McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms
ERIC Educational Resources Information Center
Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.
2016-01-01
The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…
Li, Su-Xia
2004-12-01
Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.
Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori
2010-01-01
Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.
Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K
2017-09-01
Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.
Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.
2016-01-01
Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631
2013-10-01
identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year
High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling
Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven
2006-01-01
Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952
USDA-ARS?s Scientific Manuscript database
Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...
Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A
2014-08-01
Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.
Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-11-01
Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.
Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-01-01
Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242
Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.
Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A
2010-08-01
Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
2013-01-01
Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216
Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A
2017-04-01
Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.
Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A
2008-05-01
Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.
Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.
2009-01-01
OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852
Wang, Jing; Street, Nathaniel R.; Scofield, Douglas G.; Ingvarsson, Pär K.
2016-01-01
A central aim of evolutionary genomics is to identify the relative roles that various evolutionary forces have played in generating and shaping genetic variation within and among species. Here we use whole-genome resequencing data to characterize and compare genome-wide patterns of nucleotide polymorphism, site frequency spectrum, and population-scaled recombination rates in three species of Populus: Populus tremula, P. tremuloides, and P. trichocarpa. We find that P. tremuloides has the highest level of genome-wide variation, skewed allele frequencies, and population-scaled recombination rates, whereas P. trichocarpa harbors the lowest. Our findings highlight multiple lines of evidence suggesting that natural selection, due to both purifying and positive selection, has widely shaped patterns of nucleotide polymorphism at linked neutral sites in all three species. Differences in effective population sizes and rates of recombination largely explain the disparate magnitudes and signatures of linked selection that we observe among species. The present work provides the first phylogenetic comparative study on a genome-wide scale in forest trees. This information will also improve our ability to understand how various evolutionary forces have interacted to influence genome evolution among related species. PMID:26721855
Wang, Jing; Street, Nathaniel R; Scofield, Douglas G; Ingvarsson, Pär K
2016-03-01
A central aim of evolutionary genomics is to identify the relative roles that various evolutionary forces have played in generating and shaping genetic variation within and among species. Here we use whole-genome resequencing data to characterize and compare genome-wide patterns of nucleotide polymorphism, site frequency spectrum, and population-scaled recombination rates in three species of Populus: Populus tremula, P. tremuloides, and P. trichocarpa. We find that P. tremuloides has the highest level of genome-wide variation, skewed allele frequencies, and population-scaled recombination rates, whereas P. trichocarpa harbors the lowest. Our findings highlight multiple lines of evidence suggesting that natural selection, due to both purifying and positive selection, has widely shaped patterns of nucleotide polymorphism at linked neutral sites in all three species. Differences in effective population sizes and rates of recombination largely explain the disparate magnitudes and signatures of linked selection that we observe among species. The present work provides the first phylogenetic comparative study on a genome-wide scale in forest trees. This information will also improve our ability to understand how various evolutionary forces have interacted to influence genome evolution among related species. Copyright © 2016 by the Genetics Society of America.
Kusumi, J.; Zidong, L.; Kado, T.; Tsumura, Y.; Middleton, B.A.; Tachida, H.
2010-01-01
Premise of the Study: Studies of the geographic patterns of genetic variation can give important insights into the past population structure of species. Our study species, Taxodium distichum L. (bald-cypress), prefers riparian and wetland habitats and is widely distributed in southeastern North America and Mexico. We compared the genetic variation of T. distichum with that of its close relative, Cryptomeria japonica, which is endemic to Japan. Methods: Nucleotide polymorphisms of T. distichum in the lower Mississippi River alluvial valley, USA, were examined at 10 nuclear loci. Key Results: The average nucleotide diversity at silent sites, 7sil, across the 10 loci in T. distichum was higher than that of C. japonica (7sil = 0.00732 and 0.00322, respectively). In T. distichum, Tajima's D values were each negative at 9 out of 10 loci, which suggests a recent population expansion. Maximum-likelihood and Bayesian estimations of the exponential population growth rate (g) of T. distichum populations indicated that this species had expanded approximately at the rate of 1.7 - 1.0 10 -6 per year in the past. Conclusions: Taxodium distichum had signifi cantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.
Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo
2016-01-01
Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941
Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun
2007-01-01
Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779
A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, G K; Hillier, L; Brandstrom, M
2005-02-20
We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less
DNA variation in a conifer, Cryptomeria japonica (Cupressaceae sensu lato).
Kado, Tomoyuki; Yoshimaru, Hiroshi; Tsumura, Yoshihiko; Tachida, Hidenori
2003-01-01
We investigated the nucleotide variation of a conifer, Cryptomeria japonica, and the divergence between this species and its closest relative, Taxodium distichum, at seven nuclear loci (Acl5, Chi1, Ferr, GapC, HemA, Lcyb, and Pat). Samples of C. japonica were collected from three areas, Kantou-Toukai, Hokuriku, and Iwate. No apparent geographic differentiation was found among these samples. However, the frequency spectrum of the nucleotide polymorphism revealed excesses of intermediate-frequency variants, which suggests that the population was not panmictic and a constant size in the past. The average nucleotide diversity, pi, for silent sites was 0.00383. However, values of pi for silent sites vary among loci. Comparisons of polymorphism to divergence among loci (the HKA test) showed that the polymorphism at the Acl5 locus was significantly lower. We also observed a nearly significant excess of replacement polymorphisms at the Lcyb locus. These results suggested possibilities of natural selection acting at some of the loci. Intragenic recombination was detected only once at the Chi1 locus and was not detected at the other loci. The low level of population recombination rate, 4Nr, seemed to be due to both low level of recombination, r, and small population size, N. PMID:12930759
A survey of copy number variation in the porcine genome detected from whole-genome sequence
USDA-ARS?s Scientific Manuscript database
An important challenge to post-genomic biology is relating observed phenotypic variation to the underlying genotypic variation. Genome-wide association studies (GWAS) have made thousands of connections between single nucleotide polymorphisms (SNPs) and phenotypes, implicating regions of the genome t...
Structural and functional impacts of copy number variations on the cattle genome
USDA-ARS?s Scientific Manuscript database
Although there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs), similar realizations for larger, more complex forms of genetic variation have just emerged. Several recent publications reveal that copy number variations (CNVs) are common an...
Radiogenomics Consortium (RGC)
The Radiogenomics Consortium's hypothesis is that a cancer patient's likelihood of developing toxicity to radiation therapy is influenced by common genetic variations, such as single nucleotide polymorphisms (SNPs).
Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.
Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela
2014-01-01
Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.
Robinson, James; Guethlein, Lisbeth A; Cereb, Nezih; Yang, Soo Young; Norman, Paul J; Marsh, Steven G E; Parham, Peter
2017-06-01
HLA class I glycoproteins contain the functional sites that bind peptide antigens and engage lymphocyte receptors. Recently, clinical application of sequence-based HLA typing has uncovered an unprecedented number of novel HLA class I alleles. Here we define the nature and extent of the variation in 3,489 HLA-A, 4,356 HLA-B and 3,111 HLA-C alleles. This analysis required development of suites of methods, having general applicability, for comparing and analyzing large numbers of homologous sequences. At least three amino-acid substitutions are present at every position in the polymorphic α1 and α2 domains of HLA-A, -B and -C. A minority of positions have an incidence >1% for the 'second' most frequent nucleotide, comprising 70 positions in HLA-A, 85 in HLA-B and 54 in HLA-C. The majority of these positions have three or four alternative nucleotides. These positions were subject to positive selection and correspond to binding sites for peptides and receptors. Most alleles of HLA class I (>80%) are very rare, often identified in one person or family, and they differ by point mutation from older, more common alleles. These alleles with single nucleotide polymorphisms reflect the germ-line mutation rate. Their frequency predicts the human population harbors 8-9 million HLA class I variants. The common alleles of human populations comprise 42 core alleles, which represent all selected polymorphism, and recombinants that have assorted this polymorphism.
Cereb, Nezih; Yang, Soo Young; Marsh, Steven G. E.; Parham, Peter
2017-01-01
HLA class I glycoproteins contain the functional sites that bind peptide antigens and engage lymphocyte receptors. Recently, clinical application of sequence-based HLA typing has uncovered an unprecedented number of novel HLA class I alleles. Here we define the nature and extent of the variation in 3,489 HLA-A, 4,356 HLA-B and 3,111 HLA-C alleles. This analysis required development of suites of methods, having general applicability, for comparing and analyzing large numbers of homologous sequences. At least three amino-acid substitutions are present at every position in the polymorphic α1 and α2 domains of HLA-A, -B and -C. A minority of positions have an incidence >1% for the ‘second’ most frequent nucleotide, comprising 70 positions in HLA-A, 85 in HLA-B and 54 in HLA-C. The majority of these positions have three or four alternative nucleotides. These positions were subject to positive selection and correspond to binding sites for peptides and receptors. Most alleles of HLA class I (>80%) are very rare, often identified in one person or family, and they differ by point mutation from older, more common alleles. These alleles with single nucleotide polymorphisms reflect the germ-line mutation rate. Their frequency predicts the human population harbors 8–9 million HLA class I variants. The common alleles of human populations comprise 42 core alleles, which represent all selected polymorphism, and recombinants that have assorted this polymorphism. PMID:28650991
Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif
2015-05-15
Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.
Large scale variation in DNA copy number in chicken breeds
USDA-ARS?s Scientific Manuscript database
Background Detecting genetic variation is a critical step in elucidating the molecular mechanisms underlying phenotypic diversity. Until recently, such detection has mostly focused on single nucleotide polymorphisms (SNPs) because of the ease in screening complete genomes. Another type of variant, c...
USDA-ARS?s Scientific Manuscript database
One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...
Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia
2013-01-01
Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.
Genomic profiling of plastid DNA variation in the Mediterranean olive tree
2011-01-01
Background Characterisation of plastid genome (or cpDNA) polymorphisms is commonly used for phylogeographic, population genetic and forensic analyses in plants, but detecting cpDNA variation is sometimes challenging, limiting the applications of such an approach. In the present study, we screened cpDNA polymorphism in the olive tree (Olea europaea L.) by sequencing the complete plastid genome of trees with a distinct cpDNA lineage. Our objective was to develop new markers for a rapid genomic profiling (by Multiplex PCRs) of cpDNA haplotypes in the Mediterranean olive tree. Results Eight complete cpDNA genomes of Olea were sequenced de novo. The nucleotide divergence between olive cpDNA lineages was low and not exceeding 0.07%. Based on these sequences, markers were developed for studying two single nucleotide substitutions and length polymorphism of 62 regions (with variable microsatellite motifs or other indels). They were then used to genotype the cpDNA variation in cultivated and wild Mediterranean olive trees (315 individuals). Forty polymorphic loci were detected on this sample, allowing the distinction of 22 haplotypes belonging to the three Mediterranean cpDNA lineages known as E1, E2 and E3. The discriminating power of cpDNA variation was particularly low for the cultivated olive tree with one predominating haplotype, but more diversity was detected in wild populations. Conclusions We propose a method for a rapid characterisation of the Mediterranean olive germplasm. The low variation in the cultivated olive tree indicated that the utility of cpDNA variation for forensic analyses is limited to rare haplotypes. In contrast, the high cpDNA variation in wild populations demonstrated that our markers may be useful for phylogeographic and populations genetic studies in O. europaea. PMID:21569271
Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.
2016-01-01
Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145
Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.
2012-01-01
Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373
Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.
Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E
2014-02-01
The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.
Guirao-Rico, Sara; Aguadé, Montserrat
2013-01-01
In Drosophila, the insulin-signaling pathway controls some life history traits, such as fertility and lifespan, and it is considered to be the main metabolic pathway involved in establishing adult body size. Several observations concerning variation in body size in the Drosophila genus are suggestive of its adaptive character. Genes encoding proteins in this pathway are, therefore, good candidates to have experienced adaptive changes and to reveal the footprint of positive selection. The Drosophila insulin-like peptides (DILPs) are the ligands that trigger the insulin-signaling cascade. In Drosophila melanogaster, there are several peptides that are structurally similar to the single mammalian insulin peptide. The footprint of recent adaptive changes on nucleotide variation can be unveiled through the analysis of polymorphism and divergence. With this aim, we have surveyed nucleotide sequence variation at the dilp1-7 genes in a natural population of D. melanogaster. The comparison of polymorphism in D. melanogaster and divergence from D. simulans at different functional classes of the dilp genes provided no evidence of adaptive protein evolution after the split of the D. melanogaster and D. simulans lineages. However, our survey of polymorphism at the dilp gene regions of D. melanogaster has provided some evidence for the action of positive selection at or near these genes. The regions encompassing the dilp1-4 genes and the dilp6 gene stand out as likely affected by recent adaptive events. PMID:23308258
Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A
2011-01-01
PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.
El-Sabrout, Karim; Aggag, Sarah A.
2017-01-01
Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458
VarDetect: a nucleotide sequence variation exploratory tool
Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades
2008-01-01
Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032
Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome
Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark
2016-01-01
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779
Natural variations in OsγTMT contribute to diversity of the α-tocopherol content in rice.
Wang, Xiao-Qiang; Yoon, Min-Young; He, Qiang; Kim, Tae-Sung; Tong, Wei; Choi, Bu-Woong; Lee, Young-Sang; Park, Yong-Jin
2015-12-01
Tocopherols and tocotrienols, collectively known as tocochromanols, are lipid-soluble molecules that belong to the group of vitamin E compounds. Among them, α-tocopherol (αΤ) is one of the antioxidants with diverse functions and benefits for humans and animals. Thus, understanding the genetic basis of these traits would be valuable to improve nutritional quality by breeding in rice. Genome-wide association study (GWAS) has emerged as a powerful strategy for identifying genes or quantitative trait loci (QTL) underlying complex traits in plants. To discover the genes or QTLs underlying the naturally occurring variations of αΤ content in rice, we performed GWAS using 1.44 million high-quality single-nucleotide polymorphisms acquired from re-sequencing of 137 accessions from a diverse rice core collection. Thirteen candidate genes were found across 2-year phenotypic data, among which gamma-tocopherol methyltransferase (OsγTMT) was identified as the major factor responsible for the αΤ content among rice accessions. Nucleotide variations in the coding region of OsγTMT were significantly associated with the αΤ content variations, while nucleotide polymorphisms in the promoter region of OsγTMT also could partly demonstrate the correlation with αΤ content variations, according to our RNA expression analyses. This study provides useful information for genetic factors underlying αΤ content variations in rice, which will significantly contribute the research on αΤ biosynthesis mechanisms and αΤ improvement of rice.
USDA-ARS?s Scientific Manuscript database
Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...
USDA-ARS?s Scientific Manuscript database
Deep sequencing of viruses isolated from infected hosts is an efficient way to measure population-genetic variation and can reveal patterns of dispersal and natural selection. In this study, we mined existing Illumina sequence reads to investigate single-nucleotide polymorphisms (SNPs) within two RN...
USDA-ARS?s Scientific Manuscript database
Copy number variation (CNV) is an important type of genetic variation contributing to phenotypic differences among mammals and may serve as an alternative molecular marker to single nucleotide polymorphism (SNP) for genome-wide association study (GWAS). Recently, GWAS analysis using CNV has been app...
Genetic Variation Linked to Lung Cancer Survival in White Smokers | Center for Cancer Research
CCR investigators have discovered evidence that links lung cancer survival with genetic variations (called single nucleotide polymorphisms) in the MBL2 gene, a key player in innate immunity. The variations in the gene, which codes for a protein called the mannose-binding lectin, occur in its promoter region, where the RNA polymerase molecule binds to start transcription, and
Chowanadisai, Winyoo; Kelleher, Shannon L; Nemeth, Jennifer F; Yachetti, Stephen; Kuhlman, Charles F; Jackson, Joan G; Davis, Anne M; Lien, Eric L; Lönnerdal, Bo
2005-05-01
Variability in the protein composition of breast milk has been observed in many women and is believed to be due to natural variation of the human population. Single nucleotide polymorphisms (SNPs) are present throughout the entire human genome, but the impact of this variation on human milk composition and biological activity and infant nutrition and health is unclear. The goals of this study were to characterize a variant of human alpha-lactalbumin observed in milk from a Filipino population by determining the location of the polymorphism in the amino acid and genomic sequences of alpha-lactalbumin. Milk and blood samples were collected from 20 Filipino women, and milk samples were collected from an additional 450 women from nine different countries. alpha-Lactalbumin concentration was measured by high-performance liquid chromatography (HPLC), and milk samples containing the variant form of the protein were identified with both HPLC and mass spectrometry (MS). The molecular weight of the variant form was measured by MS, and the location of the polymorphism was narrowed down by protein reduction, alkylation and trypsin digestion. Genomic DNA was isolated from whole blood, and the polymorphism location and subject genotype were determined by amplifying the entire coding sequence of human alpha-lactalbumin by PCR, followed by DNA sequencing. A variant form of alpha-lactalbumin was observed in HPLC chromatograms, and the difference in molecular weight was determined by MS (wild type=14,070 Da, variant=14,056 Da). Protein reduction and digestion narrowed the polymorphism between the 33rd and 77th amino acid of the protein. The genetic polymorphism was identified as adenine to guanine, which translates to a substitution from isoleucine to valine at amino acid 46. The frequency of variation was higher in milk from China, Japan and Philippines, which suggests that this polymorphism is most prevalent in Asia. There are SNPs in the genome for human milk proteins and their implications for protein bioactivity and infant nutrition need to be considered.
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...
2016-09-07
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parker, Glendon J.; Leppert, Tami; Anex, Deon S.
Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less
USDA-ARS?s Scientific Manuscript database
Single nucleotide polymorphisms (SNPs) are the most abundant DNA sequence variation in the genomes which can be used to associate genotypic variation to the phenotype. Therefore, availability of a high-density SNP array with uniform genome coverage can advance genetic studies and breeding applicatio...
Bison PRNP genotyping and potential association with Brucella spp. seroprevalence
Seabury, C.M.; Halbert, N.D.; Gogan, P.J.P.; Templeton, J.W.; Derr, J.N.
2005-01-01
The implication that host cellular prion protein (PrPC) may function as a cell surface receptor and/or portal protein for Brucella abortus in mice prompted an evaluation of nucleotide and amino acid variation within exon 3 of the prion protein gene (PRNP) for six US bison populations. A non-synonymous single nucleotide polymorphism (T50C), resulting in the predicted amino acid replacement M17T (Met ??? Thr), was identified in each population. To date, no variation (T50: Met) has been detected at the corresponding exon 3 nucleotide and/or amino acid position for domestic cattle. Notably, 80% (20 of 25) of the Yellowstone National Park bison possessing the C/C genotype were Brucella spp. seropositive, representing a significant (P = 0.021) association between seropositivity and the C/C genotypic class. Moreover, significant differences in the distribution of PRNP exon 3 alleles and genotypes were detected between Yellowstone National Park bison and three bison populations that were either founded from seronegative stock or previously subjected to test-and-slaughter management to eradicate brucellosis. Unlike domestic cattle, no indel polymorphisms were detected within the corresponding regions of the putative bison PRNP promoter, intron 1, octapeptide repeat region or 3???-untranslated region for any population examined. This study provides the first evidence of a potential association between nucleotide variation within PRNP exon 3 and the presence of Brucella spp. antibodies in bison, implicating PrPC in the natural resistance of bison to brucellosis infection. ?? 2005 International Society for Animal Genetics.
Keller, Thomas E; Lasky, Jesse R; Yi, Soojin V
2016-04-01
Epigenetic changes can occur due to extracellular environmental conditions. Consequently, epigenetic mechanisms can play an intermediate role to translate environmental signals to intracellular changes. Such a role might be particularly important in plants, which often show strong local adaptation and have the potential for heritable epigenetic states. However, little is currently known about the role of epigenetic variation in the ecological mechanisms of adaptation. Here, we used multivariate redundancy analyses to examine genomewide associations between DNA methylation polymorphisms and climate variation in two independent panels of Arabidopsis accessions, including 122 Eurasian accessions as well as in a regional panel of 148 accessions in Sweden. At the single-nucleotide methylation level, climate and space (geographic spatial structure) explain small yet significant amount of variation in both panels. On the other hand, when viewed in a context of genomic clusters of methylated and unmethylated cytosines, climate and space variables explain much greater amounts of variation in DNA methylation than those explained by variation at the single-nucleotide level. We found that the single-nucleotide methylation polymorphisms with the strongest associations with climate were enriched in transposable elements and in potentially RNA-directed methylation contexts. When viewed in the context of genomic clusters, variation of DNA methylation at different sequence contexts exhibit distinctive segregation along different axes of variation in the redundancy analyses. Genomewide methylation showed much stronger associations with climate within the regional panel (Sweden) compared to the global (Eurasia). Together, these findings indicate that genetic and epigenetic variation across the genome may play a role in response to climate conditions and local adaptation. © 2016 John Wiley & Sons Ltd.
Aguadé, M
2001-01-01
The FAH1 and F3H genes encode ferulate-5-hydroxylase and flavanone-3-hydroxylase, which are enzymes in the pathways leading to the synthesis of sinapic acid esters and flavonoids, respectively. Nucleotide variation at these genes was surveyed by sequencing a sample of 20 worldwide Arabidopsis thaliana ecotypes and one Arabidopsis lyrata spp. petraea stock. In contrast with most previously studied genes, the percentage of singletons was rather low in both the FAH1 and the F3H gene regions. There was, therefore, no footprint of a recent species expansion in the pattern of nucleotide variation in these regions. In both FAH1 and F3H, nucleotide variation was structured into two major highly differentiated haplotypes. In both genes, there was a peak of silent polymorphism in the 5' part of the coding region without a parallel increase in silent divergence. In FAH1, the peak was centered at the beginning of the second exon. In F3H, nucleotide diversity was highest at the beginning of the gene. The observed pattern of variation in both FAH1 and F3H, although suggestive of balancing selection, was compatible with a neutral model with no recombination.
Anderson, Justin E; Michno, Jean-Michel; Kono, Thomas J Y; Stec, Adrian O; Campbell, Benjamin W; Curtin, Shaun J; Stupar, Robert M
2016-05-12
The safety of mutagenized and genetically transformed plants remains a subject of scrutiny. Data gathered and communicated on the phenotypic and molecular variation induced by gene transfer technologies will provide a scientific-based means to rationally address such concerns. In this study, genomic structural variation (e.g. large deletions and duplications) and single nucleotide polymorphism rates were assessed among a sample of soybean cultivars, fast neutron-derived mutants, and five genetically transformed plants developed through Agrobacterium based transformation methods. On average, the number of genes affected by structural variations in transgenic plants was one order of magnitude less than that of fast neutron mutants and two orders of magnitude less than the rates observed between cultivars. Structural variants in transgenic plants, while rare, occurred adjacent to the transgenes, and at unlinked loci on different chromosomes. DNA repair junctions at both transgenic and unlinked sites were consistent with sequence microhomology across breakpoints. The single nucleotide substitution rates were modest in both fast neutron and transformed plants, exhibiting fewer than 100 substitutions genome-wide, while inter-cultivar comparisons identified over one-million single nucleotide polymorphisms. Overall, these patterns provide a fresh perspective on the genomic variation associated with high-energy induced mutagenesis and genetically transformed plants. The genetic transformation process infrequently results in novel genetic variation and these rare events are analogous to genetic variants occurring spontaneously, already present in the existing germplasm, or induced through other types of mutagenesis. It remains unclear how broadly these results can be applied to other crops or transformation methods.
Genetics of Oxidative Stress in Obesity
Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.
2014-01-01
Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334
Genetics of oxidative stress in obesity.
Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M
2014-02-20
Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.
Árnason, Einar
2015-01-01
Natural selection, the most important force in evolution, comes in three forms. Negative purifying selection removes deleterious variation and maintains adaptations. Positive directional selection fixes beneficial variants, producing new adaptations. Balancing selection maintains variation in a population. Important mechanisms of balancing selection include heterozygote advantage, frequency-dependent advantage of rarity, and local and fluctuating episodic selection. A rare pathogen gains an advantage because host defenses are predominantly effective against prevalent types. Similarly, a rare immune variant gives its host an advantage because the prevalent pathogens cannot escape the host’s apostatic defense. Due to the stochastic nature of evolution, neutral variation may accumulate on genealogical branches, but trans-species polymorphisms are rare under neutrality and are strong evidence for balancing selection. Balanced polymorphism maintains diversity at the major histocompatibility complex (MHC) in vertebrates. The Atlantic cod is missing genes for both MHC-II and CD4, vital parts of the adaptive immune system. Nevertheless, cod are healthy in their ecological niche, maintaining large populations that support major commercial fisheries. Innate immunity is of interest from an evolutionary perspective, particularly in taxa lacking adaptive immunity. Here, we analyze extensive amino acid and nucleotide polymorphisms of the cathelicidin gene family in Atlantic cod and closely related taxa. There are three major clusters, Cath1, Cath2, and Cath3, that we consider to be paralogous genes. There is extensive nucleotide and amino acid allelic variation between and within clusters. The major feature of the results is that the variation clusters by alleles and not by species in phylogenetic trees and discriminant analysis of principal components. Variation within the three groups shows trans-species polymorphism that is older than speciation and that is suggestive of balancing selection maintaining the variation. Using Bayesian and likelihood methods positive and negative selection is evident at sites in the conserved part of the genes and, to a larger extent, in the active part which also shows episodic diversifying selection, further supporting the argument for balancing selection. PMID:26038731
Ryynänen, Heikki J; Primmer, Craig R
2006-01-01
Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523
Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric
2008-01-01
Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p
USDA-ARS?s Scientific Manuscript database
Copy number variation (CNV) is an important type of genetic variation contributing to phenotypic differences among mammals and may serve as an alternative molecular marker to single nucleotide polymorphism (SNP) for genome-wide association study (GWAS). Recently, GWAS analysis using CNV has been app...
Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).
Studer, Jacqueline; Bartsch, Christine; Haas, Cordula
2014-07-01
Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.
Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy
2017-03-01
Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.
Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up
2007-04-01
Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.
Quantitative trait nucleotide analysis using Bayesian model selection.
Blangero, John; Goring, Harald H H; Kent, Jack W; Williams, Jeff T; Peterson, Charles P; Almasy, Laura; Dyer, Thomas D
2005-10-01
Although much attention has been given to statistical genetic methods for the initial localization and fine mapping of quantitative trait loci (QTLs), little methodological work has been done to date on the problem of statistically identifying the most likely functional polymorphisms using sequence data. In this paper we provide a general statistical genetic framework, called Bayesian quantitative trait nucleotide (BQTN) analysis, for assessing the likely functional status of genetic variants. The approach requires the initial enumeration of all genetic variants in a set of resequenced individuals. These polymorphisms are then typed in a large number of individuals (potentially in families), and marker variation is related to quantitative phenotypic variation using Bayesian model selection and averaging. For each sequence variant a posterior probability of effect is obtained and can be used to prioritize additional molecular functional experiments. An example of this quantitative nucleotide analysis is provided using the GAW12 simulated data. The results show that the BQTN method may be useful for choosing the most likely functional variants within a gene (or set of genes). We also include instructions on how to use our computer program, SOLAR, for association analysis and BQTN analysis.
Single nucleotide polymorphisms in the Mycobacterium bovis genome resolve phylogenetic relationships
USDA-ARS?s Scientific Manuscript database
Mycobacterium bovis isolates carry restricted allelic variation yet exhibit a range of disease phenotypes and host preferences. Conventional genotyping methods target small hyper-variable regions of their genome and provide anonymous biallelic information insufficient to develop phylogeny. To resolv...
Depaulis, F; Brazier, L; Veuille, M
1999-01-01
The hitchhiking model of population genetics predicts that an allele favored by Darwinian selection can replace haplotypes from the same locus previously established at a neutral mutation-drift equilibrium. This process, known as "selective sweep," was studied by comparing molecular variation between the polymorphic In(2L)t inversion and the standard chromosome. Sequence variation was recorded at the Suppressor of Hairless (Su[H]) gene in an African population of Drosophila melanogaster. We found 47 nucleotide polymorphisms among 20 sequences of 1.2 kb. Neutrality tests were nonsignificant at the nucleotide level. However, these sites were strongly associated, because 290 out of 741 observed pairwise combinations between them were in significant linkage disequilibrium. We found only seven haplotypes, two occurring in the 9 In(2L)t chromosomes, and five in the 11 standard chromosomes, with no shared haplotype. Two haplotypes, one in each chromosome arrangement, made up two-thirds of the sample. This low haplotype diversity departed from neutrality in a haplotype test. This pattern supports a selective sweep hypothesis for the Su(H) chromosome region. PMID:10388820
2011-01-01
Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066
Uronen, Riikka-Liisa; Lundmark, Per; Orho-Melander, Marju; Jauhiainen, Matti; Larsson, Kristina; Siegbahn, Agneta; Wallentin, Lars; Zethelius, Björn; Melander, Olle; Syvänen, Ann-Christine; Ikonen, Elina
2010-08-01
To study how Niemann-Pick disease type C1 (NPC1) influences hepatic triacylglycerol (TG) metabolism and to determine whether this is reflected in circulating lipid levels. In Npc1(-/-) mice, the hepatic cholesterol content is increased but the TG content is decreased. We investigated lipid metabolism in Npc1(-/-) mouse hepatocytes and the association of NPC1 single-nucleotide polymorphisms with circulating TGs in humans. TGs were reduced in Npc1(-/-) mouse serum and hepatocytes. In Npc1(-/-) hepatocytes, the incorporation of [3H]oleic acid and [3H]acetate into TG was decreased, but shunting of oleic acid- or acetate-derived [3H]carbons into cholesterol was increased. Inhibition of cholesterol synthesis normalized TG synthesis, content, and secretion in Npc1(-/-) hepatocytes, suggesting increased hepatic cholesterol neogenesis as a cause for the reduced TG content and secretion. We found a significant association between serum TG levels and 5 common NPC1 single-nucleotide polymorphisms in a cohort of 1053 men, with the lowest P=8.7 x 10(-4) for the single-nucleotide polymorphism rs1429934. The association between the rs1429934 A allele and higher TG levels was replicated in 2 additional cohorts, which included 8041 individuals. This study provides evidence of the following: (1) in mice, loss of NPC1 function reduces hepatocyte TG content and secretion by increasing the metabolic flux of carbons into cholesterol synthesis; and (2) common variation in NPC1 contributes to serum TG levels in humans.
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Developing 100K Affymetrix Axiom SNP Array for Polyploid Sugarcane
USDA-ARS?s Scientific Manuscript database
Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genomes. With the advance of next generation sequencing (NGS) technologies, ...
Variation in the γ-glutamyltransferase 1 gene and risk of chronic pancreatitis.
Brand, Harrison; Diergaarde, Brenda; O'Connell, Michael R; Whitcomb, David C; Brand, Randall E
2013-07-01
Individuals with chronic pancreatitis are at increased risk for pancreatic cancer. We hypothesized that genetic variation in the γ-glutamyltransferase 1 (GGT1) gene, which was recently reported associated with pancreatic cancer risk in a genome-wide association study, is also associated with risk of chronic pancreatitis. Associations between common polymorphisms in GGT1 and chronic pancreatitis were evaluated using data and samples from the North American Pancreatitis Study 2. Patients (n = 496) and control subjects (n = 465) were genotyped for 4 single-nucleotide polymorphisms: rs4820599, rs2017869, rs8135987, and rs5751901. Odds ratios (ORs) and corresponding 95% confidence intervals (95% CI) for chronic pancreatitis risk were calculated using multiple logistic regression models. Interactions with cigarette smoking and alcohol use were explored. Single-nucleotide polymorphisms rs8135987 and rs4820599 were both statistically significantly associated with risk of chronic pancreatitis; compared with common allele homozygotes, individuals with at least 1 minor allele were at increased risk (rs8135987: OR, 1.36; 95% CI, 1.03-1.80 [P(trend) = 0.01]; rs4820599: OR, 1.39; 95% CI, 1.04-1.84 [P(trend) = 0.0]; adjusted for age, sex, race, smoking status, and alcohol use). No significant interactions with cigarette smoking and alcohol use were observed. Our results suggest that common variation in the GGT1 gene may also affect risk of chronic pancreatitis.
Rapid evolution of avirulence genes in rice blast fungus Magnaporthe oryzae
2014-01-01
Background Rice blast fungus Magnaporthe oryzae is one of the most devastating pathogens in rice. Avirulence genes in this fungus share a gene-for-gene relationship with the resistance genes in its host rice. Although numerous studies have shown that rice blast R-genes are extremely diverse and evolve rapidly in their host populations, little is known about the evolutionary patterns of the Avr-genes in the pathogens. Results Here, six well-characterized Avr-genes and seven randomly selected non-Avr control genes were used to investigate the genetic variations in 62 rice blast strains from different parts of China. Frequent presence/absence polymorphisms, high levels of nucleotide variation (~10-fold higher than non-Avr genes), high non-synonymous to synonymous substitution ratios, and frequent shared non-synonymous substitution were observed in the Avr-genes of these diversified blast strains. In addition, most Avr-genes are closely associated with diverse repeated sequences, which may partially explain the frequent presence/absence polymorphisms in Avr-genes. Conclusion The frequent deletion and gain of Avr-genes and rapid non-synonymous variations might be the primary mechanisms underlying rapid adaptive evolution of pathogens toward virulence to their host plants, and these features can be used as the indicators for identifying additional Avr-genes. The high number of nucleotide polymorphisms among Avr-gene alleles could also be used to distinguish genetic groups among different strains. PMID:24725999
Ibeagha-Awemu, Eveline M.; Kgwatalala, Patrick; Ibeagha, Aloysius E.
2008-01-01
Genetic variations through their effects on gene expression and protein function underlie disease susceptibility in farm animal species. The variations are in the form of single nucleotide polymorphisms, deletions/insertions of nucleotides or whole genes, gene or whole chromosomal rearrangements, gene duplications, and copy number polymorphisms or variants. They exert varying degrees of effects on gene action, such as substitution of an amino acid for another, shift in reading frame and premature termination of translation, and complete deletion of entire exon(s) or gene(s) in diseased individuals. These factors influence gene function by affecting mRNA splicing pattern or by altering/eliminating protein function. Elucidating the genetic bases of diseases under the control of many genes is very challenging, and it is compounded by several factors, including host × pathogen × environment interactions. In this review, the genetic variations that underlie several diseases of livestock (under monogenic and polygenic control) are analyzed. Also, factors hampering research efforts toward identification of genetic influences on animal disease identification and control are highlighted. A better understanding of the factors analyzed could be better harnessed to effectively identify and control, genetically, livestock diseases. Finally, genetic control of animal diseases can reduce the costs associated with diseases, improve animal welfare, and provide healthy animal products to consumers, and should be given more attention. PMID:18350334
The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.
Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W
2017-01-01
The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.
Consolandi, Clarissa
2009-01-01
One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.
Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.
Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima
2017-10-16
Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Fournier-Level, Alexandre; Le Cunff, Loïc; Gomez, Camila; Doligez, Agnès; Ageorges, Agnès; Roux, Catherine; Bertrand, Yves; Souquet, Jean-Marc; Cheynier, Véronique; This, Patrice
2009-11-01
The combination of QTL mapping studies of synthetic lines and association mapping studies of natural diversity represents an opportunity to throw light on the genetically based variation of quantitative traits. With the positional information provided through quantitative trait locus (QTL) mapping, which often leads to wide intervals encompassing numerous genes, it is now feasible to directly target candidate genes that are likely to be responsible for the observed variation in completely sequenced genomes and to test their effects through association genetics. This approach was performed in grape, a newly sequenced genome, to decipher the genetic architecture of anthocyanin content. Grapes may be either white or colored, ranging from the lightest pink to the darkest purple tones according to the amount of anthocyanin accumulated in the berry skin, which is a crucial trait for both wine quality and human nutrition. Although the determinism of the white phenotype has been fully identified, the genetic bases of the quantitative variation of anthocyanin content in berry skin remain unclear. A single QTL responsible for up to 62% of the variation in the anthocyanin content was mapped on a Syrah x Grenache F(1) pseudo-testcross. Among the 68 unigenes identified in the grape genome within the QTL interval, a cluster of four Myb-type genes was selected on the basis of physiological evidence (VvMybA1, VvMybA2, VvMybA3, and VvMybA4). From a core collection of natural resources (141 individuals), 32 polymorphisms revealed significant association, and extended linkage disequilibrium was observed. Using a multivariate regression method, we demonstrated that five polymorphisms in VvMybA genes except VvMybA4 (one retrotransposon, three single nucleotide polymorphisms and one 2-bp insertion/deletion) accounted for 84% of the observed variation. All these polymorphisms led to either structural changes in the MYB proteins or differences in the VvMybAs promoters. We concluded that the continuous variation in anthocyanin content in grape was explained mainly by a single gene cluster of three VvMybA genes. The use of natural diversity helped to reduce one QTL to a set of five quantitative trait nucleotides and gave a clear picture of how isogenes combined their effects to shape grape color. Such analysis also illustrates how isogenes combine their effect to shape a complex quantitative trait and enables the definition of markers directly targeted for upcoming breeding programs.
Translational genomics for analysis of complex traits in peanut and sorghum
USDA-ARS?s Scientific Manuscript database
The integration of sequencing and genotype data from natural variation studies (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) facilitated the development of DNA markers in the form of single nucleotide polymorphic (SNP)...
Development and utilization of 100K SNP array in Saccharum Spp.
USDA-ARS?s Scientific Manuscript database
Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genome. With the advance of next generation sequencing (NGS) technologies, m...
Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas
2014-07-01
Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli
2015-01-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive–compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples. PMID:20155310
Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli
2010-09-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.
USDA-ARS?s Scientific Manuscript database
Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...
Genome wide association analysis for seedling response traits to thermal stress in sorghum germplasm
USDA-ARS?s Scientific Manuscript database
The sorghum association panel exhibited extensive variation for seedling traits under cold and heat stress. Genome-wide analyses identified thirty single nucleotide polymorphisms (SNPs) that were strongly associated with traits measured at seedling stage under cold stress and tagged genes that act a...
Partial-genome evaluation of postweaning feed intake and efficiency of crossbred beef cattle
USDA-ARS?s Scientific Manuscript database
Effects of individual single nucleotide polymorphisms (SNP), and variation explained by sets of SNP associated with dry matter intake (DMI), metabolic mid-test weight (MBW), BW gain (GN) and feed efficiency expressed as phenotypic and genetic residual feed intake (RFIp; RFIg) were estimated from wei...
Walthour, C. S.; Schaeffer, S. W.
1994-01-01
The transformer locus (tra) produces an RNA processing protein that alternatively splices the doublesex pre-mRNA in the sex determination hierarchy of Drosophila melanogaster. Comparisons of the tra coding region among Drosophila species have revealed an unusually high degree of divergence in synonymous and nonsynonymous sites. In this study, we tested the hypothesis that the tra gene will be polymorphic in synonymous and nonsynonymous sites within species by investigating nucleotide sequence variation in eleven tra alleles within D. melanogaster. Of the 1063 nucleotides examined, two synonymous sites were polymorphic and no amino acid variation was detected. Three statistical tests were used to detect departures from an equilibrium neutral model. Two tests failed to reject a neutral model of molecular evolution because of low statisitical power associated with low levels of genetic variation (Tajima/Fu and Li). The Hudson, Kreitman, and Aguade test rejected a neutral model when the tra region was compared to the 5'-flanking region of alcohol dehydrogenase (Adh). The lack of variability in the tra gene is consistent with a recent selective sweep of a beneficial allele in or near the tra locus. PMID:8013913
Willing, Eva-Maria; Bentzen, Paul; van Oosterhout, Cock; Hoffmann, Margarete; Cable, Joanne; Breden, Felix; Weigel, Detlef; Dreyer, Christine
2010-03-01
Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise F(ST) values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. F(ST) outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations.
Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King
2011-01-01
Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743
Ozkan, Z S; Deveci, D; Onalan Etem, E; Yüce, H
2010-11-30
We investigated the effect of bone morphogenetic protein 2 and 4 (BMP-2 and -4) gene polymorphisms on bone density in postmenopausal Turkish women with osteoporosis. The frequency of single-nucleotide polymorphisms (SNPs) of BMP-2 and -4 genes was analyzed in 101 osteoporotic-postmenopausal women and 52 postmenopausal women with positive bone mineral density scores. We evaluated the frequency of the thymine→cytosine nucleotide variation at position 538 for BMP-4 and the transposition of adenine→thymine at codon 190 for BMP-2, with PCR. The proportions of genotypes observed for the BMP-2 SNP in the osteoporotic group were AA (47.5%), AT (39.6%), TT (12.9%), and in the non-osteoporotic group they were AA (48.1%), AT (40.4%), TT (11.5%). The corresponding frequencies for the BMP-4 SNP in the osteoporotic group were TT (30.7%), TC (45.5%), CC (23.8%), and in the non-osteoporotic group they were TT (26.9%), TC (40.4%), CC (32.7%). There were no significant differences in the frequencies of these genotypes between the patient and control groups. We conclude that genetic variations in BMP-2 and -4 do not substantially contribute to lumbar spine bone mineral density in postmenopausal Turkish women.
USDA-ARS?s Scientific Manuscript database
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...
Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J
2018-03-01
Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.
Functional analysis of regulatory single-nucleotide polymorphisms.
Pampín, Sandra; Rodríguez-Rey, José C
2007-04-01
The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.
Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar
2018-06-01
Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.
Hawwa, Ahmed F; Millership, Jeff S; Collier, Paul S; Vandenbroeck, Koen; McCarthy, Anthony; Dempsey, Sid; Cairns, Carole; Collins, John; Rodgers, Colin; McElnay, James C
2008-01-01
AIMS To examine the allelic variation of three enzymes involved in 6-mercaptopurine/azathioprine (6-MP/AZA) metabolism and evaluate the influence of these polymorphisms on toxicity, haematological parameters and metabolite levels in patients with acute lymphoblastic leukaemia (ALL) or inflammatory bowel disease (IBD). METHODS Clinical data and blood samples were collected from 19 ALL paediatric patients and 35 IBD patients who were receiving 6-MP/AZA therapy. All patients were screened for seven genetic polymorphisms in three enzymes involved in mercaptopurine metabolism [xanthine oxidase, inosine triphosphatase (C94→A and IVS2+21A→C) and thiopurine methyltransferase]. Erythrocyte and plasma metabolite concentrations were also determined. The associations between the various genotypes and myelotoxicity, haematological parameters and metabolite concentrations were determined. RESULTS Thiopurine methyltransferase variant alleles were associated with a preferential metabolism away from 6-methylmercaptopurine nucleotides (P = 0.008 in ALL patients, P = 0.038 in IBD patients) favouring 6-thioguanine nucleotides (6-TGNs) (P = 0.021 in ALL patients). Interestingly, carriers of inosine triphosphatase IVS2+21A→C variants among ALL and IBD patients had significantly higher concentrations of the active cytotoxic metabolites, 6-TGNs (P = 0.008 in ALL patients, P = 0.047 in IBD patients). The study confirmed the association of thiopurine methyltransferaseheterozygosity with leucopenia and neutropenia in ALL patients and reported a significant association between inosine triphosphatase IVS2+21A→C variants with thrombocytopenia (P = 0.012). CONCLUSIONS Pharmacogenetic polymorphisms in the 6-MP pathway may help identify patients at risk for associated toxicities and may serve as a guide for dose individualization. WHAT IS ALREADY KNOWN ABOUT THIS SUBJECT6-Mercaptopurine (6-MP) and azathioprine (AZA) are both inactive prodrugs that require intracellular activation into the active 6-thioguanine nucleotides (6-TGNs).This metabolic process undergoes three different competitive pathways that are catalysed by three different enzymes; xanthine oxidase (XO), thiopurine methyltransferase (TPMT) and inosine triphosphatase (ITPA), all of which exhibit genetic polymorphisms.Although the impact of genetic variation in the TPMT gene on treatment outcome and toxicity has been demonstrated, the role of other polymorphisms remains less well known. WHAT THIS STUDY ADDS New information on the allelic variation of these three enzymes (XO, TPMT and ITPA) and their influence on 6-MP/AZA metabolism and toxicity.Confirmation of the association of TPMT polymorphism with haematological toxicity.Identified potential genetic characteristics that may contribute to higher risk of adverse events (such as ITPA IVS2+21A→C mutation). PMID:18662289
Genome Wide Scan for Loci influencing Warner Bratzler Shear Force in Five Bos taurus Breeds
USDA-ARS?s Scientific Manuscript database
Genetic tests for beef tenderness are currently limited to single nucleotide polymorphisms (SNPs) within µ-calpain (CAPN1) and calpastatin (CAST) and explain little of the phenotypic variation in Warner-Bratzler shear force (WBSF). We performed a genome-wide association study for WBSF by genotyping...
USDA-ARS?s Scientific Manuscript database
Background Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator–activated receptor gamma (PPARgamma) that is involve...
Association genetics in Pinus taeda L. I. wood property traits
Santiago C. Gonzalez-Martinez; Nicholas C. Wheeler; Elhan Ersoz; C. Dana Nelson; David B. Neale
2007-01-01
Genetic association is a powerful method for dissecting complex adaptive traits due to (i) fine-scale mapping resulting from historical recombination, (ii) wide coverage of phenotypic and genotypic variation within a single experiment, and (iii) the simultaneous discovery of loci and alleles. In this article, genetic association among single nucleotide polymorphisms (...
Personalized Medicine in a New Genomic Era: Ethical and Legal Aspects.
Shoaib, Maria; Rameez, Mansoor Ali Merchant; Hussain, Syed Ather; Madadin, Mohammed; Menezes, Ritesh G
2017-08-01
The genome of two completely unrelated individuals is quite similar apart from minor variations called single nucleotide polymorphisms which contribute to the uniqueness of each and every person. These single nucleotide polymorphisms are of great interest clinically as they are useful in figuring out the susceptibility of certain individuals to particular diseases and for recognizing varied responses to pharmacological interventions. This gives rise to the idea of 'personalized medicine' as an exciting new therapeutic science in this genomic era. Personalized medicine suggests a unique treatment strategy based on an individual's genetic make-up. Its key principles revolve around applied pharmaco-genomics, pharmaco-kinetics and pharmaco-proteomics. Herein, the ethical and legal aspects of personalized medicine in a new genomic era are briefly addressed. The ultimate goal is to comprehensively recognize all relevant forms of genetic variation in each individual and be able to interpret this information in a clinically meaningful manner within the ambit of ethical and legal considerations. The authors of this article firmly believe that personalized medicine has the potential to revolutionize the current landscape of medicine as it makes its way into clinical practice.
Genetic and epigenetic variation in the lineage specification of regulatory T cells
Arvey, Aaron; van der Veeken, Joris; Plitas, George; Rich, Stephen S; Concannon, Patrick; Rudensky, Alexander Y
2015-01-01
Regulatory T (Treg) cells, which suppress autoimmunity and other inflammatory states, are characterized by a distinct set of genetic elements controlling their gene expression. However, the extent of genetic and associated epigenetic variation in the Treg cell lineage and its possible relation to disease states in humans remain unknown. We explored evolutionary conservation of regulatory elements and natural human inter-individual epigenetic variation in Treg cells to identify the core transcriptional control program of lineage specification. Analysis of single nucleotide polymorphisms in core lineage-specific enhancers revealed disease associations, which were further corroborated by high-resolution genotyping to fine map causal polymorphisms in lineage-specific enhancers. Our findings suggest that a small set of regulatory elements specify the Treg lineage and that genetic variation in Treg cell-specific enhancers may alter Treg cell function contributing to polygenic disease. DOI: http://dx.doi.org/10.7554/eLife.07571.001 PMID:26510014
Xu, L; Shi, Y; Gu, J; Wang, Y; Wang, L; You, L; Qi, X; Ye, Y; Chen, Z
2014-03-01
To investigate the association between 2 single nucleotide polymorphisms (SNP501A/C and 604 G/A) in the promoter of the ghrelin gene and the hormonal and metabolic phenotypes of polycystic ovary syndrome (PCOS) in a Chinese population. 285 patients with PCOS and 260 healthy controls were selected for a prospective, case-control study at Shandong Provincial Hospital, Jinan, China. All subjects underwent genotype analysis of the 2 single nucleotide polymorphisms of the ghrelin gene. Measurements were also taken of blood lipids, glucose, and hormone levels, and calculations of body mass index (BMI) and waist-to-hip ratio (WHR) were performed to detect hormonal and metabolic phenotypes. No significant diff erences in polymorphism genotypes were found between PCOS patients and healthy controls. However, the frequency of the -501 A/C A allele was significantly higher in the PCOS group than in the control group. PCOS -501 A/C A carriers had significantly higher BMI and WHR than PCOS women with the CC genotype. -604 G/A polymorphisms were not associated with clinical or biochemical characteristics of PCOS. The -501 A/C polymorphism of the ghrelin gene is associated with metabolic features of PCOS in a Chinese population. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.
Footprints of ancient-balanced polymorphisms in genetic variation data from closely related species
Gao, Ziyue; Przeworski, Molly; Sella, Guy
2015-01-01
When long-lasting, balancing selection can lead to “trans-species” polymorphisms that are shared by two or more species identical by descent. In such cases, the gene genealogy at the selected site clusters by allele instead of by species, and nearby neutral sites also have unusual genealogies because of linkage. While this scenario is expected to leave discernible footprints in genetic variation data, the specific patterns remain poorly characterized. Motivated by recent findings in primates, we focus on the case of a biallelic polymorphism under ancient balancing selection and derive approximations for summaries of the polymorphism data from two species. Specifically, we characterize the length of the segment that carries most of the footprints, the expected number of shared neutral single nucleotide polymorphisms (SNPs), and the patterns of allelic associations among them. We confirm the accuracy of our approximations by coalescent simulations. We further show that for humans and chimpanzees—more generally, for pairs of species with low genetic diversity levels—these patterns are highly unlikely to be generated by neutral recurrent mutations. We discuss the implications for the design and interpretation of genome scans for ancient balanced polymorphisms in primates and other taxa. PMID:25403856
Inherited variations in the SOD and GPX gene families and cancer risk.
Yuzhalin, Arseniy E; Kutikhin, Anton G
2012-05-01
Antioxidant defence enzymes are essential protectors of living organisms against oxidative stress. These enzymes are involved in the detoxification and decomposition of harmful chemical compounds called reactive oxygen species (ROS), which are, first and foremost, a source of intracellular oxidative stress. ROS directly promote the oxidative damage of genes resulting in aberrant regulation of many vital cell processes. As a consequence, the presence of ROS can lead to genomic instability, deregulation of transcription, induction of mitogenic signal transduction pathways and replication errors, all of which may increase the risk of cancer development. Single nucleotide polymorphisms of antioxidant defence genes may significantly modify the functional activity of the encoded proteins; therefore, certain alleles can be established as risk factors for particular cancer types. In the future, these risk alleles may be utilized as genomic markers of cancer predisposition to allow for early prevention measures among carriers of these alleles. The review is devoted to common single nucleotide polymorphisms of the superoxide dismutase (SOD) and glutathione peroxidase (GPX) gene families and their impact on carcinogenesis. The predictive significance of several polymorphisms was determined, and these polymorphisms were recommended for further in-depth research.
Simple sequence repeats in Escherichia coli: abundance, distribution, composition, and polymorphism.
Gur-Arie, R; Cohen, C J; Eitan, Y; Shelef, L; Hallerman, E M; Kashi, Y
2000-01-01
Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.
Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron
2015-11-14
Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and strengthen the history of mango diversity.
Ichikawa, Shoji; Koller, Daniel L.; Curry, Leah R.; Lai, Dongbing; Xuei, Xiaoling; Edenberg, Howard J.; Hui, Siu L.; Peacock, Munro; Foroud, Tatiana; Econs, Michael J.
2010-01-01
Phenotypic variation in bone mineral density (BMD) among healthy adults is influenced by both genetic and environmental factors. Genetic sequence variations in the adenylate cyclase 10 (ADCY10) gene, which is also called soluble adenylate cyclase, have previously been reported to be associated with low spinal BMD in hypercalciuric patients. Since ADCY10 is located in the region linked to spinal BMD in our previous linkage analysis, we tested whether polymorphisms in this gene are also associated with normal BMD variation in healthy adults. Sixteen single nucleotide polymorphisms (SNPs) distributed throughout ADCY10 were genotyped in two healthy groups of American whites: 1,692 premenopausal women and 715 men. Statistical analyses were performed in the two groups to test for association between these SNPs and femoral neck and lumbar spine areal BMD. We observed significant evidence of association (p<0.01) with one SNP each in men and women. Genotypes at these SNPs accounted for less than 1% of hip BMD variation in men, but 1.5% of spinal BMD in women. However, adjacent SNPs did not corroborate the association in either males or females. In conclusion, we found a modest association between an ADCY10 polymorphism and spinal areal BMD in premenopausal white women. PMID:19093065
Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.
2016-01-01
The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325
Genetic Variation Linked to Lung Cancer Survival in White Smokers | Center for Cancer Research
CCR investigators have discovered evidence that links lung cancer survival with genetic variations (called single nucleotide polymorphisms) in the MBL2 gene, a key player in innate immunity. The variations in the gene, which codes for a protein called the mannose-binding lectin, occur in its promoter region, where the RNA polymerase molecule binds to start transcription, and in the first exon that is responsible for the correct structure of MBL. The findings appear in the September 19, 2007, issue of the Journal of the National Cancer Institute.
Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.
2012-01-01
Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573
Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P
2016-06-01
We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Structure and Temporal Dynamics of Populations within Wheat Streak Mosaic Virus Isolates
Hall, Jeffrey S.; French, Roy; Morris, T. Jack; Stenger, Drake C.
2001-01-01
Variation within the Type and Sidney 81 strains of wheat streak mosaic virus was assessed by single-strand conformation polymorphism (SSCP) analysis and confirmed by nucleotide sequencing. Limiting-dilution subisolates (LDSIs) of each strain were evaluated for polymorphism in the P1, P3, NIa, and CP cistrons. Different SSCP patterns among LDSIs of a strain were associated with single-nucleotide substitutions. Sidney 81 LDSI-S10 was used as founding inoculum to establish three lineages each in wheat, corn, and barley. The P1, HC-Pro, P3, CI, NIa, NIb, and CP cistrons of LDSI-S10 and each lineage at passages 1, 3, 6, and 9 were evaluated for polymorphism. By passage 9, each lineage differed in consensus sequence from LDSI-S10. The majority of substitutions occurred within NIa and CP, although at least one change occurred in each cistron except HC-Pro and P3. Most consensus sequence changes among lineages were independent, with substitutions accumulating over time. However, LDSI-S10 bore a variant nucleotide (G6016) in NIa that was restored to A6016 in eight of nine lineages by passage 6. This near-global reversion is most easily explained by selection. Examination of nonconsensus variation revealed a pool of unique substitutions (singletons) that remained constant in frequency during passage, regardless of the host species examined. These results suggest that mutations arising by viral polymerase error are generated at a constant rate but that most newly generated mutants are sequestered in virions and do not serve as replication templates. Thus, a substantial fraction of variation generated is static and has yet to be tested for relative fitness. In contrast, nonsingleton variation increased upon passage, suggesting that some mutants do serve as replication templates and may become established in a population. Replicated mutants may or may not rise to prominence to become the consensus sequence in a lineage, with the fate of any particular mutant subject to selection and stochastic processes such as genetic drift and population growth factors. PMID:11581391
Comparative genomics of the mimicry switch in Papilio dardanus.
Timmermans, Martijn J T N; Baxter, Simon W; Clark, Rebecca; Heckel, David G; Vogel, Heiko; Collins, Steve; Papanicolaou, Alexie; Fukova, Iva; Joron, Mathieu; Thompson, Martin J; Jiggins, Chris D; ffrench-Constant, Richard H; Vogler, Alfried P
2014-07-22
The African Mocker Swallowtail, Papilio dardanus, is a textbook example in evolutionary genetics. Classical breeding experiments have shown that wing pattern variation in this polymorphic Batesian mimic is determined by the polyallelic H locus that controls a set of distinct mimetic phenotypes. Using bacterial artificial chromosome (BAC) sequencing, recombination analyses and comparative genomics, we show that H co-segregates with an interval of less than 500 kb that is collinear with two other Lepidoptera genomes and contains 24 genes, including the transcription factor genes engrailed (en) and invected (inv). H is located in a region of conserved gene order, which argues against any role for genomic translocations in the evolution of a hypothesized multi-gene mimicry locus. Natural populations of P. dardanus show significant associations of specific morphs with single nucleotide polymorphisms (SNPs), centred on en. In addition, SNP variation in the H region reveals evidence of non-neutral molecular evolution in the en gene alone. We find evidence for a duplication potentially driving physical constraints on recombination in the lamborni morph. Absence of perfect linkage disequilibrium between different genes in the other morphs suggests that H is limited to nucleotide positions in the regulatory and coding regions of en. Our results therefore support the hypothesis that a single gene underlies wing pattern variation in P. dardanus.
Tatarenkov, Andrey; Ayala, Francisco J
2007-08-01
We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in strong positive association, whereas a large number of sites in the Raleigh population are associated nonrandomly but the association is not strong. Linkage disequilibrium analysis shows presence of two groups of haplotypes in the populations, each of which is fairly diverged, suggesting epistasis or inversion polymorphism. There is evidence of two forms of natural selection acting on Ddc. The McDonald-Kreitman test indicates a deficit of fixed amino acid differences between D. melanogaster and D. simulans, which may be due to negative selection. An excess of derived alleles at high frequency, significant according to the H-test, is consistent with the effect of hitchhiking. The hitchhiking may have been caused by directional selection downstream of the locus studied, as suggested by a gradual decrease of the polymorphism-to-divergence ratio. Altogether, the Ddc locus exhibits a complicated pattern of variation apparently due to several evolutionary forces. Such a complex pattern may be a result of an unusually high density of functionally important genes.
Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L
2015-05-01
Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-01-01
Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-05-05
Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.
ERIC Educational Resources Information Center
Greenwood, Pamela M.; Sundararajan, Ramya; Lin, Ming-Kuan; Kumar, Reshma; Fryxell, Karl J.; Parasuraman, Raja
2009-01-01
We investigated the relation between the two systems of visuospatial attention and working memory by examining the effect of normal variation in cholinergic and noradrenergic genes on working memory performance under attentional manipulation. We previously reported that working memory for location was impaired following large location precues,…
ERIC Educational Resources Information Center
McDonald, Nicole M.; Baker, Jason K.; Messinger, Daniel S.
2016-01-01
This longitudinal study investigated whether variation in the oxytocin receptor gene (OXTR) and early parent-child interactions predicted later empathic behavior in 84 toddlers at high or low familial risk for autism spectrum disorder. Two well-studied OXTR single-nucleotide polymorphisms, rs53576 and rs2254298, were examined. Parent-child…
USDA-ARS?s Scientific Manuscript database
Trichinella spiralis is a parasitic roundworm that infects domestic swine, rats and humans. Ingestion of infected pork by humans can lead to the potentially fatal disease trichinellosis. The phylogeny and historical dispersal of Trichinella spp. have been studied, in part, by sequencing portions of...
Inter- and intraspecific mitochondrial DNA variation in North American bears (Ursus)
Cronin, Matthew A.; Amstrup, Steven C.; Garner, Gerald W.; Vyse, Ernest R.
1991-01-01
We assessed mitochondrial DNA variation in North American black bears (Ursus americanus), brown bears (Ursus arctos), and polar bears (Ursus maritimus). Divergent mitochondrial DNA haplotypes (0.05 base substitutions per nucleotide) were identified in populations of black bears from Montana and Oregon. In contrast, very similar haplotypes occur in black bears across North America. This discordance of haplotype phylogeny and geographic distribution indicates that there has been maintenance of polymorphism and considerable gene flow throughout the history of the species. Intraspecific mitochondrial DNA sequence divergence in brown bears and polar bears is lower than in black bears. The two morphological forms of U. arctos, grizzly and coastal brown bears, are not in distinct mtDNA lineages. Interspecific comparisons indicate that brown bears and polar bears share similar mitochondrial DNA (0.023 base substitutions per nucleotide) which is quite divergent (0.078 base substitutions per nucleotide) from that of black bears. High mitochondrial DNA divergence within black bears and paraphyletic relationships of brown and polar bear mitochondrial DNA indicate that intraspecific variation across species' ranges should be considered in phylogenetic analyses of mitochondrial DNA.
BDNF Polymorphism Predicts General Intelligence after Penetrating Traumatic Brain Injury
Rostami, Elham; Krueger, Frank; Zoubak, Serguei; Dal Monte, Olga; Raymont, Vanessa; Pardini, Matteo; Hodgkinson, Colin A.; Goldman, David; Risling, Mårten; Grafman, Jordan
2011-01-01
Neuronal plasticity is a fundamental factor in cognitive outcome following traumatic brain injury. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, plays an important role in this process. While there are many ways to measure cognitive outcome, general cognitive intelligence is a strong predictor of everyday decision-making, occupational attainment, social mobility and job performance. Thus it is an excellent measure of cognitive outcome following traumatic brain injury (TBI). Although the importance of the single-nucleotide polymorphisms polymorphism on cognitive function has been previously addressed, its role in recovery of general intelligence following TBI is unknown. We genotyped male Caucasian Vietnam combat veterans with focal penetrating TBI (pTBI) (n = 109) and non-head injured controls (n = 38) for 7 BDNF single-nucleotide polymorphisms. Subjects were administrated the Armed Forces Qualification Test (AFQT) at three different time periods: pre-injury on induction into the military, Phase II (10–15 years post-injury, and Phase III (30–35 years post-injury). Two single-nucleotide polymorphisms, rs7124442 and rs1519480, were significantly associated with post-injury recovery of general cognitive intelligence with the most pronounced effect at the Phase II time point, indicating lesion-induced plasticity. The genotypes accounted for 5% of the variance of the AFQT scores, independently of other significant predictors such as pre-injury intelligence and percentage of brain volume loss. These data indicate that genetic variations in BDNF play a significant role in lesion-induced recovery following pTBI. Identifying the underlying mechanism of this brain-derived neurotrophic factor effect could provide insight into an important aspect of post-traumatic cognitive recovery. PMID:22087305
Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E
2014-07-01
The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated.
Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop.
Hazzouri, Khaled M; Flowers, Jonathan M; Visser, Hendrik J; Khierallah, Hussam S M; Rosas, Ulises; Pham, Gina M; Meyer, Rachel S; Johansen, Caryn K; Fresquez, Zoë A; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A; Thirkhill, Deborah; Markhand, Ghulam S; Krueger, Robert R; Zaid, Abdelouahhab; Purugganan, Michael D
2015-11-09
Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop.
Genetic Alterations Affecting Cholesterol Metabolism and Human Fertility1
DeAngelis, Anthony M.; Roy-O'Reilly, Meaghan; Rodriguez, Annabelle
2014-01-01
ABSTRACT Single nucleotide polymorphisms (SNPs) represent genetic variations among individuals in a population. In medicine, these small variations in the DNA sequence may significantly impact an individual's response to certain drugs or influence the risk of developing certain diseases. In the field of reproductive medicine, a significant amount of research has been devoted to identifying polymorphisms which may impact steroidogenesis and fertility. This review discusses current understanding of the effects of genetic variations in cholesterol metabolic pathways on human fertility that bridge novel linkages between cholesterol metabolism and reproductive health. For example, the role of the low-density lipoprotein receptor (LDLR) in cellular metabolism and human reproduction has been well studied, whereas there is now an emerging body of research on the role of the high-density lipoprotein (HDL) receptor scavenger receptor class B type I (SR-BI) in human lipid metabolism and female reproduction. Identifying and understanding how polymorphisms in the SCARB1 gene or other genes related to lipid metabolism impact human physiology is essential and will play a major role in the development of personalized medicine for improved diagnosis and treatment of infertility. PMID:25122065
Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop
Hazzouri, Khaled M.; Flowers, Jonathan M.; Visser, Hendrik J.; Khierallah, Hussam S. M.; Rosas, Ulises; Pham, Gina M.; Meyer, Rachel S.; Johansen, Caryn K.; Fresquez, Zoë A.; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A.; Thirkhill, Deborah; Markhand, Ghulam S.; Krueger, Robert R.; Zaid, Abdelouahhab; Purugganan, Michael D.
2015-01-01
Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop. PMID:26549859
Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen
2017-04-01
In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsugu, H.; Horowitz, R.; Gibson, N.
1994-12-01
Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less
One novel SNP of growth hormone gene and its associations with growth and carcass traits in ducks.
Wu, Y; Pan, A L; Pi, J S; Pu, Y J; Du, J P; Liang, Z H; Shen, J
2012-08-01
In this study, the growth hormone (GH) gene was studied as a candidate gene for growth and carcass traits of three duck populations (Cherry Valley duck, Muscovy duck and Jingjiang duck). Three pairs of primers were designed to detect single nucleotide polymorphisms of introns 2, 3 and 4 of the GH gene by polymerase chain reaction-restriction fragment length polymorphism and sequencing methods. Only the products amplified from intron 2 displayed polymorphism. The results showed one novel polymorphism: a variation in intron 2 of GH gene (C172T, JN408701 and JN408702). It was associated with some growth and carcass traits in three duck populations including birth weight, 8-week weight, carcass weight, breast muscle weight, leg muscle weight, eviscerated weight, lean meat rate, dressing percentage, etc. And the TT and CT genotypes were associated with superior growth and carcass traits in carcass weight, dressing percentage and percentage of eviscerated weight. Therefore, the variation in intron 2 of GH may be a molecular marker for superior growth and carcass traits in above duck populations.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
SLC11A1 polymorphisms and host susceptibility to cutaneous leishmaniasis in Pakistan.
Sophie, Mariam; Hameed, Abdul; Muneer, Akhtar; Samdani, Azam J; Saleem, Saima; Azhar, Abid
2017-01-07
The vector-borne cutaneous leishmaniasis (CL) is endemic in several regions of Pakistan mainly affecting poor populations. Host genetic factors, particularly SLC11A1 (solute carrier transmembrane protein) within macrophages, play a crucial role in disease pathology and susceptibility. Association of SLC11A1 with cutaneous leishmaniasis, a neglected tropical disease, is not well established. Inconsistencies have been observed within different populations worldwide with respect to genetic susceptibility. This study was designed to investigate genetic variation(s) in SLC11A1 and to assess possible association with cutaneous leishmaniasis in Pakistan. Eight polymorphisms (rs2276631, rs3731864, rs2290708, rs2695342, rs201565523, rs17215556, rs17235409, rs17235416) were genotyped across SLC11A1 in 274 patients and 119 healthy controls. Six polymorphisms were studied by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing. Two single nucleotide polymorphisms were analyzed with newly designed semi-nested PCR assays. Case-control analysis showed no association between selected polymorphisms in SLC11A1 and cutaneous leishmaniasis. No significant difference was observed in the distribution of alleles between leishmaniasis patients and healthy individuals. Strong pairwise linkage disequilibrium was observed between rs2276631 and rs2290708 (r 2 = 64); and rs17235409 and rs17235416 (r 2 = 78). This study shows that genetic variations in the candidate gene SLC11A1 do not affect susceptibility to cutaneous leishmaniasis in the sample population from Pakistan.
Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H
2006-04-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.
Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.
2006-01-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031
Landscape of Insertion Polymorphisms in the Human Genome
Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.
2015-01-01
Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018
Sun, Zichen; Stack, Colin; Šlapeta, Jan
2012-05-25
In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.
Rutkowski, Melanie R; Conejo-Garcia, Jose R
2015-08-01
We have reported that TLR5-mediated recognition of commensal microbiota modulates systemic tumor-promoting inflammation and malignant progression of tumors at distal locations. Approximately 7-10% of the general population harbors a deleterious single nucleotide polymorphism in TLR5, implicating a novel role for genetic variation during the initiation and progression of cancer.
USDA-ARS?s Scientific Manuscript database
A single missense mutation at position 159 of COQ9 (GàA) has been associated with genetic variation in fertility in Holstein cattle, with the A allele associated with higher fertility. COQ9 is involved in the synthesis of coenzyme COQ10, a component of the electron transport system of the mitochondr...
USDA-ARS?s Scientific Manuscript database
The objectives of this study were to evaluate the effect of 68 SNP previously associated with genetic merit for fertility and production on phenotype for reproductive and productive traits in a population of Holstein cows. In addition, we determined which SNP had repeated effects across three studie...
USDA-ARS?s Scientific Manuscript database
Favorable associations between magnesium intake and glycemic traits, such as fasting glucose and insulin, are observed in observational and clinical studies, but whether genetic variation affects these associations is largely unknown. We hypothesized that single nucleotide polymorphisms (SNPs) assoc...
Impact of vitamin D receptor gene polymorphisms in pathogenesis of Type-1 diabetes mellitus
Kamel, Mahmoud M; Fouad, Shawky A; Salaheldin, Omina; El-Razek, Abd El-Rahman A Abd; El-Fatah, Abeer I Abd
2014-01-01
Background: Type 1 diabetes mellitus (TIDM) results from an immune-mediated destruction of insulin-producing-cells in the pancreatic islets of Langerhans. There are clear differences in immunogenetic predisposition to type1 diabetes among countries. Studies have indicated that vitamin D supplementation in early childhood decreases the risk of TIDM. Vitamin D exerts its action via the nuclear vitamin D receptor (VDR), which shows an extensive polymorphism. VDR gene polymorphisms have been associated with altered gene expression or gene function. Four single nucleotide polymorphisms (SNPs) in the VDR gene produce variation in four recognition sites. These recognition sites variants include Fok I, Bsm I, Apa I and Taq I. Aim of the study: TO investigate the relationship between VDR gene polymorphisms (at positions Taq I and Apa I) and the incidence of TIDM in Egyptian peoples. Subjects and methods: This study included 74 patients with type 1 DM in addition to 28 healthy age and sex matched control subjects. All of them were subjected to full history taking and clinical examination. Three ml of venous blood were withdrawn from each patient at fasting and postprandial times and used for genomic DNA extraction, estimation of Hb A1C, as well as, fasting and postprandial C-peptide and blood glucose levels. Results: Apa I recognition site was found in low frequency in diabetic patients (14/74) 18.9% while, its frequency was high (16/28) 57.1% among normal subjects. Taq I has two recognition sites. The first was found at nucleotide number 293 that was found in a frequency of (2/28) 7.1% in normal non-diabetic individuals while it was detected in (14/74) 18.9% in diabetic patients. The second Taq I recognition site was found at nucleotide number 494 without any differences between diabetic and normal individuals. Conclusion: This study indicates that there is an association between VDR genetic polymorphism and incidence of TIDM in Egyptian patients. PMID:25664062
Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
NASA Astrophysics Data System (ADS)
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek
2005-02-01
Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.
Normal Genetic Variation, Cognition, and Aging
Greenwood, P. M.; Parasuraman, Raja
2005-01-01
This article reviews the modulation of cognitive function by normal genetic variation. Although the heritability of “g” is well established, the genes that modulate specific cognitive functions are largely unidentified. Application of the allelic association approach to individual differences in cognition has begun to reveal the effects of single nucleotide polymorphisms on specific and general cognitive functions. This article proposes a framework for relating genotype to cognitive phenotype by considering the effect of genetic variation on the protein product of specific genes within the context of the neural basis of particular cognitive domains. Specificity of effects is considered, from genes controlling part of one receptor type to genes controlling agents of neuronal repair, and evidence is reviewed of cognitive modulation by polymorphisms in dopaminergic and cholinergic receptor genes, dopaminergic enzyme genes, and neurotrophic genes. Although allelic variation in certain genes can be reliably linked to cognition—specifically to components of attention, working memory, and executive function in healthy adults—the specificity, generality, and replicability of the effects are not fully known. PMID:15006290
Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q
2010-11-01
Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.
Genetic variation of the porcine NR5A1 is associated with meat color.
Görres, Andreas; Ponsuksili, Siriluck; Wimmers, Klaus; Muráni, Eduard
2016-02-01
Because of the central role of Steroidogenic factor 1 in the regulation of the development and function of steroidogenic tissues, including the adrenal gland, we chose the encoding gene NR5A1 as a candidate for stress response, meat quality and carcass composition in the domestic pig. To identify polymorphisms of the porcine NR5A1 we comparatively sequenced the coding, untranslated and regulatory regions in four commercial pig lines. Single nucleotide polymorphisms could be found in the 3' UTR and in an intronic enhancer, whereas no polymorphisms were detected in the proximal promoter and coding region. A subset of the detected polymorphisms was genotyped in Piétrain x (German Large White x German Landrace) and German Landrace pigs. For the same animals, carcass composition traits, meat quality characteristics and parameters of adrenal function were recorded. Associations with meat color were found for two of the discovered SNPs in Piétrain x (German Large White x German Landrace) and German Landrace pigs but no connections to parameters of adrenal function could be established. We conclude that NR5A1 variations influence meat color in a hypothalamus-pituitary-adrenal axis independent manner and that further regulatory regions need to be analyzed for genetic variations to understand the discovered effects.
Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A
2018-01-30
Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Hansen, John A; Chien, Jason W; Warren, Edus H; Zhao, Lue Ping; Martin, Paul J
2011-01-01
Purpose of review To explore what is known about the genetics of hematopoietic stem cell transplantation (HCT) and how genetic polymorphism affects risk of graft-versus-host disease (GVHD) and mortality. Recent findings Genetic variation found across the human genome can impact HCT outcome by 1) causing genetic disparity between patient and donor, and 2) modifying gene function. Single nucleotide polymorphisms (SNP) and structural variation can result in mismatching for cellular peptides known as histocompatibility antigens (HA). At least 25 to 30 polymorphic genes are known to encode functional HA in mismatched individuals, but their individual contribution to clinical GVHD is unclear. HCT outcome may also be affected by polymorphism in donor or recipient. Association studies have implicated several genes with GVHD and mortality, however results have been inconsistent most likely due to limited sample size, and differences in racial diversity and clinical covariates. New technologies using DNA arrays genotyping for a million or more SNPs promise genome-wide discovery of HCT associated genes, however adequate statistical power requires study populations of several thousand patient-donor pairs. Summary Available data offers strong preliminary support for the impact that genetic variation has on risk of GVHD and mortality following HCT. Definitive results however await future genome-wide studies of large multi-center HCT cohorts. PMID:20827186
Irwin, Judith A; Soumpourou, Eleni; Lister, Clare; Ligthart, Jan-Dick; Kennedy, Sue; Dean, Caroline
2016-09-01
Variation in flowering time and response to overwintering has been exploited to breed brassica vegetables that can be harvested year-round. Our knowledge of flowering time control now enables the investigation of the molecular basis of this important variation. Here, we show that a major determinant of heading date variation in Brassica oleracea is from variation in vernalization response through allelic variation at FLOWERING LOCUS C.C2 (BoFLC4). We characterize two alleles of BoFLC.C2 that are both functional and confer a requirement for vernalization, but they show distinct expression dynamics in response to cold. Complementation experiments in Arabidopsis thaliana revealed that the allelic variation results from cis polymorphism at BoFLC.C2, which quantitatively influences the degree of cold-induced epigenetic silencing. This results in one allelic variant conferring consistently later heading under both glasshouse and field conditions through reduced environmental sensitivity. Our results suggest that breeding of brassica varieties for commercially valuable variation in heading date has been achieved through the selection of cis polymorphism at FLC, similar to that underpinning natural variation in A. thaliana. This understanding will allow for the selection of alleles with distinct sensitivities to cold and robust heading dates under variable climatic conditions, and will facilitate the breeding of varieties more resistant to climate change. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.
Impact of genomic polymorphisms on the repertoire of human MHC class I-associated peptides
Granados, Diana Paola; Sriranganadane, Dev; Daouda, Tariq; Zieger, Antoine; Laumont, Céline M.; Caron-Lizotte, Olivier; Boucher, Geneviève; Hardy, Marie-Pierre; Gendron, Patrick; Côté, Caroline; Lemieux, Sébastien; Thibault, Pierre; Perreault, Claude
2014-01-01
For decades, the global impact of genomic polymorphisms on the repertoire of peptides presented by major histocompatibility complex (MHC) has remained a matter of speculation. Here we present a novel approach that enables high-throughput discovery of polymorphic MHC class I-associated peptides (MIPs), which play a major role in allorecognition. On the basis of comprehensive analyses of the genomic landscape of MIPs eluted from B lymphoblasts of two MHC-identical siblings, we show that 0.5% of non-synonymous single nucleotide variations are represented in the MIP repertoire. The 34 polymorphic MIPs found in our subjects are encoded by bi-allelic loci with dominant and recessive alleles. Our analyses show that, at the population level, 12% of the MIP-coding exome is polymorphic. Our method provides fundamental insights into the relationship between the genomic self and the immune self and accelerates the discovery of polymorphic MIPs (also known as minor histocompatibility antigens). PMID:24714562
Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia
2017-08-01
Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.
Bhattacharjee, Bornali; Sengupta, Sharmila
2006-02-01
We evaluated the status of the HPV16 E2 gene (disrupted or intact), nucleotide sequence alterations within intact E2 genes and LCR of HPV16 isolates in a group of CaCx cases (invasive squamous cell carcinomas, n = 81) and population controls (normal cervical scrapes, n = 27) from Indian women. E2 disruption was detected by amplifying the entire E2 gene with single set of primers, while overlapping primers were used to determine if any particular region got selectively disrupted. Nucleotide variations in E2 and LCR were analyzed by PCR amplification followed by bi-directional sequencing. The associations between the viral factors and CaCx were analyzed using Fisher's Exact or Chi-squared test and interpreted as OR (95% CI) and P values. E2 disruption was significantly higher among the cases [3.38 (1.07-10.72); P = 0.02], which was maximum in the region between nucleotides 3650 and 3872 (DNA-binding region). The European (E) variant was found to be the prevalent subgroup (87.76% among cases and 96.30% among the controls), and the remaining samples were Asian-American variants. Among the E subgroup, variation at position 7450 (T > C) within the E2-binding site-IV was found to be significantly higher among the E2 undisrupted cases (21/37; 56.76%), compared to controls (5/18; 27.78%) [3.41 (1.01-11.55); P = 0.03]. Besides HPV16 E2 disruption, LCR 7450T > C variation within undisrupted E2 of E subgroup appears to be a major factor contributing to the risk of CaCx development in Indian women. Furthermore, polymorphisms in the E2 gene of HPV16 may not be significant for disease risk.
Wu, Lei; He, Yao; Zhang, Di
2015-11-01
To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.
CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.
Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru
2015-11-01
Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.
Wang, Baosheng; Khalili Mahani, Marjan; Ng, Wei Lun; Kusumi, Junko; Phi, Hai Hong; Inomata, Nobuyuki; Wang, Xiao-Ru; Szmidt, Alfred E
2014-01-01
Pinus krempfii Lecomte is a morphologically and ecologically unique pine, endemic to Vietnam. It is regarded as vulnerable species with distribution limited to just two provinces: Khanh Hoa and Lam Dong. Although a few phylogenetic studies have included this species, almost nothing is known about its genetic features. In particular, there are no studies addressing the levels and patterns of genetic variation in natural populations of P. krempfii. In this study, we sampled 57 individuals from six natural populations of P. krempfii and analyzed their sequence variation in ten nuclear gene regions (approximately 9 kb) and 14 mitochondrial (mt) DNA regions (approximately 10 kb). We also analyzed variation at seven chloroplast (cp) microsatellite (SSR) loci. We found very low haplotype and nucleotide diversity at nuclear loci compared with other pine species. Furthermore, all investigated populations were monomorphic across all mitochondrial DNA (mtDNA) regions included in our study, which are polymorphic in other pine species. Population differentiation at nuclear loci was low (5.2%) but significant. However, structure analysis of nuclear loci did not detect genetically differentiated groups of populations. Approximate Bayesian computation (ABC) using nuclear sequence data and mismatch distribution analysis for cpSSR loci suggested recent expansion of the species. The implications of these findings for the management and conservation of P. krempfii genetic resources were discussed. PMID:25360263
Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard
2014-01-01
High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323
Rexrode, Kathryn M; Ridker, Paul M; Hegener, Hillary H; Buring, Julie E; Manson, JoAnn E; Zee, Robert Y L
2008-05-01
Androgen receptors (AR) are expressed in endothelial cells and vascular smooth-muscle cells. Some studies suggest an association between AR gene variation and risk of cardiovascular disease (CVD) in men; however, the relationship has not been examined in women. Six haplotype block-tagging single nucleotide polymorphisms (rs962458, rs6152, rs1204038, rs2361634, rs1337080, rs1337082), as well as the cysteine, adenine, guanine (CAG) microsatellite in exon 1, of the AR gene were evaluated among 300 white postmenopausal women who developed CVD (158 myocardial infarctions and 142 ischemic strokes) and an equal number of matched controls within the Women's Health Study. Genotype distributions were similar between cases and controls, and genotypes were not significantly related to risk of CVD, myocardial infarctions or ischemic stroke in conditional logistic regression models. Seven common haplotypes were observed, but distributions did not differ between cases and controls nor were significant associations observed in logistic regression analysis. The median CAG repeat length was 21. In conditional logistic regression, there was no association between the number of alleles with CAG repeat length >or=21 (or >or=22) and risk of CVD, myocardial infarctions or ischemic stroke. No association between AR genetic variation, as measured by haplotype-tagging single nucleotide polymorphisms and CAG repeat number, and risk of CVD was observed in women.
Kino, Tomoshige
2018-05-11
The human genome contains numerous single nucleotide variations (SNVs), and the human GR gene harbors ∼450 of these genetic changes. Among them, extremely rare non-synonymous variants known as pathologic GR gene mutations develop a characteristic pathologic condition, familial/sporadic generalized glucocorticoid resistance syndrome, by replacing the amino acids critical for GR protein structure and functions, whereas others known as pathologic polymorphisms develop mild manifestations recognized mainly at population bases by changing the GR activities slightly. Recent progress on the structural analysis to the GR protein and subsequent computer-based structural simulation revealed details of the molecular defects caused by such pathologic GR gene mutations, including their impact on the receptor interaction to ligands, nuclear receptor coactivators (NCoAs) or DNA glucocorticoid response elements (GREs). Indeed, those found in the GR ligand-binding domain significantly damage protein structure of the ligand-binding pocket and/or the activation function-2 transactivation domain and change their molecular interaction to glucocorticoids or the LxxLL signature motif of NCoAs. Two mutations found in GR DBD also affect interaction of the mutant receptors to GRE DNA by affecting the critical amino acid for the interaction or changing local hydrophobic circumstance. In this review, we discuss recent findings on the structural simulation of the pathologic GR mutants in connection to their functional and clinical impacts along with brief explanation to recent research achievement on the GR polymorphisms.
Hong, Y. P.; Hipkins, V. D.; Strauss, S. H.
1993-01-01
The amount, distribution and mutational nature of chloroplast DNA polymorphisms were studied via analysis of restriction fragment length polymorphisms in three closely related species of conifers, the California closed-cone pines-knobcone pine: Pinus attenuata Lemm.; bishop pine: Pinus muricata D. Don; and Monterey pine: Pinus radiata D. Don. Genomic DNA from 384 trees representing 19 populations were digested with 9-20 restriction enzymes and probed with cloned cpDNA fragments from Douglas-fir [Pseudotsuga menziesii (Mirb.) Franco] that comprise 82% of the chloroplast genome. Up to 313 restriction sites were surveyed, and 25 of these were observed to be polymorphic among or within species. Differences among species accounted for the majority of genetic (haplotypic) diversity observed [G(st) = 84(+/-13)%]; nucleotide diversity among species was estimated to be 0.3(+/-0.1)%. Knobcone pine and Monterey pine displayed almost no genetic variation within or among populations. Bishop pine also showed little variability within populations, but did display strong population differences [G(st) = 87(+/-8)%] that were a result of three distinct geographic groups. Mean nucleotide diversity within populations was 0.003(+/-0.002)%; intrapopulation polymorphisms were found in only five populations. This pattern of genetic variation contrasts strongly with findings from study of nuclear genes (allozymes) in the group, where most genetic diversity resides within populations rather than among populations or species. Regions of the genome subject to frequent length mutations were identified; estimates of subdivision based on length variant frequencies in one region differed strikingly from those based on site mutations or allozymes. Two trees were identified with a major chloroplast DNA inversion that closely resembled one documented between Pinus and Pseudotsuga. PMID:7905846
Silva-Junior, Orzenil B; Grattapaglia, Dario
2015-11-01
We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Küpper, Clemens; Burke, Terry; Lank, David B.
2015-01-01
Sequence variation in the melanocortin-1 receptor (MC1R) gene explains color morph variation in several species of birds and mammals. Ruffs (Philomachus pugnax) exhibit major dark/light color differences in melanin-based male breeding plumage which is closely associated with alternative reproductive behavior. A previous study identified a microsatellite marker (Ppu020) near the MC1R locus associated with the presence/absence of ornamental plumage. We investigated whether coding sequence variation in the MC1R gene explains major dark/light plumage color variation and/or the presence/absence of ornamental plumage in ruffs. Among 821bp of the MC1R coding region from 44 male ruffs we found 3 single nucleotide polymorphisms, representing 1 nonsynonymous and 2 synonymous amino acid substitutions. None were associated with major dark/light color differences or the presence/absence of ornamental plumage. At all amino acid sites known to be functionally important in other avian species with dark/light plumage color variation, ruffs were either monomorphic or the shared polymorphism did not coincide with color morph. Neither ornamental plumage color differences nor the presence/absence of ornamental plumage in ruffs are likely to be caused entirely by amino acid variation within the coding regions of the MC1R locus. Regulatory elements and structural variation at other loci may be involved in melanin expression and contribute to the extreme plumage polymorphism observed in this species. PMID:25534935
Dey, Avishek; Samanta, Milan Kumar; Gayen, Srimonta; Sen, Soumitra K.; Maiti, Mrinal K.
2016-01-01
Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE) and gene-silencing (RNAi). Analyses of the coding DNA sequence (CDS) of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5’-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS) of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene expression rather than natural polymorphism in coding sequence of OsbZIP23 is accountable for improved drought tolerance and yield performance in rice genotypes. PMID:26959651
Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun
2015-01-01
Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.
Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.
Genetic Modeling of Radiation Injury in Prostate Cancer Patients Treated with Radiotherapy
2016-10-01
nucleotide polymorphisms, prostate cancer, radiation therapy, adverse effects, urinary morbidity, rectal injury, sexual dysfunction 16. SECURITY...prostate cancer, radiation therapy, adverse effects, urinary morbidity, rectal injury, sexual dysfunction 3. ACCOMPLISHMENTS: What were the...Significant results: As shown in Table 1A, the mean age of patients across the eight studies ranged from 65 to 72 years with some moderate variation
Iskow, Rebecca C.; Austermann, Christian; Scharer, Christopher D.; Raj, Towfique; Boss, Jeremy M.; Sunyaev, Shamil; Price, Alkes; Stranger, Barbara; Simon, Viviana; Lee, Charles
2013-01-01
Ancient population structure shaping contemporary genetic variation has been recently appreciated and has important implications regarding our understanding of the structure of modern human genomes. We identified a ∼36-kb DNA segment in the human genome that displays an ancient substructure. The variation at this locus exists primarily as two highly divergent haplogroups. One of these haplogroups (the NE1 haplogroup) aligns with the Neandertal haplotype and contains a 4.6-kb deletion polymorphism in perfect linkage disequilibrium with 12 single nucleotide polymorphisms (SNPs) across diverse populations. The other haplogroup, which does not contain the 4.6-kb deletion, aligns with the chimpanzee haplotype and is likely ancestral. Africans have higher overall pairwise differences with the Neandertal haplotype than Eurasians do for this NE1 locus (p<10−15). Moreover, the nucleotide diversity at this locus is higher in Eurasians than in Africans. These results mimic signatures of recent Neandertal admixture contributing to this locus. However, an in-depth assessment of the variation in this region across multiple populations reveals that African NE1 haplotypes, albeit rare, harbor more sequence variation than NE1 haplotypes found in Europeans, indicating an ancient African origin of this haplogroup and refuting recent Neandertal admixture. Population genetic analyses of the SNPs within each of these haplogroups, along with genome-wide comparisons revealed significant FST (p = 0.00003) and positive Tajima's D (p = 0.00285) statistics, pointing to non-neutral evolution of this locus. The NE1 locus harbors no protein-coding genes, but contains transcribed sequences as well as sequences with putative regulatory function based on bioinformatic predictions and in vitro experiments. We postulate that the variation observed at this locus predates Human–Neandertal divergence and is evolving under balancing selection, especially among European populations. PMID:23593015
Genetic Variation within a Lotic Population of Janthinobacterium lividum
Saeger, Jennifer L.; Hale, Alan B.
1993-01-01
An understanding of the genetic variation within and between populations should allow scientists to address many problems, including those associated with endangered species and the release of genetically modified organisms into the environment. With respect to microorganisms, the release of genetically engineered microorganisms is likely to increase dramatically given the current growth in the bioremediation industry. In this study, genetic variation within a lotic, bacterial population of Janthinobacterium lividum was measured with restriction fragment length polymorphism analysis. Chromosomal DNA from 10 Kettle Creek (Hawk Mountain Sanctuary, Kempton, Pa.) J. lividum isolates was digested with six restriction endonucleases and probed with a 7.5-kb pKK3535 fragment containing the E. coli rrnB rRNA operon. Genetic variation, as measured in terms of nucleotide diversity, was high within the population. The 0.0781 value for genetic variation was especially high given the conservative nature of the genetic probe. The average percent similarity among isolates within the population was 67.25%. Pairwise comparisons of nucleotide diversity values (π) and similarity coefficients (F) yielded values ranging from 0.0032 to 0.1816 and 0.3363 to 0.9808, respectively. Putative clonemates were not present within the group of isolates; however, all isolates shared 14 fragments across a spectrum of six restriction enzymes. The presence of these common fragments indicates that restriction fragment length polymorphism analysis may provide population- or species-specific diagnostic markers for J. lividum. Data that suggest a plume effect with respect to the downstream movement of J. lividum are also presented. An increase in genetic variation within groups of isolates along the longitudinal gradient of Kettle Creek is also suggested. PMID:16348995
Genetic Variation within a Lotic Population of Janthinobacterium lividum.
Saeger, J L; Hale, A B
1993-07-01
An understanding of the genetic variation within and between populations should allow scientists to address many problems, including those associated with endangered species and the release of genetically modified organisms into the environment. With respect to microorganisms, the release of genetically engineered microorganisms is likely to increase dramatically given the current growth in the bioremediation industry. In this study, genetic variation within a lotic, bacterial population of Janthinobacterium lividum was measured with restriction fragment length polymorphism analysis. Chromosomal DNA from 10 Kettle Creek (Hawk Mountain Sanctuary, Kempton, Pa.) J. lividum isolates was digested with six restriction endonucleases and probed with a 7.5-kb pKK3535 fragment containing the E. coli rrnB rRNA operon. Genetic variation, as measured in terms of nucleotide diversity, was high within the population. The 0.0781 value for genetic variation was especially high given the conservative nature of the genetic probe. The average percent similarity among isolates within the population was 67.25%. Pairwise comparisons of nucleotide diversity values (pi) and similarity coefficients (F) yielded values ranging from 0.0032 to 0.1816 and 0.3363 to 0.9808, respectively. Putative clonemates were not present within the group of isolates; however, all isolates shared 14 fragments across a spectrum of six restriction enzymes. The presence of these common fragments indicates that restriction fragment length polymorphism analysis may provide population- or species-specific diagnostic markers for J. lividum. Data that suggest a plume effect with respect to the downstream movement of J. lividum are also presented. An increase in genetic variation within groups of isolates along the longitudinal gradient of Kettle Creek is also suggested.
Zhang, Zhifeng; Sun, Yawei; Du, Wei; He, Sangang; Liu, Mingjun; Tian, Changyan
2017-09-01
The vertebral number is associated with body length and carcass traits, which represents an economically important trait in farm animals. The variation of vertebral number has been observed in a few mammalian species. However, the variation of vertebral number and quantitative trait loci in sheep breeds have not been well addressed. In our investigation, the information including gender, age, carcass weight, carcass length and the number of thoracic and lumbar vertebrae from 624 China Kazakh sheep was collected. The effect of vertebral number variation on carcass weight and carcass length was estimated by general linear model. Further, the polymorphic sites of Vertnin ( VRTN ) gene were identified by sequencing, and the association of the genotype and vertebral number variation was analyzed by the one-way analysis of variance model. The variation of thoracolumbar vertebrae number in Kazakh sheep (18 to 20) was smaller than that in Texel sheep (17 to 21). The individuals with 19 thoracolumbar vertebrae (T13L6) were dominant in Kazakh sheep (79.2%). The association study showed that the numbers of thoracolumbar vertebrae were positively correlated with the carcass length and carcass weight, statistically significant with carcass length. To investigate the association of thoracolumbar vertebrae number with VRTN gene, we genotyped the VRTN gene. A total of 9 polymorphic sites were detected and only a single nucleotide polymorphism (SNP) (rs426367238) was suggested to associate with thoracic vertebral number statistically. The variation of thoracolumbar vertebrae number positively associated with the carcass length and carcass weight, especially with the carcass length. VRTN gene polymorphism of the SNP (rs426367238) with significant effect on thoracic vertebral number could be as a candidate marker to further evaluate its role in influence of thoracolumbar vertebral number.
HERC1 polymorphisms: population-specific variations in haplotype composition.
Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen
2009-08-01
Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.
Nilsson, L L; Djurisic, S; Andersen, A-M N; Melbye, M; Bjerre, D; Ferrero-Miliani, L; Hackmon, R; Geraghty, D E; Hviid, T V F
2016-10-01
The etiological pathways and pathogenesis of preeclampsia have rendered difficult to disentangle. Accumulating evidence points toward a maladapted maternal immune system, which may involve aberrant placental expression of immunomodulatory human leukocyte antigen (HLA) class Ib molecules during pregnancy. Several studies have shown aberrant or reduced expression of HLA-G in the placenta and in maternal blood in cases of preeclampsia compared with controls. Unlike classical HLA class Ia loci, the nonclassical HLA-G has limited polymorphic variants. Most nucleotide variations are clustered in the 5'-upstream regulatory region (5'URR) and 3'-untranslated regulatory region (3'UTR) of HLA-G and reflect a stringent expressional control. Based on genotyping and full gene sequencing of HLA-G in a large number of cases and controls (n > 900), the present study, which to our knowledge is the largest and most comprehensive performed, investigated the association between the HLA-G 14-bp ins/del (rs66554220) and HLA-E polymorphisms in mother and newborn dyads from pregnancies complicated by severe preeclampsia/eclampsia and from uncomplicated pregnancies. Furthermore, results from extended HLA-G haplotyping in the newborns are presented in order to assess whether a combined contribution of nucleotide variations spanning the 5'URR, coding region, and 3'UTR of HLA-G describes the genetic association with severe preeclampsia more closely. In contrast to earlier findings, the HLA-G 14-bp ins/del polymorphism was not associated with severe preeclampsia. Furthermore, the polymorphism (rs1264457) defining the two nonsynonymous HLA-E alleles, HLA-E*01:01:xx:xx and HLA-E*01:03:xx:xx, were not associated with severe preeclampsia. Finally, no specific HLA-G haplotypes were significantly associated with increased risk of developing severe preeclampsia/eclampsia. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Catalog of MicroRNA Seed Polymorphisms in Vertebrates
Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja
2012-01-01
MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453
VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.
Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia
2015-01-01
Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.
Contrasting Histories of Three Gene Regions Associated with In(3l)payne of Drosophila Melanogaster
Hasson, E.; Eanes, W. F.
1996-01-01
In the present report, we studied nucleotide variation in three gene regions of Drosophila melanogaster, spanning >5 kb and showing different degrees of association with the cosmopolitan inversion In(3-L)Payne. The analysis of sequence variation in the regions surrounding the breakpoints and the heat shock 83 (Hsp83) gene locus, located close to the distal breakpoint, revealed the absence of shared polymorphisms and the presence of a number of fixed differences between arrangements, indicating absence of genetic exchange. In contrast, for the esterase-6 gene region, located in the center of the inversion, we observed the presence of shared polymorphisms between arrangements suggesting genetic exchange. In the regions close to the breakpoints, the common St arrangement is 10 times more polymorphic than inverted chromosomes. We propose that the lack of recombination between arrangements in these regions coupled with genetic hitchhiking is the best explanation for the low heterozygosity observed in inverted lines. Using the data for the breakpoints, we estimate that this inversion polymorphism is around 0.36 million yr old. Although it is widely accepted that inversions are examples of balanced polymorphisms, none of the current neutrality tests including our Monte Carlo simulations showed significant departure from neutral expectations. PMID:8978045
Zhu, Xiao-Juan; Lin, Ya-Jun; Chen, Wei; Wang, Ya-Hui; Qiu, Li-Qiang; Cai, Can-Xin; Xiong, Qun; Chen, Fei; Chen, Li-Hui; Zhou, Qiong
2016-01-01
Nicotinamide N-methyltransferase (NNMT) catalyzes the methylation of nicotinamide. Our previous works indicate that NNMT is involved in the body mass index and energy metabolism, and recently the association between a SNP (rs694539) of NNMT and a variety of cardiovascular diseases was reported. At present, more than 200 NNMT single nucleotide polymorphisms (SNPs) have been identified in the databases of the human genome projects; however, the association between rs694539 variation and hyperlipidemia has not been reported yet, and whether there are any SNPs in NNMT significantly associated with hyperlipidemia is still unclear. In this paper, we selected 19 SNPs in NNMT as the tagSNPs using Haploview software (Haploview 4.2) first and then performed a case-control study to observe the association between these tagSNPs and hyperlipidemia and finally applied physiological approaches to explore the possible mechanisms through which the NNMT polymorphism induces hyperlipidemia. The results show that a SNP (rs1941404) in NNMT is significantly associated with hyperlipidemia, and the influence of rs1941404 variation on the resting energy expenditure may be the possible mechanism for rs1941404 variation to induce hyperlipidemia. PMID:27999813
Genetic Architectures of Quantitative Variation in RNA Editing Pathways
Gu, Tongjun; Gatti, Daniel M.; Srivastava, Anuj; Snyder, Elizabeth M.; Raghupathy, Narayanan; Simecek, Petr; Svenson, Karen L.; Dotu, Ivan; Chuang, Jeffrey H.; Keller, Mark P.; Attie, Alan D.; Braun, Robert E.; Churchill, Gary A.
2016-01-01
RNA editing refers to post-transcriptional processes that alter the base sequence of RNA. Recently, hundreds of new RNA editing targets have been reported. However, the mechanisms that determine the specificity and degree of editing are not well understood. We examined quantitative variation of site-specific editing in a genetically diverse multiparent population, Diversity Outbred mice, and mapped polymorphic loci that alter editing ratios globally for C-to-U editing and at specific sites for A-to-I editing. An allelic series in the C-to-U editing enzyme Apobec1 influences the editing efficiency of Apob and 58 additional C-to-U editing targets. We identified 49 A-to-I editing sites with polymorphisms in the edited transcript that alter editing efficiency. In contrast to the shared genetic control of C-to-U editing, most of the variable A-to-I editing sites were determined by local nucleotide polymorphisms in proximity to the editing site in the RNA secondary structure. Our results indicate that RNA editing is a quantitative trait subject to genetic variation and that evolutionary constraints have given rise to distinct genetic architectures in the two canonical types of RNA editing. PMID:26614740
Genetic alterations affecting cholesterol metabolism and human fertility.
DeAngelis, Anthony M; Roy-O'Reilly, Meaghan; Rodriguez, Annabelle
2014-11-01
Single nucleotide polymorphisms (SNPs) represent genetic variations among individuals in a population. In medicine, these small variations in the DNA sequence may significantly impact an individual's response to certain drugs or influence the risk of developing certain diseases. In the field of reproductive medicine, a significant amount of research has been devoted to identifying polymorphisms which may impact steroidogenesis and fertility. This review discusses current understanding of the effects of genetic variations in cholesterol metabolic pathways on human fertility that bridge novel linkages between cholesterol metabolism and reproductive health. For example, the role of the low-density lipoprotein receptor (LDLR) in cellular metabolism and human reproduction has been well studied, whereas there is now an emerging body of research on the role of the high-density lipoprotein (HDL) receptor scavenger receptor class B type I (SR-BI) in human lipid metabolism and female reproduction. Identifying and understanding how polymorphisms in the SCARB1 gene or other genes related to lipid metabolism impact human physiology is essential and will play a major role in the development of personalized medicine for improved diagnosis and treatment of infertility. © 2014 by the Society for the Study of Reproduction, Inc.
Genomic signatures of selection at linked sites: unifying the disparity among species
Cutter, Asher D.; Payseur, Bret A.
2014-01-01
Population genetics theory supplies powerful predictions about how natural selection interacts with genetic linkage to sculpt the genomic landscape of nucleotide polymorphism. Both the spread of beneficial mutations and removal of deleterious mutations act to depress polymorphism levels, especially in low-recombination regions. However, empiricists have documented extreme disparities among species. Here we characterize the dominant features that could drive variation in linked selection among species, including roles for selective sweeps being ‘hard’ or ‘soft’, and concealing by demography and genomic confounds. We advocate targeted studies of close relatives to unify our understanding of how selection and linkage interact to shape genome evolution. PMID:23478346
Koole, Cassandra; Savage, Emilia E.; Christopoulos, Arthur; Miller, Laurence J.
2013-01-01
The glucagon-like peptide-1 receptor (GLP-1R) controls the physiological responses to the incretin hormone glucagon-like peptide-1 and is a major therapeutic target for the treatment of type 2 diabetes, owing to the broad range of effects that are mediated upon its activation. These include the promotion of glucose-dependent insulin secretion, increased insulin biosynthesis, preservation of β-cell mass, improved peripheral insulin action, and promotion of weight loss. Regulation of GLP-1R function is complex, with multiple endogenous and exogenous peptides that interact with the receptor that result in the activation of numerous downstream signaling cascades. The current understanding of GLP-1R signaling and regulation is limited, with the desired spectrum of signaling required for the ideal therapeutic outcome still to be determined. In addition, there are several single-nucleotide polymorphisms (used in this review as defining a natural change of single nucleotide in the receptor sequence; clinically, this is viewed as a single-nucleotide polymorphism only if the frequency of the mutation occurs in 1% or more of the population) distributed within the coding sequence of the receptor protein that have the potential to produce differential responses for distinct ligands. In this review, we discuss the current understanding of GLP-1R function, in particular highlighting recent advances in the field on ligand-directed signal bias, allosteric modulation, and probe dependence and the implications of these behaviors for drug discovery and development. PMID:23864649
Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast
Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora
2006-01-01
Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318
Arko, B; Prezelj, J; Komel, R; Kocijancic, A; Hudler, P; Marc, J
2002-09-01
Osteoprotegerin (OPG) is a recently discovered member of the TNF receptor superfamily that acts as an important paracrine regulator of bone remodeling. OPG knockout mice develop severe osteoporosis, whereas administration of OPG can prevent ovariectomy-induced bone loss. These findings implicate a role for OPG in the development of osteoporosis. In the present study, we screened the OPG gene promoter for sequence variations and examined their association with bone mineral density (BMD) in 103 osteoporotic postmenopausal women. Single-strand conformation polymorphism analysis followed by DNA sequencing revealed a presence of four nucleotide substitutions: 209 G-->A, 245 T-->G, 889 C-->T, and 950 T-->C. The frequencies of genotypes were as follows: GG (89.3%), GA (10.7%) for 209 G-->A polymorphism; TT (89.3%), TG (10.7%) for 245 T-->G polymorphism; and TT (25.2%), TC (53.4%), CC (21.4%) for 950 T-->C polymorphism. Substitution 889 C-->T was found in only two patients. Statistically significant association of genotypes with BMD at the lumbar spine (P = 0.005) was observed for 209 G-->A and 245 T-->G polymorphisms. Haplotype GATG was associated with lower BMD as compared with GGTT haplotype. Our results suggest that 209 G-->A and 245 T-->G polymorphisms in the OPG gene promoter may contribute to the genetic regulation of BMD.
Hayes, John E.; Wallace, Margaret R.; Knopik, Valerie S.; Herbstman, Deborah M.; Bartoshuk, Linda M.
2011-01-01
The 25 human bitter receptors and their respective genes (TAS2Rs) contain unusually high levels of allelic variation, which may influence response to bitter compounds in the food supply. Phenotypes based on the perceived bitterness of single bitter compounds were first linked to food preference over 50 years ago. The most studied phenotype is propylthiouracil bitterness, which is mediated primarily by the TAS2R38 gene and possibly others. In a laboratory-based study, we tested for associations between TAS2R variants and sensations, liking, or intake of bitter beverages among healthy adults who were primarily of European ancestry. A haploblock across TAS2R3, TAS2R4, and TAS2R5 explained some variability in the bitterness of espresso coffee. For grapefruit juice, variation at a TAS2R19 single nucleotide polymorphism (SNP) was associated with increased bitterness and decreased liking. An association between a TAS2R16 SNP and alcohol intake was identified, and the putative TAS2R38–alcohol relationship was confirmed, although these polymorphisms did not explain sensory or hedonic responses to sampled scotch whisky. In summary, TAS2R polymorphisms appear to influence the sensations, liking, or intake of common and nutritionally significant beverages. Studying perceptual and behavioral differences in vivo using real foods and beverages may potentially identify polymorphisms related to dietary behavior even in the absence of known ligands. PMID:21163912
Hayes, John E; Wallace, Margaret R; Knopik, Valerie S; Herbstman, Deborah M; Bartoshuk, Linda M; Duffy, Valerie B
2011-03-01
The 25 human bitter receptors and their respective genes (TAS2Rs) contain unusually high levels of allelic variation, which may influence response to bitter compounds in the food supply. Phenotypes based on the perceived bitterness of single bitter compounds were first linked to food preference over 50 years ago. The most studied phenotype is propylthiouracil bitterness, which is mediated primarily by the TAS2R38 gene and possibly others. In a laboratory-based study, we tested for associations between TAS2R variants and sensations, liking, or intake of bitter beverages among healthy adults who were primarily of European ancestry. A haploblock across TAS2R3, TAS2R4, and TAS2R5 explained some variability in the bitterness of espresso coffee. For grapefruit juice, variation at a TAS2R19 single nucleotide polymorphism (SNP) was associated with increased bitterness and decreased liking. An association between a TAS2R16 SNP and alcohol intake was identified, and the putative TAS2R38-alcohol relationship was confirmed, although these polymorphisms did not explain sensory or hedonic responses to sampled scotch whisky. In summary, TAS2R polymorphisms appear to influence the sensations, liking, or intake of common and nutritionally significant beverages. Studying perceptual and behavioral differences in vivo using real foods and beverages may potentially identify polymorphisms related to dietary behavior even in the absence of known ligands.
NASA Astrophysics Data System (ADS)
Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue
2008-11-01
Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...
Clinical relevance of IL-6 gene polymorphism in severely injured patients
Jeremić, Vasilije; Alempijević, Tamara; Mijatović, Srđan; Šijački, Ana; Dragašević, Sanja; Pavlović, Sonja; Miličić, Biljana; Krstić, Slobodan
2014-01-01
In polytrauma, injuries that may be surgically treated under regular circumstances due to a systemic inflammatory response become life-threatening. The inflammatory response involves a complex pattern of humoral and cellular responses and the expression of related factors is thought to be governed by genetic variations. This aim of this paper is to examine the influence of interleukin (IL) 6 single nucleotide polymorphism (SNP) -174C/G and -596G/A on the treatment outcome in severely injured patients. Forty-seven severely injured patients were included in this study. Patients were assigned an Injury Severity Score. Blood samples were drawn within 24 h after admission (designated day 1) and on subsequent days (24, 48, 72 hours and 7days) of hospitalization. The IL-6 levels were determined through ELISA technique. Polymorphisms were analyzed by a method of Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR). Among subjects with different outcomes, no statistically relevant difference was found with regards to the gene IL-6 SNP-174G/C polymorphism. More than a half of subjects who died had the SNP-174G/C polymorphism, while this polymorphism was represented in a slightly lower number in survivors. The incidence of subjects without polymorphism and those with heterozygous and homozygous gene IL-6 SNP-596G/A polymorphism did not present statistically significant variations between survivors and those who died. The levels of IL-6 over the observation period did not present any statistically relevant difference among subjects without the IL-6 SNP-174 or IL-6 SNP -596 gene polymorphism and those who had either a heterozygous or a homozygous polymorphism. PMID:24856384
Anousha, Negin; Hossein-Nezhad, Arash; Biramijamal, Firouzeh; Rahmani, Ali; Maghbooli, Zhila; Aghababaei, Elahe; Nemati, Shahram
2013-01-01
Estrogen plays a crucial role in fetal and placental development through estrogen receptors. Association of estrogen receptor alpha gene (ESR1) polymorphisms with spontaneous abortion has been shown in some studies. Our main goal was to study the potential association of spontaneous abortion with the ESR1 gene variations (PvuII and XbaI) in fetal tissue. Totally, 161 samples were recruited including 80 samples of formalin-fixed paraffin-embedded fetal tissue from spontaneous abortion and 81 samples of normal term placental tissue. The restriction fragment length polymorphism (RFLP) method was performed for genotyping the rs2234693 (A/G XbaI) and rs9340799 (T/C PvuII) single nucleotide polymorphisms located in intron 1 of ESR1. The results have been confirmed by DNA sequencing analysis. The different genotypes distribution was detected in two study groups. Haplotype analysis indicated that ppxx is protective genotype against spontaneous abortion (P = 0.01). In conclusion, the potential role of ESR1 genetic variation in spontaneous abortion might be valuable in high-risk subjects, and that needs to be confirmed with future studies.
Anousha, Negin; Hossein-Nezhad, Arash; Biramijamal, Firouzeh; Rahmani, Ali; Maghbooli, Zhila; Aghababaei, Elahe; Nemati, Shahram
2013-01-01
Estrogen plays a crucial role in fetal and placental development through estrogen receptors. Association of estrogen receptor alpha gene (ESR1) polymorphisms with spontaneous abortion has been shown in some studies. Our main goal was to study the potential association of spontaneous abortion with the ESR1 gene variations (PvuII and XbaI) in fetal tissue. Totally, 161 samples were recruited including 80 samples of formalin-fixed paraffin-embedded fetal tissue from spontaneous abortion and 81 samples of normal term placental tissue. The restriction fragment length polymorphism (RFLP) method was performed for genotyping the rs2234693 (A/G XbaI) and rs9340799 (T/C PvuII) single nucleotide polymorphisms located in intron 1 of ESR1. The results have been confirmed by DNA sequencing analysis. The different genotypes distribution was detected in two study groups. Haplotype analysis indicated that ppxx is protective genotype against spontaneous abortion (P = 0.01). In conclusion, the potential role of ESR1 genetic variation in spontaneous abortion might be valuable in high-risk subjects, and that needs to be confirmed with future studies. PMID:24228243
Sheikh, Haroon I.; Hayden, Elizabeth P.; Singh, Shiva M.; Dougherty, Lea R.; Olino, Thomas M.; Durbin, C. Emily; Klein, Daniel N.
2008-01-01
Although a vast literature examining the role of attributional styles in depression has accumulated, the origins of such cognitions remain poorly understood. Investigators are increasingly interested in whether cognitive vulnerability to depression is linked to genetic variation. As a preliminary test of this hypothesis, we examined whether the serotonin transporter promoter polymorphism (5-HTTLPR) was associated with attributional styles in children. Thirty-eight children completed a self-report measure of attributional styles, the Child Attributional Style Questionnaire-Revised (CASQ-R). Children were also genotyped for the 5-HTTLPR polymorphism, including the single nucleotide polymorphism (SNP) rs25531 in the long allele of the 5-HTTLPR. The short alleles of the 5-HTTLPR and their putative functional equivalents were associated with increased levels of depressogenic attributions for negative events, as measured by the CASQ-R, lending support to the role of 5-HTTLPR polymorphisms in cognitive vulnerability to depression. PMID:19122845
Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.
2014-01-01
SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139
Bereir, R E H; Mohamed, H S; Seielstad, M; El Hassani, A M; Khalil, E A G; Peacock, C S; Blackwell, J M; Ibrahim, M E
2003-09-01
Four single nucleotide polymorphisms (SNPs) and a variable number of tandem repeats (VNTR) polymorphism located within disease associated/causing genes were typed in four populations of different tribal and ethnic affiliation from the Sudan. The genotype and allele frequencies were compared with those of other groups from published and unpublished data of world populations. The combined Sudanese sample conformed with Hardy-Weinberg equilibrium (HWE) expectation. However, population sub-structuring according to ethnic/linguistic group indicated at least two SNPs in departure from HWE. Differences in allele frequencies and genotype distribution between groups was also noted in three of the four SNPs. The other loci were distributed homogeneously within the populations studied with genotype frequencies in agreement with HWE expectation. These results highlight the importance of inter-population stratification for polymorphic markers, as well as the potential influence of evolutionary history and ethnic variation of loci, in the general distribution of SNPs and other polymorphisms.
González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B
2006-03-01
Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...
Sogabe, Natsuko; Tanabe, Rieko; Haraikawa, Mayu; Maruoka, Yutaka; Orimo, Hideo; Hosoi, Takayuki; Goseki-Sone, Masae
2013-01-01
We had demonstrated that single nucleotide polymorphism (787T>C) in the tissue-nonspecific ALP (TNSALP) gene was associated with the bone mineral density (BMD). BMD was the lowest among TNSALP 787T homozygotes (TT-type) and highest among TNSALP 787T>C homozygotes (CC-type) in postmenopausal women. In the present study, we investigated the effects of the TNSALP genotype on associations among serum bonespecific alkaline phosphatase (BAP), serum calcium, and phosphorus in healthy young Japanese subjects. Young healthy adult subjects (n=193) were genotyped for the polymorphism, and we measured the levels of serum BAP, serum calcium, and phosphorus. Dietary nutrient intakes were calculated based on 3-day food records before the day of blood examinations. Grouped by the TNSALP genotype, a significant negative correlation between serum BAP and phosphorus was observed in 787T>C homozygotes (CC-type), but not in heterozygotes (TCtype), nor in 787T homozygotes (TT-type). In the present study, we revealed that the single nucleotide polymorphism 787T>C in the TNSALP gene had effects on the correlation between serum BAP and phosphorus in young adult subjects. These results suggest that variation in TNSALP may be an important determinant of phosphate metabolism. Our data may be useful for planning strategies to prevent osteoporosis.
Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism
Gur-Arie, Riva; Cohen, Cyril J.; Eitan, Yuval; Shelef, Leora; Hallerman, Eric M.; Kashi, Yechezkel
2000-01-01
Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AF209020–209030 and AF209508–209518.] PMID:10645951
Vargas-Rodríguez, Rosa del Carmen Miluska; da Silva Bastos, Melissa; Menezes, Maria José; Orjuela-Sánchez, Pamela; Ferreira, Marcelo U.
2012-01-01
Emerging resistance to chloroquine (CQ) poses a major challenge for Plasmodium vivax malaria control, and nucleotide substitutions and copy number variation in the P. vivax multidrug resistance 1 (pvmdr-1) locus, which encodes a digestive vacuole membrane transporter, may modulate this phenotype. We describe patterns of genetic variation in pvmdr-1 alleles from Acre and Amazonas in northwestern Brazil, and compare then with those reported in other malaria-endemic regions. The pvmdr-1 mutation Y976F, which is associated with CQ resistance in Southeast Asia and Oceania, remains rare in northwestern Brazil (1.8%) and its prevalence mirrors that of CQ resistance worldwide. Gene amplification of pvmdr-1, which is associated with mefloquine resistance but increased susceptibility to CQ, remains relatively rare in northwestern Brazil (0.9%) and globally (< 4%), but became common (> 10%) in Tak Province, Thailand, possibly because of drug-mediated selection. The global database we have assembled provides a baseline for further studies of genetic variation in pvmdr-1 and drug resistance in P. vivax malaria. PMID:22949516
Vargas-Rodríguez, Rosa del Carmen Miluska; da Silva Bastos, Melissa; Menezes, Maria José; Orjuela-Sánchez, Pamela; Ferreira, Marcelo U
2012-11-01
Emerging resistance to chloroquine (CQ) poses a major challenge for Plasmodium vivax malaria control, and nucleotide substitutions and copy number variation in the P. vivax multidrug resistance 1 (pvmdr-1) locus, which encodes a digestive vacuole membrane transporter, may modulate this phenotype. We describe patterns of genetic variation in pvmdr-1 alleles from Acre and Amazonas in northwestern Brazil, and compare then with those reported in other malaria-endemic regions. The pvmdr-1 mutation Y976F, which is associated with CQ resistance in Southeast Asia and Oceania, remains rare in northwestern Brazil (1.8%) and its prevalence mirrors that of CQ resistance worldwide. Gene amplification of pvmdr-1, which is associated with mefloquine resistance but increased susceptibility to CQ, remains relatively rare in northwestern Brazil (0.9%) and globally (< 4%), but became common (> 10%) in Tak Province, Thailand, possibly because of drug-mediated selection. The global database we have assembled provides a baseline for further studies of genetic variation in pvmdr-1 and drug resistance in P. vivax malaria.
Oxytocin Receptor Genetic Variation Promotes Human Trust Behavior
Krueger, Frank; Parasuraman, Raja; Iyengar, Vijeth; Thornburg, Matthew; Weel, Jaap; Lin, Mingkuan; Clarke, Ellen; McCabe, Kevin; Lipsky, Robert H.
2012-01-01
Given that human trust behavior is heritable and intranasal administration of oxytocin enhances trust, the oxytocin receptor (OXTR) gene is an excellent candidate to investigate genetic contributions to individual variations in trust behavior. Although a single-nucleotide polymorphism involving an adenine (A)/guanine (G) transition (rs53576) has been associated with socio-emotional phenotypes, its link to trust behavior is unclear. We combined genotyping of healthy male students (n = 108) with the administration of a trust game experiment. Our results show that a common occurring genetic variation (rs53576) in the OXTR gene is reliably associated with trust behavior rather than a general increase in trustworthy or risk behaviors. Individuals homozygous for the G allele (GG) showed higher trust behavior than individuals with A allele carriers (AA/AG). Although the molecular functionality of this polymorphism is still unknown, future research should clarify how the OXTR gene interacts with other genes and the environment in promoting socio-emotional behaviors. PMID:22347177
Miller, John J; Eackles, Michael S.; Stauffer, Jay R; King, Timothy L.
2015-01-01
We characterized variation within the mitochondrial genomes of the invasive silver carp (Hypophthalmichthys molitrix) and bighead carp (H. nobilis) from the Mississippi River drainage by mapping our Next-Generation sequences to their publicly available genomes. Variant detection resulted in 338 single-nucleotide polymorphisms for H. molitrix and 39 for H. nobilis. The much greater genetic variation in H. molitrix mitochondria relative to H. nobilis may be indicative of a greater North American female effective population size of the former. When variation was quantified by gene, many tRNA loci appear to have little or no variability based on our results whereas protein-coding regions were more frequently polymorphic. These results provide biologists with additional regions of DNA to be used as markers to study the invasion dynamics of these species.
USDA-ARS?s Scientific Manuscript database
The actions of prolactin (PRL) are mediated by both long (LF) and short isoforms (SF) of the PRL receptor (PRLR). Here, we report on a genetic and functional analysis of the porcine PRLR (pPRLR) SF. Three single nucleotide polymorphisms (SNPs) within exon 11 of the pPRLR-SF give rise to four amino a...
Range-wide parallel climate-associated genomic clines in Atlantic salmon
Stanley, Ryan R. E.; Wringe, Brendan F.; Guijarro-Sabaniel, Javier; Bourret, Vincent; Bernatchez, Louis; Bentzen, Paul; Beiko, Robert G.; Gilbey, John; Clément, Marie; Bradbury, Ian R.
2017-01-01
Clinal variation across replicated environmental gradients can reveal evidence of local adaptation, providing insight into the demographic and evolutionary processes that shape intraspecific diversity. Using 1773 genome-wide single nucleotide polymorphisms we evaluated latitudinal variation in allele frequency for 134 populations of North American and European Atlantic salmon (Salmo salar). We detected 84 (4.74%) and 195 (11%) loci showing clinal patterns in North America and Europe, respectively, with 12 clinal loci in common between continents. Clinal single nucleotide polymorphisms were evenly distributed across the salmon genome and logistic regression revealed significant associations with latitude and seasonal temperatures, particularly average spring temperature in both continents. Loci displaying parallel clines were associated with several metabolic and immune functions, suggesting a potential basis for climate-associated adaptive differentiation. These climate-based clines collectively suggest evidence of large-scale environmental associated differences on either side of the North Atlantic. Our results support patterns of parallel evolution on both sides of the North Atlantic, with evidence of both similar and divergent underlying genetic architecture. The identification of climate-associated genomic clines illuminates the role of selection and demographic processes on intraspecific diversity in this species and provides a context in which to evaluate the impacts of climate change. PMID:29291123
Hall, S J G; Lenstra, J A; Deeming, D C
2012-06-01
Conservation of the intraspecific genetic diversity of livestock species requires protocols that assess between-breed genetic variability and also take into account differences among individuals within breeds. Here, we focus on variation between breeds. Conservation of neutral genetic variation has been seen as promoting, through linkage processes, the retention of useful and potentially useful variation. Using public information on beef cattle breeds, with a total of 165 data sets each relating to a breed comparison of a performance variable, we have tested this paradigm by calculating the correlations between pairwise breed differences in performance and pairwise genetic distances deduced from biochemical and immunological polymorphisms, microsatellites and single-nucleotide polymorphisms. As already observed in floral and faunal biodiversity, significant positive correlations (n=54) were found, but many correlations were non-significant (n=100) or significantly negative (n=11). This implies that maximizing conserved neutral genetic variation with current techniques may conserve breed-level genetic variation in some traits but not in others and supports the view that genetic distance measurements based on neutral genetic variation are not sufficient as a determinant of conservation priority among breeds. © 2011 Blackwell Verlag GmbH.
Nonneutral mitochondrial DNA variation in humans and chimpanzees
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nachman, M.W.; Aquadro, C.F.; Brown, W.M.
1996-03-01
We sequenced the NADH dehydrogenase subunit 3 (ND3) gene from a sample of 61 humans, five common chimpanzees, and one gorilla to test whether patterns of mitochondrial DNA (mtDNA) variation are consistent with a neutral model of molecular evolution. Within humans and within chimpanzees, the ratio of replacement to silent nucleotide substitutions was higher than observed in comparisons between species, contrary to neutral expectations. To test the generality of this result, we reanalyzed published human RFLP data from the entire mitochondrial genome. Gains of restriction sites relative to a known human mtDNA sequence were used to infer unambiguous nucleotide substitutions.more » We also compared the complete mtDNA sequences of three humans. Both the RFLP data and the sequence data reveal a higher ratio of replacement to silent nucleotide substitutions within humans than is seen between species. This pattern is observed at most or all human mitochondrial genes and is inconsistent with a strictly neutral model. These data suggest that many mitochondrial protein polymorphisms are slightly deleterious, consistent with studies of human mitochondrial diseases. 59 refs., 2 figs., 8 tabs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adams, Scott V., E-mail: sadams@fhcrc.org; Barrick, Brian; Christopher, Emily P.
Background: Metallothionein (MT) proteins play critical roles in the physiological handling of both essential (Cu and Zn) and toxic (Cd) metals. MT expression is regulated by metal-regulatory transcription factor 1 (MTF1). Hence, genetic variation in the MT gene family and MTF1 might influence excretion of these metals. Methods: 321 women were recruited in Seattle, WA and Las Cruces, NM and provided demographic information, urine samples for measurement of metal concentrations by mass spectrometry and creatinine, and blood or saliva for extraction of DNA. Forty-one single nucleotide polymorphisms (SNPs) within the MTF1 gene region and the region of chromosome 16 encodingmore » the MT gene family were selected for genotyping in addition to an ancestry informative marker panel. Linear regression was used to estimate the association of SNPs with urinary Cd, Cu, and Zn, adjusted for age, urinary creatinine, smoking history, study site, and ancestry. Results: Minor alleles of rs28366003 and rs10636 near the MT2A gene were associated with lower urinary Cd, Cu, and Zn. Minor alleles of rs8044719 and rs1599823, near MT1A and MT1B, were associated with lower urinary Cd and Zn, respectively. Minor alleles of rs4653329 in MTF1 were associated with lower urinary Cd. Conclusions: These results suggest that genetic variation in the MT gene region and MTF1 influences urinary Cd, Cu, and Zn excretion. - Highlights: • Genetic variation in metallothionein (MT) genes was assessed in two diverse populations. • Single nucleotide polymorphisms (SNPs) in MT genes were associated with mean urinary Cd, Cu and Zn. • Genetic variation may influence biomarkers of exposure, and associations of exposure with health.« less
Genetic variation in eleven phase I drug metabolism genes in an ethnically diverse population.
Solus, Joseph F; Arietta, Brenda J; Harris, James R; Sexton, David P; Steward, John Q; McMunn, Chara; Ihrie, Patrick; Mehall, Janelle M; Edwards, Todd L; Dawson, Elliott P
2004-10-01
The extent of genetic variation found in drug metabolism genes and its contribution to interindividual variation in response to medication remains incompletely understood. To better determine the identity and frequency of variation in 11 phase I drug metabolism genes, the exons and flanking intronic regions of the cytochrome P450 (CYP) isoenzyme genes CYP1A1, CYP1A2, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP2E1, CYP3A4 and CYP3A5 were amplified from genomic DNA and sequenced. A total of 60 kb of bi-directional sequence was generated from each of 93 human DNAs, which included Caucasian, African-American and Asian samples. There were 388 different polymorphisms identified. These included 269 non-coding, 45 synonymous and 74 non-synonymous polymorphisms. Of these, 54% were novel and included 176 non-coding, 14 synonymous and 21 non-synonymous polymorphisms. Of the novel variants observed, 85 were represented by single occurrences of the minor allele in the sample set. Much of the variation observed was from low-frequency alleles. Comparatively, these genes are variation-rich. Calculations measuring genetic diversity revealed that while the values for the individual genes are widely variable, the overall nucleotide diversity of 7.7 x 10(-4) and polymorphism parameter of 11.5 x 10(-4) are higher than those previously reported for other gene sets. Several independent measurements indicate that these genes are under selective pressure, particularly for polymorphisms corresponding to non-synonymous amino acid changes. There is relatively little difference in measurements of diversity among the ethnic groups, but there are large differences among the genes and gene subfamilies themselves. Of the three CYP subfamilies involved in phase I drug metabolism (1, 2, and 3), subfamily 2 displays the highest levels of genetic diversity.
VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism.
Kim, HyoYoung; Sung, Samsun; Cho, Seoae; Kim, Tae-Hun; Seo, Kangseok; Kim, Heebal
2014-12-01
Copy number variation (CNV) or single nucleotide phlyorphism (SNP) is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP) to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i) the enrichment of genome contents in CNV; ii) the physical distribution of CNV or SNP on chromosomes; iii) the distribution of log2 ratio of CNVs with criteria of interested; iv) the number of CNV or SNP per binning unit; v) the distribution of homozygosity of SNP genotype; and vi) cytomap of genes within CNV or SNP region.
Positive selection in the SLC11A1 gene in the family Equidae.
Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr
2016-05-01
Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.
Genovar: a detection and visualization tool for genomic variants.
Jung, Kwang Su; Moon, Sanghoon; Kim, Young Jin; Kim, Bong-Jo; Park, Kiejung
2012-05-08
Along with single nucleotide polymorphisms (SNPs), copy number variation (CNV) is considered an important source of genetic variation associated with disease susceptibility. Despite the importance of CNV, the tools currently available for its analysis often produce false positive results due to limitations such as low resolution of array platforms, platform specificity, and the type of CNV. To resolve this problem, spurious signals must be separated from true signals by visual inspection. None of the previously reported CNV analysis tools support this function and the simultaneous visualization of comparative genomic hybridization arrays (aCGH) and sequence alignment. The purpose of the present study was to develop a useful program for the efficient detection and visualization of CNV regions that enables the manual exclusion of erroneous signals. A JAVA-based stand-alone program called Genovar was developed. To ascertain whether a detected CNV region is a novel variant, Genovar compares the detected CNV regions with previously reported CNV regions using the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation) and the Single Nucleotide Polymorphism Database (dbSNP). The current version of Genovar is capable of visualizing genomic data from sources such as the aCGH data file and sequence alignment format files. Genovar is freely accessible and provides a user-friendly graphic user interface (GUI) to facilitate the detection of CNV regions. The program also provides comprehensive information to help in the elimination of spurious signals by visual inspection, making Genovar a valuable tool for reducing false positive CNV results. http://genovar.sourceforge.net/.
Origin of the polymorphism of the involucrin gene in Asians.
Djian, P; Delhomme, B; Green, H
1995-01-01
The involucrin gene, encoding a protein of the terminally differentiated keratinocyte, is polymorphic in the human. There is polymorphism of marker nucleotides a two positions in the coding region, and there are over eight polymorphic forms based on the number and kind of 10-codon tandem repeats in that part of the coding region most recently added in the human lineage. The involucrin alleles of Caucasians and Africans differ in both nucleotides and repeat patterns. We show that the involucrin alleles of East Asians (Chinese and Japanese) can be divided into two populations according to whether they possess the two marker nucleotides typical of Africans or Caucasians. The Asian population bearing Caucasian-type marker nucleotides has repeat patterns similar to those of Caucasians, whereas Asians bearing African-type marker nucleotides have repeat patterns that resemble those of Africans more than those of Caucasians. The existence of two populations of East Asian involucrin alleles gives support for the existence of a Eurasian stem lineage from which Caucasians and a part of the Asian population originated. PMID:7762559
Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu
2016-04-01
Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.
Xu, Feng-Ling; Ding, Mei; Yao, Jun; Shi, Zhang-Sen; Wu, Xue; Zhang, Jing-Jing; Pang, Hao; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie
2017-01-01
To determine whether mitochondrial DNA (mtDNA) variations are associated with schizophrenia, 313 patients with schizophrenia and 326 unaffected participants of the northern Chinese Han population were included in a prospective study. Single-nucleotide polymorphisms (SNPs) including C5178A, A10398G, G13708A, and C13928G were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Hypervariable regions I and II (HVSI and HVSII) were analyzed by sequencing. The results showed that the 4 SNPs and 11 haplotypes, composed of the 4 SNPs, did not differ significantly between patient and control groups. No significant association between haplogroups and the risk of schizophrenia was ascertained after Bonferroni correction. Drawing a conclusion, there was no evidence of an association between mtDNA (the 4 SNPs and the control region) and schizophrenia in the northern Chinese Han population.
Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent
2012-05-01
Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.
Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan
2018-01-01
CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.
Koskela, J; Laiho, J; KäHönen, M; Rontu, R; Lehtinen, R; Viik, J; Niemi, M; Niemelä, K; Kööbi, T; Turjanmaa, V; Pörsti, I; Lehtimäki, T; Nieminen, T
2008-01-01
Cardiac repolarization is regulated, in part, by the KCNH2 gene, which encodes a rapidly activating component of the delayed rectifier potassium channel. The gene expresses a functional single nucleotide polymorphism, K897T, which changes the biophysical properties of the channel. The objective of this study was to evaluate whether this polymorphism influences two indices of repolarization--the QT interval and T-wave alternans (TWA)--during different phases of a physical exercise test. The cohort consisted of 1,975 patients undergoing an exercise test during which on-line electrocardiographic data were registered. Information on coronary risk factors and medication was recorded. The 2690A>C nucleotide variation in the KCNH2 gene corresponding to the K897T amino acid change was analysed after polymerase chain reaction with allele-specific TaqMan probes. Among all subjects, the QTc intervals did not differ between the three genotype groups (p> or =0.31, RANOVA). Women with the CC genotype tended to have longer QT intervals during the exercise test, but the difference was statistically significant only at rest (p = 0.011, ANOVA). This difference was also detected when the analysis was adjusted for several factors influencing the QT interval. No statistically significant effects of the K897T polymorphism on TWA were observed among all subjects (p = 0.16, RANOVA), nor in men and women separately. The K897T polymorphism of the KCNH2 gene may not be a major genetic determinant for the TWA, but the influence of the CC genotype on QT interval deserves further research among women.
Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R
2017-05-01
To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.
Sacco, James; Ruplin, Andrew; Skonieczny, Paul; Ohman, Michael
2017-01-01
In humans, reduced activity of the enzyme monoamine oxidase type A (MAOA) due to genetic polymorphisms within the MAOA gene leads to increased brain neurotransmitter levels associated with aggression. In order to study MAOA genetic diversity in dogs, we designed a preliminary study whose objectives were to identify novel alleles in functionally important regions of the canine MAOA gene, and to investigate whether the frequencies of these polymorphisms varied between five broad breed groups (ancient, herding, mastiff, modern European, and mountain). Fifty dogs representing these five breed groups were sequenced. A total of eleven polymorphisms were found. Seven were single nucleotide polymorphisms (SNPs; two exonic, two intronic and three in the promoter), while four were repeat intronic variations. The most polymorphic loci were repeat regions in introns 1, 2 (7 alleles) and 10 (3 alleles), while the exonic and the promoter regions were highly conserved. Comparison of the allele frequencies of certain microsatellite polymorphisms among the breed groups indicated a decreasing or increasing trend in the number of repeats at different microsatellite loci, as well as the highest genetic diversity for the ancient breeds and the lowest for the most recent mountain breeds, perhaps attributable to canine domestication and recent breed formation. While a specific promoter SNP (-212A > G) is rare in the dog, it is the major allele in wolves. Replacement of this ancestral allele in domestic dogs may lead to the deletion of heat shock factor binding sites on the MAOA promoter. Dogs exhibit significant variation in certain intronic regions of the MAOA gene, while the coding and promoter regions are well-conserved. Distinct genetic differences were observed between breed groups. Further studies are now required to establish whether such polymorphisms are associated in any way with MAOA level and canine behaviour including aggression.
Yadav, Suresh Kumar; Singh, Sudhir; Gupta, Shalini; Brahma Bhatt, Madan Lal; Mishra, Durga P; Roy, D; Sanyal, Somali
2018-01-01
Genetic variations in nucleotide excision repair genes can alter the risk of squamous cell carcinoma of head and neck (SCCHN). The present study has genotyped 334 subjects from North Indian population for xeroderma pigmentosum complementation Group C (XPC) rs2228001A>C, XPC rs77907221 polyadenylate (PAT) deletion/insertion (D/I), xeroderma pigmentosum complementation Group D - rs13181A>C, and xeroderma pigmentosum complementation Type G rs17655 G>C polymorphisms with polymerase chain reaction (PCR)-restriction-fragment length polymorphism or allele-specific PCR methods. Compared to D allele, I allele for XPC PAT D/I polymorphism was associated with significantly decreased the risk of SCCHN (odds ratios = 0.67, 95% confidence interval [CI] =0.48-0.94, P = 0.03). Haplotype CI constituted from XPC polymorphisms was also associated with decreased risk of SCCHN (P = 0.004). In contrast, haplotype Crohn's disease significantly increased the risk for SCCHN (P < 0.00). A significant early onset of SCCHN was observed in individuals with CC genotype for XPC A>C polymorphism (P = 0.004). Our results suggest a possible risk modulation for SCCHN with XPC polymorphisms in North Indian population.
Association of Ugrp2 gene polymorphisms with adenoid hypertrophy in the pediatric population.
Atilla, Mahmut Huntürk; Özdaş, Sibel; Özdaş, Talih; Baştimur, Sibel; Muz, Sami Engin; Öz, Işılay; Kurt, Kenan; İzbirak, Afife; Babademez, Mehmet Ali; Vatandaş, Nilgün
2017-08-01
Adenoid hypertrophy is a condition that presents itself as the chronic enlargement of adenoid tissues; it is frequently observed in the pediatric population. The Ugrp2 gene, a member of the secretoglobin superfamily, encodes a low-molecular weight protein that functions in the differentiation of upper airway epithelial cells. However, little is known about the association of Ugrp2 genetic variations with adenoid hypertrophy. The aim of this study is to investigate the association of single nucleotide polymorphisms in the Ugrp2 gene with adenoid hypertrophy and its related phenotypes. A total of 219 children, comprising 114 patients suffering from adenoid hypertrophy and 105 healthy patients without adenoid hypertrophy, were enrolled in this study. Genotypes of the Ugrp2 gene were determined by DNA sequencing. We identified four single nucleotide polymorphisms (IVS1-189G>A, IVS1-89T>G, c.201delC, and IVS2-15G>A) in the Ugrp2 gene. Our genotype analysis showed that the Ugrp2 (IVS1-89T>G) TG and (c.201delC) CdelC genotypes and their minor alleles were associated with a considerable increase in the risk of adenoid hypertrophy compared with the controls (p=0.012, p=0.009, p=0.013, and p=0.037, respectively). Furthermore, Ugrp2 (GTdelCG, GTdelCA) haplotypes were significantly associated with adenoid hypertrophy (four single nucleotide polymorphisms ordered from 5' to 3'; p=0.0001). Polymorfism-Polymorfism interaction analysis indicated a strong interaction between combined genotypes of the Ugrp2 gene contributing to adenoid hypertrophy, as well as an increased chance of its diagnosis (p<0.0001). In addition, diplotypes carrying the mutant Ugrp2 (c.201delC) allele were strongly associated with an increased risk of adenoid hypertrophy with asthma and adenoid hypertrophy with allergies (p=0.003 and p=0.0007, respectively). Some single nucleotide polymorphisms and their combinations in the Ugrp2 gene are associated with an increased risk of developing adenoid hypertrophy. Therefore, we tried to underline the importance of genetic factors associated with adenoid hypertrophy and adenoid hypertrophy-related clinical phenotypes. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Yue, Hua; He, Jin-wei; Zhang, Hao; Wang, Chun; Hu, Wei-wei; Gu, Jie-mei; Ke, Yao-hua; Fu, Wen-zhen; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Wu, Song-hua; Zhang, Zhen-lin
2012-05-01
Myostatin gene is a member of the transforming growth factor-β (TGF-β) family that negatively regulates skeletal muscle growth. Genetic polymorphisms in Myostatin were found to be associated with the peak bone mineral density (BMD) in Chinese women. The purpose of this study was to investigate whether myostatin played a role in the normal variation in peak BMD, lean mass (LM), and fat mass (FM) of Chinese men. Four hundred male-offspring nuclear families of Chinese Han ethnic group were recruited. Anthropometric measurements, including the peak BMD, body LM and FM were measured using dual-energy X-ray absorptiometry (DXA). The single nucleotide polymorphisms (SNPs) studied were tag-SNPs selected by sequencing. Both rs2293284 and +2278GA were genotyped using TaqMan assay, and rs3791783 was genotyped with PCR-restriction fragment length polymorphism (RFLP) analysis. The associations of the SNPs with anthropometric variations were analyzed using the quantitative transmission disequilibrium test (QTDT). Using QTDT to detect within-family associations, neither single SNP nor haplotype was found to be associated with peak BMD at any bone site. However, rs3791783 was found to be significantly associated with fat mass of the trunk (P<0.001). Moreover, for within-family associations, haplotypes AGG, AAA, and TGG were found to be significantly associated with the trunk fat mass (all P<0.001). Our results suggest that genetic variation within myostatin may play a role in regulating the variation in fat mass in Chinese males. Additionally, the myostatin gene may be a candidate that determines body fat mass in Chinese men.
Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F
2016-04-01
Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.
Genetic variation and willingness to participate in epidemiologic research: data from three studies.
Bhatti, Parveen; Sigurdson, Alice J; Wang, Sophia S; Chen, Jinbo; Rothman, Nathaniel; Hartge, Patricia; Bergen, Andrew W; Landi, Maria Teresa
2005-10-01
The differences in common genetic polymorphism frequencies by willingness to participate in epidemiologic studies are unexplored, but the same threats to internal validity operate as for studies with nongenetic information. We analyzed single nucleotide polymorphism genotypes, haplotypes, and short tandem repeats among control groups from three studies with different recruitment designs that included early, late, and never questionnaire responders, one or more participation incentives, and blood or buccal DNA collection. Among 2,955 individuals, we compared 108 genotypes, 8 haplotypes, and 9 to 15 short tandem repeats by respondent type. Among our main comparisons, single nucleotide polymorphism genotype frequencies differed significantly (P < 0.05) between respondent groups in six instances, with 13 expected by chance alone. When comparing the odds of carrying a variant among the various response groups, 19 odds ratios were =0.70 or >/=1.40, levels that might be notably different. Among the various respondent group comparisons, haplotype and short tandem repeat frequencies were not significantly different by willingness to participate. We observed little evidence to suggest that genotype differences underlie response characteristics in molecular epidemiologic studies, but a greater variety of genes should be examined, including those related to behavioral traits potentially associated with willingness to participate. To the extent possible, investigators should evaluate their own genetic data for bias in response categories.
Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng
2015-01-01
Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.
Habibi, Mohsen; Mirfakhraie, Reza; Khani, Maryam; Rakhshan, Azadeh; Azargashb, Eznollah; Pouresmaeili, Farkhondeh
2017-11-15
Glucuronidation is a major pathway for elimination of exogenous and endogenous compounds such as environmental carcinogens and androgens from the body. This biochemical pathway is mediated by enzymes called uridine diphosphoglucuronosyltransferases (UGTs). Null (del/del) genes polymorphisms in UGT2B17, and UGT2B28 and D85Y single-nucleotide polymorphism (SNP) of UGT2B15 have been reported to increase the risk of prostate cancer. The goal of this study was to determine the association of mentioned genetic variants with the risk of prostate cancer. We investigated the copy number variations (CNVs) of UGT2B17 and UGT2B28 loci and the association between rs1902023 polymorphism of UGT2B15 gene in 360 subjects consisted of 120 healthy controls, 120 prostate cancer (PC) patients and 120 benign prostatic hyperplasia (BPH) patients. No association was detected for the mentioned polymorphisms and the risk of PC. However, a significant association was detected between UGT2B17 copy number variation and BPH risk (OR=2.189; 95% CI, 1.303-3.675; p=0.003). Furthermore, we observed that the D85Y polymorphism increases the risk of BPH when analyzed in combination with the copy number variation of UGT2B17 gene (OR=0.135; 95% CI, 0.036-0.512; p=0.003). Our findings suggest that the D85Y polymorphism of UGT2B15 and CNVs in UGT2B28 and UGT2B17 genes is not associated with prostate cancer risk in Iranian patients. To our knowledge, this is the first report that implicates the role of CNV of UGT2B17 gene in BPH. Copyright © 2017 Elsevier B.V. All rights reserved.
Getacher Feleke, Daniel; Nateghpour, Mehdi; Motevalli Haghi, Afsaneh; Hajjaran, Homa; Farivar, Leila; Mohebali, Mehdi; Raoofian, Reza
2015-01-01
Parasite lactate dehydrogenase (pLDH) is extensively employed as malaria rapid diagnostic tests (RDTs). Moreover, it is a well-known drug target candidate. However, the genetic diversity of this gene might influence performance of RDT kits and its drug target candidacy. This study aimed to determine polymorphism of pLDH gene from Iranian isolates of P. vivax and P. falciparum. Genomic DNA was extracted from whole blood of microscopically confirmed P. vivax and P. falciparum infected patients. pLDH gene of P. falciparum and P. vivax was amplified using conventional PCR from 43 symptomatic malaria patients from Sistan and Baluchistan Province, Southeast Iran from 2012 to 2013. Sequence analysis of 15 P. vivax LDH showed fourteen had 100% identity with P. vivax Sal-1 and Belem strains. Two nucleotide substitutions were detected with only one resulted in amino acid change. Analysis of P. falciparum LDH sequences showed six of the seven sequences had 100% homology with P. falciparum 3D7 and Mzr-1. Moreover, PfLDH displayed three nucleotide changes that resulted in changing only one amino acid. PvLDH and PfLDH showed 75%-76% nucleotide and 90.4%-90.76% amino acid homology. pLDH gene from Iranian P. falciparum and P. vivax isolates displayed 98.8-100% homology with 1-3 nucleotide substitutions. This indicated this gene was relatively conserved. Additional studies can be done weather this genetic variation can influence the performance of pLDH based RDTs or not.
Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan
2018-01-01
To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.
Natarajan, Sathishkumar; Kim, Hoy-Taek; Thamilarasan, Senthil Kumar; Veerappan, Karpagam; Park, Jong-In; Nou, Ill-Sup
2016-01-01
Powdery mildew is one of the most common fungal diseases in the world. This disease frequently affects melon (Cucumis melo L.) and other Cucurbitaceous family crops in both open field and greenhouse cultivation. One of the goals of genomics is to identify the polymorphic loci responsible for variation in phenotypic traits. In this study, powdery mildew disease assessment scores were calculated for four melon accessions, 'SCNU1154', 'Edisto47', 'MR-1', and 'PMR5'. To investigate the genetic variation of these accessions, whole genome re-sequencing using the Illumina HiSeq 2000 platform was performed. A total of 754,759,704 quality-filtered reads were generated, with an average of 82.64% coverage relative to the reference genome. Comparisons of the sequences for the melon accessions revealed around 7.4 million single nucleotide polymorphisms (SNPs), 1.9 million InDels, and 182,398 putative structural variations (SVs). Functional enrichment analysis of detected variations classified them into biological process, cellular component and molecular function categories. Further, a disease-associated QTL map was constructed for 390 SNPs and 45 InDels identified as related to defense-response genes. Among them 112 SNPs and 12 InDels were observed in powdery mildew responsive chromosomes. Accordingly, this whole genome re-sequencing study identified SNPs and InDels associated with defense genes that will serve as candidate polymorphisms in the search for sources of resistance against powdery mildew disease and could accelerate marker-assisted breeding in melon.
Kim, S-J; Young, L J; Gonen, D; Veenstra-VanderWeele, J; Courchesne, R; Courchesne, E; Lord, C; Leventhal, B L; Cook, E H; Insel, T R
2002-01-01
Impairment in social reciprocity is a central component of autism. In preclinical studies, arginine vasopressin (AVP) has been shown to increase a range of social behaviors, including affiliation and attachment, via the V(1a) receptor (AVPR1A) in the brain. Both the behavioral effects of AVP and the neural distribution of the V1a receptor vary greatly across mammalian species. This difference in regional receptor expression as well as differences in social behavior may result from a highly variable repetitive sequence in the 5' flanking region of the V1a gene (AVPR1A). Given this comparative evidence for a role in inter-species variation in social behavior, we explored whether within our own species, variation in the human AVPR1A may contribute to individual variations in social behavior, with autism representing an extreme form of social impairment. We genotyped two microsatellite polymorphisms from the 5' flanking region of AVPR1A for 115 autism trios and found nominally significant transmission disequilibrium between autism and one of the microsatellite markers by Multiallelic Transmission/Disequilibrium test (MTDT) that was not significant after Bonferroni correction. We also screened approximately 2 kb of the 5' flanking region and the coding region and identified 10 single nucleotide polymorphisms.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Phase variation and microevolution at homopolymeric tracts in Bordetella pertussis
Gogol, Emily B; Cummings, Craig A; Burns, Ryan C; Relman, David A
2007-01-01
Background Bordetella pertussis, the causative agent of whooping cough, is a highly clonal pathogen of the respiratory tract. Its lack of genetic diversity, relative to many bacterial pathogens, could limit its ability to adapt to a hostile and changing host environment. This limitation might be overcome by phase variation, as observed for other mucosal pathogens. One of the most common mechanisms of phase variation is reversible expansion or contraction of homopolymeric tracts (HPTs). Results The genomes of B. pertussis and the two closely related species, B. bronchiseptica and B. parapertussis, were screened for homopolymeric tracts longer than expected on the basis of chance, given their nucleotide compositions. Sixty-nine such HPTs were found in total among the three genomes, 74% of which were polymorphic among the three species. Nine HPTs were genotyped in a collection of 90 geographically and temporally diverse B. pertussis strains using the polymerase chain reaction/ligase detection reaction (PCR/LDR) assay. Six HPTs were polymorphic in this collection of B. pertussis strains. Of note, one of these polymorphic HPTs was found in the fimX promoter, where a single base insertion variant was present in seven strains, all of which were isolated prior to introduction of the pertussis vaccine. Transcript abundance of fimX was found to be 3.8-fold lower in strains carrying the longer allele. HPTs in three other genes, tcfA, bapC, and BP3651, varied widely in composition across the strain collection and displayed allelic polymorphism within single cultures. Conclusion Allelic polymorphism at homopolymeric tracts is common within the B. pertussis genome. Phase variability may be an important mechanism in B. pertussis for evasion of the immune system and adaptation to different niches in the human host. High sensitivity and specificity make the PCR/LDR assay a powerful tool for investigating allelic variation at HPTs. Using this method, allelic diversity and phase variation were demonstrated at several B. pertussis loci. PMID:17509142
Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi
2017-06-13
We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
USDA-ARS?s Scientific Manuscript database
High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...
Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C
1993-01-01
DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)
Laska, Magdalena J; Nexø, Bjørn A; Vistisen, Kirsten; Poulsen, Henrik Enghusen; Loft, Steffen; Vogel, Ulla
2005-07-28
Testicular cancer has been suggested to be primed in utero and there is familiar occurrence, particularly brothers and sons of men with testicular cancer have increased risk. Although no specific causative genotoxic agents have been identified, variations in DNA repair capacity could be associated with the risk of testicular cancer. A case-control study of 184 testicular cancer cases and 194 population-based controls living in the Copenhagen Greater Area in Denmark was performed. We found that neither polymorphisms in several DNA repair genes nor alleles of several polymorphisms in the chromosomal of region 19q13.2-3, encompassing the genes ASE, ERCC1, RAI and XPD, were associated with risk of testicular cancer in Danish patients. This is in contrast to other cancers, where we reported strong associations between polymorphisms in ERCC1, ASE and RAI and occurrence of basal cell carcinoma, breast cancer and lung. To our knowledge this is the first study of DNA repair gene polymorphisms and risk of testicular cancer.
Kovács, Krisztina; Virányi, Zsófia; Kis, Anna; Turcsán, Borbála; Hudecz, Ágnes; Marmota, Maria T; Koller, Dóra; Rónai, Zsolt; Gácsi, Márta; Topál, József
2018-01-01
Variations in human infants' attachment behavior are associated with single nucleotide polymorphisms (SNPs) in the oxytocin receptor (OXTR) gene, suggesting a genetic component to infant-mother attachment. However, due to the genetic relatedness of infants and their mothers, it is difficult to separate the genetic effects of infants' OXTR genotype from the environmental effects of mothers' genotype possibly affecting their parental behavior. The apparent functional analogy between child-parent and dog-owner relationship, however, offers a way to disentangle the effects of these factors because pet dogs are not genetically related to their caregivers. In the present study we investigated whether single nucleotide polymorphisms of pet dogs' OXTR gene (-213AG,-94TC,-74CG) and their owners' OXTR gene (rs53576, rs1042778, rs2254298) are associated with components of dog-owner attachment. In order to investigate whether social-environmental effects modulate the potential genetic influence on attachment, dogs and their owners from two different countries (Austria and Hungary, N = 135 in total) were tested in a modified version of the Ainsworth Strange Situation Test (SST) and questionnaires were also used to collect information about owner personality and attachment style. We coded variables related to three components of attachment behavior in dogs: their sensitivity to the separation from and interaction with the owner (Attachment), stress caused by the unfamiliar environment (Anxiety), and their responsiveness to the stranger (Acceptance). We found that (1) dogs' behavior was significantly associated with polymorphisms in both dogs' and owners' OXTR gene, (2) SNPs in dogs' and owners' OXTR gene interactively influenced dog-human relationship, (3) dogs' attachment behavior was affected by the country of origin, and (4) it was related to their owners' personality as well as attachment style. Thus, the present study provides evidence, for the first time, that both genetic variation in the OXTR gene and various aspects of pet dogs' environmental background are associated with their attachment to their human caregivers.
Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting
2007-01-01
The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383
Lin, Wei-Jye; Salton, Stephen R
2013-01-01
The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired.
Lin, Wei-Jye; Salton, Stephen R.
2013-01-01
The regulated secretory pathway provides critical control of peptide, growth factor, and hormone release from neuroendocrine and endocrine cells, and neurons, maintaining physiological homeostasis. Propeptides and prohormones are packaged into dense core granules (DCGs), where they frequently undergo tissue-specific processing as the DCG matures. Proteins of the granin family are DCG components, and although their function is not fully understood, data suggest they are involved in DCG formation and regulated protein/peptide secretion, in addition to their role as precursors of bioactive peptides. Association of gene variation, including single nucleotide polymorphisms (SNPs), with neuropsychiatric, endocrine, and metabolic diseases, has implicated specific secreted proteins and peptides in disease pathogenesis. For example, a SNP at position 196 (G/A) of the human brain-derived neurotrophic factor gene dysregulates protein processing and secretion and leads to cognitive impairment. This suggests more generally that variants identified in genes encoding secreted growth factors, peptides, hormones, and proteins involved in DCG biogenesis, protein processing, and the secretory apparatus, could provide insight into the process of regulated secretion as well as disorders that result when it is impaired. PMID:23964269
Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N
2016-04-01
Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.
Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.
2015-01-01
Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239
USDA-ARS?s Scientific Manuscript database
Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...
Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms
USDA-ARS?s Scientific Manuscript database
We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...
USDA-ARS?s Scientific Manuscript database
Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...
USDA-ARS?s Scientific Manuscript database
Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...
USDA-ARS?s Scientific Manuscript database
Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...
USDA-ARS?s Scientific Manuscript database
Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...
Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Molecular population genetics of inversion breakpoint regions in Drosophila pseudoobscura.
Wallace, Andre G; Detweiler, Don; Schaeffer, Stephen W
2013-07-08
Paracentric inversions in populations can have a profound effect on the pattern and organization of nucleotide variability along a chromosome. Regions near inversion breakpoints are expected to have greater levels of differentiation because of reduced genetic exchange between different gene arrangements whereas central regions in the inverted segments are predicted to have lower levels of nucleotide differentiation due to greater levels of genetic flux among different karyotypes. We used the inversion polymorphism on the third chromosome of Drosophila pseudoobscura to test these predictions with an analysis of nucleotide diversity of 18 genetic markers near and away from inversion breakpoints. We tested hypotheses about how the presence of different chromosomal arrangements affects the pattern and organization of nucleotide variation. Overall, markers in the distal segment of the chromosome had greater levels of nucleotide heterozygosity than markers within the proximal segment of the chromosome. In addition, our results rejected the hypothesis that the breakpoints of derived inversions will have lower levels of nucleotide variability than breakpoints of ancestral inversions, even when strains with gene conversion events were removed. High levels of linkage disequilibrium were observed within all 11 breakpoint regions as well as between the ends of most proximal and distal breakpoints. The central region of the chromosome had the greatest levels of linkage disequilibrium compared with the proximal and distal regions because this is the region that experiences the highest level of recombination suppression. These data do not fully support the idea that genetic exchange is the sole force that influences genetic variation on inverted chromosomes.
Cronin, Matthew A; Cánovas, Angela; Bannasch, Danika L; Oberbauer, Anita M; Medrano, Juan F
2015-01-01
There is considerable interest in the genetics of wolves (Canis lupus) because of their close relationship to domestic dogs (C. familiaris) and the need for informed conservation and management. This includes wolf populations in Southeast Alaska for which we determined genotypes of 305 wolves at 173662 single nucleotide polymorphism (SNP) loci. After removal of invariant and linked SNP, 123801 SNP were used to quantify genetic differentiation of wolves in Southeast Alaska and wolves, coyotes (C. latrans), and dogs from other areas in North America. There is differentiation of SNP allele frequencies between the species (wolves, coyotes, and dogs), although differentiation is relatively low between some wolf and coyote populations. There are varying levels of differentiation among populations of wolves, including low differentiation of wolves in interior Alaska, British Columbia, and the northern US Rocky Mountains. There is considerable differentiation of SNP allele frequencies of wolves in Southeast Alaska from wolves in other areas. However, wolves in Southeast Alaska are not a genetically homogeneous group and there are comparable levels of genetic differentiation among areas within Southeast Alaska and between Southeast Alaska and other geographic areas. SNP variation and other genetic data are discussed regarding taxonomy and management. © The American Genetic Association 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Cánovas, A; Rincón, G; Islas-Trejo, A; Jimenez-Flores, R; Laubscher, A; Medrano, J F
2013-04-01
The technological properties of milk have significant importance for the dairy industry. Citrate, a normal constituent of milk, forms one of the main buffer systems that regulate the equilibrium between Ca(2+) and H(+) ions. Higher-than-normal citrate content is associated with poor coagulation properties of milk. To identify the genes responsible for the variation of citrate content in milk in dairy cattle, the metabolic steps involved in citrate and fatty acid synthesis pathways in ruminant mammary tissue using RNA sequencing were studied. Genetic markers that could influence milk citrate content in Holstein cows were used in a marker-trait association study to establish the relationship between 74 single nucleotide polymorphisms (SNP) in 20 candidate genes and citrate content in 250 Holstein cows. This analysis revealed 6 SNP in key metabolic pathway genes [isocitrate dehydrogenase 1 (NADP+), soluble (IDH1); pyruvate dehydrogenase (lipoamide) β (PDHB); pyruvate kinase (PKM2); and solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1)] significantly associated with increased milk citrate content. The amount of the phenotypic variation explained by the 6 SNP ranged from 10.1 to 13.7%. Also, genotype-combination analysis revealed the highest phenotypic variation was explained combining IDH1_23211, PDHB_5562, and SLC25A1_4446 genotypes. This specific genotype combination explained 21.3% of the phenotypic variation. The largest citrate associated effect was in the 3' untranslated region of the SLC25A1 gene, which is responsible for the transport of citrate across the mitochondrial inner membrane. This study provides an approach using RNA sequencing, metabolic pathway analysis, and association studies to identify genetic variation in functional target genes determining complex trait phenotypes. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Demirci, F Yesim K; Manzi, Susan; Ramsey-Goldman, Rosalind; Kenney, Margaret; Shaw, Penny S; Dunlop-Thomas, Charmayne M; Kao, Amy H; Rhew, Elisa Y; Bontempo, Franklin; Kammerer, Candace; Kamboh, M Ilyas
2007-08-01
Toll-like receptors (TLR) play an important role in both adaptive and innate immunity. Variations in TLR genes have been shown to be associated with various infectious and inflammatory diseases. We investigated the association of TLR5 (Arg392Stop, rs5744168) and TLR9 (-1237T-->C, rs5743836) single nucleotide polymorphisms (SNP) with systemic lupus erythematosus (SLE) in Caucasian American subjects. We performed a case-control association study and genotyped 409 Caucasian women with SLE and 509 Caucasian healthy female controls using TaqMan allelic discrimination (rs5744168) or polymerase chain reaction-restriction fragment length polymorphism analysis (rs5743836). None of the 2 TLR SNP showed a statistically significant association with SLE risk in our cohort. Our results do not indicate a major influence of these putative functional TLR SNP on the susceptibility to (or protection from) SLE.
Khadem, M; Munté, A; Camacho, R; Aguadé, M; Segarra, C
2012-04-01
Drosophila madeirensis is an endemic species of Madeira that inhabits the island Laurisilva forest. Nucleotide variation in D. madeirensis is analysed in six genomic regions and compared to that previously reported for the same regions in Drosophila subobscura, an abundant species in the Palearctic region that is closely related to D. madeirensis. The gene regions analysed are distributed along the O(3) inversion. The O(3) arrangement is monomorphic in D. madeirensis, and it was present in ancestral populations of D. subobscura but went extinct in this species after the origin of the derived O(ST) and O(3+4) arrangements. Levels of nucleotide polymorphism in D. madeirensis are similar to those present in the O(ST) and O(3+4) arrangements of D. subobscura, and the frequency spectrum is skewed towards rare variants. Purifying selection against deleterious nonsynonymous mutations is less effective in D. madeirensis. Although D. madeirensis and D. subobscura coexist at present in Madeira, no clear evidence of introgression was detected in the studied regions. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.
Integrating common and rare genetic variation in diverse human populations.
Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Dermitzakis, Emmanouil; Schaffner, Stephen F; Yu, Fuli; Peltonen, Leena; Dermitzakis, Emmanouil; Bonnen, Penelope E; Altshuler, David M; Gibbs, Richard A; de Bakker, Paul I W; Deloukas, Panos; Gabriel, Stacey B; Gwilliam, Rhian; Hunt, Sarah; Inouye, Michael; Jia, Xiaoming; Palotie, Aarno; Parkin, Melissa; Whittaker, Pamela; Yu, Fuli; Chang, Kyle; Hawes, Alicia; Lewis, Lora R; Ren, Yanru; Wheeler, David; Gibbs, Richard A; Muzny, Donna Marie; Barnes, Chris; Darvishi, Katayoon; Hurles, Matthew; Korn, Joshua M; Kristiansson, Kati; Lee, Charles; McCarrol, Steven A; Nemesh, James; Dermitzakis, Emmanouil; Keinan, Alon; Montgomery, Stephen B; Pollack, Samuela; Price, Alkes L; Soranzo, Nicole; Bonnen, Penelope E; Gibbs, Richard A; Gonzaga-Jauregui, Claudia; Keinan, Alon; Price, Alkes L; Yu, Fuli; Anttila, Verneri; Brodeur, Wendy; Daly, Mark J; Leslie, Stephen; McVean, Gil; Moutsianas, Loukas; Nguyen, Huy; Schaffner, Stephen F; Zhang, Qingrun; Ghori, Mohammed J R; McGinnis, Ralph; McLaren, William; Pollack, Samuela; Price, Alkes L; Schaffner, Stephen F; Takeuchi, Fumihiko; Grossman, Sharon R; Shlyakhter, Ilya; Hostetter, Elizabeth B; Sabeti, Pardis C; Adebamowo, Clement A; Foster, Morris W; Gordon, Deborah R; Licinio, Julio; Manca, Maria Cristina; Marshall, Patricia A; Matsuda, Ichiro; Ngare, Duncan; Wang, Vivian Ota; Reddy, Deepa; Rotimi, Charles N; Royal, Charmaine D; Sharp, Richard R; Zeng, Changqing; Brooks, Lisa D; McEwen, Jean E
2010-09-02
Despite great progress in identifying genetic variants that influence human disease, most inherited risk remains unexplained. A more complete understanding requires genome-wide studies that fully examine less common alleles in populations with a wide range of ancestry. To inform the design and interpretation of such studies, we genotyped 1.6 million common single nucleotide polymorphisms (SNPs) in 1,184 reference individuals from 11 global populations, and sequenced ten 100-kilobase regions in 692 of these individuals. This integrated data set of common and rare alleles, called 'HapMap 3', includes both SNPs and copy number polymorphisms (CNPs). We characterized population-specific differences among low-frequency variants, measured the improvement in imputation accuracy afforded by the larger reference panel, especially in imputing SNPs with a minor allele frequency of
Tabak, Benjamin A; McCullough, Michael E; Carver, Charles S; Pedersen, Eric J; Cuccaro, Michael L
2014-06-01
Variations in the gene that encodes the oxytocin receptor (OXTR) have been associated with many aspects of social cognition as well as several prosocial behaviors. However, potential associations of OXTR variants with reactions to betrayals of trust while cooperating for mutual benefit have not yet been explored. We examined how variations in 10 single-nucleotide polymorphisms on OXTR were associated with behavior and emotional reactions after a betrayal of trust in an iterated Prisoner's Dilemma Game. After correction for multiple testing, one haplotype (C-rs9840864, T-rs2268494) was significantly associated with faster retaliation post-betrayal-an association that appeared to be due to this haplotype's intermediate effect of exacerbating people's anger after they had been betrayed. Furthermore, a second haplotype (A-rs237887, C-rs2268490) was associated with higher levels of post-betrayal satisfaction, and a third haplotype (G-rs237887, C-rs2268490) was associated with lower levels of post-betrayal satisfaction. © The Author (2013). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Wang, Jiqing; Zhou, Huitong; Forrest, Rachel H J; Hu, Jiang; Liu, Xiu; Li, Shaobin; Luo, Yuzhu; Hickford, Jon G H
2017-09-01
Myogenic factor 5 (MYF5) plays an important role in regulating skeletal muscle, but to date there have been no reports on whether the gene is variable and whether this variation is associated with meat yield in sheep. In this study, four variants (A to D) of ovine MYF5 containing two Single Nucleotide Polymorphisms (SNPs) and one basepair (bp) insertion/deletion were detected by Polymerase Chain Reaction - Single Stranded Conformational Polymorphism (PCR-SSCP) analysis. Breed differences in variant frequencies were observed. The effect of variation in ovine MYF5 on lean meat yield, predicted using VIAScan® technology, was investigated in 388 male NZ Romney lambs. Only genotypes AA and AB were found in these lambs. Lambs with genotype AA had a higher leg yield (P=0.044), loin yield (P=0.002) and total yield (P=0.012) than those with genotype AB. No association with shoulder yield was detected. These results suggest that ovine MYF5 may be a valuable genetic marker for improved lean meat yield. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rut, Marcin; Machoy-Mokrzyńska, Anna; Ręcławowicz, Daniel; Słoniewski, Paweł; Kurzawski, Mateusz; Droździk, Marek; Safranow, Krzysztof; Morawska, Michalina; Białecka, Monika
2014-02-01
This study was aimed at the evaluation of the relationship between genetic polymorphisms of catechol-O-methyltransferase (COMT) (rs4680:A > G-Val158Met, rs6269:A > G, rs4633:C > T, rs4818:C > G) and pain sensitivity after lumbar discectomy. All patients had one-level symptomatic disc herniation from L3 to S1. The primary data recorded included visual analogue pain scales assessing back and leg pain, Oswestry Disability Questionnaire assessing quality of life and pain intensity, received/filled pre- and postoperatively. Each subject was genotyped for single-nucleotide polymorphism in the COMT gene. Clinical outcome was measured by difference between pre- and postoperative values and those results were analyzed with genetics findings. Pain intensity was associated with the COMT polymorphism. Carriers of rs6269 AA, rs4633 TT, rs4818 CC, and rs4680 AA genotypes were characterized by the lowest preoperative scores related to pain intensity and lower pain intensity at 1 year after the surgery. The rs4633 CC, rs4680 GG genotypes demonstrated significant clinical improvement in VASBACK score at 1 year after the surgery. Patients with COMT haplotype associated with low metabolic activity of enzyme (A_C_C_G) showed better clinical outcome measured by ODI score and VASBACK score 1 year after surgery. We did not observe any significant correlation between leg pain and single-nucleotide polymorphisms in the COMT gene. The results of our study indicate that polymorphism in the COMT gene may play an important role in the mechanism of pain perception, which may have a potential implication for clinical decision-making in the future.
Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.
Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O
2009-02-01
Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.
Kilpeläinen, Tuomas O; Lakka, Timo A; Laaksonen, David E; Mager, Ursula; Salopuro, Titta; Kubaszek, Agata; Todorova, Boryana; Laukkanen, Olli; Lindström, Jaana; Eriksson, Johan G; Hämäläinen, Helena; Aunola, Sirkka; Ilanne-Parikka, Pirjo; Keinänen-Kiukaanniemi, Sirkka; Tuomilehto, Jaako; Laakso, Markku; Uusitupa, Matti
2008-03-01
Single nucleotide polymorphisms (SNPs) in the ADRB2, ADRB3, TNF, IL6, IGF1R, LIPC, LEPR, and GHRL genes were associated with the conversion from impaired glucose tolerance (IGT) to type 2 diabetes mellitus (T2D) in the Finnish Diabetes Prevention Study (DPS). In this study, we determined whether polymorphisms in these genes modified the effect of changes in physical activity (PA) on the risk of T2D in the DPS. Moreover, we assessed whether the polymorphisms modified the effect of changes in PA on changes in measures of body fat, serum lipids, and blood pressure during the first year of the follow-up of the DPS. Overweight subjects with IGT (n = 487) were followed for an average of 4.1 years, and PA was assessed annually with a questionnaire. The interactions of the polymorphisms with changes in total and moderate-to-vigorous PA on the conversion to T2D during the 4.1-year follow-up were assessed using Cox regression with adjustments for the other components of the intervention (dietary changes, weight reduction). Univariate analysis of variance was used to assess interactions on changes in continuous variables during the first year of the follow-up. No interaction between the polymorphisms and PA on the conversion to T2D was found. The Leu72Met (rs696217) polymorphism in GHRL modified the effect of moderate-to-vigorous PA on changes in weight and waist circumference, the -501A/C (rs26802) polymorphism in GHRL modified the effect of total and moderate-to-vigorous PA on change in high-density lipoprotein cholesterol, and the Lys109Arg (rs1137100) polymorphism in LEPR modified the effect of total PA on change in blood pressure. In conclusion, genetic variation may modify the magnitude of the beneficial effects of PA on characteristics of the metabolic syndrome in persons with IGT.
NASA Astrophysics Data System (ADS)
Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.
2015-11-01
Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.
Nakaoka, Hirofumi; Takahashi, Tomoko; Akiyama, Koichi; Cui, Tailin; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hata, Akira; Inoue, Ituro
2010-08-01
Recently, a genome-wide association study identified associations between single nucleotide polymorphisms on chromosome 9p21 and risk of harboring intracranial aneurysm (IA). Aneurysm characteristics or subphenotypes of IAs, such as history of subarachnoid hemorrhage, presence of multiple IAs and location of IAs, are clinically important. We investigated whether the association between 9p21 variation and risk of IA varied among these subphenotypes. We conducted a case-control study of 981 cases and 699 controls in Japanese. Four single nucleotide polymorphisms tagging the 9p21 risk locus were genotyped. The OR and 95% CI were estimated using logistic regression analyses. Among the 4 single nucleotide polymorphisms, rs1333040 showed the strongest evidence of association with IA (P=1.5x10(-6); per allele OR, 1.43; 95% CI, 1.24-1.66). None of the patient characteristics (gender, age, smoking, and hypertension) was a significant confounder or effect modifier of the association. Subgroup analyses of IA subphenotypes showed that among the most common sites of IAs, the association was strongest for IAs of the posterior communicating artery (OR, 1.69; 95% CI, 1.26-2.26) and not significant for IAs in the anterior communicating artery (OR, 1.22; 95% CI, 0.96-1.57). When dichotomizing IA sites, the association was stronger for IAs of the posterior circulation-posterior communicating artery group (OR, 1.73; 95% CI, 1.32-2.26) vs the anterior circulation group (OR, 1.28; 95% CI, 1.07-1.53). Heterogeneity in these ORs was significant (P=0.032). The associations did not vary when stratifying by history of subarachnoid hemorrhage (OR, 1.42; 95% CI, 1.18-1.71 for ruptured IA; OR, 1.27; 95% CI, 1.00-1.62 for unruptured IA) or by multiplicity of IA (OR, 1.57; 95% CI, 1.21-2.03 for multiple IAs; OR, 1.36; 95% CI, 1.15-1.61 for single IA). Our results suggest that genetic influence on formation may vary between IA subphenotypes.
USDA-ARS?s Scientific Manuscript database
Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...
USDA-ARS?s Scientific Manuscript database
Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...
Prospects for inferring pairwise relationships with single nucleotide polymorphisms
Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody
2003-01-01
An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...
USDA-ARS?s Scientific Manuscript database
Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...
USDA-ARS?s Scientific Manuscript database
Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...
Neutral theory, microbial practice: challenges in bacterial population genetics.
Rocha, Eduardo P C
2018-04-19
Kimura's outstanding contributions to population genetics included many elegant theoretical results on the vagaries of alleles in populations. Once polymorphism data showed extensive variation in natural populations, these results led naturally to the Neutral Theory. In this article, I'll depart from some of these results to focus on four major open problems in microbial population genetics with direct implications to the study of molecular evolution: the lack of neutral polymorphism, the modeling of genetic exchanges, the population genetics of ill-defined populations, and the difficulty of untangling selection and demography in the light of the previous issues. Whilst studies in population genetics usually focus on single nucleotide polymorphism and allelic recombination, ignoring even small indels, a large fraction of genetic diversification in Bacteria results from horizontal gene transfer. Ignoring this fact defeats the purpose of population genetics: to characterize the genetic variation in populations and their adaptive effects. I'll argue that, following on Kimura's life work, one may need to develop new approaches to study microbes that reproduce asexually but are able to engage in gene exchanges with very distantly related organisms in a context where random sampling is often unachievable, populations are ill-defined, genetic linkage is strong, and random drift is rare.
Genetic polymorphisms of 54 mitochondrial DNA SNP loci in Chinese Xibe ethnic minority group
Shen, Chun-Mei; Hu, Li; Yang, Chun-Hua; Yin, Cai-Yong; Li, Zhi-Dan; Meng, Hao-Tian; Guo, Yu-Xin; Mei, Ting; Chen, Feng; Zhu, Bo-Feng
2017-01-01
We analyzed the genetic polymorphisms of 54 mitochondrial DNA (mtDNA) variants in Chinese Xibe ethnic minority group. A total of 137 unrelated healthy volunteers from Chinese Xibe group were the objects of our study. Among the selected loci, there were 51 variable positions including transitions and transversions, and single nucleotide transitions were common (83.93%) versus transversions. These variations defined 64 different mtDNA haplotypes exclusive of (CA)n and 9 bp deletion variation. The haplotype diversity and discrimination power in Xibe population were 0.9800 ± 0.004 and 0.9699, respectively. Besides, we compared Xibe group with 18 other populations and reconstructed a phylogenetic tree using Neighbor-Joining method. The result revealed that Xibe group was a close to Xinjiang Han and Yanbian Korean groups. Our data also indicated that Xibe group has a close relationship with Daur and Ewenki groups, which is reflected by the history that Xibe was influenced by Daur and Ewenki groups during the development of these groups. In conclusion, the variants we studied are polymorphic and could be used as informative genetic markers for forensic and population genetic application. PMID:28327596
Kambeitz, Joseph P; Bhattacharyya, Sagnik; Kambeitz-Ilankovic, Lana M; Valli, Isabel; Collier, David A; McGuire, Philip
2012-10-01
Brain derived neurotrophic factor (BDNF) is a critical component of the molecular mechanism of memory formation. Variation in the BDNF gene, particularly the rs6265 (val(66)met) single nucleotide polymorphism (SNP), has been linked to variability in human memory performance and to both the structure and physiological response of the hippocampus, which plays a central role in memory processing. However, these effects have not been consistently reported, which may reflect the modest size of the samples studied to date. Employing a meta-analytic approach, we examined the effect of the BDNF val(66)met polymorphism on human memory (5922 subjects) and hippocampal structure (2985 subjects) and physiology (362 subjects). Our results suggest that variations in the rs6265 SNP of the BDNF gene have a significant effect on memory performance, and on both the structure and physiology of the hippocampus, with carriers of the met allele being adversely affected. These results underscore the role of BDNF in moderating variability between individuals in human memory performance and in mediating some of the neurocognitive impairments underlying neuropsychiatric disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.
Zhang, Shuo; Ji, Guofa; Liang, Yiqian; Zhang, Rui; Shi, Puyu; Guo, Dangshe; Li, Chunqi; Feng, Jing; Liu, Feng; Peng, Rong; Chen, Mingwei
2017-01-06
The role of telomere in genomic stability is an established fact. Variation in leukocyte telomere length (LTL) has been considered a crucial factor that associated with age-associated diseases. To elucidate the association between LTL variation and ischemic stroke (IS) risk, we selected ten single nucleotide polymorphisms (SNPs) in three genes (TERC, TERT and RTEL1) that previously reported link to LTL, and genotyped SNPs of these genes in a case-control study. The association between polymorphisms and IS risk were tested by Chi squared test and haplotype analysis. In allele association analysis, allele "C" in rs10936599 of TERC gene and allele "G" in rs2853677 of TERT gene were found to have an increased risk of IS when compared with allele "T" and "A", respectively. Model association analysis showed that genotype "G/A" in the overdominant model and genotypes "G/A" and "A/A" in the dominant model of rs2242652 presented a more likelihood to have IS. Another TERT locus (rs2853677) with genotype "G" was also found IS-related risky in the log-additive model. Taken together, our results suggest a potential association between LTL related TERC, TERT gene variants and ischemic stroke risk.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Zeng, Ling; Gu, Wei; Chen, Kehong; Jiang, Dongpo; Zhang, Lianyang; Du, Dingyuan; Hu, Ping; Liu, Qing; Huang, Suna; Jiang, Jianxin
2009-01-01
An excessive inflammatory response is thought to account for the pathogenesis of sepsis and multiple organ dysfunction syndrome (MODS) after severe trauma. The interleukin-10 (IL-10) is a potent anti-inflammatory cytokine. The objectives of this prospective study were to investigate the distribution of IL-10 promoter polymorphisms in a cohort of 308 Chinese Han patients with major trauma, and to identify associations of IL-10 promoter polymorphisms with IL-10 production and incidence of sepsis and MODS. A total of 308 patients with major trauma were included in this study. The genotypes of polymorphisms -1082, -819 and -592 were determined by polymerase chain reaction-restriction fragment length polymorphism. The IL-10 levels in the supernatants were determined with enzyme-linked immunoabsorbent assay. The -1082A and -592A alleles were significantly associated with lower lipopolysaccharide-induced IL-10 production in an allele-dose dependent fashion. There was no significant difference for the -819 polymorphism. Except for the -1082 polymorphism, the -819 and -592 polymorphisms were not significantly associated with sepsis morbidity rate and MOD scores. Our results further confirm the functionality of the IL-10 promoter single nucleotide polymorphisms in relation to IL-10 production. They also suggest that individual difference in IL-10 production in trauma patients might be at least in part related to genetic variations in the IL-10 promoter region.
Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał
2017-09-01
It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.
Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng
2015-01-01
Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697
Cross-host evolution of severe acute respiratory syndrome coronavirus in palm civet and human
Song, Huai-Dong; Tu, Chang-Chun; Zhang, Guo-Wei; Wang, Sheng-Yue; Zheng, Kui; Lei, Lian-Cheng; Chen, Qiu-Xia; Gao, Yu-Wei; Zhou, Hui-Qiong; Xiang, Hua; Zheng, Hua-Jun; Chern, Shur-Wern Wang; Cheng, Feng; Pan, Chun-Ming; Xuan, Hua; Chen, Sai-Juan; Luo, Hui-Ming; Zhou, Duan-Hua; Liu, Yu-Fei; He, Jian-Feng; Qin, Peng-Zhe; Li, Ling-Hui; Ren, Yu-Qi; Liang, Wen-Jia; Yu, Ye-Dong; Anderson, Larry; Wang, Ming; Xu, Rui-Heng; Wu, Xin-Wei; Zheng, Huan-Ying; Chen, Jin-Ding; Liang, Guodong; Gao, Yang; Liao, Ming; Fang, Ling; Jiang, Li-Yun; Li, Hui; Chen, Fang; Di, Biao; He, Li-Juan; Lin, Jin-Yan; Tong, Suxiang; Kong, Xiangang; Du, Lin; Hao, Pei; Tang, Hua; Bernini, Andrea; Yu, Xiao-Jing; Spiga, Ottavia; Guo, Zong-Ming; Pan, Hai-Yan; He, Wei-Zhong; Manuguerra, Jean-Claude; Fontanet, Arnaud; Danchin, Antoine; Niccolai, Neri; Li, Yi-Xue; Wu, Chung-I; Zhao, Guo-Ping
2005-01-01
The genomic sequences of severe acute respiratory syndrome coronaviruses from human and palm civet of the 2003/2004 outbreak in the city of Guangzhou, China, were nearly identical. Phylogenetic analysis suggested an independent viral invasion from animal to human in this new episode. Combining all existing data but excluding singletons, we identified 202 single-nucleotide variations. Among them, 17 are polymorphic in palm civets only. The ratio of nonsynonymous/synonymous nucleotide substitution in palm civets collected 1 yr apart from different geographic locations is very high, suggesting a rapid evolving process of viral proteins in civet as well, much like their adaptation in the human host in the early 2002–2003 epidemic. Major genetic variations in some critical genes, particularly the Spike gene, seemed essential for the transition from animal-to-human transmission to human-to-human transmission, which eventually caused the first severe acute respiratory syndrome outbreak of 2002/2003. PMID:15695582
2013-01-01
Background Rice blast caused by the fungus Magnaporthe oryzae is an important disease in virtually every rice growing region of the world, which leads to significant annual decreases of grain quality and yield. To prevent disease, resistance genes in rice have been cloned and introduced into susceptible cultivars. However, introduced resistance can often be broken within few years of release, often due to mutation of cognate avirulence genes in fungal field populations. Results To better understand the pattern of mutation of M. oryzae field isolates under natural selection forces, we used a next generation sequencing approach to analyze the genomes of two field isolates FJ81278 and HN19311, as well as the transcriptome of FJ81278. By comparing the de novo genome assemblies of the two isolates against the finished reference strain 70–15, we identified extensive polymorphisms including unique genes, SNPs (single nucleotide polymorphism) and indels, structural variations, copy number variations, and loci under strong positive selection. The 1.75 MB of isolate-specific genome content carrying 118 novel genes from FJ81278, and 0.83 MB from HN19311 were also identified. By analyzing secreted proteins carrying polymorphisms, in total 256 candidate virulence effectors were found and 6 were chosen for functional characterization. Conclusions We provide results from genome comparison analysis showing extensive genome variation, and generated a list of M. oryzae candidate virulence effectors for functional characterization. PMID:24341723
Parsons, Michael J; Lester, Kathryn J; Barclay, Nicola L; Archer, Simon N; Nolan, Patrick M; Eley, Thalia C; Gregory, Alice M
2014-01-01
Sleep and circadian rhythms are intrinsically linked, with several sleep traits, including sleep timing and duration, influenced by both sleep homeostasis and the circadian phase. Genetic variation in several circadian genes has been associated with diurnal preference (preference in timing of sleep), although there has been limited research on whether they are associated with other sleep measurements. We investigated whether these genetic variations were associated with diurnal preference (Morningness–Eveningness Questionnaire) and various sleep measures, including: the global Pittsburgh Sleep Quality index score; sleep duration; and sleep latency and sleep quality. We genotyped 10 polymorphisms in genes with circadian expression in participants from the G1219 sample (n = 966), a British longitudinal population sample of young adults. We conducted linear regressions using dominant, additive and recessive models of inheritance to test for associations between these polymorphisms and the sleep measures. We found a significant association between diurnal preference and a polymorphism in period homologue 3 (PER3) (P < 0.005, recessive model) and a novel nominally significant association between diurnal preference and a polymorphism in aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2) (P < 0.05, additive model). We found that a polymorphism in guanine nucleotide binding protein beta 3 (GNβ3) was associated significantly with global sleep quality (P < 0.005, recessive model), and that a rare polymorphism in period homologue 2 (PER2) was associated significantly with both sleep duration and quality (P < 0.0005, recessive model). These findings suggest that genes with circadian expression may play a role in regulating both the circadian clock and sleep homeostasis, and highlight the importance of further studies aimed at dissecting the specific roles that circadian genes play in these two interrelated but unique behaviours. PMID:24635757
Giroux, Sylvie; Elfassihi, Latifa; Cardinal, Guy; Laflamme, Nathalie; Rousseau, François
2007-05-01
Bone mineral density has a strong genetic component but it is also influenced by environmental factors making it a complex trait to study. LRP5 gene was previously shown to be involved in rare diseases affecting bone mass. Mutations associated with gain-of-function were described as well as loss-of-function mutations. Following this discovery, many frequent LRP5 polymorphisms were tested against the variation of BMD in the normal population. Heel bone parameters (SOS, BUA) were measured by right calcaneal QUS in 5021 healthy French-Canadian women and for 2104 women, BMD evaluated by DXA at two sites was available (femoral neck (FN) and lumbar spine (LS)). Among women with QUS measures and those with DXA measures, 26.5% and 32.8% respectively were premenopausal, 9.2% and 10.7% were perimenopausal and 64.2% and 56.5% were postmenopausal. About a third of the peri- and postmenopausal women never received hormone therapy. Two single nucleotide coding polymorphisms (Val667Met and Ala1330Val) in LRP5 gene were genotyped by allele-specific PCR. All bone measures were tested individually for associations with each polymorphism by analysis of covariance with adjustment for non genetic risk factors. Furthermore, haplotype analysis was performed to take into account the strong linkage disequilibrium between the two polymorphisms. The two LRP5 polymorphisms were found to be associated with all five bone measures (L2L4 and femoral neck DXA as well as heel SOS, BUA and stiffness index) in the whole sample. Premenopausal women drove the association as expected from the proposed role of LRP5 in peak bone mass. Our results suggest that the Val667Met polymorphism is the causative variant but this remains to be functionally proven.
NASA Astrophysics Data System (ADS)
Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.
2018-04-01
Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.
No association of SORL1 SNPs with Alzheimer's disease.
Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas
2008-08-01
SORL1 is an element of the amyloid precursor protein processing pathway and is therefore a good candidate for affecting Alzheimer's disease (AD) risk. Indeed, there have been reports of associations between variation in SORL1 and AD risk. We examined six statistically significant single-nucleotide polymorphisms from the initial observation in a large Caucasian American case-controls cohort (1000 late-onset AD [LOAD] cases and 1000 older controls). Analysis of allele, genotype and haplotype frequencies revealed no association with LOAD risk in our cohort.
Wang, Guan-Feng; He, Yijian; Strauch, Renee; Olukolu, Bode A; Nielsen, Dahlia; Li, Xu; Balint-Kurti, Peter J
2015-11-01
In plants, most disease resistance genes encode nucleotide binding Leu-rich repeat (NLR) proteins that trigger a rapid localized cell death called a hypersensitive response (HR) upon pathogen recognition. The maize (Zea mays) NLR protein Rp1-D21 derives from an intragenic recombination between two NLRs, Rp1-D and Rp1-dp2, and confers an autoactive HR in the absence of pathogen infection. From a previous quantitative trait loci and genome-wide association study, we identified a single-nucleotide polymorphism locus highly associated with variation in the severity of Rp1-D21-induced HR. Two maize genes encoding hydroxycinnamoyltransferase (HCT; a key enzyme involved in lignin biosynthesis) homologs, termed HCT1806 and HCT4918, were adjacent to this single-nucleotide polymorphism. Here, we show that both HCT1806 and HCT4918 physically interact with and suppress the HR conferred by Rp1-D21 but not other autoactive NLRs when transiently coexpressed in Nicotiana benthamiana. Other maize HCT homologs are unable to confer the same level of suppression on Rp1-D21-induced HR. The metabolic activity of HCT1806 and HCT4918 is unlikely to be necessary for their role in suppressing HR. We show that the lignin pathway is activated by Rp1-D21 at both the transcriptional and metabolic levels. We derive a model to explain the roles of HCT1806 and HCT4918 in Rp1-mediated disease resistance. © 2015 American Society of Plant Biologists. All Rights Reserved.
Wang, Guan-Feng; He, Yijian; Strauch, Renee; Olukolu, Bode A.; Nielsen, Dahlia; Li, Xu; Balint-Kurti, Peter J.
2015-01-01
In plants, most disease resistance genes encode nucleotide binding Leu-rich repeat (NLR) proteins that trigger a rapid localized cell death called a hypersensitive response (HR) upon pathogen recognition. The maize (Zea mays) NLR protein Rp1-D21 derives from an intragenic recombination between two NLRs, Rp1-D and Rp1-dp2, and confers an autoactive HR in the absence of pathogen infection. From a previous quantitative trait loci and genome-wide association study, we identified a single-nucleotide polymorphism locus highly associated with variation in the severity of Rp1-D21-induced HR. Two maize genes encoding hydroxycinnamoyltransferase (HCT; a key enzyme involved in lignin biosynthesis) homologs, termed HCT1806 and HCT4918, were adjacent to this single-nucleotide polymorphism. Here, we show that both HCT1806 and HCT4918 physically interact with and suppress the HR conferred by Rp1-D21 but not other autoactive NLRs when transiently coexpressed in Nicotiana benthamiana. Other maize HCT homologs are unable to confer the same level of suppression on Rp1-D21-induced HR. The metabolic activity of HCT1806 and HCT4918 is unlikely to be necessary for their role in suppressing HR. We show that the lignin pathway is activated by Rp1-D21 at both the transcriptional and metabolic levels. We derive a model to explain the roles of HCT1806 and HCT4918 in Rp1-mediated disease resistance. PMID:26373661
Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang
2018-02-23
The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.
Michalakis, Y.; Veuille, M.
1996-01-01
Eleven genes distributed along the Drosophila melanogaster chromosome 2 and showing exonic tandem repeats of glutamine codons (CAG or CAA) were surveyed for length variation in a sample of four European and African populations. Only one gene was monomorphic. Eight genes were polymorphic in all populations, with a total number of alleles varying between five and 12 for 120 chromosomes. The average heterozygozity per locus and population was 0.41. Selective neutrality in length variation could not be rejected under the assumptions of the infinite allele model. Significant population subdivision was found though no geographical pattern emerged, all populations being equally different. Significant linkage disequilibrium was found in four out of seven cases where the genetic distance between loci was <1 cM and was negligible when the distance was larger. There is evidence that these associations were established after the populations separated. An unexpected result was that variation at each locus was independent of the coefficient of exchange, although the latter ranged from zero to the relatively high value of 6.7%. This would indicate that background selection and selective hitchhiking, which are thought to affect levels of nucleotide substitution polymorphism, have no effect on trinucleotide repeat variation. PMID:8844158
Kanthak, Magdalena K.; Chen, Frances S.; Kumsta, Robert; Hill, LaBarron K.; Thayer, Julian F.; Heinrichs, Markus
2017-01-01
A large body of empirical research has demonstrated stress-buffering effects of social support. However, recent studies suggest that genetic variation of the oxytocin system (specifically, a common single nucleotide polymorphism, rs53576, of the oxytocin receptor gene) modulates the efficacy of social support. The timing and neurobiological basis of this genetic modulation were investigated using a standardized, laboratory-based psychological stress procedure (Trier Social Stress Test for Groups, TSST-G). To index potential stress buffering effects of social support mediated by the oxytocin system, heart rate variability (HRV) was obtained before and during the TSST-G from 40 healthy participants. Results indicate that social support is associated with higher HRV only in G allele carriers. Specifically, social support increased heart rate variability during direct social interaction and only in individuals with at least one copy of the G allele of rs53576. These findings support the idea that the stress-attenuating effects of social support are modulated by genetic variation of the oxytocin system. PMID:26903384
Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder
ERIC Educational Resources Information Center
Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.
2012-01-01
Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…
USDA-ARS?s Scientific Manuscript database
Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...
USDA-ARS?s Scientific Manuscript database
Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...
USDA-ARS?s Scientific Manuscript database
Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...
Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore
2018-04-04
Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.
Haplotypes in SLC24A5 Gene as Ancestry Informative Markers in Different Populations
Giardina, Emiliano; Pietrangeli, Ilenia; Martínez-Labarga, Cristina; Martone, Claudia; de Angelis, Flavio; Spinella, Aldo; De Stefano, Gianfranco; Rickards, Olga; Novelli, Giuseppe
2008-01-01
Ancestry informative markers (AIMs) are human polymorphisms that exhibit substantially allele frequency differences among populations. These markers can be useful to provide information about ancestry of samples which may be useful in predicting a perpetrator’s ethnic origin to aid criminal investigations. Variations in human pigmentation are the most obvious phenotypes to distinguish individuals. It has been recently shown that the variation of a G in an A allele of the coding single-nucleotide polymorphism (SNP) rs1426654 within SLC24A5 gene varies in frequency among several population samples according to skin pigmentation. Because of these observations, the SLC24A5 locus has been evaluated as Ancestry Informative Region (AIR) by typing rs1426654 together with two additional intragenic markers (rs2555364 and rs16960620) in 471 unrelated individuals originating from three different continents (Africa, Asia and Europe). This study further supports the role of human SLC24A5 gene in skin pigmentation suggesting that variations in SLC24A5 haplotypes can correlate with human migration and ancestry. Furthermore, our data do reveal the utility of haplotype and combined unphased genotype analysis of SLC24A5 in predicting ancestry and provide a good example of usefulness of genetic characterization of larger regions, in addition to single polymorphisms, as candidates for population-specific sweeps in the ancestral population. PMID:19440451
Liu, Jun-Jun; Shamoun, Simon Francis; Leal, Isabel; Kowbel, Robert; Sumampong, Grace; Zamany, Arezoo
2018-05-01
Characterization of genes involved in differentiation of pathogen species and isolates with variations of virulence traits provides valuable information to control tree diseases for meeting the challenges of sustainable forest health and phytosanitary trade issues. Lack of genetic knowledge and genomic resources hinders novel gene discovery, molecular mechanism studies and development of diagnostic tools in the management of forest pathogens. Here, we report on transcriptome profiling of Heterobasidion occidentale isolates with contrasting virulence levels. Comparative transcriptomic analysis identified orthologous groups exclusive to H. occidentale and its isolates, revealing biological processes involved in the differentiation of isolates. Further bioinformatics analyses identified an H. occidentale secretome, CYPome and other candidate effectors, from which genes with species- and isolate-specific expression were characterized. A large proportion of differentially expressed genes were revealed to have putative activities as cell wall modification enzymes and transcription factors, suggesting their potential roles in virulence and fungal pathogenesis. Next, large numbers of simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were detected, including more than 14 000 interisolate non-synonymous SNPs. These polymorphic loci and species/isolate-specific genes may contribute to virulence variations and provide ideal DNA markers for development of diagnostic tools and investigation of genetic diversity. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Immunogenetics as a tool in anthropological studies
Sanchez-Mazas, Alicia; Fernandez-Viña, Marcelo; Middleton, Derek; Hollenbach, Jill A; Buhler, Stéphane; Di, Da; Rajalingam, Raja; Dugoujon, Jean-Michel; Mack, Steven J; Thorsby, Erik
2011-01-01
The genes coding for the main molecules involved in the human immune system – immunoglobulins, human leucocyte antigen (HLA) molecules and killer-cell immunoglobulin-like receptors (KIR) – exhibit a very high level of polymorphism that reveals remarkable frequency variation in human populations. ‘Genetic marker’ (GM) allotypes located in the constant domains of IgG antibodies have been studied for over 40 years through serological typing, leading to the identification of a variety of GM haplotypes whose frequencies vary sharply from one geographic region to another. An impressive diversity of HLA alleles, which results in amino acid substitutions located in the antigen-binding region of HLA molecules, also varies greatly among populations. The KIR differ between individuals according to both gene content and allelic variation, and also display considerable population diversity. Whereas the molecular evolution of these polymorphisms has most likely been subject to natural selection, principally driven by host–pathogen interactions, their patterns of genetic variation worldwide show significant signals of human geographic expansion, demographic history and cultural diversification. As current developments in population genetic analysis and computer simulation improve our ability to discriminate among different – either stochastic or deterministic – forces acting on the genetic evolution of human populations, the study of these systems shows great promise for investigating both the peopling history of modern humans in the time since their common origin and human adaptation to past environmental (e.g. pathogenic) changes. Therefore, in addition to mitochondrial DNA, Y-chromosome, microsatellites, single nucleotide polymorphisms and other markers, immunogenetic polymorphisms represent essential and complementary tools for anthropological studies. PMID:21480890
Bae, Joon Seol; Kim, Jason Yongha; Park, Byung-Lae; Cheong, Hyun Sub; Kim, Jeong-Hyun; Namgoong, Suhg; Kim, Ji-On; Park, Chul Soo; Kim, Bong-Jo; Lee, Cheol-Soon; Lee, Migyung; Choi, Woo Hyuk; Shin, Tae-Min; Hwang, Jaeuk; Shin, Hyoung Doo; Woo, Sung-Il
2015-04-01
Schizophrenia is a serious mental disorder that is affected by genetic and environmental factors. As the disease has a high heritability rate, genetic studies identifying candidate genes for schizophrenia have been conducted in various populations. The gene for human Ran‑binding protein 9 (RANBP9) is a newly discovered candidate gene for schizophrenia. As RANBP9 is a small guanosine‑5'‑triphosphate‑binding protein that interacts with the disrupted in schizophrenia 1 protein, it is considered to be an important molecule in the pathogenesis of schizophrenia. However, to date, no study has examined the possible association between the genetic variations of RANBP9 and the risk of schizophrenia. In the present study, it was hypothesized that RANBP9 variations may influence the risk of schizophrenia. In order to investigate the association between RANBP9 polymorphisms and the risk of schizophrenia and smooth pursuit eye movement (SPEM) abnormalities, a case‑control association analysis was performed. Using a TaqMan assay, five single‑nucleotide polymorphisms and an insertion/deletion variation within the start codon region of RANBP9 were genotyped. Five major haplotypes were identified in 449 patients with schizophrenia and 393 unrelated healthy individuals as controls (total, n=842). However, the association analyses revealed no associations between all genetic variants and schizophrenia and SPEM abnormality. To the best of our knowledge, this is the first study to investigate an association between RANBP9 polymorphisms and schizophrenia and SPEM abnormality. The findings of allele frequencies and association results in this study may aid in further genetic etiological studies in schizophrenia in various populations.
Teng, Allen C T; Adamo, Kristi; Tesson, Frédérique; Stewart, Alexandre F R
2009-06-01
Diet-induced weight loss is affected by a wide range of factors, including genetic variation. Identifying functional polymorphisms will help to elucidate mechanisms that account for variation in dietary metabolism. Previously, we reported a strong association between a common single nucleotide polymorphism (SNP) rs2419621 (C>T) in the promoter of acyl-CoA synthetase long chain 5 (ACSL5), rapid weight loss in obese Caucasian females, and elevated ACSL5 mRNA levels in skeletal muscle biopsies. Here, we showed by electrophoretic mobility shift assay (EMSA) that the T allele creates a functional cis-regulatory E-box element (CANNTG) that is recognized by the myogenic regulatory factor MyoD. The T allele promoted MyoD-dependent activation of a 1089-base pair ACSL5 promoter fragment in nonmuscle CV1 cells. Differentiation of skeletal myoblasts significantly elevated expression of the ACSL5 promoter. The T allele sustained promoter activity 48 h after differentiation, whereas the C allele showed a significant decline. These results reveal a mechanism for elevated transcription of ACSL5 in skeletal muscle of carriers of the rs2419621(T) allele, associated with more rapid diet-induced weight loss. Natural selection favoring promoter polymorphisms that reduced expression of catabolic genes in skeletal muscle likely accounts for the resistance of obese individuals to dietary intervention.
4P: fast computing of population genetics statistics from large DNA polymorphism panels
Benazzo, Andrea; Panziera, Alex; Bertorelle, Giorgio
2015-01-01
Massive DNA sequencing has significantly increased the amount of data available for population genetics and molecular ecology studies. However, the parallel computation of simple statistics within and between populations from large panels of polymorphic sites is not yet available, making the exploratory analyses of a set or subset of data a very laborious task. Here, we present 4P (parallel processing of polymorphism panels), a stand-alone software program for the rapid computation of genetic variation statistics (including the joint frequency spectrum) from millions of DNA variants in multiple individuals and multiple populations. It handles a standard input file format commonly used to store DNA variation from empirical or simulation experiments. The computational performance of 4P was evaluated using large SNP (single nucleotide polymorphism) datasets from human genomes or obtained by simulations. 4P was faster or much faster than other comparable programs, and the impact of parallel computing using multicore computers or servers was evident. 4P is a useful tool for biologists who need a simple and rapid computer program to run exploratory population genetics analyses in large panels of genomic data. It is also particularly suitable to analyze multiple data sets produced in simulation studies. Unix, Windows, and MacOs versions are provided, as well as the source code for easier pipeline implementations. PMID:25628874
Urschitz, Johann; Sultan, Omar; Ward, Kenneth
2011-01-01
Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308
Karakas-Celik, Sevim; Piskin, Ibrahim Etem; Keni, Mehmet Fatih; Calık, Mustafa; Iscan, Akın; Dursun, Ahmet
2014-09-01
SSPE is a progressive neurological disorder of children. Only some of the children who are infected with measles virus develop SSPE, which supports individual variation. TLR-2 and TLR-4 play an important role in innate immunity by recognizing envelope proteins of MV. Another important cytokine that plays an important role in orchestrating innate immune function is IL-17. The purpose of our study is to elucidate whether the TLR2, TLR4, IL17F and IL17A gene polymorphisms are susceptibility genes for the development of SSPE. Using the PCR-RFLP methods, the single nucleotide polymorphisms of TLR2 (Arg753Gln, Arg677Trp, -194 to -174 del), TLR4 (Asp299Gly and Thr399Ile) IL17F (His161Arg, Glu126Gly) and IL17A were studied in 54 patients with SSPE and 81 healthy controls. For Asp299Gly polymorphism of the TLR4 gene we found that there were no control individuals who were homozygous carriers of the Gly/Gly genotype, and the risk for SSPE increased at approximately 4.7 fold for the heterozygous carriers of the Asp/Gly genotype (OR 4.727, 95%-CI 1.192-18.742; P=0.01), when compared to healthy controls. Also our findings demonstrate that homozygosity for the Arg161 variant of the IL17F His161Arg polymorphism is inversely associated with development of SSPE (OR 0.114 95%-CI 0.026-0.494; P<0.001). In conclusion, it is suggested that variation in susceptibility to SSPE disease may be in part due to variations in TLR4 and IL17 function resulting from polymorphisms of TLR4 Asp299Gly and IL17F His161Arg. Copyright © 2014 Elsevier B.V. All rights reserved.
Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria
2011-01-01
Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.
A global reference for human genetic variation
2016-01-01
The 1000 Genomes Project set out to provide a comprehensive description of common human genetic variation by applying whole-genome sequencing to a diverse set of individuals from multiple populations. Here we report completion of the project, having reconstructed the genomes of 2,504 individuals from 26 populations using a combination of low-coverage whole-genome sequencing, deep exome sequencing, and dense microarray genotyping. We characterized a broad spectrum of genetic variation, in total over 88 million variants (84.7 million single nucleotide polymorphisms (SNPs), 3.6 million short insertions/deletions (indels), and 60,000 structural variants), all phased onto high-quality haplotypes. This resource includes >99% of SNP variants with a frequency of >1% for a variety of ancestries. We describe the distribution of genetic variation across the global sample, and discuss the implications for common disease studies. PMID:26432245
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fahrenkrog, Annette M.; Neves, Leandro G.; Resende, Jr., Marcio F. R.
Genome-wide association studies (GWAS) have been used extensively to dissect the genetic regulation of complex traits in plants. These studies have focused largely on the analysis of common genetic variants despite the abundance of rare polymorphisms in several species, and their potential role in trait variation. Here, we conducted the first GWAS in Populus deltoides, a genetically diverse keystone forest species in North America and an important short rotation woody crop for the bioenergy industry. We searched for associations between eight growth and wood composition traits, and common and low-frequency single-nucleotide polymorphisms detected by targeted resequencing of 18 153 genesmore » in a population of 391 unrelated individuals. To increase power to detect associations with low-frequency variants, multiple-marker association tests were used in combination with single-marker association tests. Significant associations were discovered for all phenotypes and are indicative that low-frequency polymorphisms contribute to phenotypic variance of several bioenergy traits. Our results suggest that both common and low-frequency variants need to be considered for a comprehensive understanding of the genetic regulation of complex traits, particularly in species that carry large numbers of rare polymorphisms. Lastly, these polymorphisms may be critical for the development of specialized plant feedstocks for bioenergy.« less
Altools: a user friendly NGS data analyser.
Camiolo, Salvatore; Sablok, Gaurav; Porceddu, Andrea
2016-02-17
Genotyping by re-sequencing has become a standard approach to estimate single nucleotide polymorphism (SNP) diversity, haplotype structure and the biodiversity and has been defined as an efficient approach to address geographical population genomics of several model species. To access core SNPs and insertion/deletion polymorphisms (indels), and to infer the phyletic patterns of speciation, most such approaches map short reads to the reference genome. Variant calling is important to establish patterns of genome-wide association studies (GWAS) for quantitative trait loci (QTLs), and to determine the population and haplotype structure based on SNPs, thus allowing content-dependent trait and evolutionary analysis. Several tools have been developed to investigate such polymorphisms as well as more complex genomic rearrangements such as copy number variations, presence/absence variations and large deletions. The programs available for this purpose have different strengths (e.g. accuracy, sensitivity and specificity) and weaknesses (e.g. low computation speed, complex installation procedure and absence of a user-friendly interface). Here we introduce Altools, a software package that is easy to install and use, which allows the precise detection of polymorphisms and structural variations. Altools uses the BWA/SAMtools/VarScan pipeline to call SNPs and indels, and the dnaCopy algorithm to achieve genome segmentation according to local coverage differences in order to identify copy number variations. It also uses insert size information from the alignment of paired-end reads and detects potential large deletions. A double mapping approach (BWA/BLASTn) identifies precise breakpoints while ensuring rapid elaboration. Finally, Altools implements several processes that yield deeper insight into the genes affected by the detected polymorphisms. Altools was used to analyse both simulated and real next-generation sequencing (NGS) data and performed satisfactorily in terms of positive predictive values, sensitivity, the identification of large deletion breakpoints and copy number detection. Altools is fast, reliable and easy to use for the mining of NGS data. The software package also attempts to link identified polymorphisms and structural variants to their biological functions thus providing more valuable information than similar tools.
Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.
2015-01-01
Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367
Zachaki, Sophia; Stavropoulou, Chrysa; Kalomoiraki, Marina; Koromila, Theodora; Daraki, Aggeliki; Manola, Kalliopi N; Mavrou, Ariadni; Kanavakis, Emmanuel; Pantelias, Gabriel E; Sambani, Constantina
2013-08-01
Models for the pathogenesis of myelodysplastic syndrome (MDS) imply the role of individual genetic variations in genes involved in detoxification mechanisms. GSTP1 enzyme plays a key role in the biotransformation of a variety of carcinogens. The corresponding gene is subject to a single nucleotide polymorphism (A(313)G) leading to abolished enzyme activity. In order to evaluate whether the GSTP1 polymorphism influences MDS susceptibility, we conducted a case-control study comprising 310 de novo patients and 370 healthy controls using a real-time polymerase chain reaction (PCR) genotyping method. The GSTP1 gene status was also evaluated in relation to patients' characteristics and chromosomal abnormalities. A significantly higher incidence of the GSTP1 variant genotypes was observed in patients with MDS compared to controls (p < 0.0001). The results revealed increased frequencies of heterozygotes in patients younger than 60 years old and of homozygotes G/G in older patients (p = 0.007). Our results provide evidence for a pathogenetic role of the GSTP1 polymorphism in MDS risk, probably in an age-dependent manner.
Adaptive divergence in the monkey flower Mimulus guttatus is maintained by a chromosomal inversion
Twyford, Alex D.; Friedman, Jannice
2015-01-01
Organisms exhibit an incredible diversity of life history strategies as adaptive responses to environmental variation. The establishment of novel life history strategies involves multilocus polymorphisms, which will be challenging to establish in the face of gene flow and recombination. Theory predicts that adaptive allelic combinations may be maintained and spread if they occur in genomic regions of reduced recombination, such as chromosomal inversion polymorphisms, yet empirical support for this prediction is lacking. Here, we use genomic data to investigate the evolution of divergent adaptive ecotypes of the yellow monkey flower Mimulus guttatus. We show that a large chromosomal inversion polymorphism is the major region of divergence between geographically widespread annual and perennial ecotypes. In contrast, ∼40,000 single nucleotide polymorphisms in collinear regions of the genome show no signal of life history, revealing genomic patterns of diversity have been shaped by localized homogenizing gene flow and large‐scale Pleistocene range expansion. Our results provide evidence for an inversion capturing and protecting loci involved in local adaptation, while also explaining how adaptive divergence can occur with gene flow. PMID:25879251
Champoiseau, P; Daugrois, J-H; Pieretti, I; Cociancich, S; Royer, M; Rott, P
2006-10-01
ABSTRACT Pathogenicity of 75 strains of Xanthomonas albilineans from Guadeloupe was assessed by inoculation of sugarcane cv. B69566, which is susceptible to leaf scald, and 19 of the strains were selected as representative of the variation in pathogenicity observed based on stalk colonization. In vitro production of albicidin varied among these 19 strains, but the restriction fragment length polymorphism pattern of their albicidin biosynthesis genes was identical. Similarly, no genomic variation was found among strains by pulsed-field gel electrophoresis. Some variation among strains was found by amplified fragment length polymorphism, but no relationship between this genetic variation and variation in pathogenicity was found. Only 3 (pilB, rpfA, and xpsE) of 40 genes involved in pathogenicity of bacterial species closely related to X. albilineans could be amplified by polymerase chain reaction from total genomic DNA of all nine strains tested of X. albilineans differing in pathogenicity in Guadeloupe. Nucleotide sequences of these genes were 100% identical among strains, and a phylogenetic study with these genes and housekeeping genes efp and ihfA suggested that X. albilineans is on an evolutionary road between the X. campestris group and Xylella fastidiosa, another vascular plant pathogen. Sequencing of the complete genome of Xanthomonas albilineans could be the next step in deciphering molecular mechanisms involved in pathogenicity of X. albilineans.
The Single Nucleotide Polymorphism Consortium
NASA Technical Reports Server (NTRS)
Morgan, Michael
2003-01-01
I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen
2012-09-04
A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.
USDA-ARS?s Scientific Manuscript database
The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...
Shared Genetic Signals of Hypoxia Adaptation in Drosophila and in High-Altitude Human Populations
Jha, Aashish R.; Zhou, Dan; Brown, Christopher D.; Kreitman, Martin; Haddad, Gabriel G.; White, Kevin P.
2016-01-01
The ability to withstand low oxygen (hypoxia tolerance) is a polygenic and mechanistically conserved trait that has important implications for both human health and evolution. However, little is known about the diversity of genetic mechanisms involved in hypoxia adaptation in evolving populations. We used experimental evolution and whole-genome sequencing in Drosophila melanogaster to investigate the role of natural variation in adaptation to hypoxia. Using a generalized linear mixed model we identified significant allele frequency differences between three independently evolved hypoxia-tolerant populations and normoxic control populations for approximately 3,800 single nucleotide polymorphisms. Around 50% of these variants are clustered in 66 distinct genomic regions. These regions contain genes that are differentially expressed between hypoxia-tolerant and normoxic populations and several of the differentially expressed genes are associated with metabolic processes. Additional genes associated with respiratory and open tracheal system development also show evidence of directional selection. RNAi-mediated knockdown of several candidate genes’ expression significantly enhanced survival in severe hypoxia. Using genomewide single nucleotide polymorphism data from four high-altitude human populations—Sherpas, Tibetans, Ethiopians, and Andeans, we found that several human orthologs of the genes under selection in flies are also likely under positive selection in all four high-altitude human populations. Thus, our results indicate that selection for hypoxia tolerance can act on standing genetic variation in similar genes and pathways present in organisms diverged by hundreds of millions of years. PMID:26576852
Bimolata, Waikhom; Kumar, Anirudh; Sundaram, Raman Meenakshi; Laha, Gouri Shankar; Qureshi, Insaf Ahmed; Reddy, Gajjala Ashok; Ghazi, Irfan Ahmad
2013-08-01
Xa27 is one of the important R-genes, effective against bacterial blight disease of rice caused by Xanthomonas oryzae pv. oryzae (Xoo). Using natural population of Oryza, we analyzed the sequence variation in the functionally important domains of Xa27 across the Oryza species. DNA sequences of Xa27 alleles from 27 rice accessions revealed higher nucleotide diversity among the reported R-genes of rice. Sequence polymorphism analysis revealed synonymous and non-synonymous mutations in addition to a number of InDels in non-coding regions of the gene. High sequence variation was observed in the promoter region including the 5'UTR with 'π' value 0.00916 and 'θ w ' = 0.01785. Comparative analysis of the identified Xa27 alleles with that of IRBB27 and IR24 indicated the operation of both positive selection (Ka/Ks > 1) and neutral selection (Ka/Ks ≈ 0). The genetic distances of alleles of the gene from Oryza nivara were nearer to IRBB27 as compared to IR24. We also found the presence of conserved and null UPT (upregulated by transcriptional activator) box in the isolated alleles. Considerable amino acid polymorphism was localized in the trans-membrane domain for which the functional significance is yet to be elucidated. However, the absence of functional UPT box in all the alleles except IRBB27 suggests the maintenance of single resistant allele throughout the natural population.
Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?
Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F
2006-06-01
Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.
Jiang, Yiwei
2013-01-01
Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684
El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry
2017-04-03
Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.
Interaction between PON1 and population density in amyotrophic lateral sclerosis.
Diekstra, Frank P; Beleza-Meireles, Ana; Leigh, Nigel P; Shaw, Christopher E; Al-Chalabi, Ammar
2009-01-28
Paraoxonase polymorphisms have been associated with amyotrophic lateral sclerosis (ALS). Paraoxonases are detoxifying enzymes involved in the metabolism of organophosphates. We tested the hypothesis that genetic variation within paraoxonase genes would interact with the environmental exposure to paraoxonase substrates. We used population density in the location of residence of ALS patients as a surrogate marker for environmental exposure. Paraoxonase genotypes at previously associated single nucleotide polymorphisms rs662, rs854560, rs6954345, and rs11981433 were studied in 98 patients from the South East England ALS population-based register. A case-only analysis was carried out and median population density was used to categorize patients into rural or urban environments. We found a significant interaction with population density for marker rs854560 (L55M) in ALS.
Khan, Imran; Ansari, Irfan A; Singh, Pratichi; Dass J, Febin Prabhu
2017-09-01
The phosphatase and tensin homolog (PTEN) gene plays a crucial role in signal transduction by negatively regulating the PI3K signaling pathway. It is the most frequent mutated gene in many human-related cancers. Considering its critical role, a functional analysis of missense mutations of PTEN gene was undertaken in this study. Thirty five nonsynonymous single nucleotide polymorphisms (nsSNPs) within the coding region of the PTEN gene were selected for our in silico investigation, and five nsSNPs (G129E, C124R, D252G, H61D, and R130G) were found to be deleterious based on combinatorial predictions of different computational tools. Moreover, molecular dynamics (MD) simulation was performed to investigate the conformational variation between native and all the five mutant PTEN proteins having predicted deleterious nsSNPs. The results of MD simulation of all mutant models illustrated variation in structural attributes such as root-mean-square deviation, root-mean-square fluctuation, radius of gyration, and total energy; which depicts the structural stability of PTEN protein. Furthermore, mutant PTEN protein structures also showed a significant variation in the solvent accessible surface area and hydrogen bond frequencies from the native PTEN structure. In conclusion, results of this study have established the deleterious effect of the all the five predicted nsSNPs on the PTEN protein structure. Thus, results of the current study can pave a new platform to sort out nsSNPs that can be undertaken for the confirmation of their phenotype and their correlation with diseased status in case of control studies. © 2016 International Union of Biochemistry and Molecular Biology, Inc.
Kozlov, Konstantin N.; Kulakovskiy, Ivan V.; Zubair, Asif; Marjoram, Paul; Lawrie, David S.; Nuzhdin, Sergey V.; Samsonova, Maria G.
2017-01-01
Annotating the genotype-phenotype relationship, and developing a proper quantitative description of the relationship, requires understanding the impact of natural genomic variation on gene expression. We apply a sequence-level model of gap gene expression in the early development of Drosophila to analyze single nucleotide polymorphisms (SNPs) in a panel of natural sequenced D. melanogaster lines. Using a thermodynamic modeling framework, we provide both analytical and computational descriptions of how single-nucleotide variants affect gene expression. The analysis reveals that the sequence variants increase (decrease) gene expression if located within binding sites of repressors (activators). We show that the sign of SNP influence (activation or repression) may change in time and space and elucidate the origin of this change in specific examples. The thermodynamic modeling approach predicts non-local and non-linear effects arising from SNPs, and combinations of SNPs, in individual fly genotypes. Simulation of individual fly genotypes using our model reveals that this non-linearity reduces to almost additive inputs from multiple SNPs. Further, we see signatures of the action of purifying selection in the gap gene regulatory regions. To infer the specific targets of purifying selection, we analyze the patterns of polymorphism in the data at two phenotypic levels: the strengths of binding and expression. We find that combinations of SNPs show evidence of being under selective pressure, while individual SNPs do not. The model predicts that SNPs appear to accumulate in the genotypes of the natural population in a way biased towards small increases in activating action on the expression pattern. Taken together, these results provide a systems-level view of how genetic variation translates to the level of gene regulatory networks via combinatorial SNP effects. PMID:28898266
Martínez-García, Pedro J; Fresnedo-Ramírez, Jonathan; Parfitt, Dan E; Gradziel, Thomas M; Crisosto, Carlos H
2013-01-01
Single nucleotide polymorphisms (SNPs) are a fundamental source of genomic variation. Large SNP panels have been developed for Prunus species. Fruit quality traits are essential peach breeding program objectives since they determine consumer acceptance, fruit consumption, industry trends and cultivar adoption. For many cultivars, these traits are negatively impacted by cold storage, used to extend fruit market life. The major symptoms of chilling injury are lack of flavor, off flavor, mealiness, flesh browning, and flesh bleeding. A set of 1,109 SNPs was mapped previously and 67 were linked with these complex traits. The prediction of the effects associated with these SNPs on downstream products from the 'peach v1.0' genome sequence was carried out. A total of 2,163 effects were detected, 282 effects (non-synonymous, synonymous or stop codon gained) were located in exonic regions (13.04 %) and 294 placed in intronic regions (13.59 %). An extended list of genes and proteins that could be related to these traits was developed. Two SNP markers that explain a high percentage of the observed phenotypic variance, UCD_SNP_1084 and UCD_SNP_46, are associated with zinc finger (C3HC4-type RING finger) family protein and AOX1A (alternative oxidase 1a) protein groups, respectively. In addition, phenotypic variation suggests that the observed polymorphism for SNP UCD_SNP_1084 [A/G] mutation could be a candidate quantitative trait nucleotide affecting quantitative trait loci for mealiness. The interaction and expression of affected proteins could explain the variation observed in each individual and facilitate understanding of gene regulatory networks for fruit quality traits in peach.
Copy Number Variation across European Populations
Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.
2011-01-01
Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696
[Identification of single nucleotide polymorphisms related to frailty].
Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José
2018-04-07
The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.
McKay, G J; Egan, D; Morris, E; Scott, C; Brown, A E
1999-02-01
Cladobotryum dendroides (= Dactylium dendroides) has hitherto been regarded as the major causal agent of cobweb disease of the cultivated mushroom, Agaricus bisporus. Nucleotide sequence data for the internal transcribed spacer (ITS) regions of four Cladobotryum/Hypomyces species reported to be associated with cobweb disease, however, indicate that the most common pathogen is now C. mycophilum. This cobweb pathogen varies somewhat in conidial septation from published descriptions of C. mycophilum and lacks the distinctive colony odor. ITS sequencing revealed minor nucleotide variation which split isolates of the pathogen into three subgroups, two comprising isolates that were sensitive to methylbenzimidazole carbamate (MBC) fungicides and one comprising MBC-resistant isolates. The MBC-resistant isolates, which were only obtained from Ireland and Great Britain, clustered together strongly in randomly amplified polymorphic DNA (RAPD) PCR analysis, suggesting that they may be clonal. The MBC-sensitive isolates were more diverse. A RAPD fragment of 800 to 900 bp, containing a microsatellite and found in the MBC-resistant isolates, also indicated their clonal nature; the microsatellites of these isolates contained the same number of GA repeats. Smaller, polymorphic microsatellites, similarly comprising GA repeats, in the MBC-sensitive isolates in general correlated with their geographic origin.
McKay, Gareth J.; Egan, Damian; Morris, Elizabeth; Scott, Carol; Brown, Averil E.
1999-01-01
Cladobotryum dendroides (= Dactylium dendroides) has hitherto been regarded as the major causal agent of cobweb disease of the cultivated mushroom, Agaricus bisporus. Nucleotide sequence data for the internal transcribed spacer (ITS) regions of four Cladobotryum/Hypomyces species reported to be associated with cobweb disease, however, indicate that the most common pathogen is now C. mycophilum. This cobweb pathogen varies somewhat in conidial septation from published descriptions of C. mycophilum and lacks the distinctive colony odor. ITS sequencing revealed minor nucleotide variation which split isolates of the pathogen into three subgroups, two comprising isolates that were sensitive to methylbenzimidazole carbamate (MBC) fungicides and one comprising MBC-resistant isolates. The MBC-resistant isolates, which were only obtained from Ireland and Great Britain, clustered together strongly in randomly amplified polymorphic DNA (RAPD) PCR analysis, suggesting that they may be clonal. The MBC-sensitive isolates were more diverse. A RAPD fragment of 800 to 900 bp, containing a microsatellite and found in the MBC-resistant isolates, also indicated their clonal nature; the microsatellites of these isolates contained the same number of GA repeats. Smaller, polymorphic microsatellites, similarly comprising GA repeats, in the MBC-sensitive isolates in general correlated with their geographic origin. PMID:9925589
Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C
2012-06-01
Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.
E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China
Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man
2017-01-01
Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822
Mycobacterium leprae: genes, pseudogenes and genetic diversity
Singh, Pushpendra; Cole, Stewart T
2011-01-01
Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636
Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira
2016-02-01
This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.
Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura
2015-01-01
Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342
Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira
2016-01-01
OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237
Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.
Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum
2014-05-01
This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P < 0.05) were identified by logistic regression analysis, but results were insignificant after Bonferroni correction. Six SNPs formed a linkage disequilibrium block, and three main haplotypes were found. Two of three haplotypes (AAAGAA and GGGAGG) distributed highly in the POF group, whereas the remaining haplotype (GGAAGG) distributed highly in the control group by logistic regression analysis (highest odds ratio, 2.515; 95% CI, 1.515-4.175; P = 0.00036). Our observations suggest that genetic variations in the FANCA gene may increase the risk for POF in Korean women.
Pfennig, Karin S; Allenby, Ashley; Martin, Ryan A; Monroy, Anaïs; Jones, Corbin D
2012-09-01
Two congeneric species of spadefoot toad, Spea multiplicata and Spea bombifrons, have been the focus of hybridization studies since the 1970s. Because complex hybrids are not readily distinguished phenotypically, genetic markers are needed to identify introgressed individuals. We therefore developed a set of molecular markers (amplified fragment length polymorphism, polymerase chain reaction-restriction fragment length polymorphism and single nucleotide polymorphism) for identifying pure-species, F1 hybrids and more complex introgressed types. To do so, we tested a series of markers across both species and known hybrids using populations in both allopatry and sympatry. We retained those markers that differentiated the two pure-species and also consistently identified known species hybrids. These markers are well suited for identifying hybrids between these species. Moreover, those markers that show variation within each species can be used in conjunction with existing molecular markers in studies of population structure and gene flow. © 2012 Blackwell Publishing Ltd.
Jo, Ick Hyun; Kim, Young Chang; Kim, Dong Hwi; Kim, Kee Hong; Hyun, Tae Kyung; Ryu, Hojin; Bang, Kyong Hwan
2017-10-01
The development of molecular markers is one of the most useful methods for molecular breeding and marker-based molecular associated selections. Even though there is less information on the reference genome, molecular markers are indispensable tools for determination of genetic variation and identification of species with high levels of accuracy and reproducibility. The demand for molecular approaches for marker-based breeding and genetic discriminations in Panax species has greatly increased in recent times and has been successfully applied for various purposes. However, owing to the existence of diverse molecular techniques and differences in their principles and applications, there should be careful consideration while selecting appropriate marker types. In this review, we outline the recent status of different molecular marker applications in ginseng research and industrial fields. In addition, we discuss the basic principles, requirements, and advantages and disadvantages of the most widely used molecular markers, including restriction fragment length polymorphism, random amplified polymorphic DNA, sequence tag sites, simple sequence repeats, and single nucleotide polymorphisms.
Li, Hong; Sun, Gui-Rong; Tian, Ya-Dong; Han, Rui-Li; Li, Guo-Xi; Kang, Xiang-Tao
2013-05-01
In the present study, a total of 860 chickens from a Gushi-Anka F2 resource population were used to evaluate the genetic effect of the gga-miR-1614-3p gene. A novel, silent, single nucleotide polymorphism (SNP, +5 C>T) was detected in the gga-miR-1614-3p gene seed region through AvaII polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and PCR products sequencing methods. Associations between the SNP and chicken growth, meat quality and carcass traits were performed by association analysis. The results showed that the SNP was significantly associated with breast muscle shear force and leg muscle water loss rate, wing weight, liver weight and heart weight (p<0.05), and highly significantly associated with the weight of the abdominal fat (p<0.01). The secondary structure of gga-miR-1614 and the free energy were altered due to the variation predicted by the M-fold program.
Mitochondrial DNA polymorphism in a maternal lineage of Holstein cows.
Hauswirth, W W; Laipis, P J
1982-01-01
Two mitochondrial genotypes are shown to exist within one Holstein cow maternal lineage. They were detected by the appearance of an extra Hae III recognition site in one genotype. The nucleotide sequence of this region has been determined and the genotypes are distinguished by an adenine/guanine base transition which creates the new Hae III site. This point mutation occurs within an open reading frame at the third position of a glycine codon and therefore does not alter the amino acid sequence. The present pattern of genotypes within the lineage demands that multiple shifts between genotypes must have occurred within the past 20 years with the most rapid shift taking place in no more than 4 years and indicates that mitochondrial DNA polymorphism can occur between maternally related mammals. The process that gave rise to different genotypes in one lineage is clearly of fundamental importance in understanding intraspecific mitochondrial polymorphism and evolution in mammals. Several potential mechanisms for rapid mitochondrial DNA variation are discussed in light of these results. Images PMID:6289312
Heme Oxygenase 1 and 2 Common Genetic Variants and Risk for Essential Tremor
Ayuso, Pedro; Agúndez, José A.G.; Alonso-Navarro, Hortensia; Martínez, Carmen; Benito-León, Julián; Ortega-Cubero, Sara; Lorenzo-Betancor, Oswaldo; Pastor, Pau; López-Alburquerque, Tomás; García-Martín, Elena; Jiménez-Jiménez, Félix J.
2015-01-01
Abstract Several reports suggested a role of heme oxygenase genes 1 and 2 (HMOX1 and HMOX2) in modifying the risk to develop Parkinson disease (PD). Because essential tremor (ET) and PD share phenotypical and, probably, etiologic factors of the similarities, we analyzed whether such genes are related with the risk to develop ET. We analyzed the distribution of allelic and genotype frequencies of the HMOX1 rs2071746, HMOX1 rs2071747, HMOX2 rs2270363, and HMOX2 rs1051308 single nucleotide polymorphisms, as well as the presence of copy number variations of these genes in 202 subjects with familial ET and 747 healthy controls. Allelic frequencies of rs2071746T and rs1051308G were significantly lower in ET patients than in controls. None of the studied polymorphisms influenced the disease onset. The present study suggests a weak association between HMOX1 rs2071746 and HMOX2 rs1051308 polymorphisms and the risk to develop ET in the Spanish population. PMID:26091465
Heme Oxygenase 1 and 2 Common Genetic Variants and Risk for Essential Tremor.
Ayuso, Pedro; Agúndez, José A G; Alonso-Navarro, Hortensia; Martínez, Carmen; Benito-León, Julián; Ortega-Cubero, Sara; Lorenzo-Betancor, Oswaldo; Pastor, Pau; López-Alburquerque, Tomás; García-Martín, Elena; Jiménez-Jiménez, Félix J
2015-06-01
Several reports suggested a role of heme oxygenase genes 1 and 2 (HMOX1 and HMOX2) in modifying the risk to develop Parkinson disease (PD). Because essential tremor (ET) and PD share phenotypical and, probably, etiologic factors of the similarities, we analyzed whether such genes are related with the risk to develop ET. We analyzed the distribution of allelic and genotype frequencies of the HMOX1 rs2071746, HMOX1 rs2071747, HMOX2 rs2270363, and HMOX2 rs1051308 single nucleotide polymorphisms, as well as the presence of copy number variations of these genes in 202 subjects with familial ET and 747 healthy controls. Allelic frequencies of rs2071746T and rs1051308G were significantly lower in ET patients than in controls. None of the studied polymorphisms influenced the disease onset. The present study suggests a weak association between HMOX1 rs2071746 and HMOX2 rs1051308 polymorphisms and the risk to develop ET in the Spanish population.
USDA-ARS?s Scientific Manuscript database
Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...
ERIC Educational Resources Information Center
Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli
2010-01-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…
USDA-ARS?s Scientific Manuscript database
The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...
Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins
2016-01-01
Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...
ERIC Educational Resources Information Center
Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui
2017-01-01
Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…
Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.
2007-01-01
A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140
Polymorphisms of CCL3L1/CCR5 genes and recurrence of hepatitis B in liver transplant recipients.
Li, Hong; Xie, Hai-Yang; Zhou, Lin; Wang, Wei-Lin; Liang, Ting-Bo; Zhang, Min; Zheng, Shu-Sen
2011-12-01
The genetic diversity of chemokines and chemokine receptors has been associated with the outcome of hepatitis B virus infection. The aim of this study was to evaluate whether the copy number variation in the CCL3L1 gene and the polymorphisms of CCR5Δ32 and CCR5-2459A→G (rs1799987) are associated with recurrent hepatitis B in liver transplantation for hepatitis B virus infection-related end-stage liver disease. A total of 185 transplant recipients were enrolled in this study. The genomic DNA was extracted from whole blood, the copy number of the CCL3L1 gene was determined by a quantitative real-time PCR based assay, CCR5Δ32 was detected by a sizing PCR method, and a single-nucleotide polymorphism in CCR5-2459 was detected by restriction fragment length polymorphism PCR. No CCR5Δ32 mutation was detected in any of the individuals from China. Neither copy number variation nor polymorphism in CCR5-2459 was associated with post-transplant re-infection with hepatitis B virus. However, patients with fewer copies (<4) of the CCL3L1 gene compared with the population median in combination with the CCR5G allele had a significantly higher risk for recurrent hepatitis B (odds ratio=1.93, 95% CI: 1.00-3.69; P=0.047). Patients possessing the compound decreased functional genotype of both CCL3L1 and CCR5 genes might be more likely to have recurrence of hepatitis B after transplantation.
Ghodsian, Nooshin; Ismail, Patimah; Ahmadloo, Salma; Heidari, Farzad; Haghvirdizadeh, Polin; Ataollahi Eshkoor, Sima; Etemad, Ali
2016-01-01
With-no-lysine (K) Kinase-4 (WNK4) consisted of unique serine and threonine protein kinases, genetically associated with an autosomal dominant form of hypertension. Argumentative consequences have lately arisen on the association of specific single nucleotide polymorphisms of WNK4 gene and essential hypertension (EHT). The aim of this study was to determine the association of Ala589Ser polymorphism of WNK4 gene with essential hypertensive patients in Malaysia. WNK4 gene polymorphism was specified utilizing mutagenically separated polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) method in 320 subjects including 163 cases and 157 controls. Close relation between Ala589Ser polymorphism and elevated systolic and diastolic blood pressure (SBP and DBP) was recognized. Sociodemographic factors including body mass index (BMI), age, the level of fasting blood sugar (FBS), low density lipoprotein (LDL), and triglyceride (TG) in the cases and healthy subjects exhibited strong differences (p < 0.05). The distribution of allele frequency and genotype of WNK4 gene Ala589Ser polymorphism showed significant differences (p < 0.05) between EHT subjects with or without type 2 diabetes mellitus (T2DM) and normotensive subjects, statistically. The WNK4 gene variation influences significantly blood pressure increase. Ala589Ser probably has effects on the enzymic activity leading to enhanced predisposition to the disorder.
Correlation between facial morphology and gene polymorphisms in the Uygur youth population.
He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao
2017-04-25
Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.
Mastan, Shaik G; Rathore, Mangal S; Bhatt, Vacha D; Chikara, J; Ghosh, A
2014-12-01
We investigated DNA methylation and polymorphism in the methylated DNA using AFLP based methylation-sensitive amplification polymorphism (MS-AFLP) markers in ecotypes of Jatropha curcas L. growing in similar and different geo-ecological conditions. Three ecotypes growing in different geo-ecological conditions with environmental heterogeneity (Group-1) and five ecotypes growing in similar environmental conditions (Group-2) were assessed. In ecotypes growing in group-1, 44.32 % DNA was methylated and of which 93.59 % DNA was polymorphic. While in group-2, 32.27 % DNA was methylated, of which 51.64 % DNA was polymorphic. In site 1 and site 2 of group-1, overall methylation was 18.94 and 22.44 % respectively with difference of 3.5 %, while overall polymorphism was 41.14 and 39.23 % with a difference of 1.91 %. In site 1 and site 2 of group-2, overall methylation was 24.68 and 24.18 % respectively with difference of 0.5 %, while overall polymorphism was 12.19 and 12.65 % with a difference of 0.46 %. The difference of methylation percentage and percentage of methylation polymorphism throughout the genome of J. curcas at site 1 and 2 of group-1 is higher than that of J. curcas at site 1 and 2 of group-2. These results correlated the physico-chemical properties of soil at these sites. The variations of physico-chemical properties of soil at Chorwadla (site 1 in group-1 and site 2 in group-2) compared to the soil at Brahmapur (site 2 in group-1) is higher than that of soil at Neswad (site 1 in group-2). The study suggests that these homologous nucleotide sequences probably play important role in ecotype adaptation to environmental heterogeneity by creating epiallelic variations hence in evolution of ecotypes/clines or forms of species showing phenotypic/genotypic differences in different geographical areas.
Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice
Pavlicev, Mihaela; Wagner, Günter P.; Noonan, James P.; Hallgrímsson, Benedikt; Cheverud, James M.
2013-01-01
Divergence of serially homologous elements of organisms is a common evolutionary pattern contributing to increased phenotypic complexity. Here, we study the genomic intervals affecting the variational independence of fore- and hind limb traits within an experimental mouse population. We use an advanced intercross of inbred mouse strains to map the loci associated with the degree of autonomy between fore- and hind limb long bone lengths (loci affecting the relationship between traits, relationship quantitative trait loci [rQTL]). These loci have been proposed to interact locally with the products of pleiotropic genes, thereby freeing the local trait from the variational constraint due to pleiotropic mutations. Using the known polymorphisms (single nucleotide polymorphisms [SNPs]) between the parental strains, we characterized and compared the genomic regions in which the rQTL, as well as their interaction partners (intQTL), reside. We find that these two classes of QTL intervals harbor different kinds of molecular variation. SNPs in rQTL intervals more frequently reside in limb-specific cis-regulatory regions than SNPs in intQTL intervals. The intQTL loci modified by the rQTL, in contrast, show the signature of protein-coding variation. This result is consistent with the widely accepted view that protein-coding mutations have broader pleiotropic effects than cis-regulatory polymorphisms. For both types of QTL intervals, the underlying candidate genes are enriched for genes involved in protein binding. This finding suggests that rQTL effects are caused by local interactions among the products of the causal genes harbored in rQTL and intQTL intervals. This is the first study to systematically document the population-level molecular variation underlying the evolution of character individuation. PMID:24065733
Kovács, Krisztina; Virányi, Zsófia; Kis, Anna; Turcsán, Borbála; Hudecz, Ágnes; Marmota, Maria T.; Koller, Dóra; Rónai, Zsolt; Gácsi, Márta; Topál, József
2018-01-01
Variations in human infants' attachment behavior are associated with single nucleotide polymorphisms (SNPs) in the oxytocin receptor (OXTR) gene, suggesting a genetic component to infant-mother attachment. However, due to the genetic relatedness of infants and their mothers, it is difficult to separate the genetic effects of infants' OXTR genotype from the environmental effects of mothers' genotype possibly affecting their parental behavior. The apparent functional analogy between child-parent and dog-owner relationship, however, offers a way to disentangle the effects of these factors because pet dogs are not genetically related to their caregivers. In the present study we investigated whether single nucleotide polymorphisms of pet dogs' OXTR gene (−213AG,−94TC,−74CG) and their owners' OXTR gene (rs53576, rs1042778, rs2254298) are associated with components of dog-owner attachment. In order to investigate whether social-environmental effects modulate the potential genetic influence on attachment, dogs and their owners from two different countries (Austria and Hungary, N = 135 in total) were tested in a modified version of the Ainsworth Strange Situation Test (SST) and questionnaires were also used to collect information about owner personality and attachment style. We coded variables related to three components of attachment behavior in dogs: their sensitivity to the separation from and interaction with the owner (Attachment), stress caused by the unfamiliar environment (Anxiety), and their responsiveness to the stranger (Acceptance). We found that (1) dogs' behavior was significantly associated with polymorphisms in both dogs' and owners' OXTR gene, (2) SNPs in dogs' and owners' OXTR gene interactively influenced dog-human relationship, (3) dogs' attachment behavior was affected by the country of origin, and (4) it was related to their owners' personality as well as attachment style. Thus, the present study provides evidence, for the first time, that both genetic variation in the OXTR gene and various aspects of pet dogs' environmental background are associated with their attachment to their human caregivers. PMID:29674985
Genomic variation at the tips of the adaptive radiation of Darwin's finches.
Chaves, Jaime A; Cooper, Elizabeth A; Hendry, Andrew P; Podos, Jeffrey; De León, Luis F; Raeymaekers, Joost A M; MacMillan, W Owen; Uy, J Albert C
2016-11-01
Adaptive radiation unfolds as selection acts on the genetic variation underlying functional traits. The nature of this variation can be revealed by studying the tips of an ongoing adaptive radiation. We studied genomic variation at the tips of the Darwin's finch radiation; specifically focusing on polymorphism within, and variation among, three sympatric species of the genus Geospiza. Using restriction site-associated DNA (RAD-seq), we characterized 32 569 single-nucleotide polymorphisms (SNPs), from which 11 outlier SNPs for beak and body size were uncovered by a genomewide association study (GWAS). Principal component analysis revealed that these 11 SNPs formed four statistically linked groups. Stepwise regression then revealed that the first PC score, which included 6 of the 11 top SNPs, explained over 80% of the variation in beak size, suggesting that selection on these traits influences multiple correlated loci. The two SNPs most strongly associated with beak size were near genes associated with beak morphology across deeper branches of the radiation: delta-like 1 homologue (DLK1) and high-mobility group AT-hook 2 (HMGA2). Our results suggest that (i) key adaptive traits are associated with a small fraction of the genome (11 of 32 569 SNPs), (ii) SNPs linked to the candidate genes are dispersed throughout the genome (on several chromosomes), and (iii) micro- and macro-evolutionary variation (roots and tips of the radiation) involve some shared and some unique genomic regions. © 2016 John Wiley & Sons Ltd.
Hampras, Shalaka S; Sucheston, Lara; Weiss, Joli; Baer, Maria R; Zirpoli, Gary; Singh, Prashant K; Wetzler, Meir; Chennamaneni, Raj; Blanco, Javier G; Ford, LaurieAnn; Moysich, Kirsten B
2010-01-01
The overall survival of patients with acute myeloid leukemia (AML) remains poor due to both intrinsic and acquired chemotherapy resistance. Over expression of ATP binding cassette (ABC) proteins in AML cells has been suggested as a putative mechanism of drug resistance. Genetic variation among individuals affecting the expression or function of these proteins may contribute to inter-individual variation in treatment outcomes. DNA from pre-treatment bone marrow or blood samples from 261 patients age 20-85 years, who received cytarabine and anthracycline-based therapy at Roswell Park Cancer Institute between 1994 and 2006, was genotyped for eight non-synonymous single nucleotide polymorphisms in the ABCB1, ABCC1 and ABCG2 drug transporter genes. Heterozygous (AG) or homozygous (AA) variant genotypes for rs2231137 (G34A) in the ABCG2 (BRCP) gene, compared to the wild type (GG) genotype were associated with both significantly improved survival (HR=0.44, 95%CI=0.25-0.79), and increased odds for toxicity (OR=8.41, 95%CI= 1.10-64.28). Thus genetic polymorphisms in the ABCG2 (BRCP) gene may contribute to differential survival outcomes and toxicities in AML patients via a mechanism of decreased drug efflux in both, AML cells and normal progenitors. PMID:21311724
Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content.
Goszczynski, Daniel E; Papaleo-Mazzucco, Juliana; Ripoli, María V; Villarreal, Edgardo L; Rogberg-Muñoz, Andrés; Mezzadra, Carlos A; Melucci, Lilia M; Giovambattista, Guillermo
2017-07-03
FABP4 is a protein primarily expressed in adipocytes and macrophages that plays a key role in fatty acid trafficking and lipid hydrolysis. FABP4 gene polymorphisms have been associated with meat quality traits in cattle, mostly in Asian breeds under feedlot conditions. The objectives of this work were to characterize FABP4 genetic variation in several worldwide cattle breeds and evaluate possible genotype effects on fat content in a pasture-fed crossbred (Angus-Hereford-Limousin) population. We re-sequenced 43 unrelated animals from nine cattle breeds (Angus, Brahman, Creole, Hereford, Holstein, Limousin, Nelore, Shorthorn, and Wagyu) and obtained 22 single nucleotide polymorphisms (SNPs) over 3,164 bp, including four novel polymorphisms. Haplotypes and linkage disequilibrium analyses showed a high variability. Five SNPs were selected to perform validation and association studies in our crossbred population. Four SNPs showed well-balanced allele frequencies (minor frequency > 0.159), and three showed no significant deviations from Hardy-Weinberg proportions. SNPs showed significant effects on backfat thickness and fatty acid composition (P < 0.05). The protein structure of one of the missense SNPs was analyzed to elucidate its possible effect on fat content in our studied population. Our results revealed a possible blockage of the fatty acid binding site by the missense mutation.
Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K
2014-04-01
Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.
No association of SORL1 SNPs with Alzheimer’s disease
Minster, Ryan L.; DeKosky, Steven T.; Kamboh, M. Ilyas
2008-01-01
SORL1 is an element of the amyloid precursor protein processing pathway and is therefore a good candidate for affecting Alzheimer’s disease (AD) risk. Indeed, there have been reports of associations between variation in SORL1 and AD risk. We examined six statistically significant single-nucleotide polymorphisms from the initial observation in a large Caucasian American case–controls cohort (1000 late-onset AD [LOAD] cases and 1000 older controls). Analysis of allele, genotype and haplotype frequencies revealed no association with LOAD risk in our cohort. PMID:18562096
Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.
Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R
2001-11-23
Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.
How Much Does Inbreeding Reduce Heterozygosity? Empirical Results from Aedes aegypti
Powell, Jeffrey R.; Evans, Benjamin R.
2017-01-01
Deriving strains of mosquitoes with reduced genetic variation is useful, if not necessary, for many genetic studies. Inbreeding is the standard way of achieving this. Full-sib inbreeding the mosquito Aedes aegypti for seven generations reduced heterozygosity to 72% of the initial heterozygosity in contrast to the expected 13%. This deviation from expectations is likely due to high frequencies of deleterious recessive alleles that, given the number of markers studied (27,674 single nucleotide polymorphisms [SNPs]), must be quite densely spread in the genome. PMID:27799643
The genetics of exceptional longevity: Insights from centenarians.
Santos-Lozano, Alejandro; Santamarina, Ana; Pareja-Galeano, Helios; Sanchis-Gomar, Fabian; Fiuza-Luces, Carmen; Cristi-Montero, Carlos; Bernal-Pino, Aranzazu; Lucia, Alejandro; Garatachea, Nuria
2016-08-01
As the world population ages, so the prevalence increases of individuals aged 100 years or more, known as centenarians. Reaching this age has been described as exceptional longevity (EL) and is attributed to both genetic and environmental factors. Many genetic variations known to affect life expectancy exist in centenarians. This review of studies conducted on centenarians and supercentenarians (older than 110 years) updates knowledge of the impacts on longevity of the twenty most widely investigated single nucleotide polymorphisms (SNPs). Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Progress of pharmacogenomic research related to minerals and trace elements.
Zeng, Mei-Zi; Tang, Jie; Liu, Zhao-Qian; Zhou, Hong-Hao; Zhang, Wei
2015-10-01
Pharmacogenomics explores the variations in both the benefits and the adverse effects of a drug among patients in a target population by analyzing genomic profiles of individual patients. Minerals and trace elements, which can be found in human tissues and maintain normal physiological functions, are also in the focus of pharmacogenomic research. Single-nucleotide polymorphisms (SNPs) affect the metabolism, disposition and efficacy of minerals and trace elements in humans, resulting in changes of body function. This review describes some of the recent progress in pharmacogenomic research related to minerals and trace elements.
PGen: large-scale genomic variations analysis workflow and browser in SoyKB.
Liu, Yang; Khan, Saad M; Wang, Juexin; Rynge, Mats; Zhang, Yuanxun; Zeng, Shuai; Chen, Shiyuan; Maldonado Dos Santos, Joao V; Valliyodan, Babu; Calyam, Prasad P; Merchant, Nirav; Nguyen, Henry T; Xu, Dong; Joshi, Trupti
2016-10-06
With the advances in next-generation sequencing (NGS) technology and significant reductions in sequencing costs, it is now possible to sequence large collections of germplasm in crops for detecting genome-scale genetic variations and to apply the knowledge towards improvements in traits. To efficiently facilitate large-scale NGS resequencing data analysis of genomic variations, we have developed "PGen", an integrated and optimized workflow using the Extreme Science and Engineering Discovery Environment (XSEDE) high-performance computing (HPC) virtual system, iPlant cloud data storage resources and Pegasus workflow management system (Pegasus-WMS). The workflow allows users to identify single nucleotide polymorphisms (SNPs) and insertion-deletions (indels), perform SNP annotations and conduct copy number variation analyses on multiple resequencing datasets in a user-friendly and seamless way. We have developed both a Linux version in GitHub ( https://github.com/pegasus-isi/PGen-GenomicVariations-Workflow ) and a web-based implementation of the PGen workflow integrated within the Soybean Knowledge Base (SoyKB), ( http://soykb.org/Pegasus/index.php ). Using PGen, we identified 10,218,140 single-nucleotide polymorphisms (SNPs) and 1,398,982 indels from analysis of 106 soybean lines sequenced at 15X coverage. 297,245 non-synonymous SNPs and 3330 copy number variation (CNV) regions were identified from this analysis. SNPs identified using PGen from additional soybean resequencing projects adding to 500+ soybean germplasm lines in total have been integrated. These SNPs are being utilized for trait improvement using genotype to phenotype prediction approaches developed in-house. In order to browse and access NGS data easily, we have also developed an NGS resequencing data browser ( http://soykb.org/NGS_Resequence/NGS_index.php ) within SoyKB to provide easy access to SNP and downstream analysis results for soybean researchers. PGen workflow has been optimized for the most efficient analysis of soybean data using thorough testing and validation. This research serves as an example of best practices for development of genomics data analysis workflows by integrating remote HPC resources and efficient data management with ease of use for biological users. PGen workflow can also be easily customized for analysis of data in other species.
Lee, Sang Y; Zhu, Junjia; Salzberg, Anna C; Zhang, Bo; Liu, Dajiang J; Muscat, Joshua E; Langan, Sara T; Connor, James R
2017-01-01
Human hemochromatosis protein (HFE) is involved in iron metabolism. Two major HFE polymorphisms, H63D and C282Y, have been associated with an increased risk of cancers. Previously, we reported decreased gender effects in overall survival based on H63D or C282Y HFE polymorphisms patients with glioblastoma multiforme (GBM). However, the effect of other single nucleotide variation (SNV) in the HFE gene on the cancer development and progression has not been systematically studied. To expand our finding in a larger sample, and to identify other HFE SNV, we analyzed the frequency of somatic SNV in HFE gene and its relationship to survival in GBM patients using The Cancer Genome Atlas (TCGA) GBM (Caucasian only) database. We found 9 SNVs with increased frequency in blood normal of TCGA GBM patients compared to the 1000Genome. Among 9 SNVs, 7 SNVs were located in the intron and 2 SNVs (i.e., H63D, C282Y) in the exon of HFE gene. The statistical analysis demonstrated that blood normal samples of TCGA GBM have more H63D (p = 0.0002, 95% Confidence interval (CI): 0.2119-0.3223) or C282Y (p = 0.0129, 95% CI: 0.0474-0.1159) HFE polymorphisms than 1000Genome. The Kaplan-Meier survival curve for the 264 GBM samples revealed no difference between wild type (WT) HFE and H63D, and WT HFE and C282Y GBM patients. In addition, there was no difference in the survival of male/female GBM patients based on HFE genotype. There was no correlation between HFE expression and survival. In conclusion, the current results suggest that somatic HFE polymorphisms do not impact GBM patients' survival in the TCGA data set of GBM.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Raynal, Caroline; Ciccolini, Joseph; Mercier, Cédric; Boyer, Jean-Christophe; Polge, Anne; Lallemant, Benjamin; Mouzat, Kévin; Lumbroso, Serge; Brouillet, Jean-Paul; Evrard, Alexandre
2010-02-01
Gemcitabine (2',2'-difluorodeoxycytidine) is a major antimetabolite cytotoxic drug with a wide spectrum of activity against solid tumors. Hepatic elimination of gemcitabine depends on a catabolic pathway through a deamination step driven by the enzyme cytidine deaminase (CDA). Severe hematologic toxicity to gemcitabine was reported in patients harboring genetic polymorphisms in CDA gene. High-resolution melting (HRM) analysis of polymerase chain reaction amplicon emerges today as a powerful technique for both genotyping and gene scanning strategies. In this study, 46 DNA samples from gemcitabine-treated patients were subjected to HRM analysis on a LightCycler 480 platform. Residual serum CDA activity was assayed as a surrogate marker for the overall functionality of this enzyme. Genotyping of three well-described single nucleotide polymorphisms in coding region (c.79A>C, c.208G>A and c.435C>T) was successfully achieved by HRM analysis of small polymerase chain reaction fragments, whereas unknown single nucleotide polymorphisms were searched by a gene scanning strategy with longer amplicons (up to 622 bp). The gene scanning strategy allowed us to find a new intronic mutation c.246+37G>A in a female patient displaying marked CDA deficiency and who had an extreme toxic reaction with a fatal outcome to gemcitabine treatment. Our work demonstrates that HRM-based methods, owing to their simplicity, reliability, and speed, are useful tools for diagnosis of CDA deficiency and could be of interest for personalized medicine.
Brown, J K; Ostrow, K M; Idris, A M; Stenger, D C
2000-05-01
Phylogenetic and distance analyses place Chino del tomate virus (CdTV) in the New World clade of begomoviruses and indicate that CdTV and Tomato leaf crumple virus (TLCrV) are closely related strains of the same virus. One cloned CdTV A component (pCdTV-H6), when inoculated to tomato with the B component (pCdTV-B52), produced mild symptoms and low DNA titers. Another cloned CdTV A component (pCdTV-H8), when coinoculated to tomato with the B component, produced moderate leaf curling and veinal chlorosis similar to that of TLCrV. Coinoculation of both CdTV A components and the B component to tomato produced wild-type chino del tomate (CdT) disease symptoms consisting of severe leaf curling, veinal and interveinal chlorosis, and stunting. The two CdTV A components were nearly identical, except at nucleotide positions 1,722 and 2,324. The polymorphism at nucleotide 1,722 resulted in a change at Rep amino acid 261. The second polymorphism at nucleotide 2,324 resulted in changes at Rep amino acid 60 and AC4 amino acid 10. Two chimeric A components constructed by reciprocal exchange of a fragment bearing the polymorphic site at nucleotide 1,722 were evaluated for symptom phenotype. One chimeric A component (pCdTV-H86) produced wild-type CdT symptoms when coinoculated to tomato with the B component. The reciprocal chimeric A component (pCdTV-H68), when coin-oculated to tomato with the B component, also produced severe leaf curling, veinal chlorosis, and stunting. However, pCdTV-H68 induced less obvious interveinal chlorosis than wild-type or pCdTV-H86. Examination of A component genotypes recovered from tomato coinoculated with pCdTV-H6 and pCdTV-H8 indicated that recombination occurred to produce a genotype identical to pCdTV-H86. These results indicate that subtle genotypic variation has significant effects on symptom expression and may explain phenotypic differences observed among isolates and cloned DNAs of CdTV and TLCrV.
ErbB polymorphisms: insights and implications for response to targeted cancer therapeutics.
Alaoui-Jamali, Moulay A; Morand, Grégoire B; da Silva, Sabrina Daniela
2015-01-01
Advances in high-throughput genomic-scanning have expanded the repertory of genetic variations in DNA sequences encoding ErbB tyrosine kinase receptors in humans, including single nucleotide polymorphisms (SNPs), polymorphic repetitive elements, microsatellite variations, small-scale insertions and deletions. The ErbB family members: EGFR, ErbB2, ErbB3, and ErbB4 receptors are established as drivers of many aspects of tumor initiation and progression to metastasis. This knowledge has provided rationales for the development of an arsenal of anti-ErbB therapeutics, ranging from small molecule kinase inhibitors to monoclonal antibodies. Anti-ErbB agents are becoming the cornerstone therapeutics for the management of cancers that overexpress hyperactive variants of ErbB receptors, in particular ErbB2-positive breast cancer and non-small cell lung carcinomas. However, their clinical benefit has been limited to a subset of patients due to a wide heterogeneity in drug response despite the expression of the ErbB targets, attributed to intrinsic (primary) and to acquired (secondary) resistance. Somatic mutations in ErbB tyrosine kinase domains have been extensively investigated in preclinical and clinical setting as determinants for either high sensitivity or resistance to anti-ErbB therapeutics. In contrast, only scant information is available on the impact of SNPs, which are widespread in genes encoding ErbB receptors, on receptor structure and activity, and their predictive values for drug susceptibility. This review aims to briefly update polymorphic variations in genes encoding ErbB receptors based on recent advances in deep sequencing technologies, and to address challenging issues for a better understanding of the functional impact of single versus combined SNPs in ErbB genes to receptor topology, receptor-drug interaction, and drug susceptibility. The potential of exploiting SNPs in the era of stratified targeted therapeutics is discussed.
Chang, Tien-Jyun; Wang, Wen-Chang; Hsiung, Chao A; He, Chih-Tsueng; Lin, Ming-Wei; Sheu, Wayne Huey-Herng; Chang, Yi-Cheng; Quertermous, Tom; Chen, Ida; Rotter, Jerome; Chuang, Lee-Ming
2016-03-01
Essential hypertension is a complex disease involving multiple genetic and environmental factors. A human gene containing a sorbin homology domain and 3 SH3 domains in the C-terminal region, termed SORBS1, plays a significant role in insulin signaling. We previously found a significant association between the T228A polymorphism and insulin resistance, obesity, and type 2 diabetes. It has been hypothesized that a set of genes responsible for insulin resistance may be closely linked with genes susceptible to the development of hypertension. Identification of insulin resistance-related genetic factors may, therefore, enhance our understanding of essential hypertension. This study aimed to examine whether common SORBS1 genetic variations are associated with blood pressure and age at onset of hypertension in an ethnic Chinese cohort.We genotyped 9 common tagged single nucleotide polymorphisms of the SORBS1 gene in 1136 subjects of Chinese origin from the Stanford Asia-Pacific Program for Hypertension and Insulin Resistance family study. Blood pressure was measured upon enrolment. The associations of the SORBS1 single nucleotide polymorphisms with blood pressure and the presence of hypertension were analyzed with a generalized estimating equation model. We used the false-discovery rate measure Q value with a cutoff <0.1 to adjust for multiple comparisons. In the Cox regression analysis for hypertension-free survival, a robust sandwich variance estimator was used to deal with the within-family correlations with age at onset of hypertension. Gender, body mass index, and antihypertension medication were adjustment covariates in the Cox regression analysis.In this study, genetic variants of rs2281939 and rs2274490 were significantly associated with both systolic and diastolic blood pressure. A genetic variant of rs2274490 was also significantly associated with the presence of hypertension. Furthermore, genetic variants of rs2281939 and rs2274490 were associated with age at onset of hypertension after adjustment for gender, body mass index, and antihypertension medication.In conclusion, we provide evidence for an association between common SORBS1 genetic variations and blood pressure, presence of hypertension, and age at onset of hypertension. The biological mechanism of genetic variation associated with blood pressure regulation needs further investigation.
Holtmann, B; Grosser, S; Lagisz, M; Johnson, S L; Santos, E S A; Lara, C E; Robertson, B C; Nakagawa, S
2016-02-01
Quantifying the variation in behaviour-related genes within and between populations provides insight into how evolutionary processes shape consistent behavioural traits (i.e. personality). Deliberate introductions of non-native species offer opportunities to investigate how such genes differ between native and introduced populations and how polymorphisms in the genes are related to variation in behaviour. Here, we compared the genetic variation of the two 'personality' genes, DRD4 and SERT, between a native (United Kingdom, UK) and an introduced (New Zealand, NZ) population of dunnocks, Prunella modularis. The NZ population showed a significantly lower number of single nucleotide polymorphisms (SNPs) compared to the UK population. Standardized F'st estimates of the personality genes and neutral microsatellites indicate that selection (anthropogenic and natural) probably occurred during and post the introduction event. Notably, the largest genetic differentiation was found in the intronic regions of the genes. In the NZ population, we also examined the association between polymorphisms in DRD4 and SERT and two highly repeatable behavioural traits: flight-initiation distance and mating status (promiscuous females and cobreeding males). We found 38 significant associations (for different allele effect models) between the two behavioural traits and the studied genes. Further, 22 of the tested associations showed antagonistic allele effects for males and females. Our findings illustrate how introduction events and accompanying ecological changes could influence the genetic diversity of behaviour-related genes. © 2015 John Wiley & Sons Ltd.
Tan, Geoffrey C.Y.; Doke, Thomas F.; Ashburner, John; Wood, Nicholas W.; Frackowiak, Richard S.J.
2010-01-01
Recent genetic studies have implicated a number of candidate genes in the pathogenesis of Autism Spectrum Disorder (ASD). Polymorphisms of CNTNAP2 (contactin-associated like protein-2), a member of the neurexin family, have already been implicated as a susceptibility gene for autism by at least 3 separate studies. We investigated variation in white and grey matter morphology using structural MRI and diffusion tensor imaging. We compared volumetric differences in white and grey matter and fractional anisotropy values in control subjects characterised by genotype at rs7794745, a single nucleotide polymorphism in CNTNAP2. Homozygotes for the risk allele showed significant reductions in grey and white matter volume and fractional anisotropy in several regions that have already been implicated in ASD, including the cerebellum, fusiform gyrus, occipital and frontal cortices. Male homozygotes for the risk alleles showed greater reductions in grey matter in the right frontal pole and in FA in the right rostral fronto-occipital fasciculus compared to their female counterparts who showed greater reductions in FA of the anterior thalamic radiation. Thus a risk allele for autism results in significant cerebral morphological variation, despite the absence of overt symptoms or behavioural abnormalities. The results are consistent with accumulating evidence of CNTNAP2's function in neuronal development. The finding suggests the possibility that the heterogeneous manifestations of ASD can be aetiologically characterised into distinct subtypes through genetic-morphological analysis. PMID:20176116
Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan
2004-09-01
Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.
USDA-ARS?s Scientific Manuscript database
In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...
Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan
2015-12-01
We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.
Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei
2017-08-01
Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Polymorphisms of interleukin-1β and MUC7 genes in burning mouth syndrome.
Kim, Moon-Jong; Kim, Jihoon; Chang, Ji-Youn; Kim, Yoon-Young; Kho, Hong-Seop
2017-04-01
The objectives of the present study are to compare polymorphisms of the IL-1β and MUC7 genes between patients with burning mouth syndrome (BMS) and controls and to investigate relationships between these polymorphisms and clinical characteristics in BMS patients. Forty female BMS patients and 40 gender- and age-matched controls were included. Genomic DNA was extracted from saliva samples. Single-nucleotide polymorphisms of IL-1β -511 and +3954 and variation in number of tandem repeat (VNTR) polymorphism of MUC7 were analyzed. Relationships between genotypic polymorphism data and clinical characteristics in BMS patients were also analyzed. There were no significant differences in the genotypes of IL-1β -511 and +3954 and of MUC7 between the groups. There were no significant differences in symptom duration and intensity of BMS patients according to their IL-1β and MUC7 genotypes. The T allele of IL-1β -511 showed associations with psychometry results in BMS patients: paranoid ideation (P = 0.014), Global Severity Index (P = 0.025), and Positive Symptom Total (P = 0.008). The genotypic polymorphisms of IL-1β -511 and +3954, and of MUC7 VNTR, had no direct associations with the development of BMS. However, the T allele of IL-1β -511 may increase the risk of BMS by increasing psychological asthenia. The genotypic polymorphisms of IL-1β -511 may increase the risk for the development of BMS by increasing psychological asthenia.
Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne
2012-01-01
Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761
Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne
2012-11-01
Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.
Duellman, Tyler; Warren, Christopher; Yang, Jay
2014-01-01
Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221
Rate of de novo mutations and the importance of father's age to disease risk.
Kong, Augustine; Frigge, Michael L; Masson, Gisli; Besenbacher, Soren; Sulem, Patrick; Magnusson, Gisli; Gudjonsson, Sigurjon A; Sigurdsson, Asgeir; Jonasdottir, Aslaug; Jonasdottir, Adalbjorg; Wong, Wendy S W; Sigurdsson, Gunnar; Walters, G Bragi; Steinberg, Stacy; Helgason, Hannes; Thorleifsson, Gudmar; Gudbjartsson, Daniel F; Helgason, Agnar; Magnusson, Olafur Th; Thorsteinsdottir, Unnur; Stefansson, Kari
2012-08-23
Mutations generate sequence diversity and provide a substrate for selection. The rate of de novo mutations is therefore of major importance to evolution. Here we conduct a study of genome-wide mutation rates by sequencing the entire genomes of 78 Icelandic parent-offspring trios at high coverage. We show that in our samples, with an average father's age of 29.7, the average de novo mutation rate is 1.20 × 10(-8) per nucleotide per generation. Most notably, the diversity in mutation rate of single nucleotide polymorphisms is dominated by the age of the father at conception of the child. The effect is an increase of about two mutations per year. An exponential model estimates paternal mutations doubling every 16.5 years. After accounting for random Poisson variation, father's age is estimated to explain nearly all of the remaining variation in the de novo mutation counts. These observations shed light on the importance of the father's age on the risk of diseases such as schizophrenia and autism.
Genetic Diversity and Demographic History of Cajanus spp. Illustrated from Genome-Wide SNPs
Saxena, Rachit K.; von Wettberg, Eric; Upadhyaya, Hari D.; Sanchez, Vanessa; Songok, Serah; Saxena, Kulbhushan; Kimurto, Paul; Varshney, Rajeev K.
2014-01-01
Understanding genetic structure of Cajanus spp. is essential for achieving genetic improvement by quantitative trait loci (QTL) mapping or association studies and use of selected markers through genomic assisted breeding and genomic selection. After developing a comprehensive set of 1,616 single nucleotide polymorphism (SNPs) and their conversion into cost effective KASPar assays for pigeonpea (Cajanus cajan), we studied levels of genetic variability both within and between diverse set of Cajanus lines including 56 breeding lines, 21 landraces and 107 accessions from 18 wild species. These results revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, 75.8% of successful SNP assays revealed polymorphism, and more than 95% of these assays could be successfully transferred to related wild species. To show regional patterns of variation, we used STRUCTURE and Analysis of Molecular Variance (AMOVA) to partition variance among hierarchical sets of landraces and wild species at either the continental scale or within India. STRUCTURE separated most of the domesticated germplasm from wild ecotypes, and separates Australian and Asian wild species as has been found previously. Among Indian regions and states within regions, we found 36% of the variation between regions, and 64% within landraces or wilds within states. The highest level of polymorphism in wild relatives and landraces was found in Madhya Pradesh and Andhra Pradesh provinces of India representing the centre of origin and domestication of pigeonpea respectively. PMID:24533111
Schoville, Sean D.; Flowers, Jonathan M.; Burton, Ronald S.
2012-01-01
The marine copepod Tigriopus californicus lives in intertidal rock pools along the Pacific coast, where it exhibits strong, temporally stable population genetic structure. Previous allozyme surveys have found high frequency private alleles among neighboring subpopulations, indicating that there is limited genetic exchange between populations. Here we evaluate the factors responsible for the diversification and maintenance of alleles at the phosphoglucose isomerase (Pgi) locus by evaluating patterns of nucleotide variation underlying previously identified allozyme polymorphism. Copepods were sampled from eleven sites throughout California and Baja California, revealing deep genetic structure among populations as well as genetic variability within populations. Evidence of recombination is limited to the sample from Pescadero and there is no support for linkage disequilibrium across the Pgi locus. Neutrality tests and codon-based models of substitution suggest the action of natural selection due to elevated non-synonymous substitutions at a small number of sites in Pgi. Two sites are identified as the charge-changing residues underlying allozyme polymorphisms in T. californicus. A reanalysis of allozyme variation at several focal populations, spanning a period of 26 years and over 200 generations, shows that Pgi alleles are maintained without notable frequency changes. Our data suggest that diversifying selection accounted for the origin of Pgi allozymes, while McDonald-Kreitman tests and the temporal stability of private allozyme alleles suggests that balancing selection may be involved in the maintenance of amino acid polymorphisms within populations. PMID:22768211
Nucleotide diversity and linkage disequilibrium in wild avocado (Persea americana Mill.).
Chen, Haofeng; Morrell, Peter L; de la Cruz, Marlene; Clegg, Michael T
2008-01-01
Resequencing studies provide the ultimate resolution of genetic diversity because they identify all mutations in a gene that are present within the sampled individuals. We report a resequencing study of Persea americana, a subtropical tree species native to Meso- and Central America and the progenitor of cultivated avocado. The sample includes 21 wild accessions from Mexico, Costa Rica, Ecuador, and the Dominican Republic. Estimated levels of nucleotide polymorphism and linkage disequilibrium (LD) are obtained from fully resolved haplotype data from 4 nuclear loci that span 5960 nucleotide sites. Results show that, although avocado is a subtropical tree crop and a predominantly outcrossing plant, the overall level of genetic variation is not exceptionally high (nucleotide diversity at silent sites, pi(sil) = 0.0102) compared with available estimates from temperate plant species. Intralocus LD decays rapidly to half the initial value within about 1 kb. Estimates of recombination rate (based on the sequence data) show that the rate is not exceptionally high when compared with annual plants such as wild barley or maize. Interlocus LD is significant owing to substantial population structure induced by mixing of the 3 botanical races of avocado.
Portnoy, D S; Puritz, J B; Hollenbeck, C M; Gelsleichter, J; Chapman, D; Gold, J R
2015-12-01
Sex-biased dispersal is expected to homogenize nuclear genetic variation relative to variation in genetic material inherited through the philopatric sex. When site fidelity occurs across a heterogeneous environment, local selective regimes may alter this pattern. We assessed spatial patterns of variation in nuclear-encoded, single nucleotide polymorphisms (SNPs) and sequences of the mitochondrial control region in bonnethead sharks (Sphyrna tiburo), a species thought to exhibit female philopatry, collected from summer habitats used for gestation. Geographic patterns of mtDNA haplotypes and putatively neutral SNPs confirmed female philopatry and male-mediated gene flow along the northeastern coast of the Gulf of Mexico. A total of 30 outlier SNP loci were identified; alleles at over half of these loci exhibited signatures of latitude-associated selection. Our results indicate that in species with sex-biased dispersal, philopatry can facilitate sorting of locally adaptive variation, with the dispersing sex facilitating movement of potentially adaptive variation among locations and environments. © 2015 John Wiley & Sons Ltd.
Xiao, W-J; He, J-W; Zhang, H; Hu, W-W; Gu, J-M; Yue, H; Gao, G; Yu, J-B; Wang, C; Ke, Y-H; Fu, W-Z; Zhang, Z-L
2011-03-01
Arachidonate 12-lipoxygenase (ALOX12) is a member of the lipoxygenase superfamily, which catalyzes the incorporation of molecular oxygen into polyunsaturated fatty acids. The products of ALOX12 reactions serve as endogenous ligands for peroxisome proliferator-activated receptor γ (PPARG). The activation of the PPARG pathway in marrow-derived mesenchymal progenitors stimulates adipogenesis and inhibits osteoblastogenesis. Our objective was to determine whether polymorphisms in the ALOX12 gene were associated with variations in peak bone mineral density (BMD) and obesity phenotypes in young Chinese men. All six tagging single-nucleotide polymorphisms (SNPs) in the ALOX12 gene were genotyped in a total of 1215 subjects from 400 Chinese nuclear families by allele-specific polymerase chain reaction. The BMD at the lumbar spine and hip, total fat mass (TFM) and total lean mass (TLM) were measured using dual-energy X-ray absorptiometry. The pairwise linkage disequilibrium among SNPs was measured, and the haplotype blocks were inferred. Both the individual SNP markers and the haplotypes were tested for an association with the peak BMD, body mass index, TFM, TLM and percentage fat mass (PFM) using the quantitative transmission disequilibrium test (QTDT). Using the QTDT, significant within-family association was found between the rs2073438 polymorphism in the ALOX12 gene and the TFM and PFM (P=0.007 and 0.012, respectively). Haplotype analyses were combined with our individual SNP results and remained significant even after correction for multiple testing. However, we failed to find significant within-family associations between ALOX12 SNPs and the BMD at any bone site in young Chinese men. Our present results suggest that the rs2073438 polymorphism of ALOX12 contributes to the variation of obesity phenotypes in young Chinese men, although we failed to replicate the association with the peak BMD variation in this sample. Further independent studies are needed to confirm our findings.
Macé, Matthias; Crouau-Roy, Brigitte
2008-01-01
Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953
Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici
McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.
2016-01-01
Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952
Wu, Juan; Zhang, Junfeng; Zhan, Zhen; Cao, Qinhong; Li, Zhong
2016-07-26
Recent studies have implicated that members of the DICKKOPF (DKK) were causally involved in large number of human cancers. This study was designed to investigate the relationship between the genetic variations of DKK family genes and the risk of gastric cancer (GC). Six SNPs (single nucleotide polymorphisms) of DKK family genes, including rs2241529 in DKK1, rs3733635, rs17037102 and rs419764 in DKK2, rs3206824 in DKK3 and rs2073664 in DKK4, were selected and genotyped by restriction fragment length polymorphism (RFLP) and TaqMan SNP genotyping methods in 409 GC cases and 554 cancer-free controls in the Han population in eastern China. None of the six SNPs achieved significant association with the overall GC risk and stratified analysis by age, gender, smoking status, drinking status, tumor location and pathological classification confirmed these non-significant associations. Our study indicated that the studied six SNPs of DKKs would not be the risk factors for GC in this Han Chinese population. Studies of larger population for different ethnicities will be needed to warrant our findings.
Copy Number Variation in Fungi and Its Implications for Wine Yeast Genetic Diversity and Adaptation
Steenwyk, Jacob L.; Rokas, Antonis
2018-01-01
In recent years, copy number (CN) variation has emerged as a new and significant source of genetic polymorphisms contributing to the phenotypic diversity of populations. CN variants are defined as genetic loci that, due to duplication and deletion, vary in their number of copies across individuals in a population. CN variants range in size from 50 base pairs to whole chromosomes, can influence gene activity, and are associated with a wide range of phenotypes in diverse organisms, including the budding yeast Saccharomyces cerevisiae. In this review, we introduce CN variation, discuss the genetic and molecular mechanisms implicated in its generation, how they can contribute to genetic and phenotypic diversity in fungal populations, and consider how CN variants may influence wine yeast adaptation in fermentation-related processes. In particular, we focus on reviewing recent work investigating the contribution of changes in CN of fermentation-related genes in yeast wine strains and offer notable illustrations of such changes, including the high levels of CN variation among the CUP genes, which confer resistance to copper, a metal with fungicidal properties, and the preferential deletion and duplication of the MAL1 and MAL3 loci, respectively, which are responsible for metabolizing maltose and sucrose. Based on the available data, we propose that CN variation is a substantial dimension of yeast genetic diversity that occurs largely independent of single nucleotide polymorphisms. As such, CN variation harbors considerable potential for understanding and manipulating yeast strains in the wine fermentation environment and beyond. PMID:29520259
Urano, Tomohiko; Shiraki, Masataka; Saito, Mitsuru; Sasaki, Noriko; Ouchi, Yasuyoshi; Inoue, Satoshi
2014-10-01
Elevation of homocysteine is associated with an increased risk for bone fractures. We previously reported that the methylenetetrahydrofolate reductase (MTHFR) gene polymorphism is associated with homocysteine levels and fracture. The association between the fracture and folate levels or their related gene polymorphisms is not completely clear. We speculated that the SLC25A32 gene, the mitochondrial inner membrane folate transporter, also could be implicated in the regulation of folate metabolism and fracture. A total of 851 Japanese postmenopausal women participated in the association study between the single nucleotide polymorphism genotype and plasma homocysteine or folate. We also tested the association between the candidate single nucleotide polymorphism and 663 postmenopausal women. The AA genotype of rs2241777 single nucleotide polymorphism at the 3'UTR region in the SLC25A32 gene was associated with lower plasma folate concentration compared with the other genotypes in 851 postmenopausal women. A total of 674 postmenopausal ambulatory Japanese women were followed up for 5.5 ± 0.1 years (mean ± SE). The AA genotype groups also showed an apparently higher rate and earlier onset of incident fractures than the other genotypes. A total of 407 participants had >70% young-adult mean bone mineral density at the start of the observation. These results show that the SLC25A32 gene polymorphism could be a risk factor for lower folate concentration and future fracture. © 2013 Japan Geriatrics Society.
Zhang, Y R; Li, Y K; Fu, C Z; Wang, J L; Wang, H B; Zan, L S
2014-10-07
Beef cattle breeding programs focus on improving important economic traits, including growth rates, and meat quantity and quality. Molecular marker-assisted selection based on genetic variation represents a potential method for breeding genetically improved livestock with better economic traits. Smoothened (SMO) protein is a signal transducer that contributes to the regulation of both osteogenesis and adipogenesis through the hedgehog pathway. In this study, we detected polymorphisms in the bovine SMO gene of Qinchuan cattle, and we analyzed their associations with body measurement traits (BMTs) and meat quality traits (MQTs). Using DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism, 3 novel single nucleotide polymorphisms were identified in the SMO gene of 562 cattle: 1 G > C mutation on exon 9 (G21234C) and 2 C > T mutations on exon 11 (C22424T and C22481T). Association analysis showed that polymorphisms on both the G21234C and C22424T loci significantly affected certain BMTs and MQTs (P < 0.05 or P < 0.01), whereas those on the C22481T locus did not (P > 0.05). Therefore, the SMO gene could be used as a candidate gene to alter BMTs and MQTs in Qinchuan cattle or for marker-assisted selection to breed cattle with superior BMTs and MQTs.
Muddana, Venkata; Park, James; Lamb, Janette; Yadav, Dhiraj; Papachristou, Georgios I; Hawes, Robert H; Brand, Randall; Slivka, Adam; Whitcomb, David C
2010-11-01
Platelet-derived growth factor [beta] (PDGF-[beta]) is a major signal in proliferation and matrix synthesis through activated pancreatic stellate cells, leading to fibrosis of the pancreas. Recurrent acute pancreatitis (RAP) seems to predispose to chronic pancreatitis (CP) in some patients but not others. We tested the hypothesis that 2 known PDGF-[beta] polymorphisms are associated with progression from RAP to CP. We also tested the hypothesis that PDGF-[beta] polymorphisms in combination with environmental risk factors such as alcohol and smoking are associated with CP. Three hundred eighty-two patients with CP (n = 176) and RAP (n = 206) and 251 controls were evaluated. Platelet-derived growth factor [beta] polymorphisms +286 A/G (rs#1800818) seen in 5'-UTR and +1135 A/C (rs#1800817) in first intron were genotyped using single-nucleotide polymorphism polymerase chain reaction approach and confirmed by DNA sequencing. The genotypic frequencies for PDGF-[beta] polymorphisms in positions +286 and +1135 were found to be similar in controls and patients with RAP and CP. There was no difference in genotypic frequencies among RAP, CP, and controls in subjects in the alcohol and smoking subgroups. Known variations in the PDGF-[beta] gene do not have a significant effect on promoting or preventing fibrogenesis in pancreatitis. Further evaluation of this important pathway is warranted.
Genome-wide association study reveals putative regulators of bioenergy traits in Populus deltoides
Fahrenkrog, Annette M.; Neves, Leandro G.; Resende, Jr., Marcio F. R.; ...
2016-09-06
Genome-wide association studies (GWAS) have been used extensively to dissect the genetic regulation of complex traits in plants. These studies have focused largely on the analysis of common genetic variants despite the abundance of rare polymorphisms in several species, and their potential role in trait variation. Here, we conducted the first GWAS in Populus deltoides, a genetically diverse keystone forest species in North America and an important short rotation woody crop for the bioenergy industry. We searched for associations between eight growth and wood composition traits, and common and low-frequency single-nucleotide polymorphisms detected by targeted resequencing of 18 153 genesmore » in a population of 391 unrelated individuals. To increase power to detect associations with low-frequency variants, multiple-marker association tests were used in combination with single-marker association tests. Significant associations were discovered for all phenotypes and are indicative that low-frequency polymorphisms contribute to phenotypic variance of several bioenergy traits. Our results suggest that both common and low-frequency variants need to be considered for a comprehensive understanding of the genetic regulation of complex traits, particularly in species that carry large numbers of rare polymorphisms. Lastly, these polymorphisms may be critical for the development of specialized plant feedstocks for bioenergy.« less
Lado, Bettina; Matus, Ivan; Rodríguez, Alejandra; Inostroza, Luis; Poland, Jesse; Belzile, François; del Pozo, Alejandro; Quincke, Martín; Castro, Marina; von Zitzewitz, Jarislav
2013-12-09
In crop breeding, the interest of predicting the performance of candidate cultivars in the field has increased due to recent advances in molecular breeding technologies. However, the complexity of the wheat genome presents some challenges for applying new technologies in molecular marker identification with next-generation sequencing. We applied genotyping-by-sequencing, a recently developed method to identify single-nucleotide polymorphisms, in the genomes of 384 wheat (Triticum aestivum) genotypes that were field tested under three different water regimes in Mediterranean climatic conditions: rain-fed only, mild water stress, and fully irrigated. We identified 102,324 single-nucleotide polymorphisms in these genotypes, and the phenotypic data were used to train and test genomic selection models intended to predict yield, thousand-kernel weight, number of kernels per spike, and heading date. Phenotypic data showed marked spatial variation. Therefore, different models were tested to correct the trends observed in the field. A mixed-model using moving-means as a covariate was found to best fit the data. When we applied the genomic selection models, the accuracy of predicted traits increased with spatial adjustment. Multiple genomic selection models were tested, and a Gaussian kernel model was determined to give the highest accuracy. The best predictions between environments were obtained when data from different years were used to train the model. Our results confirm that genotyping-by-sequencing is an effective tool to obtain genome-wide information for crops with complex genomes, that these data are efficient for predicting traits, and that correction of spatial variation is a crucial ingredient to increase prediction accuracy in genomic selection models.
Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong
2015-01-01
Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016
Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W
2014-09-01
A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.
Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko
2016-01-01
Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
ENGINES: exploring single nucleotide variation in entire human genomes.
Amigo, Jorge; Salas, Antonio; Phillips, Christopher
2011-04-19
Next generation ultra-sequencing technologies are starting to produce extensive quantities of data from entire human genome or exome sequences, and therefore new software is needed to present and analyse this vast amount of information. The 1000 Genomes project has recently released raw data for 629 complete genomes representing several human populations through their Phase I interim analysis and, although there are certain public tools available that allow exploration of these genomes, to date there is no tool that permits comprehensive population analysis of the variation catalogued by such data. We have developed a genetic variant site explorer able to retrieve data for Single Nucleotide Variation (SNVs), population by population, from entire genomes without compromising future scalability and agility. ENGINES (ENtire Genome INterface for Exploring SNVs) uses data from the 1000 Genomes Phase I to demonstrate its capacity to handle large amounts of genetic variation (>7.3 billion genotypes and 28 million SNVs), as well as deriving summary statistics of interest for medical and population genetics applications. The whole dataset is pre-processed and summarized into a data mart accessible through a web interface. The query system allows the combination and comparison of each available population sample, while searching by rs-number list, chromosome region, or genes of interest. Frequency and FST filters are available to further refine queries, while results can be visually compared with other large-scale Single Nucleotide Polymorphism (SNP) repositories such as HapMap or Perlegen. ENGINES is capable of accessing large-scale variation data repositories in a fast and comprehensive manner. It allows quick browsing of whole genome variation, while providing statistical information for each variant site such as allele frequency, heterozygosity or FST values for genetic differentiation. Access to the data mart generating scripts and to the web interface is granted from http://spsmart.cesga.es/engines.php. © 2011 Amigo et al; licensee BioMed Central Ltd.
Lan, Bing; Chen, Peng; Jiri, Mutu; He, Na; Feng, Tian; Liu, Kai; Jin, Tianbo; Kang, Longli
2016-03-01
Current evidence suggests heredity and metabolic syndrome contributes to gout progression. Specifically, the WDR1 and CLNK genes may play a role in gout progression in European ancestry populations. However, no studies have focused on Chinese populations, especially Tibetan individuals. This study aims to determine whether variations in these two genes correlate with gout-related indices in Chinese-Tibetan gout patients. Eleven single-nucleotide polymorphisms in the WDR1 and CLNK genes were detected in 319 Chinese-Tibetan gout patients and 318 controls. We used one-way analysis of variance to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators, such as albumin, glucose (GLU), triglycerides, cholesterol, high-density lipoproteins (HDL-C), creatinine, and uric acid, from fasting venous blood samples. All p values were Bonferroni corrected. Polymorphisms of the WDR1 and CLNK genes affected multiple risk factors for gout development. Significant differences in serum GLU levels were detected between different genotypic groups with WDRI polymorphisms rs4604059 (p = 0.005) and rs12498927 (p = 0.005). In addition, significant differences in serum HDL-C levels were detected between different genotypic groups with the CLNK polymorphism rs2041215 (p = 0.001). Polymorphisms of CLNK also affected levels of albumin, triglycerides, and creatinine. This study is the first to investigate and identify positive correlations between WDR1 and CLNK gene polymorphisms in Chinese-Tibetan populations. Our findings provide significant evidence for the effect of genetic polymorphisms on gout-related factors in Chinese-Tibetan populations.
Czepiel, Jacek; Biesiada, Grażyna; Dróżdż, Mirosław; Gdula-Argasińska, Joanna; Żurańska, Justyna; Marchewka, Jakub; Perucki, William; Wołkow, Paweł; Garlicki, Aleksander
2018-01-01
There is large variation in the clinical manifestations of Clostridium difficile infection (CDI). We also still can not predict which patients are more susceptible to reinfection with CDI. The aim of our study was to evaluate the effect of gene single nucleotide polymorphisms (SNP) of proinflammatory cytokines, specifically IL-1β, IL-8 on the development, clinical course and recurrence of CDI. We performed a prospective study of adults (130 people ≥ 18 years) including 65 patients with CDI treated in tertiary hospital and 65 healthy persons. The following 3 variants were analyzed for the occurrence of gene polymorphisms in patients with CDI versus the control group: IL-1β +3953 A/G (rs1143634), IL-1β -31 A/G (rs1143627), and IL-8 +781 T/C (rs2227306). Then, we assessed the correlation between these genetic polymorphisms and biochemical parameters important in CDI course, CDI severity as well as CDI recurrence. The presence of genetic polymorphisms of IL-1β +3953 A/G, -31 A/G and IL-8 +781 T/C did not have an effect on the development or recurrence of CDI. The presence of IL-8 +781 T/C polymorphism is associated with the severe CDI. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A
2015-03-15
Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Pang, R; Li, Y; Dong, Y; Liang, Z; Zhang, Y; Zhang, W
2014-12-01
Imidacloprid resistance in the brown planthopper, Nilaparvata lugens, is primarily the result of the over-expression of cytochrome P450 monooxygenases. Here, a field-collected strain of N. lugens was shown to be highly resistant to both imidacloprid and buprofezin. Insecticide exposure and quantitative real-time PCR revealed that its resistance was mainly associated with a cytochrome P450 gene, CYP6AY1. CYP6AY1 is known to metabolize imidacloprid but its effect on buprofezin is unclear. In the 5'-untranslated region of CYP6AY1, a novel alternative splicing was detected. After a 1990-bp promoter region was cloned, its basal luciferase activity was assessed. Furthermore, genotyping studies identified 12 variations in the promoter region that discriminated between the field-collected and control strain. Finally, survival bioassays revealed a single nucleotide polymorphism and an insertion-deletion polymorphism linked to buprofezin and imidacloprid resistance. Mutagenesis of these sites enhanced the promoter activity of CYP6AY1. These results suggest that promoter polymorphisms may affect P450-mediated multiple insecticide resistance of pests. © 2014 The Royal Entomological Society.
Dettogni, Raquel Spinassé; Sá, Ricardo Tristão; Tovar, Thaís Tristão; Louro, Iúri Drumond
2013-08-01
Mapping single nucleotide polymorphisms (SNPs) in genes potentially involved in immune responses may help understand the pathophysiology of infectious diseases in specific geographical regions. In this context, we have aimed to analyze the frequency of immunogenetic markers, focusing on genes CD209 (SNP -336A/G), FCγRIIa (SNP -131H/R), TNF-α (SNP -308A/G) and VDR (SNP Taq I) in two populations of the Espirito Santo State (ES), Brazil: general and Pomeranian populations. Peripheral blood genomic DNA was extracted from one hundred healthy individuals of the general population and from 59 Pomeranians. Polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). SNP genotype frequencies were in Hardy-Weinberg Equilibrium. There was no statistically significant difference in allelic and genotypic distributions between the two populations studied. Statistically significant differences were observed for SNP genotype distribution in genes CD209, TNF-α and VDR when comparing the ES populations with other Brazilian populations. This is the first report of CD209, FcγRIIa, TNF-α and VDR allelic frequencies for the general and Pomeranian populations of ES.
Adaptive divergence in the monkey flower Mimulus guttatus is maintained by a chromosomal inversion.
Twyford, Alex D; Friedman, Jannice
2015-06-01
Organisms exhibit an incredible diversity of life history strategies as adaptive responses to environmental variation. The establishment of novel life history strategies involves multilocus polymorphisms, which will be challenging to establish in the face of gene flow and recombination. Theory predicts that adaptive allelic combinations may be maintained and spread if they occur in genomic regions of reduced recombination, such as chromosomal inversion polymorphisms, yet empirical support for this prediction is lacking. Here, we use genomic data to investigate the evolution of divergent adaptive ecotypes of the yellow monkey flower Mimulus guttatus. We show that a large chromosomal inversion polymorphism is the major region of divergence between geographically widespread annual and perennial ecotypes. In contrast, ∼40,000 single nucleotide polymorphisms in collinear regions of the genome show no signal of life history, revealing genomic patterns of diversity have been shaped by localized homogenizing gene flow and large-scale Pleistocene range expansion. Our results provide evidence for an inversion capturing and protecting loci involved in local adaptation, while also explaining how adaptive divergence can occur with gene flow. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.
Smith, Nicholas L; Felix, Janine F; Morrison, Alanna C; Demissie, Serkalem; Glazer, Nicole L; Loehr, Laura R; Cupples, L Adrienne; Dehghan, Abbas; Lumley, Thomas; Rosamond, Wayne D; Lieb, Wolfgang; Rivadeneira, Fernando; Bis, Joshua C; Folsom, Aaron R; Benjamin, Emelia; Aulchenko, Yurii S; Haritunians, Talin; Couper, David; Murabito, Joanne; Wang, Ying A; Stricker, Bruno H; Gottdiener, John S; Chang, Patricia P; Wang, Thomas J; Rice, Kenneth M; Hofman, Albert; Heckbert, Susan R; Fox, Ervin R; O'Donnell, Christopher J; Uitterlinden, Andre G; Rotter, Jerome I; Willerson, James T; Levy, Daniel; van Duijn, Cornelia M; Psaty, Bruce M; Witteman, Jacqueline C M; Boerwinkle, Eric; Vasan, Ramachandran S
2010-06-01
Although genetic factors contribute to the onset of heart failure (HF), no large-scale genome-wide investigation of HF risk has been published to date. We have investigated the association of 2,478,304 single-nucleotide polymorphisms with incident HF by meta-analyzing data from 4 community-based prospective cohorts: the Atherosclerosis Risk in Communities Study, the Cardiovascular Health Study, the Framingham Heart Study, and the Rotterdam Study. Eligible participants for these analyses were of European or African ancestry and free of clinical HF at baseline. Each study independently conducted genome-wide scans and imputed data to the approximately 2.5 million single-nucleotide polymorphisms in HapMap. Within each study, Cox proportional hazards regression models provided age- and sex-adjusted estimates of the association between each variant and time to incident HF. Fixed-effect meta-analyses combined results for each single-nucleotide polymorphism from the 4 cohorts to produce an overall association estimate and P value. A genome-wide significance P value threshold was set a priori at 5.0x10(-7). During a mean follow-up of 11.5 years, 2526 incident HF events (12%) occurred in 20 926 European-ancestry participants. The meta-analysis identified a genome-wide significant locus at chromosomal position 15q22 (1.4x10(-8)), which was 58.8 kb from USP3. Among 2895 African-ancestry participants, 466 incident HF events (16%) occurred during a mean follow-up of 13.7 years. One genome-wide significant locus was identified at 12q14 (6.7x10(-8)), which was 6.3 kb from LRIG3. We identified 2 loci that were associated with incident HF and exceeded genome-wide significance. The findings merit replication in other community-based settings of incident HF.
Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa
2012-01-01
We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708
Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu
2016-04-11
Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.
Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila
2012-07-01
Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.
Australian wild rice reveals pre-domestication origin of polymorphism deserts in rice genome.
Krishnan S, Gopala; Waters, Daniel L E; Henry, Robert J
2014-01-01
Rice is a major source of human food with a predominantly Asian production base. Domestication involved selection of traits that are desirable for agriculture and to human consumers. Wild relatives of crop plants are a source of useful variation which is of immense value for crop improvement. Australian wild rices have been isolated from the impacts of domestication in Asia and represents a source of novel diversity for global rice improvement. Oryza rufipogon is a perennial wild progenitor of cultivated rice. Oryza meridionalis is a related annual species in Australia. We have examined the sequence of the genomes of AA genome wild rices from Australia that are close relatives of cultivated rice through whole genome re-sequencing. Assembly of the resequencing data to the O. sativa ssp. japonica cv. Nipponbare shows that Australian wild rices possess 2.5 times more single nucleotide polymorphisms than in the Asian wild rice and cultivated O. sativa ssp. indica. Analysis of the genome of domesticated rice reveals regions of low diversity that show very little variation (polymorphism deserts). Both the perennial and annual wild rice from Australia show a high degree of conservation of sequence with that found in cultivated rice in the same 4.58 Mbp region on chromosome 5, which suggests that some of the 'polymorphism deserts' in this and other parts of the rice genome may have originated prior to domestication due to natural selection. Analysis of genes in the 'polymorphism deserts' indicates that this selection may have been due to biotic or abiotic stress in the environment of early rice relatives. Despite having closely related sequences in these genome regions, the Australian wild populations represent an invaluable source of diversity supporting rice food security.
Hamilton, Natasha A; Tammen, Imke; Raadsma, Herman W
2013-01-01
Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism.
Hamilton, Natasha A.; Tammen, Imke; Raadsma, Herman W.
2013-01-01
Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism. PMID:23408978
Toral-Rios, Danira; Franco-Bocanegra, Diana; Rosas-Carrasco, Oscar; Mena-Barranco, Francisco; Carvajal-García, Rosa; Meraz-Ríos, Marco Antonio; Campos-Peña, Victoria
2015-01-01
Amyloid peptide is able to promote the activation of microglia and astrocytes in Alzheimer’s disease (AD), and this stimulates the production of pro-inflammatory cytokines. Inflammation contributes to the process of neurodegeneration and therefore is a key factor in the development of AD. Some of the most important proteins involved in AD inflammation are: clusterin (CLU), complement receptor 1 (CR1), C reactive protein (CRP), tumor necrosis factor α (TNF-α), the interleukins 1α (IL-1α), 6 (IL-6), 10 (IL-10) and cyclooxygenase 2 (COX-2). In particular, COX-2 is encoded by the prostaglandin-endoperoxide synthase 2 gene (PTGS2). Since variations in the genes that encode these proteins may modify gene expression or function, it is important to investigate whether these variations may change the developing AD. The aim of this study was to determine whether the presence of polymorphisms in the genes encoding the aforementioned proteins is associated in Mexican patients with AD. Fourteen polymorphisms were genotyped in 96 subjects with AD and 100 controls; the differences in allele, genotype and haplotype frequencies were analyzed. Additionally, an ancestry analysis was conducted to exclude differences in genetic ancestry among groups as a confounding factor in the study. Significant differences in frequencies between AD and controls were found for the single-nucleotide polymorphism (SNP) rs20417 within the PTGS2 gene. Ancestry analysis revealed no significant differences in the ancestry of the compared groups, and the association was significant even after adjustment for ancestry and correction for multiple testing, which strengthens the validity of the results. We conclude that this polymorphism plays an important role in the development of the AD pathology and further studies are required, including their proteins. PMID:26041990
Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H
2012-01-01
PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.
Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.
Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A
2012-03-01
Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.
Dopaminergic genetic variation moderates the effect of nicotine on cigarette reward.
Harrell, Paul T; Lin, Hui-Yi; Park, Jong Y; Blank, Melissa D; Drobes, David J; Evans, David E
2016-01-01
Cigarette smoking is influenced by nicotine’s effects on dopaminergic activity in the mesocorticolimbic pathway. This activity appears to be moderated by genetic variation, specifically a variable number tandem repeat (VNTR) polymorphism in the third exon of the dopamine receptor gene (DRD4). We examined whether this polymorphism along with three DRD4 single-nucleotide polymorphisms (SNPs: rs936460, rs936461, and rs12280580) moderate the influence of nicotine on subjective responses to cigarettes. White, non-Hispanic smokers (n = 96, cigarettes/day ≥15) attended two double-blind, counterbalanced experimental sessions, each preceded by overnight smoking abstinence. Participants smoked four nicotine (8.9 mg) or placebo (1.0 mg) cigarettes per session, with each cigarette followed by completion of the modified Cigarette Evaluation Questionnaire (mCEQ). We examined the mCEQ composite score via 2 × 2 × 4 ANOVAs with genotype (major homozygotes versus minor carriers) as the between-subject factor and nicotine content and smoking bout as within-subject factors. Although DRD4 VNTR variation did not moderate overall nicotine response, there was a moderation of nicotine response over successive cigarettes. Smokers with fewer than seven repeats for the DRD4 VNTR reported markedly reduced craving, increased satisfaction, and a greater calming effect in response to earlier smoked nicotine cigarettes, whereas those with seven or more repeats did not. In addition, minor carriers for all three DRD4 SNPs displayed blunted overall response to nicotine. These findings provide support for DRD4 variation as an informative predictor of subjective responses to nicotine. We discuss how these data may lead to improved tailoring of smoking cessation pharmacotherapies.
Julca, Irene; Droby, Samir; Sela, Noa; Marcet-Houben, Marina; Gabaldón, Toni
2015-12-14
Penicillium digitatum and Penicillium expansum are two closely related fungal plant pathogens causing green and blue mold in harvested fruit, respectively. The two species differ in their host specificity, being P. digitatum restricted to citrus fruits and P. expansum able to infect a wide range of fruits after harvest. Although host-specific Penicillium species have been found to have a smaller gene content, it is so far unclear whether these different host specificities impact genome variation at the intraspecific level. Here we assessed genome variation across four P. digitatum and seven P. expansum isolates from geographically distant regions. Our results show very high similarity (average 0.06 SNPs [single nucleotide polymorphism] per kb) between globally distributed isolates of P. digitatum pointing to a recent expansion of a single lineage. This low level of genetic variation found in our samples contrasts with the higher genetic variability observed in the similarly distributed P. expansum isolates (2.44 SNPs per kb). Patterns of polymorphism in P. expansum indicate that recombination exists between genetically diverged strains. Consistent with the existence of sexual recombination and heterothallism, which was unknown for this species, we identified the two alternative mating types in different P. expansum isolates. Patterns of polymorphism in P. digitatum indicate a recent clonal population expansion of a single lineage that has reached worldwide distribution. We suggest that the contrasting patterns of genomic variation between the two species reflect underlying differences in population dynamics related with host specificities and related agricultural practices. It should be noted, however, that this results should be confirmed with a larger sampling of strains, as new strains may broaden the diversity so far found in P. digitatum. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Kok, Lotte; Hillegers, Manon H; Veldhuijzen, Dieuwke S; Boks, Marco Pm; Dieleman, Jan M; van Dijk, Diederik; Joëls, Marian; Vinkers, Christiaan H
2018-08-01
The glucocorticoid receptor (GR) agonist dexamethasone is frequently used for its anti-inflammatory properties. We recently showed that a single high-dose of dexamethasone had long-lasting protective effects on the development of psychopathology after cardiac surgery and postoperative intensive care unit stay. In this study, we investigated whether common genetic variation in the hypothalamic-pituitary-adrenal (HPA)-axis would influence the susceptibility for PTSD and depression after dexamethasone administration. Participants (n = 996) of the Dexamethasone for Cardiac Surgery (DECS) randomized clinical trial were followed after receiving a single high intraoperative dose of dexamethasone (1 mg/kg), a GR agonist, or placebo. PTSD and depressive symptoms were assessed up to four years after cardiac surgery. We focused primarily on five common single nucleotide polymorphisms (SNPs) in the glucocorticoid receptor (GR). Secondarily, we comprehensively assessed common genetic variation in the FK506 binding protein (FKBP5) and the mineralocorticoid receptor (MR). The protective effects of dexamethasone on postoperative PTSD symptoms were dependent on the GR polymorphisms rs41423247 (p = .009), rs10052957 (p = .003), and rs6189 (p = .002), but not on rs6195 (p = .025) or rs6198, (p = .026) after Bonferroni correction. No genotype-dependent effects were found for postoperative depressive symptoms. Also, no associations of FKBP5 and MR polymorphisms were found on PTSD and depression outcomes. Protective effects of dexamethasone on PTSD symptoms after cardiac surgery and ICU stay seem to depend on common genetic variation in its target receptor, the GR. These effects indicate that pre-operative genetic screening could potentially help in stratifying patients for their vulnerability for developing PTSD symptoms after surgery. Copyright © 2018. Published by Elsevier Ltd.
Zhang, X Y; Geng, T T; Liu, L J; Yuan, D Y; Feng, T; Kang, L L; Jin, T B; Chen, C
2015-08-19
Current evidence suggests that heredity and metabolic syndrome contribute to gout progression. SLC2A9 and ZNF518B may play a role in gout progression in different populations, but no studies have focused on the Tibetan Chinese population. In this study, we determined whether variations in these 2 genes were correlated with gout-related indices in Chinese-Tibetan gout patients. We detected 6 single nucleotide polymorphisms in SLC2A9 and ZNF518B in 319 Chinese Tibetan gout patients. One-way analysis of variance was used to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators. Polymorphisms in SLC2A9 and ZNF518B affected multiple risk factors related to gout development. Significant differences in serum triglyceride levels and high-density lipoprotein-cholesterol level were detected between different genotypic groups with SLC2A9 polymorphisms rs13129697 (P = 0.022), rs4447863 (P = 0.018), and rs1014290 (P = 0.045). Similarly in ZNF518B, rs3217 (P = 0.016) and rs10016022 (P = 0.046) were associated with high creatinine and glucose levels, respectively. This study is the first to investigate and identify positive correlations between SLC2A9 and ZNF518B gene polymorphisms and metabolic indices in Tibetan gout patients. We found significant evidence indicating that genetic polymorphisms affect gout-related factors in Chinese Tibetan populations.
Grasse, Wolfgang; Spring, Otmar
2015-03-01
Plasmopara halstedii virus (PhV) is a ss(+)RNA virus that exclusively occurs in the sunflower downy mildew pathogen Plasmopara halstedii, a biotrophic oomycete of severe economic impact. The virus origin and its genomic variability are unknown. A PCR-based screening of 128 samples of P. halstedii from five continents and up to 40 y old was conducted. PhV RNA was found in over 90 % of the isolates with no correlation to geographic origin or pathotype of its host. Sequence analyses of the two open reading frames (ORFs) revealed only 18 single nucleotide polymorphisms (SNPs) in 3873 nucleotides. The SNPs had no recognizable effect on the two encoded virus proteins. In 398 nucleotides of the untranslated regions (UTRs) of the RNA 2 strand eight additional SNPs and one short deletion was found. Modelling experiments revealed no effects of these variations on the secondary structure of the RNA. The results showed the presence of PhV in P. halstedii isolates of global origin and the existence of the virus since more than 40 y. The virus genome revealed a surprisingly low variation in both coding and noncoding parts. No sequence differences were correlated with host pathotype or geographic populations of the oomycete. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Oliveros, R; Cutillas, C; De Rojas, M; Arias, P
2000-12-01
Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).
Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young
2007-01-01
Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257
Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean
2012-01-01
Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron-based markers for linkage and association mapping in common bean. The utility of these markers is discussed in relation with the usefulness of microsatellites, the molecular markers by excellence in this crop. PMID:22734675
Veale, Andrew J.
2017-01-01
Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. PMID:29045601
Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader
2016-07-22
High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.
Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R
2018-05-03
Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.
Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod
2016-02-01
Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.
Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José
2014-02-01
Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.
Shang, Siyuan; Wu, Nan; Su, Yanjie
2017-01-01
Prosociality is related to numerous positive outcomes, and mechanisms underlying individual differences in prosociality have been widely discussed. Recently, research has found converging evidence on the influence of the oxytocin receptor ( OXTR ) gene on prosociality. Meanwhile, moral reasoning, a key precursor for social behavior, has also been associated with variability in OXTR gene, thus the relationship between OXTR and prosociality is assumed to be mediated by moral evaluation. The current study examines the relationship in question, and includes gender as a potential moderator. Self-reported prosociality on Prosocial Tendencies Measure and evaluation on the moral acceptability of behaviors in stories from 790 Chinese adolescents (32.4% boys) were analyzed for the influence of their OXTR single nucleotide polymorphisms (SNPs). Results showed that SNP at site rs2254298 was indirectly associated with prosocial behaviors via moral evaluation of behaviors, and this effect was moderated by gender. Our findings suggest an indirect association between genetic variations in OXTR and prosociality through moral evaluation, indicating the potential pathway from genetic variability to prosociality through level of moral development. We also provide some evidence that the role of oxytocin system may to some extent depend on gender. These findings may promote our understanding of the genetic and biological roots of prosociality and morality.
Lima, John J.; Blake, Kathryn V.; Tantisira, Kelan G.; Weiss, Scott T.
2009-01-01
Purpose of review Patient response to the asthma drug classes, bronchodilators, inhaled corticosteroids and leukotriene modifiers, are characterized by a large degree of heterogeneity, which is attributable in part to genetic variation. Herein, we review and update the pharmacogenetics and pharmaogenomics of common asthma drugs. Recent findings Early studies suggest that bronchodilator reversibility and asthma worsening in patients on continuous short-acting and long-acting β-agonists are related to the Gly16Arg genotype for the ADRB2. More recent studies including genome-wide association studies implicate variants in other genes contribute to bronchodilator response heterogeneity and fail to replicate asthma worsening associated with continuous β-agonist use. Genetic determinants of the safety of long-acting β-agonist require further study. Variants in CRHR1, TBX21, and FCER2 contribute to variability in response for lung function, airways responsiveness, and exacerbations in patients taking inhaled corticosteroids. Variants in ALOX5, LTA4H, LTC4S, ABCC1, CYSLTR2, and SLCO2B1 contribute to variability in response to leukotriene modifiers. Summary Identification of novel variants that contribute to response heterogeneity supports future studies of single nucleotide polymorphism discovery and include gene expression and genome-wide association studies. Statistical models that predict the genomics of response to asthma drugs will complement single nucleotide polymorphism discovery in moving toward personalized medicine. PMID:19077707
Genetic Comparison of Symptomatic and Asymptomatic Persons With Alzheimer Disease Neuropathology.
Monsell, Sarah E; Mock, Charles; Fardo, David W; Bertelsen, Sarah; Cairns, Nigel J; Roe, Catherine M; Ellingson, Sally R; Morris, John C; Goate, Alison M; Kukull, Walter A
2017-01-01
The objective was to determine whether symptomatic and asymptomatic persons with Alzheimer disease (AD) neuropathology have different allele counts for single-nucleotide polymorphisms that have been associated with clinical late-onset AD. Data came from the National Alzheimer's Coordinating Center Uniform Data Set and Neuropathology Data Set, and the Alzheimer's Disease Genetics Consortium (ADGC). Participants had low to high AD neuropathologic change. The 22 known/suspected genes associated with late-onset AD were considered. "Symptomatic" was defined as Clinical Dementia Rating global score >0. Sixty-eight asymptomatic and 521 symptomatic participants met inclusion criteria. Single-nucleotide polymorphisms associated with ABCA7 [odds ratio (OR)=1.66; 95% confidence interval (CI), 1.03-2.85] and MAPT (OR=2.18; CI, 1.26-3.77) were associated with symptomatic status. In stratified analyses, loci containing CD2AP (OR=0.35; 95% CI, 0.16-0.74), ZCWPW1 (OR=2.98; 95% CI, 1.34-6.86), and MAPT (OR=3.73, 95% CI, 1.30-11.76) were associated with symptomatic status in APOE e4 carriers. These findings potentially explain some of the variation in whether a person with AD neuropathology expresses symptoms. Understanding why some people remain cognitively normal despite having AD neuropathology could identify pathways to disease heterogeneity and guide treatment trials.
Staes, Nicky; Stevens, Jeroen M. G.; Helsen, Philippe; Hillyer, Mia; Korody, Marisa; Eens, Marcel
2014-01-01
Recent literature has revealed the importance of variation in neuropeptide receptor gene sequences in the regulation of behavioral phenotypic variation. Here we focus on polymorphisms in the oxytocin receptor gene (OXTR) and vasopressin receptor gene 1a (Avpr1a) in chimpanzees and bonobos. In humans, a single nucleotide polymorphism (SNP) in the third intron of OXTR (rs53576 SNP (A/G)) is linked with social behavior, with the risk allele (A) carriers showing reduced levels of empathy and prosociality. Bonobos and chimpanzees differ in these same traits, therefore we hypothesized that these differences might be reflected in variation at the rs53576 position. We sequenced a 320 bp region surrounding rs53576 but found no indications of this SNP in the genus Pan. However, we identified previously unreported SNP variation in the chimpanzee OXTR sequence that differs from both humans and bonobos. Humans and bonobos have previously been shown to have a more similar 5′ promoter region of Avpr1a when compared to chimpanzees, who are polymorphic for the deletion of ∼360 bp in this region (+/− DupB) which includes a microsatellite (RS3). RS3 has been linked with variation in levels of social bonding, potentially explaining part of the interspecies behavioral differences found in bonobos, chimpanzees and humans. To date, results for bonobos have been based on small sample sizes. Our results confirmed that there is no DupB deletion in bonobos with a sample size comprising approximately 90% of the captive founder population, whereas in chimpanzees the deletion of DupB had the highest frequency. Because of the higher frequency of DupB alleles in our bonobo population, we suggest that the presence of this microsatellite may partly reflect documented differences in levels of sociability found in bonobos and chimpanzees. PMID:25405348
Erdoğan, Onur; Aydin Son, Yeşim
2014-01-01
Single Nucleotide Polymorphisms (SNPs) are the most common genomic variations where only a single nucleotide differs between individuals. Individual SNPs and SNP profiles associated with diseases can be utilized as biological markers. But there is a need to determine the SNP subsets and patients' clinical data which is informative for the diagnosis. Data mining approaches have the highest potential for extracting the knowledge from genomic datasets and selecting the representative SNPs as well as most effective and informative clinical features for the clinical diagnosis of the diseases. In this study, we have applied one of the widely used data mining classification methodology: "decision tree" for associating the SNP biomarkers and significant clinical data with the Alzheimer's disease (AD), which is the most common form of "dementia". Different tree construction parameters have been compared for the optimization, and the most accurate tree for predicting the AD is presented.
Significance of genetic variants in DLC1 and their association with hepatocellular carcinoma
XIE, CHENG-RONG; SUN, HONG-GUANG; SUN, YU; ZHAO, WEN-XIU; ZHANG, SHENG; WANG, XIAO-MIN; YIN, ZHEN-YU
2015-01-01
DLC1 has been shown to be downregulated or absent in hepatocellular carcinoma (HCC) and is associated with tumorigenesis and development. However, only a small number of studies have focused on genetic variations of DLC1. The present study performed exon sequencing for the DLC1 gene in HCC tissue samples from 105 patients to identify functional genetic variation of DLC1 and its association with HCC susceptibility, clinicopathological features and prognosis. A novel missense mutation and four non-synonymous single nucleotide polymorphisms (SNPs; rs3816748, rs11203495, rs3816747 and rs532841) were identified. A significant correlation of rs3816747 polymorphisms with HCC susceptibility was identified. Compared to individuals with the GG genotype of rs3816747, those with the GA (odds ratio (OR)=0.486; P=0.037) or GA+AA genotype (OR=0.51; P=0.039) were associated with a significantly decreased HCC risk. Furthermore, patients with the GC+CC genotype of rs3816748, the TC+CC genotype of rs11203495 or the GA+AA genotype of rs3816747 had small-sized tumors compared with those carrying the wild-type genotype. No significant association of DLC1 SNPs with the patients' prognosis was found. These results indicated that genetic variations in the DLC1 gene may confer a risk for HCC. PMID:26095787
Lee, Bridgin G.; Anastasia, Agustin; Hempstead, Barbara L.; Lee, Francis S.
2015-01-01
Introduction: Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. Methods: This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNFMet/Met) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Results: Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNFMet/Met mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNFMet/Met mice; and (3) an increase in BDNF prodomain in BDNFMet/Met mice following nicotine withdrawal. Conclusions: Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNFMet/Met mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. PMID:25744957
Gehlot, Praveen; Singh, S K; Pathak, Rakesh
2012-09-01
Taxonomy of the fungus Pestalotiopsis based on morphological characters has been equivocal. Molecular characterization often Pestalotiopsis species was done based on nuclear ribosomal DNA internal transcribed spacer (ITS) amplifications. Results of the analyses showed that species of genus Pestalotiopsis are monophyletic. We report ITS length variations, single nucleotide polymorphisms (SNPs) and insertions/ deletions (INDELS) among ten species of Pestalotiopsis that did not cause any phylogenetic error at either genus or species designation levels. New gene sequences have been assigned (Gen Accession numbers from HM 190146 to HM 190155) by the National Centre for Biotechnology Information, USA.
Hill, W D; Davies, G; van de Lagemaat, L N; Christoforou, A; Marioni, R E; Fernandes, C P D; Liewald, D C; Croning, M D R; Payton, A; Craig, L C A; Whalley, L J; Horan, M; Ollier, W; Hansell, N K; Wright, M J; Martin, N G; Montgomery, G W; Steen, V M; Le Hellard, S; Espeseth, T; Lundervold, A J; Reinvang, I; Starr, J M; Pendleton, N; Grant, S G N; Bates, T C; Deary, I J
2014-01-01
Differences in general cognitive ability (intelligence) account for approximately half of the variation in any large battery of cognitive tests and are predictive of important life events including health. Genome-wide analyses of common single-nucleotide polymorphisms indicate that they jointly tag between a quarter and a half of the variance in intelligence. However, no single polymorphism has been reliably associated with variation in intelligence. It remains possible that these many small effects might be aggregated in networks of functionally linked genes. Here, we tested a network of 1461 genes in the postsynaptic density and associated complexes for an enriched association with intelligence. These were ascertained in 3511 individuals (the Cognitive Ageing Genetics in England and Scotland (CAGES) consortium) phenotyped for general cognitive ability, fluid cognitive ability, crystallised cognitive ability, memory and speed of processing. By analysing the results of a genome wide association study (GWAS) using Gene Set Enrichment Analysis, a significant enrichment was found for fluid cognitive ability for the proteins found in the complexes of N-methyl-D-aspartate receptor complex; P=0.002. Replication was sought in two additional cohorts (N=670 and 2062). A meta-analytic P-value of 0.003 was found when these were combined with the CAGES consortium. The results suggest that genetic variation in the macromolecular machines formed by membrane-associated guanylate kinase (MAGUK) scaffold proteins and their interaction partners contributes to variation in intelligence. PMID:24399044
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Hawwa, Ahmed F; Millership, Jeff S; Collier, Paul S; Vandenbroeck, Koen; McCarthy, Anthony; Dempsey, Sid; Cairns, Carole; Collins, John; Rodgers, Colin; McElnay, James C
2008-10-01
To examine the allelic variation of three enzymes involved in 6-mercaptopurine/azathioprine (6-MP/AZA) metabolism and evaluate the influence of these polymorphisms on toxicity, haematological parameters and metabolite levels in patients with acute lymphoblastic leukaemia (ALL) or inflammatory bowel disease (IBD). Clinical data and blood samples were collected from 19 ALL paediatric patients and 35 IBD patients who were receiving 6-MP/AZA therapy. All patients were screened for seven genetic polymorphisms in three enzymes involved in mercaptopurine metabolism [xanthine oxidase, inosine triphosphatase (C94-->A and IVS2+21A-->C) and thiopurine methyltransferase]. Erythrocyte and plasma metabolite concentrations were also determined. The associations between the various genotypes and myelotoxicity, haematological parameters and metabolite concentrations were determined. Thiopurine methyltransferase variant alleles were associated with a preferential metabolism away from 6-methylmercaptopurine nucleotides (P = 0.008 in ALL patients, P = 0.038 in IBD patients) favouring 6-thioguanine nucleotides (6-TGNs) (P = 0.021 in ALL patients). Interestingly, carriers of inosine triphosphatase IVS2+21A-->C variants among ALL and IBD patients had significantly higher concentrations of the active cytotoxic metabolites, 6-TGNs (P = 0.008 in ALL patients, P = 0.047 in IBD patients). The study confirmed the association of thiopurine methyltransferase heterozygosity with leucopenia and neutropenia in ALL patients and reported a significant association between inosine triphosphatase IVS2+21A-->C variants with thrombocytopenia (P = 0.012). CONCLUSIONS; Pharmacogenetic polymorphisms in the 6-MP pathway may help identify patients at risk for associated toxicities and may serve as a guide for dose individualization.
Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron
2014-01-01
Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature. PMID:24558460
Ophir, Ron; Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Sharabi Schwager, Michal; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Holland, Doron
2014-01-01
Pomegranate is a valuable crop that is grown commercially in many parts of the world. Wild species have been reported from India, Turkmenistan and Socotra. Pomegranate fruit has a variety of health-beneficial qualities. However, despite this crop's importance, only moderate effort has been invested in studying its biochemical or physiological properties or in establishing genomic and genetic infrastructures. In this study, we reconstructed a transcriptome from two phenotypically different accessions using 454-GS-FLX Titanium technology. These data were used to explore the functional annotation of 45,187 fully annotated contigs. We further compiled a genetic-variation resource of 7,155 simple-sequence repeats (SSRs) and 6,500 single-nucleotide polymorphisms (SNPs). A subset of 480 SNPs was sampled to investigate the genetic structure of the broad pomegranate germplasm collection at the Agricultural Research Organization (ARO), which includes accessions from different geographical areas worldwide. This subset of SNPs was found to be polymorphic, with 10.7% loci with minor allele frequencies of (MAF<0.05). These SNPs were successfully used to classify the ARO pomegranate collection into two major groups of accessions: one from India, China and Iran, composed of mainly unknown country origin and which was more of an admixture than the other major group, composed of accessions mainly from the Mediterranean basin, Central Asia and California. This study establishes a high-throughput transcriptome and genetic-marker infrastructure. Moreover, it sheds new light on the genetic interrelations between pomegranate species worldwide and more accurately defines their genetic nature.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan
Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less
Kong, Fanrong; Tong, Zhongsheng; Chen, Xiaoyou; Sorrell, Tania; Wang, Bin; Wu, Qixuan; Ellis, David; Chen, Sharon
2008-01-01
DNA sequencing analyses have demonstrated relatively limited polymorphisms within the fungal internal transcribed spacer (ITS) regions among Trichophyton spp. We sequenced the ITS region (ITS1, 5.8S, and ITS2) for 42 dermatophytes belonging to seven species (Trichophyton rubrum, T. mentagrophytes, T. soudanense, T. tonsurans, Epidermophyton floccosum, Microsporum canis, and M. gypseum) and developed a novel padlock probe and rolling-circle amplification (RCA)-based method for identification of single nucleotide polymorphisms (SNPs) that could be exploited to differentiate between Trichophyton spp. Sequencing results demonstrated intraspecies genetic variation for T. tonsurans, T. mentagrophytes, and T. soudanense but not T. rubrum. Signature sets of SNPs between T. rubrum and T. soudanense (4-bp difference) and T. violaceum and T. soudanense (3-bp difference) were identified. The RCA assay correctly identified five Trichophyton species. Although the use of two “group-specific” probes targeting both the ITS1 and the ITS2 regions were required to identify T. soudanense, the other species were identified by single ITS1- or ITS2-targeted species-specific probes. There was good agreement between ITS sequencing and the RCA assay. Despite limited genetic variation between Trichophyton spp., the sensitive, specific RCA-based SNP detection assay showed potential as a simple, reproducible method for the rapid (2-h) identification of Trichophyton spp. PMID:18234865
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Polygenic influences on dyslipidemias.
Dron, Jacqueline S; Hegele, Robert A
2018-04-01
Rare large-effect genetic variants underlie monogenic dyslipidemias, whereas common small-effect genetic variants - single nucleotide polymorphisms (SNPs) - have modest influences on lipid traits. Over the past decade, these small-effect SNPs have been shown to cumulatively exert consistent effects on lipid phenotypes under a polygenic framework, which is the focus of this review. Several groups have reported polygenic risk scores assembled from lipid-associated SNPs, and have applied them to their respective phenotypes. For lipid traits in the normal population distribution, polygenic effects quantified by a score that integrates several common polymorphisms account for about 20-30% of genetic variation. Among individuals at the extremes of the distribution, that is, those with clinical dyslipidemia, the polygenic component includes both rare variants with large effects and common polymorphisms: depending on the trait, 20-50% of susceptibility can be accounted for by this assortment of genetic variants. Accounting for polygenic effects increases the numbers of dyslipidemic individuals who can be explained genetically, but a substantial proportion of susceptibility remains unexplained. Whether documenting the polygenic basis of dyslipidemia will affect outcomes in clinical trials or prospective observational studies remains to be determined.
Analysis of DNA methylation in Arabidopsis thaliana based on methylation-sensitive AFLP markers.
Cervera, M T; Ruiz-García, L; Martínez-Zapater, J M
2002-12-01
AFLP analysis using restriction enzyme isoschizomers that differ in their sensitivity to methylation of their recognition sites has been used to analyse the methylation state of anonymous CCGG sequences in Arabidopsis thaliana. The technique was modified to improve the quality of fingerprints and to visualise larger numbers of scorable fragments. Sequencing of amplified fragments indicated that detection was generally associated with non-methylation of the cytosine to which the isoschizomer is sensitive. Comparison of EcoRI/ HpaII and EcoRI/ MspI patterns in different ecotypes revealed that 35-43% of CCGG sites were differentially digested by the isoschizomers. Interestingly, the pattern of digestion among different plants belonging to the same ecotype is highly conserved, with the rate of intra-ecotype methylation-sensitive polymorphisms being less than 1%. However, pairwise comparisons of methylation patterns between samples belonging to different ecotypes revealed differences in up to 34% of the methylation-sensitive polymorphisms. The lack of correlation between inter-ecotype similarity matrices based on methylation-insensitive or methylation-sensitive polymorphisms suggests that whatever the mechanisms regulating methylation may be, they are not related to nucleotide sequence variation.
Bioinformatic analyses to select phenotype affecting polymorphisms in HTR2C gene.
Piva, Francesco; Giulietti, Matteo; Baldelli, Luisa; Nardi, Bernardo; Bellantuono, Cesario; Armeni, Tatiana; Saccucci, Franca; Principato, Giovanni
2011-08-01
Single nucleotide polymorphisms (SNPs) in serotonin related genes influence mental disorders, responses to pharmacological and psychotherapeutic treatments. In planning association studies, researchers that want to investigate new SNPs have to select some among a large number of candidates. Our aim is to guide researchers in the selection of the most likely phenotype affecting polymorphisms. Here, we studied serotonin receptor 2C (HTR2C) SNPs because, till now, only relatively few of about 2000 are investigated. We used the most updated and assessed bioinformatic tools to predict which variations can give rise to biological effects among 2450 HTR2C SNPs. We suggest 48 SNPs that are worth considering in future association studies in the field of psychiatry, psychology and pharmacogenomics. Moreover, our analyses point out the biological level probably affected, such as transcription, splicing, miRNA regulation and protein structure, thus allowing to suggest future molecular investigations. Although few association studies are available in literature, their results are in agreement with our predictions, showing that our selection methods can help to guide future association studies. Copyright © 2011 John Wiley & Sons, Ltd.
Chardonnet, Floriane; Capdevielle-Dulac, Claire; Chouquet, Bastien; Joly, Nicolas; Harry, Myriam; Le Ru, Bruno; Silvain, Jean-François; Kaiser, Laure
2014-10-01
The extent of damage to crop plants from pest insects depends on the foraging behaviour of the insect's feeding stage. Little is known, however, about the genetic and molecular bases of foraging behaviour in phytophagous pest insects. The foraging gene (for), a candidate gene encoding a PKG-I, has an evolutionarily conserved function in feeding strategies. Until now, for had never been studied in Lepidoptera, which includes major pest species. The cereal stem borer Sesamia nonagrioides is therefore a relevant species within this order with which to study conservation of and polymorphism in the for gene, and its role in foraging - a behavioural trait that is directly associated with plant injuries. Full sequencing of for cDNA in S. nonagrioides revealed a high degree of conservation with other insect taxa. Activation of PKG by a cGMP analogue increased larval foraging activity, measured by how frequently larvae moved between food patches in an actimeter. We found one non-synonymous allelic variation in a natural population that defined two allelic variants. These variants presented significantly different levels of foraging activity, and the behaviour was positively correlated to gene expression levels. Our results show that for gene function is conserved in this species of Lepidoptera, and describe an original case of a single nucleotide polymorphism associated with foraging behaviour variation in a pest insect. By illustrating how variation in this single gene can predict phenotype, this work opens new perspectives into the evolutionary context of insect adaptation to plants, as well as pest management. © 2014. Published by The Company of Biologists Ltd.
Hartmann, Fanny E.; Croll, Daniel
2017-01-01
Abstract Differences in gene content are a significant source of variability within species and have an impact on phenotypic traits. However, little is known about the mechanisms responsible for the most recent gene gains and losses. We screened the genomes of 123 worldwide isolates of the major pathogen of wheat Zymoseptoria tritici for robust evidence of gene copy number variation. Based on orthology relationships in three closely related fungi, we identified 599 gene gains and 1,024 gene losses that have not yet reached fixation within the focal species. Our analyses of gene gains and losses segregating in populations showed that gene copy number variation arose preferentially in subtelomeres and in proximity to transposable elements. Recently lost genes were enriched in virulence factors and secondary metabolite gene clusters. In contrast, recently gained genes encoded mostly secreted protein lacking a conserved domain. We analyzed the frequency spectrum at loci segregating a gene presence–absence polymorphism in four worldwide populations. Recent gene losses showed a significant excess in low-frequency variants compared with genome-wide single nucleotide polymorphism, which is indicative of strong negative selection against gene losses. Recent gene gains were either under weak negative selection or neutral. We found evidence for strong divergent selection among populations at individual loci segregating a gene presence–absence polymorphism. Hence, gene gains and losses likely contributed to local adaptation. Our study shows that microbial eukaryotes harbor extensive copy number variation within populations and that functional differences among recently gained and lost genes led to distinct evolutionary trajectories. PMID:28981698
Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.
2007-12-04
The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.
Boussaha, Mekki; Michot, Pauline; Letaief, Rabia; Hozé, Chris; Fritz, Sébastien; Grohs, Cécile; Esquerré, Diane; Duchesne, Amandine; Philippe, Romain; Blanquet, Véronique; Phocas, Florence; Floriot, Sandrine; Rocha, Dominique; Klopp, Christophe; Capitan, Aurélien; Boichard, Didier
2016-11-15
In recent years, several bovine genome sequencing projects were carried out with the aim of developing genomic tools to improve dairy and beef production efficiency and sustainability. In this study, we describe the first French cattle genome variation dataset obtained by sequencing 274 whole genomes representing several major dairy and beef breeds. This dataset contains over 28 million single nucleotide polymorphisms (SNPs) and small insertions and deletions. Comparisons between sequencing results and SNP array genotypes revealed a very high genotype concordance rate, which indicates the good quality of our data. To our knowledge, this is the first large-scale catalog of small genomic variations in French dairy and beef cattle. This resource will contribute to the study of gene functions and population structure and also help to improve traits through genotype-guided selection.
Chromosome-scale selective sweeps shape Caenorhabditis elegans genomic diversity
Andersen, Erik C.; Gerke, Justin P.; Shapiro, Joshua A.; Crissman, Jonathan R.; Ghosh, Rajarshi; Bloom, Joshua S.; Félix, Marie-Anne; Kruglyak, Leonid
2011-01-01
The nematode Caenorhabditis elegans is central to research in molecular, cell, and developmental biology, but nearly all of this research has been conducted on a single strain. Comparatively little is known about the population genomic and evolutionary history of this species. We characterized C. elegans genetic variation by high-throughput selective sequencing of a worldwide collection of 200 wild strains, identifying 41,188 single nucleotide polymorphisms. Unexpectedly, C. elegans genome variation is dominated by a set of commonly shared haplotypes on four of the six chromosomes, each spanning many megabases. Population-genetic modeling shows that this pattern was generated by chromosome-scale selective sweeps that have reduced variation worldwide; at least one of these sweeps likely occurred in the past few hundred years. These sweeps, which we hypothesize to be a result of human activity, have dramatically reshaped the global C. elegans population in the recent past. PMID:22286215
Boonpeng, Hoh; Yusoff, Khalid
2013-03-01
The ultimate goal of human genetics is to understand the role of genome variation in elucidating human traits and diseases. Besides single nucleotide polymorphism (SNP), copy number variation (CNV), defined as gains or losses of a DNA segment larger than 1 kb, has recently emerged as an important tool in understanding heritable source of human genomic differences. It has been shown to contribute to genetic susceptibility of various common and complex diseases. Despite a handful of publications, its role in cardiovascular diseases remains largely unknown. Here, we deliberate on the currently available technologies for CNV detection. The possible utility and the potential roles of CNV in exploring the mechanisms of cardiac remodeling in hypertension will also be addressed. Finally, we discuss the challenges for investigations of CNV in cardiovascular diseases and its possible implications in diagnosis of hypertension-related left ventricular hypertrophy (LVH).
Hein, David W.
2009-01-01
Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125
Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija
2012-04-01
Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.
Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej
2016-01-01
Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.
Winterhagen, Patrick; Wünsche, Jens-Norbert
2016-05-01
Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.
Genetic Predictors of Interindividual Variability in Hepatic CYP3A4 ExpressionS⃞
Lamba, Vishal; Panetta, John C.; Strom, Stephen
2010-01-01
Variability in hepatic CYP3A4 cannot be explained by common CYP3A4 coding variants. We previously identified polymorphisms in pregnane X receptor (PXR) and ATP-binding cassette subfamily B member 1 (ABCB1) associated with CYP3A4 mRNA levels in small cohorts of human livers. However, the relative contributions of these genetic variations or of polymorphisms in other CYP3A4 regulators to variable CYP3A4 expression were not known. We phenotyped livers from white donors (n = 128) by quantitative real-time polymerase chain reaction for expression of CYP3A4, CYP3A5, and CYP3A7 and nine transcriptional regulators, coactivators, and corepressors. We resequenced hepatic nuclear factor-3-β (HNF3β, FoxA2), HNF4α, HNF3γ (FoxA3), nuclear receptor corepressor 2 (NCoR2), and regions of the CYP3A4 promoter and genotyped informative single-nucleotide polymorphisms in PXR and ABCB1 in the same livers. CYP3A4 mRNA was positively correlated with PXR and FoxA2 and negatively correlated with NCoR2 mRNA. A common silent polymorphism and a polymorphic trinucleotide (CCT) repeat in FoxA2 were associated with CYP3A4 expression. The transcriptional activity of the FoxA2 polymorphic CCT repeat alleles (wild-type, n = 14 and variant, n = 13, 15, and 19) when assayed by luciferase reporter transactivation assays was greatest for the wild-type repeat, with deviations from this number having decreased transcriptional activity. This corresponded with higher expression of FoxA2 mRNA and its targets PXR and CYP3A4 in human livers with (CCT) n = 14 genotypes. Multiple linear regression analysis was used to quantify the contributions of selected genetic polymorphisms to variable CYP3A4 expression. This approach identified sex and polymorphisms in FoxA2, HNF4α, FoxA3, PXR, ABCB1, and the CYP3A4 promoter that together explained as much as 24.6% of the variation in hepatic CYP3A4 expression. PMID:19934400
Xu, Zhen-Hua; Thomae, Bianca A; Eckloff, Bruce W; Wieben, Eric D; Weinshilboum, Richard M
2003-06-01
3'-Phosphoadenosine 5'-phosphosulfate (PAPS) is the high-energy "sulfate donor" for reactions catalyzed by sulfotransferase (SULT) enzymes. The strict requirement of SULTs for PAPS suggests that PAPS synthesis might influence the rate of sulfate conjugation. In humans, PAPS is synthesized from ATP and SO(4)(2-) by two isoforms of PAPS synthetase (PAPSS): PAPSS1 and PAPSS2. As a step toward pharmacogenetic studies, we have resequenced the entire coding sequence of the human PAPSS1 gene, including exon-intron splice junctions, using DNA samples from 60 Caucasian-American and 58 African-American subjects. Twenty-one genetic polymorphisms were observed-1 insertion-deletion event and 20 single nucleotide polymorphisms (SNPs)-including two non-synonymous coding SNPs (cSNPs) that altered the following amino acids: Arg333Cys and Glu531Gln. Twelve pairs of these polymorphisms were tightly linked, and a total of twelve unequivocal haplotypes could be identified-two that were common to both ethnic groups and ten that were ethnic-specific. The Arg333Cys polymorphism, with an allele frequency of 2.5%, was observed only in DNA samples from Caucasian subjects. The Glu531Gln polymorphism was rare, with only a single copy of that allele in a DNA sample from an African-American subject. Transient expression in mammalian cells showed that neither of the non-synonymous cSNPs resulted in a change in the basal level of enzyme activity measured under optimal assay conditions. However, the Glu531Gln polymorphism altered the substrate kinetic properties of the enzyme. The Gln531 variant allozyme had a 5-fold higher K(m) value for SO(4)(2-) than did the wild-type allozyme and displayed monophasic kinetics for Na(2)SO(4). The wild-type allozyme (Glu531) showed biphasic kinetics for that substrate. These observations represent a step toward testing the hypothesis that genetic variation in PAPS synthesis catalyzed by PAPSS1 might alter in vivo sulfate conjugation.
Vatansever, Sezgin; Tekin, Fatih; Salman, Esin; Altintoprak, Ender; Coskunol, Hakan; Akarca, Ulus Salih
2015-05-17
No data exists regarding the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) gene polymorphisms in Turkish alcoholic cirrhotics. We studied the polymorphisms of ADH1B, ADH1C and ALDH2 genes in alcoholic cirrhotics and compared the results with non-cirrhotic alcoholics and healthy volunteers. Overall, 237 subjects were included for the study: 156 alcoholic patients (78 cirrhotics, 78 non-cirrhotic alcoholics) and 81 healthy volunteers. Three different single-nucleotide-polymorphism genotyping methods were used. ADH1C genotyping was performed using a polymerase chain reaction-restriction fragment length polymorphism method. The identified ADH1C genotypes were named according to the presence or absence of the enzyme restriction sites. ADH1B (Arg47Hys) genotyping was performed using the allele specific primer extension method, and ALDH2 (Glu487Lys) genotyping was performed by a multiplex polymerase chain reaction using two allele-specific primer pairs. For ADH1B, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 97.4%, 94.9% and 99.4%, respectively. For ADH1C, the frequency of allele *1 in the cirrhotics, non-cirrhotic alcoholics and healthy volunteers was 47%, 36.3% and 45%, respectively. There was no statistical difference between the groups for ADH1B and ADH1C (p>0.05). All alcoholic and non-alcoholic subjects (100%) had the allele *1 for ALDH2. The obtained results for ADH1B, ADH1C, and ALDH gene polymorphisms in the present study are similar to the results of Caucasian studies. ADH1B and ADH1C genetic variations are not related to the development of alcoholism or susceptibility to alcoholic cirrhosis. ALDH2 gene has no genetic variation in the Turkish population.
Kühne, Annett; Kaiser, Rolf; Schirmer, Markus; Heider, Ulrike; Muhlke, Sabine; Niere, Wiebke; Overbeck, Tobias; Hohloch, Karin; Trümper, Lorenz; Sezer, Orhan; Brockmöller, Jürgen
2007-07-01
Melphalan is widely used in the treatment of multiple myeloma. Pharmacokinetics of this alkylating drug shows high inter-individual variability. As melphalan is a phenylalanine derivative, the pharmacokinetic variability may be determined by genetic polymorphisms in the L-type amino acid transporters LAT1 (SLC7A5) and LAT2 (SLC7A8). Pharmacokinetics were analysed in 64 patients after first administration of intravenous melphalan. Severity of side effects was documented according to WHO criteria. Genomic DNA was analysed for polymorphisms in LAT1 and LAT2 by sequencing of the entire coding region, intron-exon boundaries and 2 kb upstream promoter region. Selected polymorphisms in the common heavy chain of both transporters, the protein 4F2hc (SLC3A2), were analysed by single nucleotide primer extension. Melphalan pharmacokinetics was highly variable with up to 6.2-fold differences in total clearance. A total of 44 polymorphisms were identified in LAT1 and 21 polymorphisms in LAT2. From all variants, only five were in the coding region and only one heterozygous non-synonymous polymorphism (Ala94Thr) was found in LAT2. Numerous polymorphisms were found in the LAT1 and LAT2 5'-flanking regions but did not correlate with expression of the respective genes. No significant correlations could be observed between the polymorphisms in 4F2hc, LAT1, and LAT2 with melphalan pharmacokinetics or with melphalan side effects. The study confirmed that these transporter genes are highly conserved, particularly in the coding sequences. Genetic variation in 4F2hc, LAT1, and LAT2 does not appear to be a major cause of inter-individual variability in pharmacokinetics and of adverse reactions to melphalan.
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Plasma Soluble Receptor for Advanced Glycation End Products in Idiopathic Pulmonary Fibrosis
Manichaikul, Ani; Sun, Li; Borczuk, Alain C.; Onengut-Gumuscu, Suna; Farber, Emily A.; Mathai, Susan K.; Zhang, Weiming; Raghu, Ganesh; Kaufman, Joel D.; Hinckley-Stukovsky, Karen D.; Kawut, Steven M.; Jelic, Sanja; Liu, Wen; Fingerlin, Tasha E.; Schwartz, David A.; Sell, Jessica L.; Rich, Stephen S.; Barr, R. Graham
2017-01-01
Rationale: The receptor for advanced glycation end products (RAGE) is underexpressed in idiopathic pulmonary fibrosis (IPF) lung, but the role of RAGE in human lung fibrosis remains uncertain. Objectives: To examine (1) the association between IPF risk and variation at rs2070600, a functional missense variant in AGER (the gene that codes for RAGE), and (2) the associations between plasma-soluble RAGE (sRAGE) levels with disease severity and time to death or lung transplant in IPF. Methods: We genotyped the rs2070600 single-nucleotide polymorphism in 108 adults with IPF and 324 race-/ethnicity-matched control subjects. We measured plasma sRAGE by ELISA in 103 adults with IPF. We used generalized linear and additive models as well as Cox models to control for potential confounders. We repeated our analyses in 168 (genetic analyses) and 177 (sRAGE analyses) adults with other forms of interstitial lung disease (ILD). Results: There was no association between rs2070600 variation among adults with IPF (P = 0.31). Plasma sRAGE levels were lower among adults with IPF and other forms of ILD than in control subjects (P < 0.001). The rs2070600 allele A was associated with a 49% lower sRAGE level (95% confidence interval [CI], 11 to 71%; P = 0.02) among adults with IPF. In adjusted analyses, lower sRAGE levels were associated with greater disease severity (14% sRAGE decrement per 10% FVC decrement; 95% CI, 5 to 22%) and a higher rate of death or lung transplant at 1 year (adjusted hazard ratio, 1.9 per logarithmic unit of sRAGE decrement; 95% CI, 1.2–3.3) in IPF. Similar findings were observed in a heterogeneous group of adults with other forms of ILD. Conclusions: Lower plasma sRAGE levels may be a biological measure of disease severity in IPF. Variation at the rs2070600 single-nucleotide polymorphism was not associated with IPF risk. PMID:28248552
Liu, San-Xu; Hou, Wei; Zhang, Xue-Yan; Peng, Chang-Jun; Yue, Bi-Song; Fan, Zhen-Xin; Li, Jing
2018-07-18
The Tibetan macaque, which is endemic to China, is currently listed as a Near Endangered primate species by the International Union for Conservation of Nature (IUCN). Short tandem repeats (STRs) refer to repetitive elements of genome sequence that range in length from 1-6 bp. They are found in many organisms and are widely applied in population genetic studies. To clarify the distribution characteristics of genome-wide STRs and understand their variation among Tibetan macaques, we conducted a genome-wide survey of STRs with next-generation sequencing of five macaque samples. A total of 1 077 790 perfect STRs were mined from our assembly, with an N50 of 4 966 bp. Mono-nucleotide repeats were the most abundant, followed by tetra- and di-nucleotide repeats. Analysis of GC content and repeats showed consistent results with other macaques. Furthermore, using STR analysis software (lobSTR), we found that the proportion of base pair deletions in the STRs was greater than that of insertions in the five Tibetan macaque individuals (P<0.05, t-test). We also found a greater number of homozygous STRs than heterozygous STRs (P<0.05, t-test), with the Emei and Jianyang Tibetan macaques showing more heterozygous loci than Huangshan Tibetan macaques. The proportion of insertions and mean variation of alleles in the Emei and Jianyang individuals were slightly higher than those in the Huangshan individuals, thus revealing differences in STR allele size between the two populations. The polymorphic STR loci identified based on the reference genome showed good amplification efficiency and could be used to study population genetics in Tibetan macaques. The neighbor-joining tree classified the five macaques into two different branches according to their geographical origin, indicating high genetic differentiation between the Huangshan and Sichuan populations. We elucidated the distribution characteristics of STRs in the Tibetan macaque genome and provided an effective method for screening polymorphic STRs. Our results also lay a foundation for future genetic variation studies of macaques.
Su, Guosheng; Christensen, Ole F.; Ostersen, Tage; Henryon, Mark; Lund, Mogens S.
2012-01-01
Non-additive genetic variation is usually ignored when genome-wide markers are used to study the genetic architecture and genomic prediction of complex traits in human, wild life, model organisms or farm animals. However, non-additive genetic effects may have an important contribution to total genetic variation of complex traits. This study presented a genomic BLUP model including additive and non-additive genetic effects, in which additive and non-additive genetic relation matrices were constructed from information of genome-wide dense single nucleotide polymorphism (SNP) markers. In addition, this study for the first time proposed a method to construct dominance relationship matrix using SNP markers and demonstrated it in detail. The proposed model was implemented to investigate the amounts of additive genetic, dominance and epistatic variations, and assessed the accuracy and unbiasedness of genomic predictions for daily gain in pigs. In the analysis of daily gain, four linear models were used: 1) a simple additive genetic model (MA), 2) a model including both additive and additive by additive epistatic genetic effects (MAE), 3) a model including both additive and dominance genetic effects (MAD), and 4) a full model including all three genetic components (MAED). Estimates of narrow-sense heritability were 0.397, 0.373, 0.379 and 0.357 for models MA, MAE, MAD and MAED, respectively. Estimated dominance variance and additive by additive epistatic variance accounted for 5.6% and 9.5% of the total phenotypic variance, respectively. Based on model MAED, the estimate of broad-sense heritability was 0.506. Reliabilities of genomic predicted breeding values for the animals without performance records were 28.5%, 28.8%, 29.2% and 29.5% for models MA, MAE, MAD and MAED, respectively. In addition, models including non-additive genetic effects improved unbiasedness of genomic predictions. PMID:23028912
TGIF1 is a potential candidate gene for high myopia in ethnic Kashmiri population.
Ahmed, Ishfaq; Rasool, Shabhat; Jan, Tariq; Qureshi, Tariq; Naykoo, Niyaz A; Andrabi, Khurshid I
2014-03-01
High myopia is a complex disorder that imposes serious consequences on ocular health. Linkage analysis has identified several genetic loci with a series of potential candidate genes that reveal an ambiguous pattern of association with high myopia due to population heterogeneity. We have accordingly chosen to examine the prospect of association of one such gene [transforming growth β-induced factor 1 (TGIF1)] in population that is purely ethnic (Kashmiri) and represents a homogeneous cohort from Northern India. Cases with high myopia with a spherical equivalent of ≥-6 diopters (D) and emmetropic controls with spherical equivalent within ±0.5 D in one or both eyes represented by a sample size of 212 ethnic Kashmiri subjects and 239 matched controls. Genomic DNA was genotyped for sequence variations in TGIF1 gene and allele frequencies tested for Hardy-Weinberg disequilibrium. Potential association was evaluated using χ(2) or Fisher's exact test. Two previously reported missense variations C > T, rs4468717 (first base of codon 143) changing proline to serine and rs2229333 (second base of codon 143) changing proline to leucine were identified in exon 10 of TGIF1. Both variations exhibited possibly significant (p < 0.05) association with the disease phenotype. Since the variant allele frequency of both the single-nucleotide polymorphisms in cases is higher than controls with odds ratio greater than 1.Therefore, variant allele of both the single-nucleotide polymorphisms represents the possible risk factor for myopia in the Kashmiri population. In silico predictions show that substitutions are likely to have an impact on the structure and functional properties of the protein, making it imperative to understand their functional consequences in relation to high myopia. TGIF1 is a relevant candidate gene with potential to contribute in the genesis of high myopia.
Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease
Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.
2016-01-01
Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047
Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing
2009-06-01
The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.
Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing
2014-12-01
Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.
Amplified fragment length polymorphism (AFLP) markers can be developed more quickly and at a lower cost than microsatellite and single nucleotide polymorphism markers, which makes them ideal markers for large-scale studies of understudied taxa — such as species at risk. However,...
Pereira, Virginia A; Sánchez-Arcila, Juan C; Teva, Antonio; Perce-da-Silva, Daiana S; Vasconcelos, Mariana P A; Lima, Cleoni A M; Aprígio, Cesarino J L; Rodrigues-da-Silva, Rodrigo N; Santos, Davi O; Banic, Dalma M; Bonecini-Almeida, Maria G; Lima-Júnior, Josué C; Oliveira-Ferreira, Joseli
2015-01-28
Cytokines play an important role in human immune responses to malaria and variation in their production may influence the course of infection and determine the outcome of the disease. The differential production of cytokines has been linked to single nucleotide polymorphisms in gene promoter regions, signal sequences, and gene introns. Although some polymorphisms play significant roles in susceptibility to malaria, gene polymorphism studies in Brazil are scarce. A population of 267 individuals from Brazilian Amazon exposed to malaria was genotyped for five single nucleotide polymorphisms (SNPs), IFNG + 874 T/A, IL10A-1082G/A, IL10A-592A/C, IL10A-819 T/C and NOS2A-954G/C. Specific DNA fragments were amplified by polymerase chain reaction, allowing the detection of the polymorphism genotypes. The polymorphisms IL10A-592A/C and IL10A-819 T/C were estimated by a single analysis due to the complete linkage disequilibrium between the two SNPs with D' = 0.99. Plasma was used to measure the levels of IFN-γ and IL-10 cytokines by Luminex and nitrogen radicals by Griess reaction. No differences were observed in genotype and allelic frequency of IFNG + 874 T/A and NOS2A-954G/C between positive and negative subjects for malaria infection. Interesting, the genotype NOS2A-954C/C was not identified in the study population. Significant differences were found in IL10A-592A/C and IL10A-819 T/C genotypes distribution, carriers of IL10A -592A/-819 T alleles (genotypes AA/TT + AC/TC) were more frequent among subjects with malaria than in negative subjects that presented a higher frequency of the variant C allele (p < 0.0001). The presence of the allele C was associated with low producer of IL-10 and low parasitaemia. In addition, the GTA haplotypes formed from combinations of investigated polymorphisms in IL10A were significantly associated with malaria (+) and the CCA haplotype with malaria (-) groups. The IL10A-1082G/A polymorphism showed high frequency of heterozygous AG genotype in the population, but it was not possible to infer any association of the polymorphism because their distribution was not in Hardy Weinberg equilibrium. This study shows that the IL10A-592A/C and IL10A-819 T/C polymorphisms were associated with malaria and decreased IL-10 levels and low parasite density suggesting that this polymorphism influence IL-10 levels and may influence in the susceptibility to clinical malaria.
Han, R-L; Lan, X-Y; Zhang, L-Z; Ren, G; Jing, Y-J; Li, M-J; Zhang, B; Zhao, M; Guo, Y-K; Kang, X-T; Chen, H
2010-01-01
Visfatin is a peptide that is predominantly expressed in visceral adipose tissue and is hypothesized to be related to obesity and insulin resistance. In this study, a novel silent single-nucleotide polymorphism (SNP) was found in exon 7 of the chicken visfatin gene (also known as PBEF1) by single-stranded conformation polymorphism (SSCP) and DNA sequencing. In total, 836 chickens forming an F2 resource population of Gushi chicken crossed with Anka broiler were genotyped by XbaI forced RFLP, and the associations of this polymorphism with chicken growth, carcass characteristics, and meat quality were analyzed. Significant associations were found between the polymorphism and 4-week body weight (BW4), 6-week body weight (BW6), 4-week body slanting length (BSL4), fat bandwidth (FBW), breast muscle water loss rate (BWLR) and breast muscle fiber density (BFD) (P < 0.05), as well as 4-week breastbone length (BBL4) (P < 0.01). These observations suggested that the polymorphism in exon7 of the visfatin gene had significant effects on the early growth traits of chicken.
Maier, Polyana S; Spritzer, Poli Mara
2012-01-01
To assess whether a single nucleotide polymorphism (SNP50) of the aromatase gene (CYP19) is associated with polycystic ovary syndrome (PCOS) phenotypes and to investigate the influence of this polymorphism on the response of PCOS to treatment with oral contraceptive pills (OCP). 162 hirsute women were stratified into a classic PCOS group (hyperandrogenism, ovulatory dysfunction, c-PCOS) and an ovulatory PCOS group (hyperandrogenism, ovulatory cycles, polycystic ovaries, ov-PCOS). 51 women completed a 6-month OCP trial (20 µg ethinyl estradiol + 75 µg gestodene, 21/28 days per cycle, plus 100 mg spironolactone in 32 women with moderate to severe hirsutism). We considered the presence of the polymorphic allele A (AG+AA) in comparison to the absence of the polymorphism (GG) to express results and to perform the comparisons regarding clinical variables. Mean age was 23.3 ± 6.9 years. Hirsutism score was similar in c-PCOS and ov-PCOS (15 (11-20) vs. 13 (11-20)). The differences in hormone and metabolic variables between phenotypes were independent of the presence of allele A. In the OCP trial subsample, no differences were observed between genotypes after 6 months' treatment. The differences between c-PCOS and ov-PCOS cannot be explained by the genetic variation at SNP50 in the CYP19 gene. Copyright © 2012 S. Karger AG, Basel.
Jing, Fangyuan; Mao, Yingying; Zhang, Zhenyu; Li, Yingjun; Cai, Shaofang; Li, Qilong; Ma, Xinyuan; Jin, Mingjuan; Chen, Kun
2014-09-01
The PI3K signaling pathway plays an important role in the development of colorectal cancer (CRC) and other neoplasm. Somatic phosphatase and tensin homolog deleted on chromosome 10 (PTEN) mutations and deletions or epigenetic silencing have been observed in multiple tumor types including CRC. To assess the association of PTEN polymorphisms and lifestyle habits with CRC risk in Chinese population, we carried out a case-control study which included 545 cases and 522 controls. In the present study, we genotyped eight single-nucleotide polymorphisms (SNPs) in PTEN and found that rs11202607 was associated with increased CRC risk (odds ratio (OR) = 1.40, 95 % confidence interval (CI) = 1.04-1.90). Stratification analysis by lifestyle habits showed a stronger association between rs11202607 and CRC risk among never tea drinkers than that among tea-drinkers (OR = 2.04, 95 % CI 1.29-3.22), and significant additive interaction between rs10490920 and tea drinking status was observed. Our study provided the evidence of an association between PTEN polymorphisms and the risk of CRC and significant additive interaction between PTEN polymorphism and tea drinking. Studies with larger sample size and further investigations into the mechanism are warranted to clarify the role of PTEN in colorectal carcinogenesis and the association between PTEN genetic variations, environment exposure, and CRC risk.
Ban, Susumu; Kondo, Tomoko; Ishizuka, Mayumi; Sasaki, Seiko; Konishi, Kanae; Washino, Noriaki; Fujita, Syoichi; Kishi, Reiko
2007-05-01
The field of molecular biology currently faces the need for a comprehensive method of evaluating individual differences derived from genetic variation in the form of single nucleotide polymorphisms (SNPs). SNPs in human genes are generally considered to be very useful in determining inherited genetic disorders, susceptibility to certain diseases, and cancer predisposition. Quick and accurate discrimination of SNPs is the key characteristic of technology used in DNA diagnostics. For this study, we first developed a DNA microarray and then evaluated its efficacy by determining the detection ability and validity of this method. Using DNA obtained from 380 pregnant Japanese women, we examined 13 polymorphisms of 9 genes, which are associated with the metabolism of environmental chemical compounds found in high frequency among Japanese populations. The ability to detect CYP1A1 I462V, CYP1B1 L432V, GSTP1 I105V and AhR R554K gene polymorphisms was above 98%, and agreement rates when compared with real time PCR analysis methods (kappa values) showed high validity: 0.98 (0.96), 0.97 (0.93), 0.90 (0.81), 0.90 (0.91), respectively. While this DNA microarray analysis should prove important as a method for initial screening, it is still necessary that we find better methods for improving the detection of other gene polymorphisms not part of this study.
Lian, Yulong; Xiao, Jing; Wang, Qian; Ning, Li; Guan, Suzhen; Ge, Hua; Li, Fuye; Liu, Jiwen
2014-08-12
It is debatable whether or not glucocorticoid receptor (GR) polymorphisms moderate susceptibility to PTSD. Our objective was to examine the effects of stressful life events, social support, GR genotypes, and gene-environment interactions on the etiology of PTSD. Three tag single nucleotide polymorphisms, trauma events, stressful life events, and social support were assessed in 460 patients with PTSD and 1158 control subjects from a Chinese Han population. Gene-environment interactions were analyzed by generalized multifactor dimensionality reduction (GMDR). Variation in GR at rs41423247 and rs258747, stressful life events, social support, and the number of traumatic events were each separately associated with the risk for PTSD. A gene-environment interaction among the polymorphisms, rs41423247 and rs258747, the number of traumatic events, stressful life events, and social support resulted in an increased risk for PTSD. High-risk individuals (a large number of traumatic events, G allele of rs258747 and rs41423247, high level stressful life events, and low social support) had a 3.26-fold increased risk of developing PTSD compared to low-risk individuals. The association was statistically significant in the sub-groups with and without childhood trauma. Our data support the notion that stressful life events, the number of trauma events, and social support may play a contributing role in the risk for PTSD by interacting with GR gene polymorphisms.
Variation in the X-Linked EFHC2 Gene Is Associated with Social Cognitive Abilities in Males
Startin, Carla M.; Fiorentini, Chiara; de Haan, Michelle; Skuse, David H.
2015-01-01
Females outperform males on many social cognitive tasks. X-linked genes may contribute to this sex difference. Males possess one X chromosome, while females possess two X chromosomes. Functional variations in X-linked genes are therefore likely to impact more on males than females. Previous studies of X-monosomic women with Turner syndrome suggest a genetic association with facial fear recognition abilities at Xp11.3, specifically at a single nucleotide polymorphism (SNP rs7055196) within the EFHC2 gene. Based on a strong hypothesis, we investigated an association between variation at SNP rs7055196 and facial fear recognition and theory of mind abilities in males. As predicted, males possessing the G allele had significantly poorer facial fear detection accuracy and theory of mind abilities than males possessing the A allele (with SNP variant accounting for up to 4.6% of variance). Variation in the X-linked EFHC2 gene at SNP rs7055196 is therefore associated with social cognitive abilities in males. PMID:26107779
Ross, Lars A; Del Bene, Victor A; Molholm, Sophie; Jae Woo, Young; Andrade, Gizely N; Abrahams, Brett S; Foxe, John J
2017-11-01
Three lines of evidence motivated this study. 1) CNTNAP2 variation is associated with autism risk and speech-language development. 2) CNTNAP2 variations are associated with differences in white matter (WM) tracts comprising the speech-language circuitry. 3) Children with autism show impairment in multisensory speech perception. Here, we asked whether an autism risk-associated CNTNAP2 single nucleotide polymorphism in neurotypical adults was associated with multisensory speech perception performance, and whether such a genotype-phenotype association was mediated through white matter tract integrity in speech-language circuitry. Risk genotype at rs7794745 was associated with decreased benefit from visual speech and lower fractional anisotropy (FA) in several WM tracts (right precentral gyrus, left anterior corona radiata, right retrolenticular internal capsule). These structural connectivity differences were found to mediate the effect of genotype on audiovisual speech perception, shedding light on possible pathogenic pathways in autism and biological sources of inter-individual variation in audiovisual speech processing in neurotypicals. Copyright © 2017 Elsevier Inc. All rights reserved.
Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.
Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E
2016-11-18
Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.
Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu
2012-10-01
To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.
Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E
2007-09-01
HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.
Molecular spectrum of somaclonal variation in regenerated rice revealed by whole-genome sequencing.
Miyao, Akio; Nakagome, Mariko; Ohnuma, Takako; Yamagata, Harumi; Kanamori, Hiroyuki; Katayose, Yuichi; Takahashi, Akira; Matsumoto, Takashi; Hirochika, Hirohiko
2012-01-01
Somaclonal variation is a phenomenon that results in the phenotypic variation of plants regenerated from cell culture. One of the causes of somaclonal variation in rice is the transposition of retrotransposons. However, many aspects of the mechanisms that result in somaclonal variation remain undefined. To detect genome-wide changes in regenerated rice, we analyzed the whole-genome sequences of three plants independently regenerated from cultured cells originating from a single seed stock. Many single-nucleotide polymorphisms (SNPs) and insertions and deletions (indels) were detected in the genomes of the regenerated plants. The transposition of only Tos17 among 43 transposons examined was detected in the regenerated plants. Therefore, the SNPs and indels contribute to the somaclonal variation in regenerated rice in addition to the transposition of Tos17. The observed molecular spectrum was similar to that of the spontaneous mutations in Arabidopsis thaliana. However, the base change ratio was estimated to be 1.74 × 10(-6) base substitutions per site per regeneration, which is 248-fold greater than the spontaneous mutation rate of A. thaliana.
Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.
Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C
2015-03-13
To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.
ADCYAP1R1 and asthma in Puerto Rican children.
Chen, Wei; Boutaoui, Nadia; Brehm, John M; Han, Yueh-Ying; Schmitz, Cassandra; Cressley, Alex; Acosta-Pérez, Edna; Alvarez, María; Colón-Semidey, Angel; Baccarelli, Andrea A; Weeks, Daniel E; Kolls, Jay K; Canino, Glorisa; Celedón, Juan C
2013-03-15
Epigenetic and/or genetic variation in the gene encoding the receptor for adenylate-cyclase activating polypeptide 1 (ADCYAP1R1) has been linked to post-traumatic stress disorder in adults and anxiety in children. Psychosocial stress has been linked to asthma morbidity in Puerto Rican children. To examine whether epigenetic or genetic variation in ADCYAP1R1 is associated with childhood asthma in Puerto Ricans. We conducted a case-control study of 516 children ages 6-14 years living in San Juan, Puerto Rico. We assessed methylation at a CpG site in the promoter of ADCYAP1R1 (cg11218385) using a pyrosequencing assay in DNA from white blood cells. We tested whether cg11218385 methylation (range, 0.4-6.1%) is associated with asthma using logistic regression. We also examined whether exposure to violence (assessed by the Exposure to Violence [ETV] Scale in children 9 yr and older) is associated with cg11218385 methylation (using linear regression) or asthma (using logistic regression). Logistic regression was used to test for association between a single nucleotide polymorphism in ADCYAP1R1 (rs2267735) and asthma under an additive model. All multivariate models were adjusted for age, sex, household income, and principal components. EACH 1% increment in cg11218385 methylation was associated with increased odds of asthma (adjusted odds ratio, 1.3; 95% confidence interval, 1.0-1.6; P = 0.03). Among children 9 years and older, exposure to violence was associated with cg11218385 methylation. The C allele of single nucleotide polymorphism rs2267735 was significantly associated with increased odds of asthma (adjusted odds ratio, 1.3; 95% confidence interval, 1.02-1.67; P = 0.03). Epigenetic and genetic variants in ADCYAP1R1 are associated with asthma in Puerto Rican children.
Lado, Bettina; Matus, Ivan; Rodríguez, Alejandra; Inostroza, Luis; Poland, Jesse; Belzile, François; del Pozo, Alejandro; Quincke, Martín; Castro, Marina; von Zitzewitz, Jarislav
2013-01-01
In crop breeding, the interest of predicting the performance of candidate cultivars in the field has increased due to recent advances in molecular breeding technologies. However, the complexity of the wheat genome presents some challenges for applying new technologies in molecular marker identification with next-generation sequencing. We applied genotyping-by-sequencing, a recently developed method to identify single-nucleotide polymorphisms, in the genomes of 384 wheat (Triticum aestivum) genotypes that were field tested under three different water regimes in Mediterranean climatic conditions: rain-fed only, mild water stress, and fully irrigated. We identified 102,324 single-nucleotide polymorphisms in these genotypes, and the phenotypic data were used to train and test genomic selection models intended to predict yield, thousand-kernel weight, number of kernels per spike, and heading date. Phenotypic data showed marked spatial variation. Therefore, different models were tested to correct the trends observed in the field. A mixed-model using moving-means as a covariate was found to best fit the data. When we applied the genomic selection models, the accuracy of predicted traits increased with spatial adjustment. Multiple genomic selection models were tested, and a Gaussian kernel model was determined to give the highest accuracy. The best predictions between environments were obtained when data from different years were used to train the model. Our results confirm that genotyping-by-sequencing is an effective tool to obtain genome-wide information for crops with complex genomes, that these data are efficient for predicting traits, and that correction of spatial variation is a crucial ingredient to increase prediction accuracy in genomic selection models. PMID:24082033
2012-01-01
Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105
A common variation of the PTEN gene is associated with peripheral insulin resistance.
Grinder-Hansen, L; Ribel-Madsen, R; Wojtaszewski, J F P; Poulsen, P; Grunnet, L G; Vaag, A
2016-09-01
Phosphatase and tensin homologue (PTEN) reduces insulin sensitivity by inhibiting the phosphatidylinositol 3-kinase (PI3K)/v-akt murine thymoma viral oncogene homologue (Akt) pathway. This study investigated how a common single nucleotide polymorphism near PTEN, previously associated with fasting levels of plasma insulin and glucose, influences in vivo glucose metabolism and insulin signalling. The primary outcome measure was the gene variant's association with peripheral glucose disposal rate and, secondarily, whether this association was explained by altered activities of PTEN targets PI3K and Akt. A total of 183 normoglycaemic Danes, including 158 twins and 25 singletons, were genotyped for PTEN rs11202614, which is in complete linkage disequilibrium with rs2142136 and rs10788575, which have also been reported in association with glycaemic traits and type 2 diabetes (T2D). Hepatic and peripheral insulin sensitivity was measured using tracer and euglycaemic-hyperinsulinaemic clamp techniques; insulin secretion was assessed by intravenous glucose tolerance test; and muscle biopsies were taken during insulin infusion from 150 twins for measurement of PI3K and Akt activities. The minor G allele of PTEN rs11202614 was associated with elevated fasting plasma insulin levels and a decreased peripheral glucose disposal rate, but not with the hepatic insulin resistance index or insulin secretion measured as the first-phase insulin response and disposition index. The single nucleotide polymorphism was not associated with either PI3K or Akt activities. A common PTEN variation is associated with peripheral insulin resistance and subsequent risk of developing T2D. However, the association with insulin resistance is not explained by decreased proximal insulin signalling in skeletal muscle. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Iyer, Shoba; Wang, Ya; Xiong, Wei; Tang, Deliang; Jedrychowski, Wieslaw; Chanock, Stephen; Wang, Shuang; Stigter, Laura; Mróz, Elzbieta; Perera, Frederica
2016-11-01
Polycyclic aromatic hydrocarbons (PAH) are a class of chemicals common in the environment. Certain PAH are carcinogenic, although the degree to which genetic variation influences susceptibility to carcinogenic PAH remains unclear. Also unknown is the influence of genetic variation on the procarcinogenic effect of in utero exposures to PAH. Benzo[ a ]pyrene (B[ a ]P) is a well-studied PAH that is classified as a known human carcinogen. Within our Polish cohort, we explored interactions between maternal exposure to airborne PAH during pregnancy and maternal and newborn single nucleotide polymorphisms (SNPs) in plausible B[ a ]P metabolism genes on B[ a ]P-DNA adducts in paired cord blood samples. The study subjects included non-smoking women ( n = 368) with available data on maternal PAH exposure, paired cord adducts, and genetic data who resided in Krakow, Poland. We selected eight common variants in maternal and newborn candidate genes related to B[ a ]P metabolism, detoxification, and repair for our analyses: CYP1A1 , CYP1A2 , CYP1B1 , GSTM1 , GSTT2 , NQO1 , and XRCC1 . We observed significant interactions between maternal PAH exposure and SNPs on cord B[ a ]P-DNA adducts in the following genes: maternal CYP1A1 and GSTT2 , and newborn CYP1A1 and CYP1B1 . These novel findings highlight differences in maternal and newborn genetic contributions to B[ a ]P-DNA adduct formation and have the potential to identify at-risk subpopulations who are susceptible to the carcinogenic potential of B[ a ]P. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Le, D P; Smith, M K; Aitken, E A B
2017-10-01
Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.
Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William
2018-03-01
An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Equalizer reduces SNP bias in Affymetrix microarrays.
Quigley, David
2015-07-30
Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.
Rooki, Hassan; Haerian, Monir-Sadat; Azimzadeh, Pedram; Ebrahimi, Mahmoud; Mirhafez, Reza; Ferns, Gordon; Ghayour-Mobarhan, Majid; Zali, Mohammad-Reza
2013-01-01
BACKGROUND: Peroxisome proliferator activator receptor gamma (PPARγ) is a nuclear transcription factor regulating multiple genes involved in cell growth, differentiation, carbohydrate and lipid metabolism and energy production. Several genetic variations in the PPARγ gene have been identified to be associated with diabetes, obesity, dyslipidemia, insulin resistance, metabolic syndrome and coronary artery disease. The present study was designed to explore the distribution of two common single nucleotide polymorphisms of the PPARγ gene (C1431T and Pro12Ala) in an Iranian population. MATERIALS AND METHODS: Genotype frequencies for these two polymorphisms were compared for 160 healthy Iranian individuals with reports from other populations. The Genotyping was performed using real-time polymerase chain reaction. RESULTS: The genotype distribution of the C1431T PPARγ polymorphism was 0.869 for the CC genotype, 0.119 for the CT genotype and 0.013 for uncommon TT genotype. Allelic frequencies were 0.93 for C and 0.07 for T allele respectively. For the Pro12Ala polymorphism of PPARγ gene, genotypic distributions and allelic frequencies were, 0.813 for CC, 0.181 for CG and 0.06 for GG and 0.903 for C and 0.097 for G respectively. Allelic and genotypic frequencies for both polymorphisms of PPARγ gene were in Hardy-Weinberg equilibrium. CONCLUSIONS: Iran is a country with an ethnically diverse population and a comparison of allelic and genotypic frequencies of PPARγ C1431T and Pro12Ala polymorphisms between our population and others showed significant differences. PMID:24497707
Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de
2015-01-01
Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834
Outcomes of methotrexate therapy for psoriasis and relationship to genetic polymorphisms.
Warren, R B; Smith, R L; Campalani, E; Eyre, S; Smith, C H; Barker, J N W N; Worthington, J; Griffiths, C E M
2009-02-01
The use of methotrexate is limited by interindividual variability in response. Previous studies in patients with either rheumatoid arthritis or psoriasis suggest that genetic variation across the methotrexate metabolic pathway might enable prediction of both efficacy and toxicity of the drug. To assess if single nucleotide polymorphisms (SNPs) across four genes that are relevant to methotrexate metabolism [folypolyglutamate synthase (FPGS), gamma-glutamyl hydrolase (GGH), methylenetetrahydrofolate reductase (MTHFR) and 5-aminoimidazole-4-carboxamide ribonucleotide transformylase (ATIC)] are related to treatment outcomes in patients with psoriasis. DNA was collected from 374 patients with psoriasis who had been treated with methotrexate. Data were available on individual outcomes to therapy, namely efficacy and toxicity. Haplotype-tagging SNPs (r(2) > 0.8) for the four genes with a minor allele frequency of > 5% were selected from the HAPMAP phase II data. Genotyping was undertaken using the MassARRAY spectrometric method (Sequenom). There were no significant associations detected between clinical outcomes in patients with psoriasis treated with methotrexate and SNPs in the four genes investigated. Genetic variation in four key genes relevant to the intracellular metabolism of methotrexate does not appear to predict response to methotrexate therapy in patients with psoriasis.
Matrix Gla Protein Polymorphisms are Associated with Coronary Artery Calcification in Men
Crosier, Michael D.; Booth, Sarah L.; Peter, Inga; Dawson-Hughes, Bess; Price, Paul A.; O’Donnell, Christopher J.; Hoffmann, Udo; Williamson, Matthew K.; Ordovas, Jose M.
2009-01-01
Summary Matrix Gla protein (MGP) is a key regulator of vascular calcification. Genetic variation at the MGP locus could modulate the development of coronary artery calcification (CAC). Our aim was to examine the cross-sectional association between MGP single nucleotide polymorphisms (SNPs) [rs1800802 (T-138C), rs1800801 (G-7A), and rs4236 (Ala102Thr)] and CAC. CAC was measured by multidetector computed tomography (MDCT), in older men and women of European descent, (n = 386; 60 to 80 y of age). Serum MGP was measured by radioimmunoassay. Linear, Tobit and Ordinal regression analyses all revealed that in men, homozygous carriers of the minor allele of rs1800802 , rs1800801 , or rs4236 (minor allele frequency: 21, 38, and 40%, respectively) were associated with a decreased quantity of CAC, relative to major allele carriers. This association was not found in women. Although genetic variation in MGP was associated with serum MGP concentrations, there were no associations between serum MGP and CAC. The results of this study suggest a role for MGP genetic variants in coronary atherosclerosis among men that is not reflected in serum MGP concentrations. PMID:19352064
Haplotype diversity in 11 candidate genes across four populations.
Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F
2005-09-01
Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.
Genetic Association Study of KCNQ5 Polymorphisms with High Myopia.
Liao, Xuan; Yap, Maurice K H; Leung, Kim Hung; Kao, Patrick Y P; Liu, Long Qian; Yip, Shea Ping
2017-01-01
Identification of genetic variations related to high myopia may advance our knowledge of the etiopathogenesis of refractive error. This study investigated the role of potassium channel gene (KCNQ5) polymorphisms in high myopia. We performed a case-control study of 1563 unrelated Han Chinese subjects (809 cases of high myopia and 754 emmetropic controls). Five tag single-nucleotide polymorphisms (SNPs) of KCNQ5 were genotyped, and association testing with high myopia was conducted using logistic regression analysis adjusted for sex and age to give P asym values, and multiple comparisons were corrected by permutation test to give P emp values. All five noncoding SNPs were associated with high myopia. The SNP rs7744813, previously shown to be associated with refractive error and myopia in two GWAS, showed an odds ratio of 0.75 (95% CI 0.63-0.90; P emp = 0.0058) for the minor allele. The top SNP rs9342979 showed an odds ratio of 0.75 (95% CI 0.64-0.89; P emp = 0.0045) for the minor allele. Both SNPs are located within enhancer histone marks and DNase-hypersensitive sites. Our data support the involvement of KCNQ5 gene polymorphisms in the genetic susceptibility to high myopia and further exploration of KCNQ5 as a risk factor for high myopia.
Olsen, K M; Sutherland, B L; Small, L L
2007-10-01
White clover (Trifolium repens) is naturally polymorphic for cyanogenesis (hydrogen cyanide release following tissue damage). The ecological factors favouring cyanogenic and acyanogenic plants have been examined in numerous studies over the last half century, making this one of the best-documented examples of an adaptive polymorphism in plants. White clover cyanogenesis is controlled by two, independently segregating Mendelian genes: Ac/ac controls the presence/absence of cyanogenic glucosides; and Li/li controls the presence/absence of their hydrolysing enzyme, linamarase. In this study, we examine the molecular evolution and population genetics of Li as it relates to the cyanogenesis polymorphism. We report here that Li exists as a single-copy gene in plants possessing linamarase activity, and that the absence of enzyme activity in li/li plants is correlated with the absence of much or all of the gene from the white clover genome. Consistent with this finding, we confirm by reverse transcription-polymerase chain reaction that Li gene expression is absent in plants lacking enzyme activity. In a molecular population genetic analysis of Li and three unlinked genes using a worldwide sample of clover plants, we find an absence of nucleotide variation and statistically significant deviations from neutrality at Li; these findings are consistent with recent positive directional selection at this cyanogenesis locus.
Wang, Longxin; Wang, Bowen; Du, Qingzhang; Chen, Jinhui; Tian, Jiaxing; Yang, Xiaohui; Zhang, Deqiang
2017-02-01
Photosynthesis is one of the most important reactions on earth. PsbW, a nuclear-encoded subunit of photosystem II (PSII), stabilizes PSII structure and plays an important role in photosynthesis. Here, we used candidate gene-based linkage disequilibrium (LD) mapping to detect significant associations between allelic variations of PtoPsbW and traits related to photosynthesis, growth, and wood properties in Populus tomentosa. PtoPsbW showed the highest expression in leaves and it increased during the development of these leaves, suggesting that PtoPsbW may play an important role in plant growth and development. Analysis of nucleotide diversity and LD revealed that PtoPsbW has low single-nucleotide polymorphism (SNP) diversity (π tot = 0.0048 and θ w = 0.0050) and relatively low average value of LD (0.1500), indicating that PtoPsbW is conserved due to its indispensable function. Using single-SNP associations in an association population of 435 individuals, we identified five significant associations at the threshold of P ≤ 0.05, explaining 3.28-15.98 % of the phenotypic variation. Haplotype-based association analyses indicated that 13 haplotypes (P ≤ 0.05) from six blocks were associated with photosynthesis, growth, and wood properties. Our work shows that identifying allelic variation and LD can help to decipher the genetic basis of photosynthesis and could potentially be applied for molecular marker-assisted selection in Populus.
Ekblom, Robert; Farrell, Lindsay L; Lank, David B; Burke, Terry
2012-01-01
By next generation transcriptome sequencing, it is possible to obtain data on both nucleotide sequence variation and gene expression. We have used this approach (RNA-Seq) to investigate the genetic basis for differences in plumage coloration and mating strategies in a non-model bird species, the ruff (Philomachus pugnax). Ruff males show enormous variation in the coloration of ornamental feathers, used for individual recognition. This polymorphism is linked to reproductive strategies, with dark males (Independents) defending territories on leks against other Independents, whereas white morphs (Satellites) co-occupy Independent's courts without agonistic interactions. Previous work found a strong genetic component for mating strategy, but the genes involved were not identified. We present feather transcriptome data of more than 6,000 de-novo sequenced ruff genes (although with limited coverage for many of them). None of the identified genes showed significant expression divergence between males, but many genetic markers showed nucleotide differentiation between different color morphs and mating strategies. These include several feather keratin genes, splicing factors, and the Xg blood-group gene. Many of the genes with significant genetic structure between mating strategies have not yet been annotated and their functions remain to be elucidated. We also conducted in-depth investigations of 28 pre-identified coloration candidate genes. Two of these (EDNRB and TYR) were specifically expressed in black- and rust-colored males, respectively. We have demonstrated the utility of next generation transcriptome sequencing for identifying and genotyping large number of genetic markers in a non-model species without previous genomic resources, and highlight the potential of this approach for addressing the genetic basis of ecologically important variation. PMID:23145334
Liu, Yong-Jun; Rocha-Sanchez, Sonia M S; Liu, Peng-Yuan; Long, Ji-Rong; Lu, Yan; Elze, Leo; Recker, Robert R; Deng, Hong-Wen
2004-04-13
Genetic variations in the leptin receptor (LEPR) gene have been conceived to affect body weight in general populations. In this study, using the tests implemented in the statistical package QTDT, we evaluated association and/or linkage of the LEPR gene with obesity phenotypes in a large sample comprising 1,873 subjects from 405 Caucasian nuclear families. Obesity phenotypes tested include body mass index (BMI), fat mass, percentage fat mass (PFM), and lean mass, with the latter three measured by dual-energy X-ray absorptiometry (DXA). Three single nucleotide polymorphisms (SNPs), namely Lys109Arg (A/G), Lys656Asn (G/C), Pro1019Pro (G/A), in the LEPR gene were analyzed. Significant linkage disequilibrium (0.394 < or = |D'| < or = 0.688, P < 0.001) was observed between pairs of the three SNPs. No significant population stratification was found for any SNP/phenotype. In single-locus analyses, evidence of association was observed for Lys656Asn with lean mass (P = 0.002) and fat mass (P = 0.015). The contribution of this polymorphism to the phenotypic variation of lean mass and fat mass was 2.63% and 1.15%, respectively. Subjects carrying allele G at the Lys656Asn site had, on average, 3.16% higher lean mass and 2.71% higher fat mass than those without it. In the analyses for haplotypes defined by the three SNPs, significant associations were detected between haplotype GCA (P = 0.005) and lean mass. In addition, marginally significant evidence of association was observed for this haplotype with fat mass (P = 0.012). No statistically significant linkage was found, largely due to the limited power of the linkage approach to detect small genetic effects in our data sets. Our results suggest that the LEPR gene polymorphisms contribute to variation in obesity phenotypes.
Blanco-Marchite, Cristina; Sánchez-Sánchez, Francisco; López-Garrido, María-Pilar; Iñigez-de-Onzoño, Mercedes; López-Martínez, Francisco; López-Sánchez, Enrique; Alvarez, Lydia; Rodríguez-Calvo, Pedro-Pablo; Méndez-Hernández, Carmen; Fernández-Vega, Luis; García-Sánchez, Julián; Coca-Prados, Miguel; García-Feijoo, Julián
2011-01-01
Purpose. To investigate the role of WDR36 and P53 sequence variations in POAG susceptibility. Methods. The authors performed a case-control genetic association study in 268 unrelated Spanish patients (POAG1) and 380 control subjects matched for sex, age, and ethnicity. WDR36 sequence variations were screened by either direct DNA sequencing or denaturing high-performance liquid chromatography. P53 polymorphisms p.R72P and c.97–147ins16bp were analyzed by single-nucleotide polymorphism (SNP) genotyping and PCR, respectively. Positive SNP and haplotype associations were reanalyzed in a second sample of 211 patients and in combined cases (n = 479). Results. The authors identified almost 50 WDR36 sequence variations, of which approximately two-thirds were rare and one-third were polymorphisms. Approximately half the variants were novel. Eight patients (2.9%) carried rare mutations that were not identified in the control group (P = 0.001). Six Tag SNPs were expected to be structured in three common haplotypes. Haplotype H2 was consistently associated with the disease (P = 0.0024 in combined cases). According to a dominant model, genotypes containing allele P of the P53 p.R72P SNP slightly increased glaucoma risk. Glaucoma susceptibility associated with different WDR36 genotypes also increased significantly in combination with the P53 RP risk genotype, indicating the existence of a genetic interaction. For instance, the OR of the H2 diplotype estimated for POAG1 and combined cases rose approximately 1.6 times in the two-locus genotype H2/RP. Conclusions. Rare WDR36 variants and the P53 p.R72P polymorphism behaved as moderate glaucoma risk factors in Spanish patients. The authors provide evidence for a genetic interaction between WDR36 and P53 variants in POAG susceptibility, although this finding must be confirmed in other populations. PMID:21931130
Méndez, Juan Pablo; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Pedraza, Javier; Casas, María José; Soriano, Ruth; García-García, Eduardo; Vilchis, Felipe; Canto, Patricia
2013-10-10
Since obesity and osteoporosis present a high genetic predisposition and polymorphisms of IL-6, IL6R, LRP5, ESR1 and SP7 may influence the risk of both diseases, the aim of this study was to analyze the possible association of polymorphisms in these genes, as well as their haplotypes, with BMD variations in postmenopausal Mexican-Mestizo women with grade 2 or grade 3 obesity. One hundred eighty unrelated postmenopausal women with grade 2 or grade 3 obesity were included. BMD was measured in total hip and lumbar spine by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. Rs1800795 of IL-6, rs2228145 of IL6R, rs3736228 of LRP5, rs9340799 (XbaI) and rs2234693 (PvuII), of ESR1, rs10876432 and rs2016266, of SP7 (and their haplotypes), were studied by real-time PCR allelic discrimination. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis was conducted. Using WHO criteria, 54.5% had grade 2 obesity, and 45.5% had grade 3 obesity. Regarding DXA results, 11.1% women had osteoporosis, 41.7% had osteopenia, and 47.2% had normal BMD. Genotype and haplotype analysis showed no significant differences with BMD variations at the lumbar spine, total hip or femoral neck. We did not find a significant association between the polymorphisms analyzed or their haplotypes and BMD variations in postmenopausal women with obesity. The higher BMD observed in women with obesity could be the result of an adaptive response to the higher loading of the skeleton. © 2013 Elsevier B.V. All rights reserved.
Dill, Alisa; Letra, Ariadne; Chaves de Souza, Letícia; Yadlapati, Mamatha; Biguetti, Claudia Cristina; Garlet, Gustavo Pompermaier; Vieira, Alexandre R; Silva, Renato Menezes
2015-02-01
It has been proposed that individual genetic predisposition may contribute to persistent apical periodontitis. Cytokines are associated with levels of inflammation and are involved in caries, pulpal, and periapical tissue destruction. We hypothesized that polymorphisms in cytokine genes may contribute to an individual's increased susceptibility to apical tissue destruction in response to deep carious lesions. Subjects with deep carious lesions with or without periapical lesions (≥3 mm) were recruited at the University of Pittsburgh, Pittsburgh, PA, and the University of Texas at Houston, Houston, TX. Genomic DNA samples of 316 patients were sorted into 2 groups: 136 cases with deep carious lesions and periapical lesions (cases) and 180 cases with deep carious lesions but no periapical lesions (controls). Nine single-nucleotide polymorphisms in IL1B, IL6, TNF, RANK, RANKL, and OPG genes were selected for genotyping. Genotypes were generated by end point analysis using TaqMan chemistry (Invitrogen, Carlsbad, CA) in a real-time polymerase chain reaction instrument. Allele and genotype frequencies were compared among cases and controls using the PLINK program (http://pngu.mgh.harvard.edu/purcell/plink/). Ninety-three human periapical granulomas and 24 healthy periodontal ligament tissues collected postoperatively were used for messenger RNA expression analyses of IL1B. A single-nucleotide polymorphism in IL1B (rs1143643) showed allelic (P = .02) and genotypic (P = .004) association with cases of deep caries and periapical lesions. We also observed altered transmission of IL1B marker haplotypes (P = .02) in these individuals. IL1B was highly expressed in granulomas (P < .001). Variations in IL1B may be associated with periapical lesion formation in individuals with untreated deep carious lesions. Future studies could help predict host susceptibility to developing periapical lesions. Copyright © 2015 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.