH. Determination of the in vivo redox state revealed that mMDH was stably present in the reduced form even in Trx-o-deficient plants. Accordingly, we concluded that mMDH is not in the class of redox-regulated enzymes. By contrast, mMDH activity was lowered by adenine nucleotides (AMP, ADP, and ATP). Each adenine nucleotide suppressed mMDH activity with different potencies and ATP exerted the largest inhibitory effect with a significantly lower K(I). Correspondingly, mMDH activity was inhibited by the increase in ATP/ADP ratio within the physiological range. These results suggest that mMDH activity is finely controlled in response to variations in mitochondrial adenine nucleotide balance. Copyright © 2016 Elsevier B.V. All rights reserved.
Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S
1994-01-01
To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378
Fatty acid composition and desaturase gene expression in flax (Linum usitatissimum L.).
Thambugala, Dinushika; Cloutier, Sylvie
2014-11-01
Little is known about the relationship between expression levels of fatty acid desaturase genes during seed development and fatty acid (FA) composition in flax. In the present study, we looked at promoter structural variations of six FA desaturase genes and their relative expression throughout seed development. Computational analysis of the nucleotide sequences of the sad1, sad2, fad2a, fad2b, fad3a and fad3b promoters showed several basic transcriptional elements including CAAT and TATA boxes, and several putative target-binding sites for transcription factors, which have been reported to be involved in the regulation of lipid metabolism. Using semi-quantitative reverse transcriptase PCR, the expression patterns throughout seed development of the six FA desaturase genes were measured in six flax genotypes that differed for FA composition but that carried the same desaturase isoforms. FA composition data were determined by phenotyping the field grown genotypes over four years in two environments. All six genes displayed a bell-shaped pattern of expression peaking at 20 or 24 days after anthesis. Sad2 was the most highly expressed. The expression of all six desaturase genes did not differ significantly between genotypes (P = 0.1400), hence there were no correlations between FA desaturase gene expression and variations in FA composition in relatively low, intermediate and high linolenic acid genotypes expressing identical isoforms for all six desaturases. These results provide further clues towards understanding the genetic factors responsible for FA composition in flax.
Rzehak, Peter; Thijs, Carel; Standl, Marie; Mommers, Monique; Glaser, Claudia; Jansen, Eugène; Klopp, Norman; Koppelman, Gerard H.; Singmann, Paula; Postma, Dirkje S.; Sausenthaler, Stefanie; Dagnelie, Pieter C.; van den Brandt, Piet A.; Koletzko, Berthold; Heinrich, Joachim
2010-01-01
Background Association of genetic-variants in the FADS1-FADS2-gene-cluster with fatty-acid-composition in blood of adult-populations is well established. We analyze this genetic-association in two children-cohort-studies. In addition, the association between variants in the FADS-gene-cluster and blood-fatty-acid-composition with eczema was studied. Methods and Principal Findings Data of two population-based-birth-cohorts in the Netherlands and Germany (KOALA, LISA) were pooled (n = 879) and analyzed by (logistic) regression regarding the mutual influence of single-nucleotide-polymorphisms (SNPs) in the FADS-gene-cluster (rs174545, rs174546, rs174556, rs174561, rs3834458), on polyunsaturated fatty acids (PUFA) in blood and parent-reported eczema until the age of 2 years. All SNPs were highly significantly associated with all PUFAs except for alpha-linolenic-acid and eicosapentaenoic-acid, also after correction for multiple-testing. All tested SNPs showed associations with eczema in the LISA-study, but not in the KOALA-study. None of the PUFAs was significantly associated with eczema neither in the pooled nor in the analyses stratified by study-cohort. Conclusions and Significance PUFA-composition in young children's blood is under strong control of the FADS-gene-cluster. Inconsistent results were found for a link between these genetic-variants with eczema. PUFA in blood was not associated with eczema. Thus the hypothesis of an inflammatory-link between PUFA and eczema by the metabolic-pathway of LC-PUFAs as precursors for inflammatory prostaglandins and leukotrienes could not be confirmed by these data. PMID:20948998
Information capacity of nucleotide sequences and its applications.
Sadovsky, M G
2006-05-01
The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.
Optimization of algorithm of coding of genetic information of Chlamydia
NASA Astrophysics Data System (ADS)
Feodorova, Valentina A.; Ulyanov, Sergey S.; Zaytsev, Sergey S.; Saltykov, Yury V.; Ulianova, Onega V.
2018-04-01
New method of coding of genetic information using coherent optical fields is developed. Universal technique of transformation of nucleotide sequences of bacterial gene into laser speckle pattern is suggested. Reference speckle patterns of the nucleotide sequences of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci serovar I as well are generated. Algorithm of coding of gene information into speckle pattern is optimized. Fully developed speckles with Gaussian statistics for gene-based speckles have been used as criterion of optimization.
NASA Astrophysics Data System (ADS)
Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.
2008-08-01
We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.
Trotta, Edoardo
2016-05-17
The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.
Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C
1988-01-01
We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025
Pu, Fang; Ren, Jinsong; Qu, Xiaogang
2014-06-25
Molecular logic gates in response to chemical, biological, or optical input signals at a molecular level have received much interest over the past decade. Herein, we construct "plug and play" logic systems based on the fluorescence switching of guest molecules confined in coordination polymer nanoparticles generated from nucleotide and lanthanide ions. In the system, the addition of new modules directly enables new logic functions. PASS 0, YES, PASS 1, NOT, IMP, OR, and AND gates are successfully constructed in sequence. Moreover, different logic gates (AND, INH, and IMP) can be constructed using different guest molecules and the same input combinations. The work will be beneficial to the future logic design and expand the applications of coordination polymers.
DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere
2006-01-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders.
Balintová, Jana; Plucnara, Medard; Vidláková, Pavlína; Pohl, Radek; Havran, Luděk; Fojta, Miroslav; Hocek, Michal
2013-09-16
Benzofurazane has been attached to nucleosides and dNTPs, either directly or through an acetylene linker, as a new redox label for electrochemical analysis of nucleotide sequences. Primer extension incorporation of the benzofurazane-modified dNTPs by polymerases has been developed for the construction of labeled oligonucleotide probes. In combination with nitrophenyl and aminophenyl labels, we have successfully developed a three-potential coding of DNA bases and have explored the relevant electrochemical potentials. The combination of benzofurazane and nitrophenyl reducible labels has proved to be excellent for ratiometric analysis of nucleotide sequences and is suitable for bioanalytical applications. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nucleotide diversity and linkage disequilibrium in wild avocado (Persea americana Mill.).
Chen, Haofeng; Morrell, Peter L; de la Cruz, Marlene; Clegg, Michael T
2008-01-01
Resequencing studies provide the ultimate resolution of genetic diversity because they identify all mutations in a gene that are present within the sampled individuals. We report a resequencing study of Persea americana, a subtropical tree species native to Meso- and Central America and the progenitor of cultivated avocado. The sample includes 21 wild accessions from Mexico, Costa Rica, Ecuador, and the Dominican Republic. Estimated levels of nucleotide polymorphism and linkage disequilibrium (LD) are obtained from fully resolved haplotype data from 4 nuclear loci that span 5960 nucleotide sites. Results show that, although avocado is a subtropical tree crop and a predominantly outcrossing plant, the overall level of genetic variation is not exceptionally high (nucleotide diversity at silent sites, pi(sil) = 0.0102) compared with available estimates from temperate plant species. Intralocus LD decays rapidly to half the initial value within about 1 kb. Estimates of recombination rate (based on the sequence data) show that the rate is not exceptionally high when compared with annual plants such as wild barley or maize. Interlocus LD is significant owing to substantial population structure induced by mixing of the 3 botanical races of avocado.
Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar
2017-06-01
Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.
Mikhailov, Sergey N; Zakharova, Alexandra N; Drenichev, Mikhail S; Ershov, Andrey V; Kasatkina, Mariya A; Vladimirov, Leonid V; Novikov, Valentin V; Kildeeva, Natalia R
2016-01-01
In medical and pharmaceutical applications, chitosan is used as a component of hydrogels-macromolecular networks swollen in water. Chemical hydrogels are formed by covalent links between the crosslinking reagents and amino functionalities of chitosan. To date, the most commonly used chitosan crosslinkers are dialdehydes, such as glutaraldehyde (GA). We have developed novel GA like crosslinkers with additional functional groups-dialdehyde derivatives of uridine (oUrd) and nucleotides (oUMP and oAMP)-leading to chitosan-based biomaterials with new properties. The process of chitosan crosslinking was investigated in details and compared to crosslinking with GA. The rates of crosslinking with oUMP, oAMP, and GA were essentially the same, though much higher than in the case of oUrd. The remarkable difference in the crosslinking properties of nucleoside and nucleotide dialdehydes can be clearly attributed to the presence of the phosphate group in nucleotides that participates in the gelation process through ionic interactions with the amino groups of chitosan. Using NMR spectroscopy, we have not observed the formation of aldimine bonds. It can be concluded that the real number of crosslinks needed to cause gelation of chitosan chains may be less than 1%.
Kirouac, Kevin N.; Ling, Hong
2011-01-01
The 8-oxo-guanine (8-oxo-G) lesion is the most abundant and mutagenic oxidative DNA damage existing in the genome. Due to its dual coding nature, 8-oxo-G causes most DNA polymerases to misincorporate adenine. Human Y-family DNA polymerase iota (polι) preferentially incorporates the correct cytosine nucleotide opposite 8-oxo-G. This unique specificity may contribute to polι’s biological role in cellular protection against oxidative stress. However, the structural basis of this preferential cytosine incorporation is currently unknown. Here we present four crystal structures of polι in complex with DNA containing an 8-oxo-G lesion, paired with correct dCTP or incorrect dATP, dGTP, and dTTP nucleotides. An exceptionally narrow polι active site restricts the purine bases in a syn conformation, which prevents the dual coding properties of 8-oxo-G by inhibiting syn/anti conformational equilibrium. More importantly, the 8-oxo-G base in a syn conformation is not mutagenic in polι because its Hoogsteen edge does not form a stable base pair with dATP in the narrow active site. Instead, the syn 8-oxo-G template base forms the most stable replicating base pair with correct dCTP due to its small pyrimidine base size and enhanced hydrogen bonding with the Hoogsteen edge of 8-oxo-G. In combination with site directed mutagenesis, we show that Gln59 in the finger domain specifically interacts with the additional O8 atom of the lesion base, which influences nucleotide selection, enzymatic efficiency, and replication stalling at the lesion site. Our work provides the structural mechanism of high-fidelity 8-oxo-G replication by a human DNA polymerase. PMID:21300901
Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S
2017-04-01
Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.
Novel Synthesis and Phenotypic Analysis of Mutant Clouds for Hepatitis E Virus Genotype 1.
Agarwal, Shubhra; Baccam, Prasith; Aggarwal, Rakesh; Veerapu, Naga Suresh
2018-02-15
Many RNA viruses exist as an ensemble of genetically diverse, replicating populations known as a mutant cloud. The genetic diversity (cloud size) and composition of this mutant cloud may influence several important phenotypic features of the virus, including its replication capacity. We applied a straightforward, bacterium-free approach using error-prone PCR coupled with reverse genetics to generate infectious mutant RNA clouds with various levels of genetic diversity from a genotype 1 strain of hepatitis E virus (HEV). Cloning and sequencing of a genomic fragment encompassing 70% of open reading frame 1 ( ORF1 ) or of the full genome from variants in the resultant clouds showed the occurrence of nucleotide mutations at a frequency on the order of 10 -3 per nucleotide copied and the existence of marked genetic diversity, with a high normalized Shannon entropy value. The mutant clouds showed transient replication in cell culture, while wild-type HEV did not. Cross-sectional data from these cell cultures supported the existence of differential effects of clouds of various sizes and compositions on phenotypic characteristics, such as the replication level of (+)-RNA progeny, the amounts of double-stranded RNA (a surrogate for the rate of viral replication) and ORF1 protein, and the expression of interferon-stimulated genes. Since mutant cloud size and composition influenced the viral phenotypic properties, a better understanding of this relationship may help to provide further insights into virus evolution and prediction of emerging viral diseases. IMPORTANCE Several biological or practical limitations currently prevent the study of phenotypic behavior of a mutant cloud in vitro We developed a simple and rapid method for synthesizing mutant clouds of hepatitis E virus (HEV), a single-stranded (+)-RNA [ss(+) RNA] virus, with various and controllable levels of genetic diversity, which could then be used in a cell culture system to study the effects of cloud size and composition on viral phenotype. In a cross-sectional analysis, we demonstrated that a particular mutant cloud which had an extremely high genetic diversity had a replication rate exceeding that of wild-type HEV. This method should thus provide a useful model for understanding the phenotypic behavior of ss(+) RNA viruses. Copyright © 2018 American Society for Microbiology.
Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J
2013-09-01
The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.
Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.
Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W
2016-01-01
DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.
Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X
1993-05-01
The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.
Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John
2013-01-01
The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.
A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, G K; Hillier, L; Brandstrom, M
2005-02-20
We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less
Hammond, R; Smith, D R; Diener, T O
1989-01-01
The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114
Three new HLA-C alleles (HLA-C*14:02:13, HLA-C*15:72 and HLA-C*15:74) in Saudi bone marrow donors.
Fakhoury, H A; Jawdat, D; Alaskar, A S; Al Jumah, M; Cereb, N; Hajeer, A H
2015-10-01
Three new HLA-C alleles were identified by sequence-based typing method (SBT) in donors for the Saudi Bone Marrow Donor Registry (SBMDR). HLA-C*14:02:13 differs from HLA-C*14:02:01 by a silent G to A substitution at nucleotide position 400 in exon 2, where lysine at position 66 remains unchanged. HLA-C*15:72 differs from HLA-C*15:22 by a nonsynonymous C to A substitution at nucleotide position 796 in exon 3, resulting in an amino acid change from phenylalanine to leucine at position 116. HLA-C*15:74 differs from HLA-C*15:08 by a nonsynonymous C to T substitution at nucleotide position 914 in exon 3, resulting in an amino acid change from arginine to tryptophan at position 156. © 2015 John Wiley & Sons Ltd.
Inquiry-Based Learning of Molecular Phylogenetics
ERIC Educational Resources Information Center
Campo, Daniel; Garcia-Vazquez, Eva
2008-01-01
Reconstructing phylogenies from nucleotide sequences is a challenge for students because it strongly depends on evolutionary models and computer tools that are frequently updated. We present here an inquiry-based course aimed at learning how to trace a phylogeny based on sequences existing in public databases. Computer tools are freely available…
Cyclic nucleotide binding proteins in the Arabidopsis thaliana and Oryza sativa genomes
Bridges, Dave; Fraser, Marie E; Moorhead, Greg BG
2005-01-01
Background Cyclic nucleotides are ubiquitous intracellular messengers. Until recently, the roles of cyclic nucleotides in plant cells have proven difficult to uncover. With an understanding of the protein domains which can bind cyclic nucleotides (CNB and GAF domains) we scanned the completed genomes of the higher plants Arabidopsis thaliana (mustard weed) and Oryza sativa (rice) for the effectors of these signalling molecules. Results Our analysis found that several ion channels and a class of thioesterases constitute the possible cyclic nucleotide binding proteins in plants. Contrary to some reports, we found no biochemical or bioinformatic evidence for a plant cyclic nucleotide regulated protein kinase, suggesting that cyclic nucleotide functions in plants have evolved differently than in mammals. Conclusion This paper provides a molecular framework for the discussion of cyclic nucleotide function in plants, and resolves a longstanding debate about the presence of a cyclic nucleotide dependent kinase in plants. PMID:15644130
Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang
2016-01-01
Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5′ untranslated region (5′UTR), have not been investigated until now. Here, a series of nucleotides present in 5′UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5′UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5′UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5′UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5′UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413
Ananvoranich, S; Lafontaine, D A; Perreault, J P
1999-01-01
Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808
Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki
N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the synmore » conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.« less
Burns, John A; Chowdhury, Moinuddin A; Cartularo, Laura; Berens, Christian; Scicchitano, David A
2018-01-01
Abstract Simple sequence repeats (SSRs) are found throughout the genome, and under some conditions can change in length over time. Germline and somatic expansions of trinucleotide repeats are associated with a series of severely disabling illnesses, including Huntington's disease. The underlying mechanisms that effect SSR expansions and contractions have been experimentally elusive, but models suggesting a role for DNA repair have been proposed, in particular the involvement of transcription-coupled nucleotide excision repair (TCNER) that removes transcription-blocking DNA damage from the transcribed strand of actively expressed genes. If the formation of secondary DNA structures that are associated with SSRs were to block RNA polymerase progression, TCNER could be activated, resulting in the removal of the aberrant structure and a concomitant change in the region's length. To test this, TCNER activity in primary human fibroblasts was assessed on defined DNA substrates containing extrahelical DNA loops that lack discernible internal base pairs or DNA stem–loops that contain base pairs within the stem. The results show that both structures impede transcription elongation, but there is no corresponding evidence that nucleotide excision repair (NER) or TCNER operates to remove them. PMID:29474673
Genetic structure and genealogy in the Sphagnum subsecundum complex (Sphagnaceae: Bryophyta).
Shaw, A J; Pokorny, L; Shaw, B; Ricca, M; Boles, S; Szövényi, P
2008-10-01
Allopolyploidy is probably the most extensively studied mode of plant speciation and allopolyploid species appear to be common in the mosses (Bryophyta). The Sphagnum subsecundum complex includes species known to be gametophytically haploid or diploid, and it has been proposed that the diploids (i.e., with tetraploid sporophytes) are allopolyploids. Nucleotide sequence and microsatellite variation among haploids and diploids from Newfoundland and Scandinavia indicate that (1) the diploids exhibit fixed or nearly fixed heterozygosity at the majority of loci sampled, and are clearly allopolyploids, (2) diploids originated independently in North America and Europe, (3) the European diploids appear to have the haploid species, S. subsecundum, as the maternal parent based on shared chloroplast DNA haplotypes, (4) the North American diploids do not have the chloroplast DNA of any sampled haploid, (5) both North American and European diploids share nucleotide and microsatellite similarities with S. subsecundum, (6) the diploids harbor more nucleotide and microsatellite diversity than the haploids, and (7) diploids exhibit higher levels of linkage disequilibrium among microsatellite loci. An experiment demonstrates significant artifactual recombination between interspecific DNAs coamplified by PCR, which may be a complicating factor in the interpretation of sequence-based analyses of allopolyploids.
Dong, Biqin; Almassalha, Luay M.; Stypula-Cyrus, Yolanda; Urban, Ben E.; Chandler, John E.; Nguyen, The-Quyen; Sun, Cheng; Zhang, Hao F.; Backman, Vadim
2016-01-01
Visualizing the nanoscale intracellular structures formed by nucleic acids, such as chromatin, in nonperturbed, structurally and dynamically complex cellular systems, will help expand our understanding of biological processes and open the next frontier for biological discovery. Traditional superresolution techniques to visualize subdiffractional macromolecular structures formed by nucleic acids require exogenous labels that may perturb cell function and change the very molecular processes they intend to study, especially at the extremely high label densities required for superresolution. However, despite tremendous interest and demonstrated need, label-free optical superresolution imaging of nucleotide topology under native nonperturbing conditions has never been possible. Here we investigate a photoswitching process of native nucleotides and present the demonstration of subdiffraction-resolution imaging of cellular structures using intrinsic contrast from unmodified DNA based on the principle of single-molecule photon localization microscopy (PLM). Using DNA-PLM, we achieved nanoscopic imaging of interphase nuclei and mitotic chromosomes, allowing a quantitative analysis of the DNA occupancy level and a subdiffractional analysis of the chromosomal organization. This study may pave a new way for label-free superresolution nanoscopic imaging of macromolecular structures with nucleotide topologies and could contribute to the development of new DNA-based contrast agents for superresolution imaging. PMID:27535934