Effects of rs6234/rs6235 and rs6232/rs6234/rs6235 PCSK1 single-nucleotide polymorphism clusters on proprotein convertase 1/3 biosynthesis and activity.

PubMed

Mbikay, Majambu; Sirois, Francine; Nkongolo, Kabwe K; Basak, Ajoy; Chrétien, Michel

2011-12-01

Proprotein convertase 1/3 (PC1/3) is one of the endoproteases initiating the proteolytic activation of prohormones and proneuropeptides in the secretory pathway. It is produced as a zymogen that is subsequently modified by activity-determining cleavages at the amino and the carboxyl termini. In human, it is encoded by the PCSK1 locus on chromosome 5. Spontaneous inactivating mutations in its gene have been linked to obesity. Minor alleles of the common non-synonymous single-nucleotide polymorphisms (SNPs) rs6232 (T>C, N221D), rs6234 (G>C, Q665E) and rs6235 (C>G, S690T) have been associated with increased risk of obesity. We have shown that the variations associated with these SNPs are linked on minor PCSK1 alleles. In this study, we examined the impact of amino acid substitutions specified by the minor PCSK1 alleles on PC1/3 biosynthesis and prohormone processing activity in cultured cells. The common and variant isoforms of PC1/3 were expressed in transfected rat pituitary GH4C1 cells with or without proopiomelanocortin (POMC) as a substrate. Secreted PC1/3- or POMC-related proteins and peptides were analyzed by immunoblotting and immunoprecipitation. When expressed in GH4C1 cells, the triple-variant PC1/3 underwent significantly more proteolytic processing at the amino and carboxyl termini than the common and double-variant isoforms. However, there was no detectable difference among these isoforms in their ability to process POMC in the transfected cells. Since truncation of PC1/3 in its C-terminal region reportedly renders the enzyme unstable, we speculate that the accentuated processing of the triple variant in this region may, in vivo, create a subtle deficit of PC1/3 enzymatic activity in endocrine and neuroendocrine cells, causing impaired processing of prohormones and proneuropeptides to their bioactive forms. Copyright © 2011 Elsevier Inc. All rights reserved.

Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

PubMed

Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

2017-06-01

Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

Correlations between ACE single nucleotide polymorphisms and prognosis of patients with septic shock.

PubMed

Dou, Xin-Man; Cheng, Hui-Juan; Meng, Ling; Zhou, Lin-Lin; Ke, Yi-Hong; Liu, Li-Ping; Li, Yu-Min

2017-04-30

The aim of the present study is to investigate association between septic shock (SS) and angiotensin I-converting enzyme ( ACE ) single nucleotide polymorphisms (SNPs). From October 2009 to December 2016, 238 SS patients and 242 healthy individuals were selected for our study. ACE activity was detected, ACE rs4291 and rs4646994 polymorphisms were detected using PCR-restriction fragment length polymorphism (PCR-RFLP). The Kaplan-Meier survival curve was employed to evaluate the association between ACE SNPs and patients' survival and univariate and multivariate analyses to estimate risk factors for SS. ACE activity in the case group was increased in comparison with the control group. Allele and genotype frequencies of rs4291 and rs4646994 were different between the case and control groups. The TT genotype frequency of the rs4291 polymorphisms and the DD genotype of the rs4646994 polymorphisms of the case group were higher than those in the control group. The AT and TT genotypes indicated a significant elevation of ACE activity than the AA genotype, while a significant decline was found in the DI and II genotypes in comparison with the DI genotype. Patients with TT or DD genotypes had increased fatality rate within 7 and 30 days when compared with those with non-TT or non-DD genotypes. Lower sepsis-related organ failure assessment (SOFA) scores, rs4291, serum ACE and rs4646994 were all considered as risky factors for SS patients. The study demonstrates that TT genotype of rs4291 or DD genotype of rs4646994 may be indicative of a higher risk of SS and a poorer prognosis in SS patients. © 2017 The Author(s).

Association of polycystic ovary syndrome susceptibility single nucleotide polymorphism rs2479106 and PCOS in Caucasian patients with PCOS or hirsutism as referral diagnosis.

PubMed

Eriksen, Mette B; Brusgaard, Klaus; Andersen, Marianne; Tan, Qihua; Altinok, Magda L; Gaster, Michael; Glintborg, Dorte

2012-07-01

Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women. To investigate the association between rs13405728 (LHCGR gene), rs13429458 (THADA gene) and rs2479106 (DENND1A gene), PCOS, hirsutism and metabolic and hormonal parameters in a well characterized cohort of Caucasian patients of Danish descendant with PCOS or hirsutism. Patients underwent clinical examination, hormone analyses, oral glucose tolerance test and transvaginal ultrasound. Genetic variation was tested using allelic discrimination by real-time PCR. 268 patients referred to The Department of Endocrinology, Odense University Hospital, Denmark with PCOS or hirsutism between 1997 and 2011. Two hundred and forty-eight healthy females were included as controls. Genotype distributions and allele frequencies of rs13405728, rs13429458, and rs2479106 were comparable in patients and controls. The rs2479106 G allele was associated with a decreased PCOS susceptibility. None of the SNPs were associated with hirsutism or increased metabolic parameters. The rs2479106 G allele was associated with decreased PCOS susceptibility, thus confirming previously reported findings of association between rs2479106 and PCOS. Metabolic and hormonal parameters were comparable between genotypes of rs13405728 and rs2479106. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

GLUTATHIONE PEROXIDASE-1 PRO200LEU POLYMORPHISM (RS1050450) IS ASSOCIATED WITH MORBID OBESITY INDEPENDENTLY OF THE PRESENCE OF PREDIABETES OR DIABETES IN WOMEN FROM CENTRAL MEXICO.

PubMed

Hernández Guerrero, César; Hernández Chávez, Paulina; Martínez Castro, Noemí; Parra Carriedo, Alicia; García Del Rio, Sandra; Pérez Lizaur, Ana

2015-10-01

obesity affects more than a third of Mexican population. Oxidative stress participates actively in the etiology of this phenomenon. Glutathione peroxidase-1 (GPX-1) plays a protective role against oxidative stress. The SNP Pro200Leu (rs10504050) has been reported to affect the activity of the enzyme. to determine the frequency of rs10504050 polymorphism in women with obesity and normal weight control, asses the concentration of peripheral TBARS and evaluate the consumption of pro and antioxidants. 104 women with obesity and 70 healthy controls (CG) were included in the study. Anthropometric, biochemical, clinical and dietary features were evaluated. GPx-1 rs10504050 was determined by PCR/RFLP method. TBARS was assayed spectrophotometrically in plasma. The subjects were stratified and compared by obesity grades and by subgroups of prediabetes and diabetes condition. Statistical analysis included ANOVA of Kruskal Wallis, Xi squared and Pearson correlation. for rs10504050 polymorphism there were differences (Xi2 = 6; p = 0.01) between frequency (0.61) of obese carriers (Pro/Leu plus Leu/Leu) and CG carriers (0.42), and between (Xi2 = 8; p = 0.004) morbid (IMC > 40) obesity (0.74) and CG carriers. The obese group (OB) showed a prevalence of 66% of prediabetes plus diabetes. There were no differences in frequencies of rs10504050 in OB with pre or diabetes versus CG, or versus obese participants without diabetes. TBARS concentration was greater in all the degrees of OB versus CG. GPx-1 Pro200Leu polymorphism was associated with obesity especially with morbid obesity, but not with obese participants with prediabetes or diabetes. Oxidative stress is present in all grades of obesity significantly. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

PubMed Central

Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

2012-01-01

Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

CLU rs9331888 Polymorphism Contributes to Alzheimer's Disease Susceptibility in Caucasian But Not East Asian Populations.

PubMed

Zhang, Shuyan; Li, Xuling; Ma, Guoda; Jiang, Yongshuai; Liao, Mingzhi; Feng, Rennan; Zhang, Liangcai; Liu, Jiafeng; Wang, Guangyu; Zhao, Bin; Jiang, Qinghua; Li, Keshen; Liu, Guiyou

2016-04-01

Large-scale genome-wide association studies (GWAS) identified three single nucleotide polymorphisms rs11136000, rs2279590, and rs9331888 in CLU gene to be significantly associated with Alzheimer's disease (AD) in Caucasian ancestry. Both rs11136000 and rs2279590 variants were successfully replicated in Asian population. However, previous studies reported either a weak association or no association between rs9331888 polymorphism and AD in Asian population. Here, we searched the PubMed, AlzGene, and Google Scholar databases. We selected 12 independent studies that evaluated the association between the rs9331888 polymorphism and AD using a case-control design. Using an additive model, we did not identify significant heterogeneity among these 12 studies. We observed significant association between rs9331888 polymorphism and AD in pooled populations (P = 2.26E - 07, odds ratio (OR) = 1.10, 95% confidence interval (CI) 1.06-1.14). In subgroup analysis, we did not identify significant heterogeneity in both Asian and Caucasian populations. We identified significant association in Caucasian population (P = 1.67E - 08, OR = 1.13, 95% CI 1.08-1.18) but not in East Asian population (P = 0.49, OR = 1.02, 95% CI 0.96-1.10).

Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

PubMed

Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

2012-11-10

We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

Interleukin-21 gene polymorphism rs2221903 is associated with disease activity in patients with rheumatoid arthritis.

PubMed

Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof; Pawlik, Andrzej

2017-08-01

Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04-2.28; p = 0.035). The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity.

Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

PubMed

Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

2012-10-01

To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

Impact of Genetic Polymorphisms on 6-Thioguanine Nucleotide Levels and Toxicity in Pediatric Patients with IBD Treated with Azathioprine.

PubMed

Lee, Mi-Na; Kang, Ben; Choi, So Yoon; Kim, Mi Jin; Woo, Sook Young; Kim, Jong-Won; Choe, Yon Ho; Lee, Soo-Youn

2015-12-01

Thiopurine-related toxicity results in discontinuation of therapy in up to 30% of patients with inflammatory bowel disease. Although thiopurine S-methyltransferase (TPMT) is implicated in toxicity, not all toxicity can be attributed to TPMT polymorphisms. We investigated the effects of polymorphisms of genes involved in thiopurine and folate metabolism pathways on 6-thioguanine nucleotide levels and toxicity. Retrospective clinical data and blood samples were collected from 132 pediatric patients with inflammatory bowel disease treated with azathioprine. Eighty-seven genetic polymorphisms of 30 genes were screened using the MassARRAY system, and 70 polymorphisms of 28 genes were selected for further analysis. TPMT genotype (P < 0.001), concurrent use of mesalazine (P = 0.006), ABCC5 (rs2293001) (P < 0.001), ITPA (rs2236206 and rs8362) (P = 0.010 and P = 0.003), and ABCB1 (rs2032582) (P = 0.028) were all associated with the ratio of 6-thioguanine nucleotides to azathioprine dose. ADK (rs10824095) (P = 0.004, odds ratio [OR] = 6.220), SLC29A1 (rs747199) (P = 0.016, OR = 5.681), and TYMS (rs34743033) (P = 0.045, OR = 3.846) were associated with neutropenia. ABCC1 (rs2074087) (P = 0.022, OR = 3.406), IMPDH1 (rs2278294) (P = 0.027, OR = 0.276), and IMPDH2 (rs11706052) (P = 0.034, OR = 3.639) had a significant impact on lymphopenia. This study describes genetic polymorphisms in genes whose products may affect pharmacokinetics and which may predict the relative likelihood of benefit or risk from thiopurine treatment. These findings may serve as a basis for personalized thiopurine therapy in pediatric patients with inflammatory bowel disease, although our data need to be validated in further studies.

IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

PubMed

Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

2014-06-01

Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers.

PubMed

Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado

2017-11-01

Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.

Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

PubMed

Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

2017-09-01

It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

Interleukin-21 gene polymorphism rs2221903 is associated with disease activity in patients with rheumatoid arthritis

PubMed Central

Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof

2017-01-01

Introduction Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. Material and methods We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. Results There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04–2.28; p = 0.035). Conclusions The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity. PMID:28883856

Genetic associations of the INSIG2 rs7566605 polymorphism with obesity-related metabolic traits in Malaysian Malays.

PubMed

Apalasamy, Y D; Moy, F M; Rampal, S; Bulgiba, A; Mohamed, Z

2014-07-04

A genome-wide association study showed that the tagging single nucleotide polymorphism (SNP) rs7566605 in the insulin-induced gene 2 (INSIG2) was associated with obesity. Attempts to replicate this result in different populations have produced inconsistent findings. We aimed to study the association between the rs7566605 SNP with obesity and other metabolic parameters in Malaysian Malays. Anthropometric and obesity-related metabolic parameters and DNA samples were collected. We genotyped the rs7566605 polymorphism in 672 subjects using real-time polymerase chain reaction. No significant associations were found between the rs7566605 tagging SNP of INSIG2 with obesity or other metabolic parameters in the Malaysian Malay population. The INSIG2 rs7566605 SNP may not play a role in the development of obesity-related metabolic traits in Malaysian Malays.

The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

PubMed

Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

2018-03-01

Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

Antioxidant-related gene polymorphisms associated with the cardio-ankle vascular index in young Russians.

PubMed

Sorokin, Alexander V; Kotani, Kazuhiko; Bushueva, Olga Y; Polonikov, Alexey V

2016-04-01

The cardio-ankle vascular index is a measure of arterial stiffness, whereas oxidative stress underlies arterial pathology. This study aimed to investigate the association between the cardio-ankle vascular index and antioxidant-related gene polymorphisms in young Russians. A total of 89 patients (mean age, 21.6 years) were examined by the cardio-ankle vascular index and for 15 gene polymorphisms related to antioxidant enzymes including FMO3 (flavin-containing monooxygenase 3), GPX1 (glutathione peroxidase 1), and GPX4 (glutathione peroxidase 4). A higher cardio-ankle vascular index level was detected in carriers with the KK-genotype of FMO3 polymorphism rs2266782 than in those without (mean levels: 6.2 versus 5.6, respectively, p<0.05). Similarly, a higher cardio-ankle vascular index level was seen in carriers with the CC-genotype of GPX4 polymorphism rs713041 than in those without (6.0 versus 5.5, respectively, p<0.05). We did not observe significant associations between the cardio-ankle vascular index levels and the other gene polymorphisms. Although carriers with the LL-genotype of GPX1 polymorphism rs1050450 showed a higher diastolic blood pressure level than those without, the polymorphism did not affect the cardio-ankle vascular index level. This study showed a significant association between rs2266782 and rs713041 polymorphisms and arterial stiffness, as measured by the cardio-ankle vascular index, in young Russians. The pathways utilised by antioxidant enzymes may be responsible for early arterial stiffening in the Russian population.

Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

PubMed

Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

2017-07-01

To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

The association between rs4684677 T/A polymorphism in preproghrelin gene and predisposition to autoimmune thyroid diseases in children.

PubMed

Moniuszko, Anna; Wawrusiewicz-Kurylonek, Natalia; Bossowska, Anna; Gościk, Joanna; Łuczyński, Włodzimierz; Głowińska-Olszewska, Barbara; Krętowski, Adam; Bossowski, Artur

2015-01-01

A potential role of preproghrelin polymorphisms on autoimmune thyroid diseases (AITDs) has not been established equivocally yet. To estimate the association of two polymorphisms of preproghrelin gene with the predisposition to Graves' disease (GD) and Hashimoto's thyroiditis (HT) in children. The study was performed in 145 patients with GD, 87 with HT and 161 healthy volunteers. The two single nucleotide polymorphisms (SNPs) rs696217 (C_3151003_20) and rs4684677 (C_25607748_10) in the preproghrelin gene were genotyped by TaqMan SNP genotyping assay using the real-time PCR. Rs4684677 T alleles were more frequent in HT patients (99% in women and 100% in men) in comparison to healthy subjects (p = 0.002) with OR = 8.0 and 95% confidence interval for OR: 1.8-206.7. In women group, rs4684677 T alleles were more frequent compared to healthy controls (99%) in HT (p = 0.02) with OR = 6.7 and 95% confidence interval for OR: 1.2-168.37. Frequency of the SNP rs696217 did not differ between the groups. There was a significant relationship between rs696217 polymorphisms and anti-TSHR antibodies level (p = 0.036) in women from GD/HT groups. A significant relationship between rs696217 polymorphisms and anti-TG antibodies level in GD women group (p = 0.038) and between rs696217 polymorphisms and fT4 concentration (p = 0.03) were found. Rs4684677 T/A polymorphisms in preproghrelin gene could contribute to development of AITDs in children and T allele is the main risk factor.

Association of rs7903146, rs12255372, and rs290487 polymorphisms in TCF7L2 gene with type 2 diabetes in an Iranian Kurdish ethnic group.

PubMed

Shokouhi, Shabnam; Delpisheh, Ali; Haghani, Karimeh; Mahdizadeh, Mohsen; Bakhtiyari, Salar

2014-01-01

Single nucleotide polymorphisms (SNPs) within the transcription factor 7-like 2 (TCF7L2) gene are well known risk variants for type 2 diabetes mellitus (T2DM). The association between TCF7L2 SNPs and T2DM has been investigated in several studies, but the results are controversial. In this study, we investigated whether the rs7903146, rs12255372, and rs290487 polymorphisms of TCF7L2 are associated with T2DM per se or metabolic traits related to this disease in a Kurdish ethnic group of Iran. In all, 173 patients with T2DM and 173 normoglycemic subjects were included in this study. All subjects were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Genotypic and allelic frequencies were then analyzed in each group. Serum lipids, fasting glucose, fasting serum insulin, HOMA-IR, and HbA1c levels were determined by conventional methods. T-allele and genotype frequencies of rs7903146, rs12255372, and rs290487 were significantly different between T2DM and control subjects. The CT genotype (OR = 1.98, p = 0.008), TT genotype (OR = 3.54, p = 0.024), and the dominant model (OR = 2.16, p = 0.002) of rs7903146 were associated with T2DM. The GT genotype (OR = 2.23, p = 0.005), TT genotype (OR = 4.25, p = 0.046), and the dominant model (OR = 2.2, p = 0.001) of rs12255372 gave a higher risk for T2DM. The carriers of CT genotype of rs290487 showed a significantly increased risk for T2DM (OR = 2.24, p = 0.003). Similarly, the dominant model of this SNP was found to be significantly associated with T2DM (OR = 2.25, p = 0.002). The control subjects carrying the T-allele of rs7903146 had higher levels of total cholesterol (CC; 4.52 +/- 1.03 vs. CT + TT; 5.00 +/- 1.2 mmol/L, p = 0.009) than those with CC genotype. Normoglycemic subjects carrying GT + TT genotypes of rs12255372 had a significantly higher WHR (GG; 0.90 +/- 0.059 vs. GT + TT; 0.93 +/- 0.07, p = 0.038) as compared with those with the GG genotype. The T-allele of rs12255372, rs

Genetic association of polymorphism rs1333049 with gout.

PubMed

Wang, Binbin; Meng, Dongmei; Wang, Jing; Liu, Shiguo; Zhou, Sirui; Miao, Zhimin; Han, Lin; Chu, Nan; Zhang, Kun; Ma, Xu; Li, Changgui

2011-09-01

We suspect that genes or loci that contribute to coronary artery disease (CAD) may also play a role in the pathogenesis of gout, since hyperuricaemia leads to gout, and serum uric acid (SUA) levels are potential risk factors for CAD. The single nucleotide polymorphism (SNP) rs1333049 (C/G) on chromosome 9p21 has been implicated in previous studies to be associated with CAD. The aim of this study was to evaluate the relationship between this SNP and gout pathogenesis. Nine hundred Chinese Han were recruited for this study (461 gout patients and 439 gout-free individuals). The rs1333049 SNP and surrounding sequences were PCR sequenced. There was a clear link between the rs1333049 genotypic and allelic frequencies between gout cases and controls (χ(2) = 6.81, df = 2, P = 0.033 by genotype; χ(2) = 6.63, df = 1, P = 0.01 by allele). There was a significantly increased risk of gout in carriers of the CC genotype (odds ratio = 1.43, 95% CI 1.07, 1.91). To the best of our knowledge, our findings are the first to establish an association of rs1333049 with gout in a Chinese Han population. Meanwhile, this SNP is homologous to miR-519 and miR-520.

Association of the rs7903146 single nucleotide polymorphism at the Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian subjects.

PubMed

Barra, Gustavo Barcelos; Dutra, Ludmila Alves Sanches; Watanabe, Sílvia Conde; Costa, Patrícia Godoy Garcia; Cruz, Patrícia Sales Marques da; Azevedo, Monalisa Ferreira; Amato, Angélica Amorim

2012-11-01

To investigate the association of the T allele of the single nucleotide polymorphism (SNP) rs7903146 of TCF7L2 with the occurrence of T2D in a sample of subjects followed up at the Brasilia University Hospital. The SNP rs7903146 of TCF7L2 was genotyped by allele-specific PCR in 113 patients with known T2D and in 139 non-diabetic controls in Brasilia, Brazil. We found that the T allele of the SNP rs7903146 of TCF7L2 was significantly associated with T2D risk (odds ratio of 3.92 for genotype TT in the recessive genetic model, p = 0.004 and 1.5 for T allele, p = 0.032). These results reinforce previous findings on the consistent association of this genetic factor and the risk of T2D in populations of diverse ethnic backgrounds.

Is the COL5A1 rs12722 gene polymorphism associated with running economy?

PubMed

Bertuzzi, Rômulo; Pasqua, Leonardo A; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H

2014-01-01

The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km · h(-1)) and 12 km · h(-1)) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km · h(-1) (p = 0.232) and 12 km · h(-1) (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running.

Is the COL5A1 rs12722 Gene Polymorphism Associated with Running Economy?

PubMed Central

Bertuzzi, Rômulo; Pasqua, Leonardo A.; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H.

2014-01-01

The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km•h−1 and 12 km•h−1) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km•h−1 (p = 0.232) and 12 km•h−1 (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running. PMID:25188268

Prevalence of the rs1801282 single nucleotide polymorphism of the PPARG gene in patients with metabolic syndrome.

PubMed

Rocha, Renato Marano; Barra, Gustavo Barcelos; Rosa, Érica Carine Campos Caldas; Garcia, Érica Correa; Amato, Angélica Amorim; Azevedo, Monalisa Ferreira

2015-08-01

This study aimed to get the genotypic and allelic frequencies of rs1801282 in 179 volunteer donors and 154 patients with Metabolic syndrome (MetS) in Brasilia, Brazil and also examine the association with anthropometric, biochemical and hemodynamic variables in the latter group. MetS comprises a group of diseases resulting from insulin resistance, in-creased risk of type 2 diabetes and atherosclerotic cardiovascular disease. MetS is defined by the presence of increased visceral fat, atherogenic dyslipidemia (elevated triglycerides (TGL)), with decreased high density lipoprotein (HDL) and increased low density lipoprotein (LDL) levels, hypertension (BPH) and disturbances in glucose homeostasis representing a significant burden across the world due to the alarming increase in the incidence over the last decades besides their significant morbidity and mortality. Peroxisome proliferator activated receptor-gamma (PPARg) has been mentioned as a candidate gene for determining the risk of MetS. It is a member of the nuclear receptors superfamily and a ligand-activated transcription factor, which regulates the expression of genes involved in the network lipogenesis and adipogenesis, insulin sensitivity, energy balance, inflammation, angiogenesis and atherosclerosis. Among the PPARG genetic variants, single nucleotide polymorphism rs1801282 has been the most extensively studied one since it was first described by Yen and cols. in 1997. This polymorphism is characterized by the replacement of a proline (CCC) to an alanine (GCA) at codon 12 of exon B, due to the exchange of a cytosine with a guanine. The Ala allele frequency varies in different ethnic groups. DNA was extracted using Chelex-100 method and determinations of genotypes were performed by allele-specific chain reaction. The distribution of genotype frequency of the MetS group was not statistically different from the frequency in the donor population at large. In the first group, genotype frequency was CC to 0

rs11613352 polymorphism (TT genotype) associates with a decrease of triglycerides and an increase of HDL in familial hypercholesterolemia patients.

PubMed

Aledo, Rosa; Padró, Teresa; Mata, Pedro; Alonso, Rodrigo; Badimon, Lina

2015-04-01

Recent genome-wide association studies have identified a locus on chromosome 12q13.3 associated with plasma levels of triglyceride and high-density lipoprotein cholesterol, with rs11613352 being the lead single nucleotide polymorphism in this genome-wide association study locus. The aim of the study is to investigate the involvement of rs11613352 in a population with high cardiovascular risk due to familial hypercholesterolemia. The single nucleotide polymorphism was genotyped by Taqman(®) assay in a cohort of 601 unrelated familial hypercholesterolemia patients and its association with plasma triglyceride and high-density lipoprotein cholesterol levels was analyzed by multivariate methods based on linear regression. Minimal allele frequency was 0.17 and genotype frequencies were 0.69, 0.27, and 0.04 for CC, CT, and TT genotypes, respectively. The polymorphism is associated in a recessive manner (TT genotype) with a decrease in triglyceride levels (P=.002) and with an increase in high-density lipoprotein cholesterol levels (P=.021) after adjusting by age and sex. The polymorphism rs11613352 may contribute to modulate the cardiovascular risk by modifying plasma lipid levels in familial hypercholesterolemia patients. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

Glutamate transporter gene (SLC1A1) single nucleotide polymorphism (rs301430) and repetitive behaviors and anxiety in children with autism spectrum disorder.

PubMed

Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli

2010-09-01

Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.

Effect of UDP-Glucuronosyltransferase (UGT) 1A Polymorphism (rs8330 and rs10929303) on Glucuronidation Status of Acetaminophen

PubMed Central

Tahir, Imtiaz Mahmood; Iqbal, Tahira; Saleem, Sadaf; Perveen, Sofia; Farooqi, Aboubakker

2017-01-01

Interindividual variability in polymorphic uridine diphosphate-glucuronosyltransferase 1A1 (UGT1A1) ascribed to genetic diversity is associated with relative glucuronidation level among individuals. The present research was aimed to study the effect of 2 important single nucleotide polymorphisms (SNPs; rs8330 and rs10929303) of UGT1A1 gene on glucuronidation status of acetaminophen in healthy volunteers (n = 109). Among enrolled volunteers, 54.13% were male (n = 59) and 45.87% were female (n = 50). The in vivo activity of UGT1A1 was investigated by high-performance liquid chromatography-based analysis of glucuronidation status (ie, acetaminophen and acetaminophen glucuronide) in human volunteers after oral intake of a single dose (1000 mg) of acetaminophen. The TaqMan SNP genotyping assay was used for UGT1A1 genotyping. The wild-type genotype (C/C) was observed the most frequent one for both SNPs (rs8330 and rs10929303) and associated with fast glucuronidator phenotypes. The distribution of variant genotype (G/G) for SNP rs8330 was observed in 5% of male and 8% of the female population; however, for SNP rs10929303, the G/G genotype was found in 8% of both genders. A trimodal distribution (fast, intermediate, and slow) based on phenotypes was observed. Among the male participants, the glucuronidation phenotypes were observed as 7% slow, 37% intermediate, and 56% fast glucuronidators; however, these findings for the females were slightly different as 8%, 32%, and 60% respectively. The k-statistics revealed a compelling evidence for good concordance between phenotype and genotype with a k value of 1.00 for SNP rs8330 and 0.966 for SNP rs10929303 in our population. PMID:28932176

Association of Interleukin-1 Gene Single Nucleotide Polymorphisms with Keratoconus in Chinese Han Population.

PubMed

Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun

2016-05-01

To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p < 0.001, OR = 2.864, 95% C.I. 1.631-4.968) and the A allele of rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.

Functional analysis of regulatory single-nucleotide polymorphisms.

PubMed

Pampín, Sandra; Rodríguez-Rey, José C

2007-04-01

The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

Determination of IL-1B (rs16944) and IL-6 (rs1800796) genetic polymorphisms in IgA nephropathy in a northwest Chinese Han population.

PubMed

Zhang, Daofa; Xie, Maowei; Yang, Xiaohong; Zhang, Yin; Su, Yan; Wang, Yanni; Huang, Haiyang; Han, Hui; Li, Wenning; Fu, Keying; Su, Huiluan; Xu, Wentan; Han, Yeguang; Wang, Ru; Zhang, Pei; Wu, Wei; Huang, Yun; Chen, Daojun; Jin, Tianbo; Wei, Jiali

2017-09-22

IgA nephropathy (IgAN) is the most common form of primary glomerulonephritis worldwide, but etiology and pathogenesis continue to be poorly understood. Polymorphisms in the cytokine genes may play a role in the etiology and pathogenesis of IgAN. The incidence of different between diverse ethnic groups suggested important genetic influences on its pathogenesis. We genotype 10 single nucleotide polymorphisms (SNPs) in IL-1B and IL-6 gene using Sequenom Mass-ARRAY technology from 417 IgAN patients and 463 healthy controls of the Chinese Han population. We evaluated these SNPs associated with IgAN utilising the chi-square tests and genetic model analysis. We identified that the minor alleles of rs16944 ("A"), rs1800796 ("G") in IL-1B, IL-6 were involved in an increasingly risk of IgAN in allelic model analysis, respectively. The rs16944 in IL-1B and rs1800796 in IL-6 were associated with 1.23-fold (95% CI, 1.02-1.48, P = 0.031) and 1.33-fold (95% CI, 1.11-1.66, P = 0.003) increases in the risk of developing IgAN, respectively. There was only rs1800796 still correlated with IgAN in the allelic model after adjustment by age and gender and the Bonferroni correction. In addition, Haplotype G rs1800796 A rs2069837 G rs2069840 ( P = 0.037) and G rs1800796 A rs2069837 C rs2069840 ( P = 0.042) in IL-6 were considered to be associated with increased IgAN risk. This study verified the IL-6, IL-1B genetic variants polymorphisms contributed to IgAN susceptibility in a Chinese Han population. Although we identified SNPs susceptibility, however, replication studies and functional research are required to confirm the genetic contribution in IgAN.

Distinct role of the Fas rs1800682 and FasL rs763110 polymorphisms in determining the risk of breast cancer among Han Chinese females.

PubMed

Wang, Meng; Wang, Zheng; Wang, Xi-Jing; Jin, Tian-Bo; Dai, Zhi-Ming; Kang, Hua-Feng; Guan, Hai-Tao; Ma, Xiao-Bin; Liu, Xing-Han; Dai, Zhi-Jun

2016-01-01

In recent years, studies have demonstrated that polymorphisms in the promoters of Fas and FasL are significantly associated with breast cancer risk. However, the results of these studies were inconsistent. This case-control study was performed to explore the associations between Fas rs1800682 and FasL rs763110 polymorphisms and breast cancer. A hospital-based case-control study of 560 Han Chinese females with breast cancer (583 controls) was conducted. The MassARRAY system was used to search for a possible association between the disease risk and the two single nucleotide polymorphisms, Fas rs1800682 and FasL rs763110. Statistical analyses were performed using SNPStats software to conduct Pearson's chi-square tests in five different genetic models. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated after adjustment to age and body mass index. PHASE v2.1 software was used to reconstruct all common haplotypes. A statistically significant association was found between Fas rs1800682 and increased breast cancer risk (AG vs AA: OR =1.37, 95% CI =1.06-1.78; AA+AG vs GG: OR =1.32, 95% CI =1.04-1.66), and also it was found that the FasL rs763110 polymorphism may decrease the risk. Stratified analyses demonstrated that the rs763110 polymorphism was associated with lower breast cancer risk among postmenopausal females (heterozygote model: OR =0.69, 95% CI =0.49-0.97; dominant model: OR =0.70, 95% CI =0.51-0.96). The T allele of rs763110 was also associated with a decreased risk of lymph node metastasis (allele model: OR =0.75, 95% CI =0.57-0.97) and an increased risk of the breast cancer being human epidermal growth factor receptor 2 positive (allele model: OR =1.37, 95% CI =1.03-1.18). Moreover, haplotype analysis showed that Ars1800682Trs763110 was associated to a statistically significant degree with lower risk of breast cancer (OR =0.70, 95% CI =0.53-0.91). These data suggest that the presence of Fas rs1800683 is an important risk factor for breast

GDF5 single-nucleotide polymorphism rs143383 is associated with lumbar disc degeneration in Northern European women

PubMed Central

Williams, F M K; Popham, M; Hart, D J; de Schepper, E; Bierma-Zeinstra, S; Hofman, A; Uitterlinden, A G; Arden, N K; Cooper, C; Spector, T D; Valdes, A M; van Meurs, J

2011-01-01

Objective Lumbar disc degeneration (LDD) is a serious social and medical problem which has been shown to be highly heritable. It has similarities with peripheral joint osteoarthritis (OA) in terms of both epidemiology and pathologic processes. A few known genetic variants have been identified using a candidate gene approach, but many more are thought to exist. GDF5 is a gene whose variants have been shown to play a role in skeletal height as well as predisposing to peripheral joint OA. In vitro, the gene product growth differentiation factor 5 has been shown to promote growth and repair of animal disc. This study was undertaken to investigate whether the GDF5 gene plays a role in LDD. Methods We investigated whether the 5′ upstream single-nucleotide polymorphism (SNP) variant rs143383 was associated with LDD, using plain radiography and magnetic resonance imaging to identify disc space narrowing and osteophytes, in 5 population cohorts from Northern Europe. Results An association between LDD and the SNP rs143383 was identified in women, with the same risk allele as in knee and hip OA (odds ratio 1.72 [95% confidence interval 1.15–2.57], P = 0.008). Conclusion Our findings in 5 population cohorts from Northern Europe indicate that a variant in the GDF5 gene is a risk factor for LDD in women. Many more such variants are predicted to exist, but this result highlights the growth and differentiation cellular pathway as a possible route to a better understanding of the process behind lumbar disc degeneration. PMID:21360499

Polymorphisms in nucleotide excision repair genes and risk of primary prostate cancer in Chinese Han populations.

PubMed

Wang, Mengyun; Li, Qiaoxin; Gu, Chengyuan; Zhu, Yao; Yang, Yajun; Wang, Jiucun; Jin, Li; He, Jing; Ye, Dingwei; Wei, Qingyi

2017-04-11

Genetic variants of nucleotide excision repair (NER) genes have been extensively investigated for their roles in the development of prostate cancer (PCa); however, the published results have been inconsistent. In a hospital-based case-control study of 1,004 PCa cases and 1,055 cancer-free controls, we genotyped eight potentially functional single nucleotide polymorphisms (SNPs) of NER genes (i.e., XPC, rs2228001 T>G and rs1870134 G>C; XPD, rs13181 T>G and rs238406 G>T; XPG, rs1047768 T>C, rs751402 C>T, and rs17655 G>C; and XPF, rs2276464 G>C) and assessed their associations with risk of PCa by using logistic regression analysis. Among these eight SNPs investigated, only XPC rs1870134 CG/CC variant genotypes were associated with a decreased risk of prostate cancer under a dominant genetic model (adjusted odds ratio [OR] = 0.77, 95% confidence interval [CI] = 0.64-1.91, P = 0.003). Phenotype-genotype analysis also suggested that the XPC rs1870134 CG/CC variant genotypes were associated with significantly decreased expression levels of XPC mRNA in a mix population of different ethnicities. These findings suggested that XPC SNPs may contribute to risk of PCa in Eastern Chinese men.

Polymorphisms of the peroxisome proliferator-activated receptor-γ (rs1801282) and its coactivator-1 (rs8192673) are associated with obesity indexes in subjects with type 2 diabetes mellitus.

PubMed

Kruzliak, Peter; Haley, Andreana P; Starcevic, Jovana Nikolajevic; Gaspar, Ludovit; Petrovic, Daniel

2015-04-28

The aim of this study was to clarify whether common single nucleotide polymorphisms (SNPs) of the Peroxisome Proliferator-Activated Receptor-γ (PPAR-γ) gene (rs1801282) and the Peroxisome Proliferator-Activated Receptor-γ Coactivator-1 (PGC-1α) gene (rs8192673) are associated with obesity indexes (BMI, waist circumference) in subjects with type 2 diabetes mellitus (T2DM) in Caucasian population. The second aim was to find an association of both polymorphisms with T2DM. Two exonic SNPs of both genes rs1801282 of the PPAR-γ gene and rs8192673 of the PGC-1α gene) were genotyped in 881 unrelated Slovene subjects (Caucasians) with T2DM and in 348 subjects without T2DM (control subjects). Female homozygotes with the CC genotype of the rs8192673 had higher waist circumference in comparison with subjects with other genotypes. Homozygotes (females, males) with wild allele (Pro) of the rs1801282 (Pro12Ala polymorphism) had higher waist circumference in comparison with subjects with other genotypes. In the study, there were no differences in the distributions of the rs8192673 and the rs1801282 genotypes between patients with T2DM and controls. Linear regression analyses for both polymorphisms were performed and demonstrated an independent effect of the rs1801282 of the PPAR-γ on waist circumference in subjects with T2DM, whereas an independent effect on waist circumference was not demonstrated for the rs8192673 of the PGC-1α gene. In a large sample of the Caucasians the rs8192673 of the PGC-1α gene and the rs1801282 of the PPAR-γ gene were associated with waist circumference in subjects with T2DM.

Determination of IL-1B (rs16944) and IL-6 (rs1800796) genetic polymorphisms in IgA nephropathy in a northwest Chinese Han population

PubMed Central

Zhang, Yin; Su, Yan; Wang, Yanni; Huang, Haiyang; Han, Hui; Li, Wenning; Fu, Keying; Su, Huiluan; Xu, Wentan; Han, Yeguang; Wang, Ru; Zhang, Pei; Wu, Wei; Huang, Yun; Chen, Daojun; Jin, Tianbo; Wei, Jiali

2017-01-01

IgA nephropathy (IgAN) is the most common form of primary glomerulonephritis worldwide, but etiology and pathogenesis continue to be poorly understood. Polymorphisms in the cytokine genes may play a role in the etiology and pathogenesis of IgAN. The incidence of different between diverse ethnic groups suggested important genetic influences on its pathogenesis. We genotype 10 single nucleotide polymorphisms (SNPs) in IL-1B and IL-6 gene using Sequenom Mass-ARRAY technology from 417 IgAN patients and 463 healthy controls of the Chinese Han population. We evaluated these SNPs associated with IgAN utilising the chi-square tests and genetic model analysis. We identified that the minor alleles of rs16944 (“A”), rs1800796 (“G”) in IL-1B, IL-6 were involved in an increasingly risk of IgAN in allelic model analysis, respectively. The rs16944 in IL-1B and rs1800796 in IL-6 were associated with 1.23-fold (95% CI, 1.02-1.48, P = 0.031) and 1.33-fold (95% CI, 1.11-1.66, P = 0.003) increases in the risk of developing IgAN, respectively. There was only rs1800796 still correlated with IgAN in the allelic model after adjustment by age and gender and the Bonferroni correction. In addition, Haplotype Grs1800796A rs2069837G rs2069840 (P = 0.037) and G rs1800796A rs2069837C rs2069840 (P = 0.042) in IL-6were considered to be associated with increased IgAN risk. This study verified the IL-6, IL-1B genetic variants polymorphisms contributed to IgAN susceptibility in a Chinese Han population. Although we identified SNPs susceptibility, however, replication studies and functional research are required to confirm the genetic contribution in IgAN. PMID:29069743

A NEIL1 single nucleotide polymorphism (rs4462560) predicts the risk of radiation-induced toxicities in esophageal cancer patients treated with definitive radiotherapy.

PubMed

Chen, Yun; Zhu, Meiling; Zhang, Zhen; Jiang, Guoliang; Fu, Xiaolong; Fan, Min; Sun, Menghong; Wei, Qingyi; Zhao, Kuaile

2013-12-01

To assess the association between single nucleotide polymorphisms (SNPs) of base-excision repair genes and clinical outcomes, the roles of genetic variants of 3 selected genes-flap structure-specific endonuclease 1 (FEN1), 8-hydroxyguanine DNA glycosylase (hOGG1), and nei endonuclease VIII-like 1 (NEIL1)--were investigated in radiation-induced esophageal toxicity (RIET), radiation pneumonitis (RP), and overall survival (OS) after radio(chemo)therapy in patients with esophageal squamous cell carcinoma (ESCC). NEIL1 reference SNP 4462560 (rs4462560) and rs7402844, hOGG1 rs1052133 and rs293795, and FEN1 rs4246215 and rs174538 were genotyped in 187 patients with ESCC who received definitive radiotherapy with or without chemotherapy. Kaplan-Meier cumulative probabilities and Cox proportional hazards regression models were used to assess the effect of the genotypes on the risk of RIET, RP, and OS. The authors observed that patients who had the NEIL1 rs4462560 GC/CC genotype had a statistically significantly lower risk of both grade ≥ 2 acute radiation-induced esophageal toxicity (RIET) (adjusted hazard ratio [HR], 0.421; 95% confidence interval [CI], 0.207-0.856; P = .017) and grade ≥ 2 acute radiation pneumonitis (RP) (adjusted HR, 0.392; 95% CI, 0.163-0.946; P = .037) compared with patients who had the GG genotype, but the genotype did not affect OS (adjusted HR, 0.778; 95% CI, 0.471-1.284; P = .326). There were no significant findings for other the SNPs under investigation. The NEIL1 rs4462560 SNP may serve as a predictor of acute RIET and RP risk but not of OS. Larger prospective studies are needed to validate these findings. © 2013 American Cancer Society.

Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

PubMed

Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

2016-07-25

Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

PubMed

Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

2015-09-25

ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

PubMed

Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

2017-01-01

Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

DNA damage and oxidative stress response to selenium yeast in the non-smoking individuals: a short-term supplementation trial with respect to GPX1 and SEPP1 polymorphism.

PubMed

Jablonska, E; Raimondi, S; Gromadzinska, J; Reszka, E; Wieczorek, E; Krol, M B; Smok-Pieniazek, A; Nocun, M; Stepnik, M; Socha, K; Borawska, M H; Wasowicz, W

2016-12-01

Selenium, both essential and toxic element, is considered to protect against cancer, though human supplementation trials have generated many inconsistent data. Genetic background may partially explain a great variability of the studies related to selenium and human health. The aim of this study was to assess whether functional polymorphisms within two selenoprotein-encoding genes modify the response to selenium at the level of oxidative stress, DNA damage, and mRNA expression, especially in the individuals with a relatively low selenium status. The trial involved 95 non-smoking individuals, stratified according to GPX1 rs1050450 and SEPP1 rs3877899 genotypes, and supplemented with selenium yeast (200 µg) for 6 weeks. Blood was collected at four time points, including 4 weeks of washout. After genotype stratification, the effect of GPX1 rs1050450 on lower GPx1 activity responsiveness was confirmed; however, in terms of DNA damage, we failed to indicate that individuals homozygous for variant allele may especially benefit from the increased selenium intake. Surprisingly, considering gene and time interaction, GPX1 polymorphism was observed to modify the level of DNA strand breaks during washout, showing a significant increase in GPX1 wild-type homozygotes. Regardless of the genotype, selenium supplementation was associated with a selectively suppressed selenoprotein mRNA expression and inconsistent changes in oxidative stress response, indicating for overlapped, antioxidant, and prooxidant effects. Intriguingly, DNA damage was not influenced by supplementation, but it was significantly increased during washout. These results point to an unclear relationship between selenium, genotype, and DNA damage.

Glypican-4 gene polymorphism (rs1048369) and susceptibility to Epstein-Barr virus-associated and -negative gastric carcinoma.

PubMed

Zhao, Danrui; Liu, Shuzhen; Sun, Lingling; Zhao, Zhenzhen; Liu, Song; Kuang, Xiaojing; Shu, Jun; Luo, Bing

2016-07-15

Gastric cancer (GC) is one of the most common malignant tumors in China and single nucleotide polymorphisms (SNPs) have been found to be highly related to GC carcinogenesis. Glypican-4 (GPC4), a member of the heparan sulphate proteoglycan family, plays an important role in the regulation of cell growth and differentiation. However, little is known about polymorphisms of GPC4 gene and their associated susceptibility to GC, especially to Epstein-Barr virus-associated GC (EBVaGC). Here we studied the GPC4 polymorphism (rs1048369) in GC individuals, especially those with EBVaGC, and we explored an association between the GPC4 gene polymorphism (rs1048369) and susceptibility to EBVaGC and Epstein-Barr virus-negative GC (EBVnGC) in a population from Northern China. The GPC4 gene polymorphism (rs1048369) was detected in 54 cases of EBVaGC and 73 cases of EBVnGC using polymerase chain reaction (PCR). One hundred and seven peripheral blood samples from healthy individuals were also measured as a control group. There were significant differences in both the genotype and allelic frequency of GPC4 gene (rs1048369) between the EBVaGC and EBVnGC patients. Meanwhile, the distribution of genotype and allelic frequency of GPC4 (rs1048369) differed between EBVaGC and control groups. Distribution of the GPC4 genotype also revealed differences between EBVnGC and control groups, no significant differences in the allelic frequency of the GPC4 gene (rs1048369) were observed. The frequency of the T allele in EBVaGC group was significantly higher than that in control and EBVnGC groups. The GPC4 gene polymorphism and the allele of GPC4 are both associated with susceptibility to EBVaGC. The T allele of GPC4 may represent a risk factor for EBVaGC. Copyright © 2016 Elsevier B.V. All rights reserved.

Association between rs2981582 polymorphism in the FGFR2 gene and the risk of breast cancer in Mexican women

PubMed Central

Murillo-Zamora, Efrén; Moreno-Macías, Hortensia; Ziv, Elad; Romieu, Isabelle; Lazcano-Ponce, Eduardo; Ángeles-Llerenas, Angélica; Pérez-Rodríguez, Edelmiro; Vidal-Millán, Silvia; Fejerman, Laura; Torres-Mejía, Gabriela

2014-01-01

Background and Aims The rs2981582 single nucleotide polymorphism in the Fibroblast Growth Factor Receptor 2 gene has been consistently associated with an increased risk of breast cancer. We evaluated the effect of rs2981582 polymorphism in the FGFR2 gene on the risk of breast cancer and its interaction with non-genetic risk factors. Methods A population based case control study was conducted in Mexico. Data from 687 cases and 907 controls were analyzed. Results The T allele of the rs2981582 polymorphism was associated with an increased risk of breast cancer (OR per allele =1.24, 95% CI 1.06 – 1.46). There was also an interaction between this polymorphism and alcohol consumption (p = 0.043); the effect of alcohol consumption on the risk of breast cancer varied according to the allelic variants of the rs2981582 polymorphism in the FGFR2 gene: OR = 3.97 (95% CI 2.10 – 7.49), OR = 2.01 (95% CI 1.23 − 3.29) and OR = 1.21 (95% CI 0.48 − 3.05) for genotypes CC, CT and TT, respectively. Conclusions This is the first study exploring the association between rs2981582 polymorphism in the FGFR2 gene and breast cancer risk in Mexican women. The interaction found may be of great public health interest, since alcohol consumption is a modifiable breast cancer risk factor. Therefore, replication of this finding is of foremost importance. PMID:24054997

Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease

PubMed Central

Heidari, Mohammad Mehdi; Soheilyfar, Sorour

2016-01-01

Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013

Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis.

PubMed

Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N

2013-01-01

Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.

Brief Report: Glutamate Transporter Gene (SLC1A1) Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

PubMed Central

Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

2015-01-01

Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive–compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples. PMID:20155310

No association between TERT-CLPTM1L single nucleotide polymorphism rs401681 and mean telomere length or cancer risk.

PubMed

Pooley, Karen A; Tyrer, Jonathan; Shah, Mitul; Driver, Kristy E; Leyland, Jean; Brown, Judith; Audley, Tina; McGuffog, Lesley; Ponder, Bruce A J; Pharoah, Paul D P; Easton, Douglas F; Dunning, Alison M

2010-07-01

A recent study reported genetic variants in the TERT-CLPTM1L locus that were associated with mean telomere length, and with risk of multiple cancers. We evaluated the association between single nucleotide polymorphism (SNP) rs401681 (C > T) and mean telomere length, using quantitative real-time PCR, in blood-extracted DNA collected from 11,314 cancer-free participants from the Sisters in Breast Screening study, the Melanoma and Pigmented Lesions Evaluative Study melanoma family study, and the SEARCH Breast, Colorectal, Melanoma studies. We also examined the relationship between rs401618 genotype and susceptibility to breast cancer (6,800 cases and 6,608 controls), colorectal cancer (2,259 cases and 2,181 controls), and melanoma (787 cases and 999 controls). The "per T allele" change in mean telomere length (DeltaCt), adjusted for age, study plate, gender, and family was 0.001 [95% confidence intervals (CI), 0.01-0.02; P trend = 0.61]. The "per T allele" odds ratio for each cancer was 1.01 for breast cancer (95% CI, 0.96-1.06; P trend = 0.64), 1.02 for colorectal cancer (95% CI, 0.94-1.11; P trend = 0.66), and 0.99 for melanoma (95% CI, 0.84-1.15; P trend = 0.87). We found no evidence that this SNP was associated with mean telomere length, or with risk of breast cancer, colorectal cancer, or melanoma. Our results indicate that the observed associations between rs401681 and several cancer types might be weaker than previously described. The lack of an association in our study between this SNP and mean telomere length suggests that any association with cancer risk at this locus is not mediated through TERT.

The RTEL1 rs6010620 polymorphism and glioma risk: a meta-analysis based on 12 case-control studies.

PubMed

Du, Shu-Li; Geng, Ting-Ting; Feng, Tian; Chen, Cui-Ping; Jin, Tian-Bo; Chen, Chao

2014-01-01

The association between the RTEL1 rs6010620 single nucleotide polymorphism (SNP) and glioma risk has been extensively studied. However, the results remain inconclusive. To further examine this association, we performed a meta-analysis. A computerized search of the PubMed and Embase databases for publications regarding the RTEL1 rs6010620 polymorphism and glioma cancer risk was performed. Genotype data were analyzed in a meta-analysis. Odds ratios (ORs) with 95% confidence intervals (CIs) were estimated to assess the association. Sensitivity analyses, tests of heterogeneity, cumulative meta-analyses, and assessments of bias were performed in our meta-analysis. Our meta-analysis confirmed that risk with allele A is lower than with allele G for glioma. The A allele of rs6010620 in RTEL1 decreased the risk of developing glioma in the 12 case-control studies for all genetic models: the allele model (OR=0.752, 95%CI: 0.715-0.792), the dominant model (OR=0.729, 95%CI: 0.685-0.776), the recessive model (OR=0.647, 95%CI: 0.569-0.734), the homozygote comparison (OR=0.528, 95%CI: 0.456-0.612), and the heterozygote comparison (OR=0.761, 95%CI: 0.713-0.812). In all genetic models, the association between the RTEL1 rs6010620 polymorphism and glioma risk was significant. This meta-analysis suggests that the RTEL1 rs6010620 polymorphism may be a risk factor for glioma. Further functional studies evaluating this polymorphism and glioma risk are warranted.

Association between ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133), FTO (rs9939609) Genes Polymorphism and Type 2 Diabetes with Dyslipidemia.

PubMed

Raza, Syed Tasleem; Abbas, Shania; Siddiqi, Zeba; Mahdi, Farzana

2017-01-01

Diabetic dyslipidemia is one of the leading causes of coronary artery disease (CAD) death. Genetic and environmental factors play an important role in the development of type 2 diabetes mellitus (T2DM) and dyslipidemia. The present study was aimed to investigate the association of ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133) and FTO (rs9939609) genes polymorphism in T2DM with dyslipidemia. Totally, 559 subjects including 221 T2DM cases with dyslipidemia, 158 T2DM without dyslipidemia and 180 controls were enrolled. ACE genes polymorphism was evaluated by polymerase chain reaction (PCR), while MTHFR , FABP2 , FTO genes polymorphisms were evaluated by PCR and restriction fragment length polymorphism (RFLP). Significant association of ACE and MTHFR genes polymorphisms were found in both group of cases [T2DM with dyslipidemia (P<0.001, and P=0.008, respectively) and T2DM without dyslipidemia (P=0.003, and P=0.010, respectively)] while FABP2 and FTO genes polymorphisms were significantly associated with T2DM without dyslipidemia (P=0.038, and P= 0.019, respectively). This study concludes that ACE , FABP2 , FTO and MTHFR genes are associated with T2DM. Additionally, it also seems that ACE and MTHFR genes might be further associated with the development of dyslipidemia in T2DM cases.

Evaluation of transcobalamin II rs1801198 and transcobalamin II receptor rs2336573 gene polymorphisms in recurrent spontaneous abortion.

PubMed

Hashemi, Mohammad; Mokhtari, Mojgan; Yazdani-Shahrbabaki, Vajiheh; Danesh, Hiva; Bizhani, Fatemeh; Taheri, Mohsen

2018-03-14

It has been proposed that transcobalamin 2 (TCN2) and the transcobalamin 2 receptor (TCN2R) are associated with idiopathic recurrent spontaneous abortion (RSA). The aim of the present study was to investigate the impact of TCN2 rs1801198 and TCN2R rs2336573 polymorphism on RSA in a sample of Iranian population. This case-control study was done on 92 RSA patients and 93 normal, fertile women. Genotyping of the TCN2 rs1801198 and TCN2R rs2336573 variants was done by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP). The findings showed no significant association between the TCN2 rs1801198 and TCN2R rs2336573 polymorphisms and the risk/protection of RSA. Our results did not support an association between the TCN2 polymorphism and the risk of RSA in a sample of southeast Iranian population. Larger studies with different ethnicities are needed to evaluate the possible impact of TCN2 and TCN2R polymorphisms on the pathogenesis of RSA. Impact statement What is already known on this subject? Recurrent spontaneous abortion (RSA), a multifactorial condition, is one of the most common complications of pregnancy. It has been proposed that genetic polymorphisms play a role in the pathogenesis of RSA. Few studies have examined the association between TNC2 and TCN2R polymorphisms and the RSA risk and the findings were inconsistent. The aim of the current study was to determine the possible association between the TCN2 rs1801198 and TCN2R rs2336573 polymorphisms and the RSA in a sample of the southeast Iranian population. What do the results of the study add? The findings of the present case-control study did not support an association between the TCN2 rs1801198 and TCN2R rs2336573 polymorphisms and the risk of RSA in a sample of the Iranian population. What are the implications of these findings for clinical practice and future research? The findings of this study may provide a basis for future studies with larger sample sizes and different ethnicities

Single nucleotide polymorphism rs3774261 in the AdipoQ gene is associated with the risk of coronary heart disease (CHD) in Northeast Han Chinese population: a case-control study.

PubMed

Kanu, Joseph Sam; Gu, Yulu; Zhi, Sun; Yu, Mingxi; Lu, Yuping; Cong, Yetong; Liu, Yunkai; Li, Yong; Yu, Yaqin; Cheng, Yi; Liu, Yawen

2016-01-12

Coronary Heart Disease (CHD) is one of the leading causes of death in the world with a projected global 82 million DALYs by 2020. Genetic and environmental factors contribute to CHD development. Here, the authors investigate the association between CHD risk and three Single Nucleotide Polymorphisms (SNPs) in the AdipoQ gene (rs3774261, rs1063537 and rs2082940); and the interaction of this association with environmental factors, in Northeast Han Chinese population. Using a case-control study design, 1514 participants (754 cases and 760 controls) were investigated. Three variants in the AdipoQ gene (rs3774261, rs1063537 and rs2082940) were selected and genotyped. The online SNPstats program and SPSS 21.0 software were used for data analyses. The authors found that the rs3774261G allele is associated with the risk of CHD but that the rs2082940T allele protects against CHD. No significant association was found between rs1063537 and CHD risk. The study also found significant interactions between triglyceride levels and the SNPs studied (P < 0.0001 for rs3774261, P = 0.014 for rs1063537, and P = 0.031 for rs2082940). Variations in AdipoQ gene can protect against CHD (as with rs2082940T) or associated with CHD risk (as with rs3774261G) in Northeast Han Chinese - findings that will help shed light on the reported conflicting roles of AdipoQ in cardiovascular diseases. Serum triglycerides levels also interact in the AdipoQ - CHD association, thus further highlighting the roles environmental factors play in the genetic aspect of diseases.

The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.

PubMed

Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S

2014-01-01

Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.

Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

PubMed

Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

2010-05-01

Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

PubMed

Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

2017-04-01

Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

Association Between the Estrogen Receptor Beta (ESR2) Rs1256120 Single Nucleotide Polymorphism and Adolescent Idiopathic Scoliosis: A Systematic Review and Meta-Analysis.

PubMed

Zhao, Linlu; Roffey, Darren M; Chen, Suzan

2017-06-01

A systematic review and meta-analysis. The aim of this study was to assess and synthesize the current evidence on the association between the rs1256120 single nucleotide polymorphism (SNP) of the estrogen receptor beta gene (ESR2) and adolescent idiopathic scoliosis (AIS). Hormonal disturbance has been postulated as a potential etiological factor in the development of AIS. As estrogen receptors are important mediators of estrogen response, mutations in these genes, including rs1256120 of ESR2, have been chosen as susceptibility candidates for AIS predisposition. The association of rs1256120 with AIS has been investigated in several recent studies, but showed conflicting evidence. We conducted a systematic review to evaluate the strength of this body of evidence and quantitative synthesis to examine sources of heterogeneity. This study conformed to PRISMA guidelines. Using a sensitive search strategy, PubMed (MEDLINE), EMBASE, and HuGE Literature Finder databases were searched to identify relevant studies for inclusion in the systematic review and meta-analysis. Risk of bias was assessed using a modified Newcastle-Ottawa Scale. The inverse variance model was used to calculate summary odds ratios (ORs) and corresponding 95% confidence intervals (CIs) for the allelic (C vs. T) and genotypic comparisons. Planned subgroup and sensitivity analyses were performed. Three studies were included for systematic review and meta-analysis (n = 1264 AIS cases and n=1020 controls). A null relationship was found between rs1256120 and AIS (allelic OR = 1.20, 95% CI: 0.81-1.78, P = 0.36, I = 84.9%), with the first reported association likely to be false-positive and contributing substantially to heterogeneity. Findings from the systematic review and meta-analysis suggest that rs1256120 of ESR2 is unlikely to be a predisposing or disease-modifying genetic risk factor for AIS. 2.

PPIA rs6850: A > G single-nucleotide polymorphism is associated with raised plasma cyclophilin A levels in patients with coronary artery disease.

PubMed

Vinitha, A; Kutty, V Raman; Vivekanand, A; Reshmi, G; Divya, G; Sumi, S; Santosh, K R; Pratapachandran, N S; Ajit, Mullassari S; Kartha, C C; Ramachandran, Surya

2016-01-01

Plasma level of cyclophilin A is a promising marker of vascular disease in patients with type 2 diabetes. Genetic variants in the peptidylprolyl isomerase A gene, encoding human cyclophilin may alter protein synthesis thus affecting its activity, function, and circulating plasma levels. We examined the effect of single-nucleotide polymorphisms (SNPs) within the PPIA gene on plasma levels of cyclophilin A and coupled this with status of vascular disease in patients with and without type 2 diabetes in 212 South Indian subjects. The regulatory region of PPIA gene was sequenced for SNPs. The association of SNPs with known blood markers of type 2 diabetes and coronary artery disease such as HbA1c, low- and high-density lipoproteins, triglycerides, fasting and postprandial blood sugar levels, and cyclophilin A were probed. We identified three SNPs namely, rs6850: A > G; (AG/-) c.*227_*228delAG and (-/T) c.*318_*319insT. Welchs two-sample t test indicated an association of SNP rs6850: A > G, located at the 5' UTR region with increased plasma levels of cyclophilin A in patients with coronary artery disease and with coronary artery disease associated with diabetes. The presence of rs6850: A > G variant was significantly associated with coronary artery disease irrespective of whether the patients had diabetes or not. In silico analysis of the sequence using different tools and matrix libraries did not predict any significant differential binding sites for rs6850: A > G, c.*227_*228delAG and c.*318_*319insT. Our results indicate that the SNP rs6850: A > G is associated with increased risk for elevated plasma levels of cyclophilin A and coronary artery disease in patients with and without type 2 diabetes.

Association of ITPA polymorphisms rs6051702/rs1127354 instead of rs7270101/rs1127354 as predictor of ribavirin-associated anemia in chronic hepatitis C treated patients.

PubMed

D'Avolio, Antonio; De Nicolò, Amedeo; Cusato, Jessica; Ciancio, Alessia; Boglione, Lucio; Strona, Silvia; Cariti, Giuseppe; Troshina, Giulia; Caviglia, Gian Paolo; Smedile, Antonina; Rizzetto, Mario; Di Perri, Giovanni

2013-10-01

Functional variants rs7270101 and rs1127354 of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of no functional rs6051702 polymorphism. Since a simultaneous evaluation of the three ITPA SNPs for hemolytic anemia has not yet been investigated, we aimed to understand the contribution of each SNPs and its potential clinical use to predict anemia in HCV treated patients. A retrospective analysis included 379 HCV treated patients. The ITPA variants rs6051702, rs7270101 and rs1127354 were genotyped and tested for association with achieving anemia at week 4. We also investigated, using multivariate logistic regression, the impact of each single and paired associated polymorphism on anemia onset. All SNPs were associated with Hb decrease. The carrier of at least one variant allele in the functional ITPA SNPs was associated with a lower decrement of Hb, as compared to patients without a variant allele. In multivariate logistic regression analyses the carrier of a variant allele in the rs6051702/rs1127354 association (OR=0.11, p=1.75×10(-5)) and Hb at baseline (OR=1.51, p=1.21×10(-4)) were independently associated with protection against clinically significant anemia at week 4. All ITPA polymorphisms considered were shown to be significantly associated with anemia onset. A multivariate regression model based on ITPA genetic polymorphisms was developed for predicting the risk of anemia. Considering the characterization of pre-therapy anemia predictors, rs6051702 SNP in association to rs1127354 is more informative in order to avoid this relevant adverse event. Copyright © 2013 Elsevier B.V. All rights reserved.

Association of CHRNA4 gene rs1044396 and rs1044397 polymorphisms with Parkinson's disease symptoms and smoking.

PubMed

Zhang, L M; Zhang, X P; Chen, Y Q; Ye, W

2015-05-12

We assessed the CHRNA4 exon 5 rs1044396 and rs1044397 polymorphisms and investigated their relationship with Parkinson's disease (PD) severity and several non-motor symptoms. Ninety-seven patients with primary PD and 108 controls were recruited, and their smoking history identified. Patients with PD were assessed using the unified PD rating scale (UPDRS), Hoehn & Yahr (H&Y) grade, Hamilton depression rating scale (HAMD), visual analogue 10-points scale (VAS), and the Pittsburgh sleep quality index (PSQI). Polymerase chain reaction amplification and direct sequencing was performed on genomic DNA to identify polymorphic variants. Statistical analysis demonstrated that there were no gender differences in rs1044396(C→T) and rs1044397(G→A) frequencies. More smokers were identified among carriers of rs1044396 CT/TT genotypes. We also found no differences between PD and control groups in frequencies of either polymorphism. However, in women, PD onset was latest in rs1044397 GA/AA (P = 0.015). rs1044396 CT/TT genotype carriers and rs1044397 GG genotype patients with PD had higher VAS scores. No differences were found on the course of PD, H&Y grade, or UPDRS-II or -III scores between various genotypes, nor were differences found on scores of HAMD, nocturia, or PSQI in PD patients. Our results suggested that the CHRNA4 rs1044396 CT/TT genotype is related to cigarette smoking, that the rs1044397 polymorphism may associate with PD age of onset in women, and that rs1044396 and rs1044397 may relate to pain in PD patients, but not to the course or severity of disease, or to depression or nocturnal or sleeping disorders.

Association between rs12045440 Polymorphism in the CAPZB Intron and Serum TSH Concentrations in Chinese Thyroid Tumor Patients

PubMed Central

Feng, Shouhao; Lin, Shengli; Zou, Jidong; Wang, Yulong; Ji, Qinghai; Lv, Zhenghua

2015-01-01

The aim of this study was to investigate the possible influence of different genotypes of the lead single nucleotide polymorphisms (SNPs) rs10917468 and rs12045440 in the CAPZB gene on the thyroid function in papillary thyroid carcinoma (PTC) and benign thyroid neoplasm (BN) patients. In the study, a significant association was detected between rs12045440 and serum TSH concentrations in thyroid tumor patients (p = 0.001). After the adjustment of relevant covariates, the difference between the mean serum TSH levels in different genotypes of rs12045440 was still significant in the BN group (p = 0.003) but was not significant in the PTC cases (p = 0.115). No significant association of rs10917468 with TSH levels was found. The SNP rs12045440 was associated with the serum TSH concentrations in Chinese thyroid tumor patients, especially in benign thyroid tumor cases. PMID:26273293

Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

PubMed

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

PubMed

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-11-20

BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

PubMed Central

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-01-01

Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

Association of rs1285933 single nucleotide polymorphism in CLEC5A gene with dengue severity and its functional effects.

PubMed

Xavier-Carvalho, Caroline; Cezar, Renata Duarte da Silva; Freire, Naishe Matos; Vasconcelos, Carla Maria Mola de; Solorzano, Victor Edgar Fiestas; de Toledo-Pinto, Thiago Gomes; Fialho, Luciana Gomes; do Carmo, Rodrigo Feliciano; Vasconcelos, Luydson Richardson Silva; Cordeiro, Marli Tenório; Baptista, Paulo; de Azeredo, Elzinandes Leal; da Cunha, Rivaldo Venâncio; de Souza, Luiz José; Pacheco, Antonio Guilherme; Kubelka, Claire Fernandes; Moura, Patrícia Muniz Mendes Freire de; Moraes, Milton Ozorio

2017-10-01

Outbreaks of the Zika, dengue, and chikungunya viruses, especially in the Americas, pose a global threat due to their rapid spread and difficulty controlling the vector. Extreme phenotypes are often observed, from asymptomatic to severe clinical manifestations, which are well-studied in dengue. Host variations are also important contributors to disease outcomes, and many case-control studies have associated single nucleotide polymorphisms (SNPs) with severe dengue. Here, we found that the TC genotype and T-carriers for SNP rs1285933 in the C-type lectin superfamily member 5 (CLEC5A) gene was associated with severe dengue in a Northern Brazilian population (OR=2.75 and p-value=0.01, OR=2.11 and p-value=0.04, respectively). We also tested the functional effect of the CLEC5A protein and found that it is upregulated on the surface of human monocytes after in vitro dengue infection. CLEC5A was correlated with viral load inside the monocytes (Spearman r=0.55, p=0.008) and TNF production in culture supernatants (Spearman r=0.72, p=0.03). Analysis of mRNA in blood samples from DENV4-infected patients exhibiting mild symptoms showed that CLEC5A mRNA expression is correlated with TNF (r=0.67, p=0.0001) and other immune mediators. Monocytes from rs1285933 TT/TC individuals showed lower CLEC5A expression compared to CC genotypes. However, in these cells, CLEC5A was not correlated with TNF production. In summary, we confirmed that CLEC5A is genetically associated with dengue severity outcome, playing a central role during the immune response triggered by a dengue viral infection, and rs1285933 is a relevant SNP that is able to regulate signaling pathways after interactions between the dengue virus and CLEC5A receptors. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Polymorphisms in TRPV1 and TAS2Rs associate with sensations from sampled ethanol.

PubMed

Allen, Alissa L; McGeary, John E; Hayes, John E

2014-10-01

Genetic variation in chemosensory genes can explain variability in individual's perception of and preference for many foods and beverages. To gain insight into variable preference and intake of alcoholic beverages, we explored individual variability in the responses to sampled ethanol (EtOH). In humans, EtOH elicits sweet, bitter, and burning sensations. Here, we explore the relationship between variation in EtOH sensations and polymorphisms in genes encoding bitter taste receptors (TAS2Rs) and a polymodal nociceptor (TRPV1). Caucasian participants (n = 93) were genotyped for 16 single nucleotide polymorphisms (SNPs) in TRPV1, 3 SNPs in TAS2R38, and 1 SNP in TAS2R13. Participants rated sampled EtOH on a generalized Labeled Magnitude Scale. Two stimuli were presented: a 16% EtOH whole-mouth sip-and-spit solution with a single time-point rating of overall intensity and a cotton swab saturated with 50% EtOH on the circumvallate papillae (CV) with ratings of multiple qualities over 3 minutes. Area-under-the-curve (AUC) was calculated for the time-intensity data. The EtOH whole-mouth solution had overall intensity ratings near "very strong." Burning/stinging had the highest mean AUC values, followed by bitterness and sweetness. Whole-mouth intensity ratings were significantly associated with burning/stinging and bitterness AUC values on the CV. Three TRPV1 SNPs (rs224547, rs4780521, rs161364) were associated with EtOH sensations on the CV, with 2 (rs224547 and rs4780521) exhibiting strong linkage disequilibrium. Additionally, the TAS2R38 SNPs rs713598, rs1726866, and rs10246939 formed a haplotype, and were associated with bitterness on the CV. Last, overall intensity for whole-mouth EtOH associated with the TAS2R13 SNP rs1015443. These data suggest genetic variation in TRPV1 and TAS2Rs influence sensations from sampled EtOH and may potentially influence how individuals initially respond to alcoholic beverages. Copyright © 2014 by the Research Society on Alcoholism.

The rs2516839 Polymorphism of the USF1 Gene May Modulate Serum Triglyceride Levels in Response to Cigarette Smoking

PubMed Central

Niemiec, Pawel; Nowak, Tomasz; Iwanicki, Tomasz; Gorczynska-Kosiorz, Sylwia; Balcerzyk, Anna; Krauze, Jolanta; Grzeszczak, Wladyslaw; Wiecha, Maria; Zak, Iwona

2015-01-01

Single nucleotide polymorphisms (SNPs) of the USF1 gene (upstream stimulatory factor 1) influence plasma lipid levels. This study aims to determine whether USF1 SNPs interact with traditional risk factors of atherosclerosis to increase coronary artery disease (CAD) risk. In the present study serum lipid levels and USF1 gene polymorphisms (rs2516839 and rs3737787) were determined in 470 subjects: 235 patients with premature CAD and 235 controls. A trend of increasing triglycerides (TG) levels in relation to the C allele dose of rs2516839 SNP was observed. The synergistic effect of cigarette smoking and C allele carrier state on CAD risk was also found (SIM = 2.69, p = 0.015). TG levels differentiated significantly particular genotypes in smokers (1.53 mmol/L for TT, 1.80 mmol/L for CT and 2.27 mmol/L for CC subjects). In contrast, these differences were not observed in the non-smokers subgroup (1.57 mmol/L for TT, 1.46 mmol/L for CT and 1.49 mmol/L for CC subjects). In conclusion, the rs2516839 polymorphism may modulate serum triglyceride levels in response to cigarette smoking. Carriers of the C allele seem to be particularly at risk of CAD, when exposed to cigarette smoking. PMID:26068452

Compositions and methods for detecting single nucleotide polymorphisms

DOEpatents

Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

2016-11-22

Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

PubMed

Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

2014-02-01

Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

PubMed

Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

2017-09-01

It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.

Association between vitamin D concentration and levels of sex hormones in an elderly Polish population with different genotypes of VDR polymorphisms (rs10735810, rs1544410, rs7975232, rs731236).

PubMed

Laczmanski, Lukasz; Lwow, Felicja; Mossakowska, Malgorzata; Puzianowska-Kuznicka, Monika; Szwed, Małgorzata; Kolackov, Katarzyna; Krzyzanowska-Swiniarska, Barbara; Bar-Andziak, Ewa; Chudek, Jerzy; Sloka, Natalia; Milewicz, Andrzej

2015-03-15

Vitamin D co-regulates the synthesis of sex hormones in part by interaction with its nuclear receptor. The aim of this study was to determine whether there is an association of vitamin D concentration vs the level of sex hormones in elderly Polish individuals with different genotypes of the vitamin D receptor (VDR) gene. Rs10735810, rs1544410, rs7975232, and rs731236 polymorphisms of VDR, the serum sex hormone level, free estrogen index (FEI) and free androgen index (FAI) as well as vitamin D, were evaluated in 766 persons (362 women and 404 men) selected from 5695 Polish population, aged 65-90years from the PolSenior survey. We observed that women with GG (rs731236), TT (rs7975232), BB (rs1544410) and FF (rs10735810) genotypes were characterized by a significant correlation between vitamin D vs testosterone concentration and FAI value. We found a significant correlation between testosterone level and FAI vs vitamin D concentration in men with heterozygote AG in the rs731236 polymorphism and in the GG (rs7975232), the BB (rs1544410), and the Ff (rs10735810) genotypes. In elderly selected Polish population with different genotypes of VDR polymorphisms, a statistically significant relationship between vitamin D concentration vs testosterone level was observed. Copyright © 2015 Elsevier B.V. All rights reserved.

Single Nucleotide Polymorphism in ATM Gene, Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study

PubMed Central

Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen

2014-01-01

Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391

Association of lipoprotein lipase polymorphism rs2197089 with serum lipid concentrations and LPL gene expression.

PubMed

Mo, Xingbo; Liu, Xuehui; Wang, Laiyuan; Lu, Xiangfeng; Chen, Shufeng; Li, Hongfan; Huang, Jianfeng; Chen, Jichun; Cao, Jie; Li, Jianxin; Tang, Yida; Gu, Dongfeng

2013-03-01

Many single-nucleotide polymorphisms (SNPs) have been reported to be associated with lipid concentrations in recent genome-wide association studies. The aim of this study was to validate the associations of rs2197089 in the lipoprotein lipase (LPL) gene with serum lipid concentrations and gene expression levels in the Chinese Han population and examine the potential interactions. A total of 9339 participants were recruited and genotyped for rs2197089. Gene expression levels of LPL in blood cells of 309 participants were evaluated by real-time PCR. We observed significant associations between rs2197089 and decreased triglycerides (TG) (P=0.0006), but not high-density lipoprotein cholesterol (HDL-C) concentration (P=0.0881). However, weak evidence of interaction between cigarette smoking and rs2197089 was detected (P=0.0362). In smokers, significant association between rs2197089 and increased HDL-C concentration was found (P=0.0068). Participants with the minor allele A had higher expression levels of LPL (P=0.0243). The results of our study indicated that rs2197089 was significantly associated with TG but it was associated with HDL-C only in smokers. This SNP seemed to have influence on the expression level of LPL.

Interleukin-18 (rs187238) and glucose transporter 4 (rs5435) polymorphisms in Euro-Brazilians with type 1 diabetes.

PubMed

Al-Lahham, Y; Mendes, A K B; Souza, E M; Alberton, D; Rego, F G M; Valdameri, G; Picheth, G

2017-09-21

Type 1 diabetes (T1D) is an autoimmune disease with a strong genetic component that has been associated with several genetic loci. Interleukin 18 (IL-18) is a potent proinflammatory cytokine, which is involved in the innate and adaptive immune responses, and in the pathogenesis of various diseases including T1D. Glucose transporter 4 (GLUT4) is known to be an insulin-responsive glucose transporter and has been associated with various diseases, including diabetes mellitus. We investigated the association of the polymorphisms rs187238 (IL-18) and rs5435 (GLUT4) in a case-control study in Euro-Brazilians with T1D (N = 136) and healthy subjects (N = 144). Real-time PCR with TaqMan ® fluorescent probes were applied for genotyping. All polymorphisms were in Hardy-Weinberg equilibrium. The minor allele frequencies for the G-allele (rs187238; IL-18) in healthy and T1D groups were 28.5% [95%CI = 23-34%] vs 31.6% [95%CI = 26-37%], P = 0.416, and for the T-allele (rs5435, GLUT4) were 33% [95%CI = 28-39] vs 27% [95%CI = 23-33%], P = 0.167, respectively. Genotype comparisons for both polymorphisms showed no significant differences (P > 0.05). The polymorphisms rs187238 and rs5435 were not associated with T1D in the studied population. The minor allele frequencies for both polymorphisms were similar to those of other Caucasian populations.

Colorectal cancer-susceptibility single-nucleotide polymorphisms in Korean population.

PubMed

Hong, Sung Noh; Park, Changho; Kim, Jong-Il; Kim, Duk-Hwan; Kim, Hee Cheol; Chang, Dong Kyung; Rhee, Poong-Lyul; Kim, Jae J; Rhee, Jong Chul; Son, Hee Jung; Kim, Young-Ho

2015-05-01

Considering the significant racial and ethnic diversity in genetic variation, it is unclear whether the genome-wide association studies-identified colorectal cancer (CRC)-susceptibility single-nucleotide polymorphisms (SNPs) discovered in European populations are also relevant to the Korean population. However, studies on CRC-susceptibility SNPs in Koreans are limited. To investigate the racial and ethnic diversity of CRC-susceptibility genetic variants, we genotyped for the established European CRC-susceptibility SNPs in 198 CRC cases and 329 controls in Korea. To identify novel genetic variants using genome-wide screening in Korea, Illumina HumanHap 370K/610K BeadChips were performed on 105 CRC patients, and candidate CRC-susceptibility SNPs were selected. Subsequently, genotyping for replication was done in 189 CRC cases and 190 controls. Among the European CRC-susceptibility SNPs, rs4939827 in SMAD7 was associated with a significant decreased risk of Korean CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 0.67 [95% CI, 0.47-0.95]; dominant model, 0.59 [95% CI, 0.39-0.91]). rs4779584 and rs10795668 were associated with CRC risk in females and males, respectively. Among candidate CRC-susceptibility SNPs selected from genome-wide screening, novel SNP, rs17051076, was found to be associated with a significantly increased risk of microsatellite instability-high CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 4.25 [95% CI, 1.51-11.98]; dominant model, 3.52 [95% CI, 1.13-10.94]) in the replication study. rs4939827, rs4779584, and rs10795668 may contribute to the risk of CRC in the Korean population as well as in European populations. Novel rs17051076 could be associated with microsatellite instability-high CRC in Koreans. These associations support the ethnic diversity of CRC-susceptibility SNPs and should be taken into account in large-scale studies. © 2013 Journal of Gastroenterology and Hepatology

Cytokine single-nucleotide polymorphisms and risk of non-small-cell lung cancer.

PubMed

Pérez-Ramírez, Cristina; Alnatsha, Ahmed; Cañadas-Garre, Marisa; Villar, Eduardo; Valdivia-Bautista, Javier; Faus-Dáder, María J; Calleja-Hernández, Miguel Á

2017-12-01

Lung cancer, particularly the non-small-cell lung cancer (NSCLC) subtype, is the leading cause of cancer-related death worldwide. Several functional polymorphisms in inflammatory cytokine genes, such as IL1B, IL6, IL12A, IL13 and IL16, have been associated with the risk of NSCLC. The aim of this study was to evaluate the association between ILs gene polymorphisms and the risk of developing NSCLC. A retrospective case-control study was carried out, including 174 NSCLC cases and 298 controls of Spanish origin. IL1B (rs1143634), IL1B (rs12621220), IL1B (rs1143623), IL1B (rs16944), IL1B (rs1143627), IL12A (rs662959), IL13 (rs1881457), IL6 (rs1800795) and IL16 (rs7170924) gene polymorphisms were analysed by TaqMan. The genotypic logistic regression model adjusted by smoking status showed that the IL1B rs1143634-TT genotype was associated with a lower risk of NSCLC (P=0.04312; odds ratio=0.226; 95% confidence interval=0.044-0.840). No other gene polymorphisms showed an association with NSCLC in any of the models tested. In conclusion, IL1B rs1143634 was significantly associated with a higher risk of NSCLC. No influence of IL1B rs12621220, rs1143623, rs16944, rs1143627, IL12A rs662959, IL13 rs1881457 and IL16 rs7170924 on the risk of developing NSCLC was found in our study.

The ZC3HC1 rs11556924 polymorphism is associated with increased carotid intima-media thickness in patients with rheumatoid arthritis

PubMed Central

2013-01-01

Introduction Rheumatoid arthritis (RA) is a complex polygenic disease associated with chronic inflammation, accelerated atherosclerosis and increased cardiovascular (CV) mortality. A recent meta-analysis has described the ZC3HC1 rs11556924 polymorphism as one of the most important signals associated with coronary artery disease (CAD) in non-rheumatic Caucasian individuals. In this study we evaluated the potential association of this gene polymorphism with subclinical atherosclerosis assessed by the evaluation of carotid intima-media thickness (cIMT) in RA patients. Methods This study included 502 RA patients from Northern Spain. The ZC3HC1 rs11556924 polymorphism was genotyped with TaqMan single-nucleotide polymorphism (SNP) genotyping assays (C__31283062_10) in a 7900HT real-time polymerase chain reaction (PCR) system. cIMT was also assessed in these patients by carotid ultrasonography (US) technology. Results RA patients carrying the TT genotype had significantly higher cIMT values than those homozygous for the CC genotype (mean ± standard deviation (SD): 0.76 ± 0.18 mm and mean ± SD: 0.71 ± 0.16 mm respectively; P = 0.03) even after adjusting the results for sex, age at the time of US study, follow-up time and traditional CV risk factors (P = 0.04) evidencing that the effect conferred by ZC3HC1 rs11556924 polymorphism is independent of the traditional CV risk factors. Conclusion Our results indicate that ZC3HC1 rs11556924 polymorphism is associated with subclinical atherosclerosis in RA. PMID:24286297

Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

PubMed Central

Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

2013-01-01

Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

Meta-analysis of the rs2075650 polymorphism and risk of Alzheimer disease.

PubMed

He, Ya; Li, Chen; Yang, Ying; Li, Yizhou; Wang, Yuan; Yang, Hua; Jin, Tianbo; Chen, Songsheng

2016-10-01

Several researchers have suggested that the rs2075650 polymorphism is significantly associated with an increased risk of developing Alzheimer disease (AD) in European. However, some others found inconsistent results in Asian (Chinese and Korean). We addressed the controversy through performing a meta-analysis of the relationship between rs2075650 in TOMM40 (translocase of outer mitochondrial membrane 40 homologue) and Alzheimer disease. We selected eight case-control studies involving 4290 cases of Alzheimer disease and 5556 healthy individuals. The association between the TOMM40 rs2075650 polymorphism and Alzheimer disease was examined by overall odds ratio (OR) with a 95 % confidence interval (CI). We used different genetic model analysis, sensitivity analysis, and assessments of bias in our meta-analysis. The pooled analysis showed the inconsistent results that TOMM40 rs2075650 polymorphism was associated with Alzheimer disease in European and Korean population in all genetic models, but there was no significant association between the TOMM40 rs2075650 polymorphism and Alzheimer disease risk in Chinese population. We conclude that rs2075650 in TOMM40 gene may increase the risk of Alzheimer disease.

Association of the DBH Polymorphism rs3025343 With Smoking Cessation in a Large Population-Based Sample.

PubMed

Hirvonen, Katariina; Korhonen, Tellervo; Salomaa, Veikko; Männistö, Satu; Kaprio, Jaakko

2017-09-01

Genetic variations in DBH-gene and its surroundings have been shown to associate with smoking behavior including smoking cessation in several studies. In this study we replicate and measure the effect size for association between DBH polymorphism rs3025343 and smoking cessation in a large population-based sample while examining environmental factors that could relate to the association. We studied 11 926 adult subjects from four surveys of the National FINRISK Study. The analysis was restricted to either current or former smokers. Logistic and linear regression analyses were conducted to investigate the relationships of the single nucleotide polymorphism (SNP), covariates, smoking cessation, and smoking severity (cotinine, CPD). Gene-environment interactions were tested by likelihood-ratio test. The association between rs3025343 and smoking cessation (prevalence odds ratio, OR = 1.12, p = .094, 95%CI = 0.98-1.30) was replicated identically with the GWAS study of The Tobacco and Genetics Consortium (OR = 1.12, 95%CI = 1.08-1.18). None of our tested phenotypes significantly influenced the association between rs3025343 and smoking cessation. Overall, marital status, education, depression, alcohol use, self-rated health, and chronic obstructive pulmonary disease (COPD) showed phenotypic associations with smoking cessation, but the association of various phenotypes with smoking cessation did not vary by genotype. The current study replicates the effect size for the association between rs3025343 and smoking cessation despite lack of overall significance due to smaller sample size. We could not show environmental influences on the association of rs3025343 with smoking cessation. Our study replicates the direction and strength of the association of DBH polymorphism rs3025343 with smoking cessation. We could not detect environmental influences on the strength of the association of rs3025343 with smoking cessation, but the limited power of our analysis needs to be taken into

Interleukin 1B rs16944 G>A polymorphism was associated with a decreased risk of esophageal cancer in a Chinese population.

PubMed

Zheng, Liang; Yin, Jun; Wang, Liming; Wang, Xu; Shi, Yijun; Shao, Aizhong; Tang, Weifeng; Ding, Guowen; Liu, Chao; Chen, Suocheng; Gu, Haiyong

2013-10-01

Esophageal cancer is the sixth leading cause of cancer-associated deaths worldwide and represents a particularly aggressive type of cancer. Genetic polymorphisms may partly explain individual differences in esophageal cancer susceptibility. We conducted a hospital-based case-control study to evaluate the genetic effects of functional single nucleotide polymorphisms (SNPs) in the interleukin 1 (IL1A and IL1B), IL1f7, IL3 and IL7Ra genes on the development of esophageal cancer. A total of 380 esophageal squamous cell carcinoma (ESCC) cases and 380 controls were recruited for this study. The genotypes were determined using a custom-by-design 48-Plex SNPscan™ Kit. When the IL1B rs16944 GG homozygote genotype was used as the reference group, the GA genotype was associated with a significantly decreased risk of ESCC (GA vs. GG: adjusted OR=0.69, 95% CI=0.49-0.99, p=0.041). However, there were no significant associations between the other five SNPs and ESCC risk. Stratified analyses indicated no significantly different risks of ESCC associated with the IL1B rs16944 G>A polymorphism according to sex, age, smoking status or alcohol consumption. IL3 rs2073506 G>A polymorphism was associated with an increased risk for ESCC higher tumor, nodal, and metastatic (TNM) stages. These findings indicated that the functional IL1B rs16944 G>A polymorphism might contribute to ESCC susceptibility. IL3 rs2073506 G>A polymorphism was associated with an increased risk for ESCC higher TNM stages. However, the results were based on a limited sample size and larger well-designed studies are warranted to confirm these initial findings. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

CR1 rs3818361 Polymorphism Contributes to Alzheimer's Disease Susceptibility in Chinese Population.

PubMed

Li, Yongning; Song, Dongjing; Jiang, Yongshuai; Wang, Jingwei; Feng, Rennan; Zhang, Liangcai; Wang, Guangyu; Chen, Zugen; Wang, Renzhi; Jiang, Qinghua; Liu, Guiyou

2016-08-01

Recent genome-wide association studies (GWAS) reported CR1 rs3818361 polymorphism to be an Alzheimer's disease (AD) susceptibility variant in European ancestry. Three independent studies investigated this association in Chinese population. However, these studies reported weak or no significant association. Here, we reinvestigated the association using all the samples from three independent studies in Chinese population (N = 4047, 1244 AD cases and 2803 controls). We also selected three independent studies in European ancestry population (N = 11787, 3939 AD cases and 7848 controls) to evaluate the effect of rs3818361 polymorphism on AD risk in different ethnic backgrounds. In Chinese population, we did not identified significant heterogeneity using additive, recessive, and dominant genetic models. Meta-analysis showed significant association between rs3818361 and AD with P = 6.00E-03 and P = 5.00E-03. We further identified no heterogeneity of rs3818361 polymorphism between Chinese and European populations. We found that rs3818361 polymorphism contributed to AD with similar genetic risk in Chinese and European populations. In summary, this is the first study to show significant association between rs3818361 polymorphism and AD in Chinese population by a meta-analysis method. Our findings indicate that the effect of CR1 rs3818361 polymorphism on AD risk in Chinese cohorts is consistent with the increased risk observed in European AD cohorts.

Simultaneous Genotyping of the rs4762 and rs699 Polymorphisms in Angiotensinogen Gene and Correlation with Iranian CAD Patients with Novel Hexa-primer ARMS-PCR

PubMed Central

KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud

2017-01-01

Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324

C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.

PubMed

Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

2015-01-01

Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.

Polymorphisms FTO rs9939609, PPARG rs1801282 and ADIPOQ rs4632532 and rs182052 but not lifestyle are associated with obesity related-traits in Mexican children.

PubMed

Muñoz-Yáñez, C; Pérez-Morales, R; Moreno-Macías, H; Calleros-Rincón, E; Ballesteros, G; González, R A; Espinosa, J

2016-01-01

Concerning the genetic factors of obesity, no consistent association between populations has been reported, which may be due to the frequency of polymorphisms, the lifestyle of studied populations and its interaction with other factors. We studied a possible association of polymorphisms FTO rs9939609, PPARG rs1801282, and ADIPOQ rs4632532 and rs182052 with obesity phenotypes in 215 Mexican children. Glucose, triglycerides, cholesterol, HDL and LDL were measured. In addition, weight, height, waist circumference and triceps skin thickness were recorded. High-energy diets and sedentary behavior were evaluated with a validated questionnaire. In contrast with other reports, only FTO rs9939609 was associated with obesity related-traits, including BMI (p = 0.03), waist circumference (p = 0.02), triceps skinfold (p = 0.03) and waist/height ratio (p = 0.01), and also with cholesterol levels (p = 0.02) and LDL (p = 0.009). Lower levels of triglycerides (p=0.04) were related with presence of PPARG rs1801282, while ADIPOQ rs4632532 showed an effect on HDL (p = 0.03) levels. On the other hand, diet, physical activity and screen time were not related with obesity. In summary, only FTO rs9939609 was associated with obesity related-traits, while PPARG2 rs1801282 and ADIPOQ rs4632532 were involved in lipid metabolism.

Polymorphisms FTO rs9939609, PPARG rs1801282 and ADIPOQ rs4632532 and rs182052 but not lifestyle are associated with obesity related-traits in Mexican children

PubMed Central

Muñoz-Yáñez, C; Pérez-Morales, R; Moreno-Macías, H; Calleros-Rincón, E; Ballesteros, G; González, R. A; Espinosa, J

2016-01-01

Abstract Concerning the genetic factors of obesity, no consistent association between populations has been reported, which may be due to the frequency of polymorphisms, the lifestyle of studied populations and its interaction with other factors. We studied a possible association of polymorphisms FTO rs9939609, PPARG rs1801282, and ADIPOQ rs4632532 and rs182052 with obesity phenotypes in 215 Mexican children. Glucose, triglycerides, cholesterol, HDL and LDL were measured. In addition, weight, height, waist circumference and triceps skin thickness were recorded. High-energy diets and sedentary behavior were evaluated with a validated questionnaire. In contrast with other reports, only FTO rs9939609 was associated with obesity related-traits, including BMI (p = 0.03), waist circumference (p = 0.02), triceps skinfold (p = 0.03) and waist/height ratio (p = 0.01), and also with cholesterol levels (p = 0.02) and LDL (p = 0.009). Lower levels of triglycerides (p=0.04) were related with presence of PPARG rs1801282, while ADIPOQ rs4632532 showed an effect on HDL (p = 0.03) levels. On the other hand, diet, physical activity and screen time were not related with obesity. In summary, only FTO rs9939609 was associated with obesity related-traits, while PPARG2 rs1801282 and ADIPOQ rs4632532 were involved in lipid metabolism. PMID:27560839

Lack of association between rheumatoid arthritis and genetic variants rs10889677, rs11209026 and rs2201841 of IL-23R gene.

PubMed

Paradowska-Gorycka, Agnieszka; Malinowski, Damian; Haladyj, Ewa; Olesinska, Marzena; Safranow, Krzysztof; Pawlik, Andrzej

2018-01-19

Rheumatoid arthritis (RA) is an autoimmune diseases, where different genetic variants in cytokine genes may play a pathogenic role. A GWAS in autoimmune diseases highlighted the IL-23R gene as a one of the susceptibility factors. We examined three candidate single nucleotide polymorphisms (SNPs) rs10889677, rs11209026 and rs2201841 of the IL-23R gene, as well as determined their possible association with RA in a Polish population. The IL-23R gene polymorphisms were genotyped for 422 RA patients and 348 healthy individuals using TaqMan SNP genotyping assay. The genotypes frequency did not deviate from HWE in each examined group. A comparison of the allele as well as genotype frequencies of the IL-23R polymorphisms under codominant, dominant and recessive genetic model revealed no significant differences between RA patients and healthy subjects. We also demonstrated that IL-23R rs2201841 and rs11209026 as well as rs11209026 and rs10889677 were in complete linkage disequilibrium (D'=1.0). Our genotype-phenotype analysis demonstrated that in carriers of rs10889677C and/or rs2201841A allele the RF, extra-articular manifestations and erosion were more frequent present than in patients with rs10889677A and/or rs2201841A allele, although this association was not significant. Present findings indicated that the autoimmune disease-associated genetic variants in IL-23R gene are not associated with RA in the Polish population. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Effect of functionally significant deiodinase single nucleotide polymorphisms on drinking behavior in alcohol dependence: an exploratory investigation

PubMed Central

Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L

2016-01-01

Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529

Associations of polymorphisms in the cytokine genes IL1β (rs16944), IL6 (rs1800795), IL12b (rs3212227) and growth factor VEGFA (rs2010963) with anthracosilicosis in coal miners in Russia and related genotoxic effects.

PubMed

Volobaev, Valentin P; Larionov, Aleksey V; Kalyuzhnaya, Ekaterina E; Serdyukova, Ekaterina S; Yakovleva, Svetlana; Druzhinin, Vladimir G; Babich, Olga O; Hill, Elena G; Semenihin, Victor A; Panev, Nikolay I; Minina, Varvara I; Sivanesan, Saravana Devi; Naoghare, Pravin; da Silva, Juliana; Barcelos, Gustavo R M; Prosekov, Alexander Y

2018-04-13

Anthracosilicosis (AS), a prevalent form of pneumoconiosis among coal miners, results from the accumulation of carbon and silica in the lungs from inhaled coal dust. This study investigated genotoxic effects and certain cytokine genes polymorphic variants in Russian coal miners with АS. Peripheral leukocytes were sampled from 129 patients with AS confirmed by X-ray and tissue biopsy and from 164 asymptomatic coal miners. Four single-nucleotide polymorphisms were genotyped in the extracted DNA samples: IL1β T-511C (rs16944), IL6 C-174G (rs1800795), IL12b A1188C (rs3212227) and VEGFA C634G (rs2010963). Genotoxic effects were assessed by the analysis of chromosome aberrations in cultured peripheral lymphocytes. The mean frequency of chromatid-type aberrations and chromosome-type aberrations, namely, chromatid-type breaks and dicentric chromosomes, was found to be higher in AS patients [3.70 (95% confidence interval {CI}, 3.29-4.10) and 0.28 (95% CI, 0.17-0.38)] compared to the control group [2.41 (95% CI, 2.00-2.82) and 0.09 (95% CI, 0.03-0.15)], respectively. IL1β gene T/T genotype (rs16944) was associated with AS [17.83% in AS patients against 4.35% in healthy donors, odds ratio = 4.77 (1.88-12.15), P < 0.01]. A significant increase in the level of certain chromosome interchanges among AS donors is of interest because such effects are typical for radiation damage and caused by acute oxidative stress. IL1β T allele probably may be considered as an AS susceptibility factor among coal miners.

Thr105Ile (rs11558538) polymorphism in the histamine-1-methyl-transferase (HNMT) gene and risk for restless legs syndrome.

PubMed

Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A G

2017-03-01

A recent meta-analysis suggests an association between the rs11558538 single nucleotide polymorphism in the histamine-N-methyl-transferase (HNMT) gene and the risk for Parkinson's disease. Based on the possible relationship between PD and restless legs syndrome (RLS), we tried to establish whether rs11558538 SNP is associated with the risk for RLS. We studied the genotype and allelic variant frequencies of HNMT rs11558538 SNP 205 RLS patients and 410 healthy controls using a TaqMan assay. The frequencies of the HNMT rs11558538 genotypes allelic variants were similar between RLS patients and controls, and were not influenced by gender, family history of RLS, or RLS severity. RLS patients carrying the genotype rs11558538TT had an earlier age at onset, but this finding was based on three subjects only. These results suggest a lack of major association between HNMT rs11558538 SNP and the risk for RLS.

Association of TNF-α rs1799964 and IL-1β rs16944 polymorphisms with multiple system atrophy in Chinese Han population.

PubMed

Zhou, Xin; Wang, Chunrong; Chen, Zhao; Peng, Yun; Peng, Huirong; Hou, Xuan; Ye, Wei; Qiu, Rong; Xia, Kun; Tang, Beisha; Jiang, Hong

2018-01-07

Recent evidence suggested that several single nucleotide polymorphisms (SNPs) of inflammation-related genes (TNF-α rs1799964, IL-1α rs1800587, IL-1β rs16944, IL-8 rs4073, ICAM-1 rs5498) were associated with multiple system atrophy (MSA). Herein, we conducted this case-control study to evaluate the possible correlation between the five SNPs related to inflammation and MSA in Chinese Han population. We recruited 154 sporadic patients with MSA and 223 health controls in this study. All subjects were genotyped for the five SNPs using polymerase chain reaction amplification and Sanger sequencing. TNF-α rs1799964, genotype distribution and minor allele frequency (MAF) showed significant differences between patients and controls, which might illustrate the minor allele C may increase the risk for MSA (genotype, P = 0.006, OR = 1.245, 95% CI = [1.066-1.455]; allele, P = 0.001, OR = 1.887, 95% CI = [1.303-2.733]). For rs16944, patients carrying AA genotype showed a nearly 5-year early age at onset (AAO) than GG genotype (50.52 ± 7.45 years vs. 54.90 ± 7.21 years, P = 0.037). No differences were found in genotype distribution and MAF of the five SNPs between patients with MSA with predominant cerebellar ataxia (MSA-C) and with predominant Parkinsonism (MSA-P). Our study suggests that rs1799964 of TNF-α may act as a risk factor for MSA and the IL-1β rs16944 might be a genetic factor that modifies the AAO in MSA. Moreover, the exact mechanism of neuroinflammatory response in MSA deserves further exploration.

LEP rs7799039, LEPR rs1137101, and ADIPOQ rs2241766 and 1501299 Polymorphisms Are Associated With Obesity and Chemotherapy Response in Mexican Women With Breast Cancer.

PubMed

Méndez-Hernández, Alejandra; Gallegos-Arreola, Martha Patricia; Moreno-Macías, Hortensia; Espinosa Fematt, Jorge; Pérez-Morales, Rebeca

2017-10-01

Obesity plays a major role in the pathogenesis of breast cancer. Leptin (LEP) and adiponectin (ADIPOQ) are important in the regulation of adipose tissue. The response to cancer treatment depends on the histological and molecular tumor type, clinical stage, and genetic variability that might promote carcinogenic development. The aim of this study was to investigate the association between overweight/obesity and polymorphisms in the LEP (rs7799039), LEP receptor (LEPR; rs1137101), and ADIPOQ genes (rs2241766, rs1501299) with the response to breast cancer treatment in Mexican women. A sample of 177 patients with primary breast cancer (stage I-III) and who received neoadjuvant therapy were included. Polymorphisms were genotyped and their serum LEP concentrations (n = 59) were quantified. The patients' median age was 53.1 years, the frequency of overweight and obesity was 57 and 84 patients, respectively, 117 were postmenopausal, and 64 of the patients did not respond to chemotherapy. An association of the LEP rs7799039, LEPR rs1137101, and ADIPOQ rs1501299 polymorphisms with overweight/obesity was found. The patients who did not respond to treatment were more frequently obese, at clinical stage III, had metastases, and high levels of glucose. Moreover, in samples that were positive for estrogen receptor, higher levels of LEP were found, and in wild type genotypes for LEP rs7799039 and LEPR rs1137101. There was a direct association between the polymorphisms in LEP rs7799039 and ADIPOQ rs1501299 with overweight/obesity, and these genotypes affected the response to chemotherapeutic treatment, suggesting that an obesogenic microenvironment is more favorable for tumoral progression. Copyright © 2017 Elsevier Inc. All rights reserved.

Impact of Maspin Polymorphism rs2289520 G/C and Its Interaction with Gene to Gene, Alcohol Consumption Increase Susceptibility to Oral Cancer Occurrence.

PubMed

Yang, Po-Yu; Miao, Nae-Fang; Lin, Chiao-Wen; Chou, Ying-Erh; Yang, Shun-Fa; Huang, Hui-Chuan; Chang, Hsiu-Ju; Tsai, Hsiu-Ting

2016-01-01

The purpose of this study was to identify gene polymorphisms of mammary serine protease inhibitor (Maspin) specific to patients with oral cancer susceptibility and clinicopathological status. Three single-nucleotide polymorphisms (SNPs) of the Maspin gene from 741 patients with oral cancer and 601 non-cancer controls were analyzed by real-time PCR. The participants with G/G homozygotes or with G/C heterozygotes of Maspin rs2289520 polymorphism had a 2.07-fold (p = 0.01) and a 2.01-fold (p = 0.02) risk of developing oral cancer compared to those with C/C homozygotes. Moreover, gene-gene interaction increased the risk of oral cancer susceptibility among subjects expose to oral cancer related risk factors, including areca, alcohol, and tobacco consumption. G allele of Maspin rs2289520 polymorphism may be a factor that increases the susceptibility to oral cancer. The interactions of gene to oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development.

Polymorphisms rs12998 and rs5780218 in KiSS1 suppressor metastasis gene in Mexican patients with breast cancer.

PubMed

Quevedo, Edhit Guadalupe Cruz; Aguilar, Gabriela Monserrat Mimendi; Aguilar, Luis Anselmo Juárez; Rubio, Susan Andrea Gutierrez; Martínez, Silvia Esperanza Flores; Rodríguez, Ingrid Patricia Dávalos; Corona, José Sánchez; Morán, Martha Isabel Torres; Gómez, Roberto Carlos Rosales; Moguel, María Cristina Morán

2015-01-01

KiSS1 is a metastasis suppressor gene associated with inhibition of cellular chemotaxis and invasion attenuating the metastasis in melanoma and breast cancer cell lines. Along the KiSS-1 gene at least 294 SNPs have been described; however the association of these polymorphisms as genetic markers for metastasis in breast cancer studies has not been investigated. Here we describe two simple PCR-RFLPs protocols to identify the rs5780218 (9DelT) and the rs12998 (E20K) KiSS1 polymorphisms and the allelic, genotypic, and haplotypic frequencies in Mexican general population (GP) and patients with benign breast disease (BBD) or breast cancer (BC). The rs5780218 polymorphism was individually associated with breast cancer (P = 0.0332) and the rs12998 polymorphism shows statistically significant differences when GP versus case (BC and BBD) groups were compared (P < 0.0001). The H1 Haplotype (G/-) occurred more frequently in BC group (0.4256) whereas H2 haplotype (G/T) was the most prevalent in BBD group (0.4674). Our data indicated that the rs5780218 polymorphism individually confers susceptibility for development of breast cancer in Mexican population and a possible role as a genetic marker in breast cancer metastasis for H1 haplotype (Wt/variant) in KiSS1 gene must be analyzed in other populations.

Association analysis of APOA5 rs662799 and rs3135506 polymorphisms with obesity in Moroccan patients.

PubMed

Lakbakbi El Yaagoubi, F; Charoute, H; Bakhchane, A; Ajjemami, M; Benrahma, H; Errouagui, A; Kandil, M; Rouba, H; Barakat, A

2015-12-01

The aim of the present study is to explore the association between the APOA5 polymorphisms and haplotypes with obesity in Moroccan patients. The study was performed in 459 subjects, Obese (n=164) and non-obese (n=295). All subjects were genotyped for the APOA5 -1131T>C (rs662799) and c.56C>G (rs3135506) polymorphisms. The contribution of APOA5 polymorphisms and haplotypes in the increased risk of obesity were explored using logistic regression analyses. The -1131T>C and c.56C>G polymorphisms were significantly associated with obesity. Both polymorphisms were strongly associated with increased BMI. Analysis of constructed haplotypes showed a significant association between CG haplotype and susceptibility to obesity (OR [95%CI]=3.09 [1.93-4.97]; P<0.001). These results support a potential role for APOA5 common variants and related haplotypes as risk factors for obesity. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

The NOD2 Single Nucleotide Polymorphism rs72796353 (IVS4+10 A>C) Is a Predictor for Perianal Fistulas in Patients with Crohn's Disease in the Absence of Other NOD2 Mutations.

PubMed

Schnitzler, Fabian; Friedrich, Matthias; Wolf, Christiane; Stallhofer, Johannes; Angelberger, Marianne; Diegelmann, Julia; Olszak, Torsten; Tillack, Cornelia; Beigel, Florian; Göke, Burkhard; Glas, Jürgen; Lohse, Peter; Brand, Stephan

2015-01-01

A previous study suggested an association of the single nucleotide polymorphism (SNP) rs72796353 (IVS4+10 A>C) in the NOD2 gene with susceptibility to Crohn's disease (CD). However, this finding has not been confirmed. Given that NOD2 variants still represent the most important predictors for CD susceptibility and phenotype, we evaluated the association of rs72796353 with inflammatory bowel disease (IBD) susceptibility and the IBD phenotype. Genomic DNA from 2256 Caucasians, including 1073 CD patients, 464 patients with ulcerative colitis (UC), and 719 healthy controls, was genotyped for the NOD2 SNP rs72796353 and the three main CD-associated NOD2 mutations rs2066844, rs2066845, and rs2066847. Subsequently, IBD association and genotype-phenotype analyses were conducted. In contrast to the strong associations of the NOD2 SNPs rs2066844 (p=3.51 x 10(-3)), rs2066845 (p=1.54 x 10(-2)), and rs2066847 (p=1.61 x 10(-20)) with CD susceptibility, no significant association of rs72796353 with CD or UC susceptibility was found. However, in CD patients without the three main CD-associated NOD2 mutations, rs72796353 was significantly associated with the development of perianal fistulas (p=2.78 x 10(-7), OR 5.27, [95% CI 2.75-10.12] vs. NOD2 wild-type carriers). Currently, this study represents the largest genotype-phenotype analysis of the impact of the NOD2 variant rs72796353 on the disease phenotype in IBD. Our data demonstrate that in CD patients the IVS4+10 A>C variant is strongly associated with the development of perianal fistulas. This association is particularly pronounced in patients who are not carriers of the three main CD-associated NOD2 mutations, suggesting rs72796353 as additional genetic marker for the CD disease behaviour.

Human Fetuin-A Rs4918 Polymorphism and its Association with Obesity in Healthy Persons and in Patients with Myocardial Infarction in Two Hungarian Cohorts.

PubMed

Temesszentandrási, György; Vörös, Krisztián; Márkus, Bernadett; Böröcz, Zoltán; Kaszás, Edit; Prohászka, Zoltán; Falus, András; Cseh, Károly; Kalabay, László

2016-08-04

BACKGROUND Human fetuin A (AHSG) has been associated with the development of obesity, insulin resistance, type 2 diabetes mellitus, and atherosclerosis. Observations on the role of AHSG rs4918 single-nucleotide polymorphism are contradictory. We investigated the association between variants of rs4918 and parameters of obesity, lipid status, tumor necrosis factor-α (TNFα), adipokines (adiponectin, resistin, leptin), and insulin resistance in healthy persons and in patients with previous myocardial infarction. MATERIAL AND METHODS This was a cross-sectional study comprising cohort 1 (81 healthy individuals) and cohort 2 (157 patients with previous myocardial infarction). We used the allele-specific KASP genotyping assay to detect rs4918 polymorphism. RESULTS In cohort 1, G-nucleotide carriers had significantly lower serum TNFα, adiponectin, and higher leptin concentrations than in non-G carriers. These differences, however, were not observed in cohort 2. In cohort 2, G-carriers had lower BMI and waist circumferences than in non-G carriers. The G allele was more frequent among lean than obese patients (RR=1.067, 95%CI=1.053-2.651, p=0.015). An association between BMI and rs4918 polymorphism was observed among patients without diabetes (CC/CG/GG genotypes: p=0.003, G vs. non-G allele: p=0.008) but not in diabetics. In addition, a strong linearity between BMI and the CC/CG/GG genotypes (association value: 4.416, p=0.036) and the frequency of the G allele (7.420, p=0.006) could be identified. In cohort 2, non-obese, non-diabetic G-carriers still had lower BMI and waist circumferences than in non-G carriers. CONCLUSIONS The rs4918 minor variant is associated with lower TNFα and adiponectin, higher leptin levels in healthy persons, and more favorable anthropomorphic parameters of obesity in cohort 2.

Human Fetuin-A Rs4918 Polymorphism and its Association with Obesity in Healthy Persons and in Patients with Myocardial Infarction in Two Hungarian Cohorts

PubMed Central

Temesszentandrási, György; Vörös, Krisztián; Márkus, Bernadett; Böröcz, Zoltán; Kaszás, Edit; Prohászka, Zoltán; Falus, András; Cseh, Károly; Kalabay, László

2016-01-01

Background Human fetuin A (AHSG) has been associated with the development of obesity, insulin resistance, type 2 diabetes mellitus, and atherosclerosis. Observations on the role of AHSG rs4918 single-nucleotide polymorphism are contradictory. We investigated the association between variants of rs4918 and parameters of obesity, lipid status, tumor necrosis factor-α (TNFα), adipokines (adiponectin, resistin, leptin), and insulin resistance in healthy persons and in patients with previous myocardial infarction. Material/Methods This was a cross-sectional study comprising cohort 1 (81 healthy individuals) and cohort 2 (157 patients with previous myocardial infarction). We used the allele-specific KASP genotyping assay to detect rs4918 polymorphism. Results In cohort 1, G-nucleotide carriers had significantly lower serum TNFα, adiponectin, and higher leptin concentrations than in non-G carriers. These differences, however, were not observed in cohort 2. In cohort 2, G-carriers had lower BMI and waist circumferences than in non-G carriers. The G allele was more frequent among lean than obese patients (RR=1.067, 95%CI=1.053–2.651, p=0.015). An association between BMI and rs4918 polymorphism was observed among patients without diabetes (CC/CG/GG genotypes: p=0.003, G vs. non-G allele: p=0.008) but not in diabetics. In addition, a strong linearity between BMI and the CC/CG/GG genotypes (association value: 4.416, p=0.036) and the frequency of the G allele (7.420, p=0.006) could be identified. In cohort 2, non-obese, non-diabetic G-carriers still had lower BMI and waist circumferences than in non-G carriers. Conclusions The rs4918 minor variant is associated with lower TNFα and adiponectin, higher leptin levels in healthy persons, and more favorable anthropomorphic parameters of obesity in cohort 2. PMID:27487851

Single-Nucleotide Polymorphisms of FAS and FASL Genes and Risk of Idiopathic Aplastic Anemia.

PubMed

Rehman, Sadia; Saba, Nusrat; Naz, Madiha; Ahmed, Parvez; Munir, Saeeda; Sajjad, Sumaira; Tabassum, Sobia; Naseem, Lubna

2018-04-03

FAS/FASL signaling system plays a vital role in the regulation of apoptosis, envisaged as a death process required for immune surveillance to prevent autoimmunity and tumorigenesis along with several other biological activities. Several single-nucleotide polymorphisms (SNPs) of FAS/FASL system can result in aberrant apoptosis, which can cause different cancers and autoimmune diseases. Aplastic anemia (AA) is an autoimmune dysfunction characterized by peripheral blood pancytopenia associated with hypoplasia of bone marrow. The aim of this study was to screen Pakistani AA patients and controls for two Fas SNPs rs2234767 and rs1800682 and two FASLG SNPs rs763110 and rs5030772. Genotyping of 392 DNA samples was done by Tetra-ARMS polymerase chain reaction. Genotypic frequencies of Fas rs1800682 and FASLG rs5030772 showed significance difference in their distribution in both controls and patients, while Fas rs2234767 and FASLG rs763110 SNPs had no such difference. Carriers of rs1800682 AG+GG had a very odd ratio of 4.63, with 95% confidence interval (CI) of 3.01-7.11, while individuals with FASLG rs5030772 AG+GG were more common in controls than patients with OR 0.53 and 95% CI of 0.34-0.83. Cumulative effects of these SNPs were analyzed, and they showed almost similar trends; however, Fas rs2234767 and FASLG rs763110 genotypes in combination with Fas rs1800682 and FASLG rs5030772 demonstrated significant association. This study provided information that endorsed the involvement of FAS/FASL system SNPs in the pathogenesis of AA; further studies should be designed to understand the exact role of SNPs that can help in early diagnosis and treatment.

Influence of TS (rs34743033) and RUNX1 (rs2014300) gene polymorphisms on survival outcomes of fluorouracil-based chemotherapy in Chinese advanced gastric cancer patients.

PubMed

Han, Rongbo; Wei, Jingsun; Zhang, Honghong; Su, Xinyu; Chu, Xia; Chen, Yuetong; Gong, Yang; Wang, Xiujuan; Shi, Junfeng; Chen, Jinfei

2018-01-01

This study aimed to explore the clinical correlation of single-nucleotide polymorphisms of thymidylate synthase (TS) and runt-related transcription factor 1 (RUNX1) in patients with postoperative stage II and III gastric cancer (GC). Samples were obtained from 661 patients with postoperative stage II and III GC. TS (rs34743033) and RUNX1 (rs2014300) were genotyped in 261 patients who received postoperative basic platinum and fluorouracil chemotherapy regimens and 400 patients who did not accept chemotherapy. TS (rs34743033) variant genotypes significantly prolonged the median overall survival (OS) time compared to the patients who only received adjuvant chemotherapy (HR 1.604, 95% CI 1.068-2.410, p =0.021). Moreover, 3R/3R variant genotypes were demonstrated to have a positive effect on the OS of patients who received chemotherapy based on cisplatin (HR 1.754, 95% CI 1.041-2.954, p =0.031) compared to oxaliplatin. A stratification analysis indicated that 2R/3R and 2R/2R variant genotypes were associated with inferior survival in GC patients with intestinal-type tumors, tumor less than 5 cm in size, and poorly differentiated tumors ( p <0.05). However, RUNX1 (rs2014300) AA genotypes markedly increased the risk of death in GC patients compared with the GG/GA genotypes ( p =0.007), but no significant difference was observed between chemotherapy based on platinum. The stratification analysis showed that the GA/AA genotype was significantly associated with inferior survival in well to moderately differentiated tumors (HR 2.001, 95% CI 1.082-3.703, p =0.023). These preliminary results indicated that the two polymorphisms had a significant effect on postoperative adjuvant chemotherapy. TS (rs34743033) and RUNX1 (rs2014300) may be used as biomarkers to predict prognosis and select chemotherapy regimens in GC patients.

Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

PubMed

Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

2013-01-01

Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

PubMed

Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-11-01

Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

PubMed Central

Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-01-01

Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

IL28B gene polymorphism rs12979860, but not rs8099917, contributes to the occurrence of chronic HCV infection in Uruguayan patients.

PubMed

Echeverría, Natalia; Chiodi, Daniela; López, Pablo; Sanchez Ciceron, Adriana; Angulo, Jenniffer; López-Lastra, Marcelo; Silvera, Paola; Canavesi, Adrian; Bianchi, Carla; Colistro, Valentina; Cristina, Juan; Hernandez, Nelia; Moreno, Pilar

2018-03-02

Host single-nucleotide polymorphisms (SNPs) near the interleukin 28B (IL28B) locus are associated with sustained virological response to antiviral therapy and with spontaneous Hepatitis C Virus (HCV) clearance. Prevalence of these SNPs varies depending on ethnicity. The impact of IL28B SNPs in HCV-infected patients is currently unknown in Uruguay. Therefore, the aim of this study was to evaluate and compare the distribution of polymorphisms in the IL28B gene (rs12979860 and rs8099917) among HCV-infected patients and healthy individuals in Uruguay and thus assess their possible association with the establishment of HCV infection. DNA was recovered from 92 non-infected individuals and 78 HCV-infected patients and SNPs were determined by RFLP and allelic discrimination by real-time PCR. The distribution of rs12979860 genotypes for the infected population was 29.5%-CC, 47.4%-CT and 23.1%-TT and for the control group 45.7%, 42.4% and 11.9%, respectively. Prevalence in both infected and uninfected individuals is similar to that reported in other countries with admixed populations. The distribution of rs8099917 genotypes for the infected population was 57.7%-TT, 27.2%-TG and 14.1%-GG and for the control group 60.9%, 33.7% and 5.4%, respectively. The comparison of rs12979860 genotype distribution between the two populations evidenced a higher prevalence of the favourable genotype (CC) in the uninfected control group (p < 0.05). Additionally, results generated using logistic regression analysis show that individuals carrying rs12979860-TT or CT genotypes have a higher likelihood of developing chronic hepatitis upon infection with HCV, when compared to CC carriers, considering rs8099917 genotype as constant. Patients with HCV infection have a statistically significant lower prevalence of the favourable rs12979860 genotype when compared to uninfected individuals; therefore we can establish that only IL28B rs12979860-CT and TT genotypes seem to contribute to the occurrence

C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population

PubMed Central

Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

2015-01-01

Introduction: Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. Objective: To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Methods: Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics®). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Results: Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Conclusions: Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies. PMID:26309343

Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

PubMed Central

Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John J; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M; Asmann, Yan W; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I; Bertrand, Kimberly A; Birmann, Brenda M; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M; Brennan, Paul; Brooks-Wilson, Angela R; Cerhan, James R; Chanock, Stephen J; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J; de Sanjose, Silvia; Di Lollo, Simonetta; Diver, W Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G; Glimelius, Bengt; Habermann, Thomas M; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R; Holly, Elizabeth A; Jackson, Rebecca D; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S; Klein, Robert J; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry J; Monnereau, Alain; Morton, Lindsay M; Nieters, Alexandra; North, Kari E; Novak, Anne J; Offit, Kenneth; Purdue, Mark P; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K; Skibola, Christine F; Slager, Susan L; Smith, Alex; Smith, Martyn T; Southey, Melissa C; Staines, Anthony; Teras, Lauren R; Thompson, Carrie A; Tilly, Hervé; Tinker, Lesley F; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

2017-01-01

Objective Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL. Methods GWAS data on European Caucasians from the International Lymphoma Epidemiology Consortium (InterLymph) provided a total of 3857 DLBCL cases and 7666 general-population controls. Data were pooled in a random-effects meta-analysis. Results Among the 28 SLE-related SNPs investigated, the two most convincingly associated with risk of DLBCL included the CD40 SLE risk allele rs4810485 on chromosome 20q13 (OR per risk allele=1.09, 95% CI 1.02 to 1.16, p=0.0134), and the HLA SLE risk allele rs1270942 on chromosome 6p21.33 (OR per risk allele=1.17, 95% CI 1.01 to 1.36, p=0.0362). Of additional possible interest were rs2205960 and rs12537284. The rs2205960 SNP, related to a cytokine of the tumour necrosis factor superfamily TNFSF4, was associated with an OR per risk allele of 1.07, 95% CI 1.00 to 1.16, p=0.0549. The OR for the rs12537284 (chromosome 7q32, IRF5 gene) risk allele was 1.08, 95% CI 0.99 to 1.18, p=0.0765. Conclusions These data suggest several plausible genetic links between DLBCL and SLE. PMID:29214033

Association study between single nucleotide polymorphisms in promoter region of AVPR1A and Korean autism spectrum disorders.

PubMed

Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae

2010-08-02

To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

PICALM gene rs3851179 polymorphism contributes to Alzheimer's disease in an Asian population.

PubMed

Liu, Guiyou; Zhang, Shuyan; Cai, Zhiyou; Ma, Guoda; Zhang, Liangcai; Jiang, Yongshuai; Feng, Rennan; Liao, Mingzhi; Chen, Zugen; Zhao, Bin; Li, Keshen

2013-06-01

PICALM gene rs3851179 polymorphism was reported to an Alzheimer's disease (AD) susceptibility locus in a Caucasian population. However, recent studies reported consistent and inconsistent results in an Asian population. Four studies indicated no association between rs3851179 and AD in a Chinese population and one study reported weak association in a Japanese population. We consider that the failure to replicate the significant association between rs3851179 and AD may be caused by at least two reasons. The first reason may be the genetic heterogeneity in AD among different populations, and the second may be the relatively small sample size compared with large-scale GWAS in Caucasian ancestry. In order to confirm this view, in this research, we first evaluated the genetic heterogeneity of rs3851179 polymorphism in Caucasian and Asian populations. We then investigated rs3851179 polymorphism in an Asian population by a pooled analysis method and a meta-analysis method. We did not observe significant genetic heterogeneity of rs3851179 in the Caucasian and Asian populations. Our results indicate that rs3851179 polymorphism is significantly associated with AD in the Asian population by both pooled analysis and meta-analysis methods. We believe that our findings will be very useful for future genetic studies in AD.

[Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].

PubMed

Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo

2012-06-01

To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.

Polymorphism of rs7688672 and rs10033237 in cGKII/PRKG2 and gout susceptibility of Han population in northern China.

PubMed

Guo, Min; Cheng, Zhifeng; Li, Changgui; Li, Shanshan; Li, Ming; Wang, Mingli; Xu, Jinmei; Tang, Yingying; Wang, Yujing; Qiu, Wenli; Liu, Xiaomin

2015-05-10

Gout is a genetic or acquired metabolic disease caused by increase of uric acid synthesis resulted from purine metabolic abnormalities. Whether cGMP-dependent protein kinase 2 (cGKII/PRKG2) is correlated with gout remains controversial. The objective of the present study was to investigate whether there is a correlation between polymorphism of cGKII/PRKG2 and gout susceptibility of Han population in northern China. Four hundred and five male patients with gout in the case group and 429 controls in the control group were collected from the Department of Endocrinology and Metabolic Disease, the Fourth Affiliated Hospital of Harbin Medical University. A case-control study method was used to study the correlation between cGKII/PRKG2 polymorphism rs7688672 and rs10033237 and gout susceptibility. The genotype frequencies of rs7688672 and rs10033237 polymorphisms of cGKII/PRKG2 in the case group and the control group both were in accordance with Hardy-Weinberg equilibrium. There were significant differences of rs10033237 in the allele frequencies and genotype distributions (P<0.05) between the two groups, while no association was found between rs7688672 and gout. Combined mutation sites AA(*) from rs7688672 and rs10033237 were negatively correlated with gout susceptibility, whereas haplotype GG(*) was positively correlated with gout susceptibility. In conclusion, patients with rs10033237 polymorphism of cGKII/PRKG2 gene are more likely to suffer from gout. With regard to haplotypes of rs10033237 and rs7688672, both AA(*) and GG(*) are related to gout. AA(*) is a gout susceptible gene, whereas GG(*) is a protective gene. Copyright © 2015 Elsevier B.V. All rights reserved.

An evidence-based approach to globally assess the covariate-dependent effect of the MTHFR single nucleotide polymorphism rs1801133 on blood homocysteine: a systematic review and meta-analysis.

PubMed

Jin, Huifeng; Cheng, Haojie; Chen, Wei; Sheng, Xiaoming; Levy, Mark A; Brown, Mark J; Tian, Junqiang

2018-05-01

The single nucleotide polymorphism of the gene 5,10-methylenetetrahydrofolate reductase (MTHFR) C677T (or rs1801133) is the most established genetic factor that increases plasma total homocysteine (tHcy) and consequently results in hyperhomocysteinemia. Yet, given the limited penetrance of this genetic variant, it is necessary to individually predict the risk of hyperhomocysteinemia for an rs1801133 carrier. We hypothesized that variability in this genetic risk is largely due to the presence of factors (covariates) that serve as effect modifiers, confounders, or both, such as folic acid (FA) intake, and aimed to assess this risk in the complex context of these covariates. We systematically extracted from published studies the data on tHcy, rs1801133, and any previously reported rs1801133 covariates. The resulting metadata set was first used to analyze the covariates' modifying effect by meta-regression and other statistical means. Subsequently, we controlled for this modifying effect by genotype-stratifying tHcy data and analyzed the variability in the risk resulting from the confounding of covariates. The data set contains data on 36 rs1801133 covariates that were collected from 114,799 participants and 256 qualified studies, among which 6 covariates (sex, age, race, FA intake, smoking, and alcohol consumption) are the most frequently informed and therefore included for statistical analysis. The effect of rs1801133 on tHcy exhibits significant variability that can be attributed to effect modification as well as confounding by these covariates. Via statistical modeling, we predicted the covariate-dependent risk of tHcy elevation and hyperhomocysteinemia in a systematic manner. We showed an evidence-based approach that globally assesses the covariate-dependent effect of rs1801133 on tHcy. The results should assist clinicians in interpreting the rs1801133 data from genetic testing for their patients. Such information is also important for the public, who increasingly

PIK3CA rs7640662 (C/G) single nucleotide polymorphism lacks association with breast cancer cases in Persians

PubMed Central

Mir, Atefeh; Sadegh, Mahdiyeh Harati; Ahmadinia, Zahra

2015-01-01

Phosphatidylinositol-3-kinase (PI3K) is a group of enzymes involved in cellular growth, proliferation, differentiation, cell motility, intracellular trafficking, and survival that play very important roles in developing breast cancer. PIK3CA is a gene that encodes α catalytic subunit of this enzyme. A common polymorphism of PIK3CA, rs7640662 (C/G), was analyzed, and its association to breast cancer cases was determined. In this study, DNA was extracted from peripheral blood samples of 278 women suffering from breast cancer and 128 healthy women. Tetra-primer amplification refractory mutation system polymerase chain reaction (T-ARMS-PCR) method was performed to genotype rs7640662. P values and ODD ratios were measured using SPSS. P value less than 0.05 and ODD ratios more than 1 were considered as significant. All ODD ratios were less than 1, and P values were more than 0.05 showing that rs7640662 (C/G) and breast cancer are not significantly associated. However, the genotypes observed in the Persian population, as an ancient population living in the Middle East, was significantly different from the genotypes reported by HapMap for Asian populations. As a conclusion, rs7640662 was not associated with the risk of breast cancer in a Persian population; however, it was observed that heterozygote (GC) is the most common genotypes in both case and control samples. PMID:25838920

Association of single nucleotide polymorphisms in CACNA 1A/CACNA 1C/CACNA 1H calcium channel genes with diabetic peripheral neuropathy in Chinese population.

PubMed

Sun, Lin; Ma, Jun; Mao, Qian; Yang, Yun-Long; Ma, Lin-Lin; Niu, Ling; Liu, Li-Feng

2018-06-29

The present study was conducted to explore the correlations between single nucleotide polymorphisms (SNPs) in the calcium channel CACNA 1A, CACNA 1C, and CACNA 1H genes and diabetic peripheral neuropathy (DPN) amongst the Chinese population. In total, 281 patients diagnosed with type 2 diabetes participated in the present study. These patients were divided into the case group, which was subdivided into the DPN (143 cases) and the non-DPN groups (138 cases). Subsequently, 180 healthy individuals that had undergone routine health examinations were also recruited and assigned to the control group. PCR-restriction fragment length polymorphism (PCR-RFLP) was used to detect the genotype and allele frequencies of CACNA 1A, CACNA 1C, and CACNA 1H genes; logistic regression analysis to investigate the association of gene polymorphisms with DNP. Gene-gene interactions were then detected by generalized multifactor dimensionality reduction (GMDR). The results revealed that CACNA 1A rs2248069 and rsl6030, CACNA 1C rs216008 and rs2239050, and CACNA 1H rs3794619, and rs7191246 SNPs were all associated with DPN, while rs2248069, rsl6030, rs2239050, and rs7191246 polymorphisms were attributed to the susceptibility to DPN. It was also observed that the optimal models were three-, four- and five-dimensional models with a prediction accuracy of 61.05% and the greatest consistency of cross-validation was 10/10. In summary, these findings demonstrated that the SNPs in the CACNA 1A, CACNA 1C, and CACNA 1H genes were involved in the pathophysiology of DPN. In addition, polymorphisms in the CACNA 1A, CACNA 1C, and CACNA 1H genes and their interactions also had effects on DPN. © 2018 The Author(s).

Elevated Levels of LDL-C are Associated With ApoE4 but Not With the rs688 Polymorphism in the LDLR Gene.

PubMed

Cahua-Pablo, Gabriel; Cruz, Miguel; Moral-Hernández, Oscar Del; Leyva-Vázquez, Marco A; Antúnez-Ortiz, Diana L; Cahua-Pablo, José A; Alarcón-Romero, Luz Del Carmen; Ortuño-Pineda, Carlos; Moreno-Godínez, Ma Elena; Hernández-Sotelo, Daniel; Flores-Alfaro, Eugenia

2016-07-01

Apolipoprotein E (ApoE) 4 isoform has been associated with elevated levels of cholesterol, low-density lipoprotein cholesterol (LDL-C), and triglycerides (TGs), meanwhile several polymorphisms in the LDL receptor (LDLR) gene have been associated with increased levels of total cholesterol and LDL-C. We studied 400 women from Southwest Mexico. Anthropometric features and biochemical profile were evaluated, and genotyping of single nucleotide polymorphisms rs429358 and rs7412 in the APOE gene and rs688 in the LDLR gene was determined by TaqMan assays. We found significant association between LDL-C (odds ratio [OR] = 3.3, 95% confidence interval [CI]: 1.9-5.7) and marginal association with TG (OR = 1.7, 95% CI: 1.0-2.9) of atherogenic risk in women carriers of the ApoE4 isoform compared to ApoE3. The TT genotype of rs688 in the LDLR gene was not found to be associated with elevated levels of total cholesterol or LDL-C. Our results show that carrier women of the ApoE4 isoform are more likely to have elevated levels of LDL-C and therefore increased risk of developing atherosclerosis. © The Author(s) 2015.

A Single Nucleotide Polymorphism in 3′-Untranslated Region Contributes to the Regulation of Toll-like Receptor 4 Translation*

PubMed Central

Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa

2012-01-01

We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708

Association of single nucleotide polymorphisms in pro-inflammatory cytokine and toll-like receptor genes with pediatric hematogenous osteomyelitis.

PubMed

Osman, A E; Mubasher, M; ElSheikh, N E; AlHarthi, H; AlZahrani, M S; Ahmed, N; ElGhazali, G; Bradley, B A; Fadil, A-S A

2016-05-23

Hematogenous osteomyelitis (HO) is a bone infection wherein bacteria penetrate to the bone through the blood stream. Several single nucleotide polymorphisms (SNPs) have been associated with susceptibility to infectious diseases. In this study, we investigated the contribution of SNPs in interleukin (IL)-1B1 (rs16944), IL1A (rs1800587), IL1B (rs1143634), toll-like receptor (TLR)-2 (rs3804099), TLR4 (rs4986790), TLR4 (rs4986791), IL1R (rs2234650), tumor necrosis factor (TNF)-α (rs1800629), TNF (rs361525), and IL1RN (rs315952) towards the development of HO in Saudi patients and compared to healthy controls. Fifty-two patients diagnosed with HO and 103 healthy individuals were genotyped. The frequencies of genotypes GG (rs16944) and AA (rs16944) were lower and higher in patients [odds ratio (OR) = 0.34, Pc = 0.05] and controls (OR = 1.33, Pc = 0.05), respectively, suggesting that SNPs at this locus could alter HO susceptibility. In addition, the patients and controls exhibited lower and higher frequencies of the alleles G (rs16944) (OR = 0.43, Pc = 0.007) and A (rs16944) (OR = 2.32, Pc = 0.007), respectively. The expression of alleles C (rs3804099) and T (rs3804099) were higher in patients (OR = 2.05, Pc = 0.04) and controls (OR = 0.49, Pc = 0.04), respectively. In conclusion, SNPs at rs16944 and rs3804099 were found to be associated with HO in the Saudi population.

Differential distribution and association of FTO rs9939609 gene polymorphism with obesity: A cross-sectional study among two tribal populations of India with East-Asian ancestry.

PubMed

Ningombam, Somorjit Singh; Chhungi, Varhlun; Newmei, Masan Kambo; Rajkumari, Sunanda; Devi, Naorem Kiranmala; Mondal, Prakash Ranjan; Saraswathy, Kallur Nava

2018-03-20

The fat mass and obesity associated (FTO) rs9939609 gene polymorphism is most widely studied in terms of obesity in various populations. Recently, the prevalence of obesity has been reported to be very high among the North-Eastern State of India. The major aim of the present study is to understand the extent of FTO rs9939609 gene polymorphism and its association with obesity among the two North-East Indian tribal populations with similar East Asian ancestry. Somatometric data and fasting blood sample were collected from 521 tribal individuals (258 Liangmai and 263 Mizo) of Manipur after obtaining written informed consent. Genotyping of FTO rs9939609 single nucleotide polymorphism (SNP) was done using restriction fragment length polymorphism method for PCR-amplified fragments. Both the presently studied populations were not following Hardy-Weinberg law. The prevalence of obesity and minor allele frequency of FTO rs9939609 polymorphism was found to be significantly higher among the Mizo tribe compared to that of Liangmai. The selected polymorphism was found to be significantly associated with obesity (BMI) only among the Liangmai tribe (Odds ratio-3.0; 95% CI-1.4, 6.4; p-0.003), after adjusting for age and occupation. Age-cohort wise distribution and absolute fitness analysis indicated the lower fitness of minor allele in the higher age group among the Liangmai tribe. To the best of the author's knowledge this is the first study, associating FTO rs9939609 gene polymorphism and obesity in the North-eastern Indian tribal populations with East-Asian ancestry. This study revealed the FTO rs9939609 polymorphism is observed to be associated with obesity only among the Liangmai tribe not among the Mizo tribe. The differential distribution and association observed in the two selected tribes, inhabited in a similar geographical region, could be attributed to differences in their migratory histories in terms of both route and time of settlement. Copyright © 2018 Elsevier B

Serum Oxytocin Levels and an Oxytocin Receptor Gene Polymorphism (rs2254298) Indicate Social Deficits in Children and Adolescents with Autism Spectrum Disorders

PubMed Central

Yang, Shuhan; Dong, Xiaopeng; Guo, Xuan; Han, Yu; Song, Hanbing; Gao, Lei; Dai, Wei; Su, Yuanyuan; Zhang, Xin

2017-01-01

The neuropeptide oxytocin (OT) and its receptor (OXTR) have been predicted to be involved in the regulation of social functioning in autism spectrum disorders (ASD). Objective of the study was to investigate serum OT levels and the OXTR rs2254298 polymorphism in Chinese Han children and adolescents with ASD as well as to identify their social deficits relevant to the oxytocinergic system. We tested serum OT levels using ELISA in 55 ASD subjects and 110 typically developing (TD) controls as well as genotyped the OXTR rs2254298 polymorphism using PCR-RFLP in 100 ASD subjects and 232 TD controls. Autistic symptoms were assessed by the Autism Behavior Checklist (ABC) and the Childhood Autism Rating Scale (CARS). There were no significant associations between OXTR rs2254298 polymorphism and ASD, serum OT levels and age, as well as serum OT levels and intelligent quotient (IQ) in both ASD and TD groups. However, ASD subjects exhibited elevated serum OT levels compared to TD controls and positive correlations between serum OT levels and “adaptation to change score” in the CARS and CARS total scores. Moreover, in the ASD group, significant relationships were revealed between the single-nucleotide polymorphism (SNP) rs2254298 and serum OT levels, the category “stereotypes and object use” in the ABC and the category “adaptation to change” in the CARS. These findings indicated that individuals with ASD may exhibit a dysregulation in OT on the basis of changes in OXTR gene expression as well as environmentally induced alterations of the oxytocinergic system to determine their social deficits. PMID:28484366

Association Between Vitamin D Receptor rs731236 (Taq1) Polymorphism and Risk for Restless Legs Syndrome in the Spanish Caucasian Population

PubMed Central

Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-De-La-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A.G.

2015-01-01

Abstract Several recent works suggest a possible role of vitamin D deficiency in the etiology or restless legs syndrome (RLS). We analyzed the possible relationship of 2 common single nucleotide polymorphisms (SNPs) in the vitamin D3 receptor (VDR) gene with the risk for RLS. We studied the genotype and allelic variant frequencies of VDR rs2228570 and VDR rs731236 SNPs in 205 RLS patients and 445 healthy controls using a TaqMan essay. The frequencies of the rs731236AA genotype and the allelic variant rs731236A were significantly lower in RLS patients than in controls (P < 0.005 and < 0.01, respectively). Restless legs syndrome patients carrying the allelic variant rs731236G had an earlier age at onset, and those carrying the rs731236GG genotype had higher severity of RLS, although these data disappeared after multivariate analyses. None of the SNPs studied was related with the positivity of family history of RLS. These results suggest a modest, but significant association between VDR rs731236 SNP and the risk for RLS. PMID:26632733

Association Between Vitamin D Receptor rs731236 (Taq1) Polymorphism and Risk for Restless Legs Syndrome in the Spanish Caucasian Population.

PubMed

Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-De-La-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A G

2015-11-01

Several recent works suggest a possible role of vitamin D deficiency in the etiology or restless legs syndrome (RLS). We analyzed the possible relationship of 2 common single nucleotide polymorphisms (SNPs) in the vitamin D3 receptor (VDR) gene with the risk for RLS.We studied the genotype and allelic variant frequencies of VDR rs2228570 and VDR rs731236 SNPs in 205 RLS patients and 445 healthy controls using a TaqMan essay.The frequencies of the rs731236AA genotype and the allelic variant rs731236A were significantly lower in RLS patients than in controls (P < 0.005 and < 0.01, respectively). Restless legs syndrome patients carrying the allelic variant rs731236G had an earlier age at onset, and those carrying the rs731236GG genotype had higher severity of RLS, although these data disappeared after multivariate analyses. None of the SNPs studied was related with the positivity of family history of RLS.These results suggest a modest, but significant association between VDR rs731236 SNP and the risk for RLS.

The Single Nucleotide Polymorphism Consortium

NASA Technical Reports Server (NTRS)

Morgan, Michael

2003-01-01

I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

Association between ALDH2 rs671 G>A polymorphism and gastric cancer susceptibility in Eastern Asia

PubMed Central

Jiang, You; Zhang, Jun; Wu, Yuee; Wang, Jian; Li, Liang

2017-01-01

To date, the relationship between the aldehyde dehydrogenases-2 (ALDH2) rs671 G>A (Glu504Lys) polymorphism and gastric cancer (GC) risk has not been thoroughly elucidated. To derive a more precise estimation of the effect of the ALDH2 rs671 G>A polymorphism on GC, we conducted this meta-analysis. We searched for qualified studies in the Embase, PubMed, Wang Fan and China National Knowledge Infrastructure databases. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were calculated to assess the association. A total of 6,421 GC patients and 8,832 control subjects were included in the present study. The pooled results indicated no significant relationship between the ALDH2 rs671 G>A polymorphism and GC susceptibility in all genetic models. A stratified analysis by country showed that the ALDH2 rs671 G>A polymorphism might be a risk factor for GC in Japan (Allele model: P unadjusted = 0.034; Dominant model: P unadjusted = 0.040); however, the result was nonsignificant when the Bonferroni correction and false discovery rate (FDR) were applied. In subgroup analyses by drinking status in the dominant model, our study revealed that the ALDH2 rs671 G>A polymorphism significantly increased the risk of GC for drinkers (dominant model: P < 0.001). No relationship between the ALDH2 rs671 G>A polymorphism and GC risk was observed in any other subgroup. Our present study indicated no association between the ALDH2 rs671 G>A polymorphism and GC risk in Eastern Asian populations. However, the ALDH2 rs671 G>A polymorphism can significantly increase GC risk for drinkers. PMID:29254255

[Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

PubMed

Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

2015-07-01

To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

Regulatory polymorphism of CXCL10 rs1439490 in seronegative occult hepatitis C virus infection.

PubMed

Wang, Xu; Wang, Song; Liu, Zhen-Hua; Qi, Wen-Qian; Zhang, Qian; Zhang, Yong-Gui; Sun, De-Rong; Xu, Yan; Wang, Hong-Guang; Li, Zhong-Xie; Cong, Xian-Ling; Zhao, Ping; Zhou, Chang-Yu; Wang, Jiang-Bin

2018-05-28

To examine the relationship between the single nucleotide polymorphism CXCL10 rs1439490 and seronegative occult hepatitis C virus (HCV) infection (OCI). One hundred and three cases of seronegative OCI and 155 cases of seropositive chronic HCV infection (CHC) were diagnosed at five Liver Centers in Northeastern China, from 2012 to 2016. CXCL10 rs1439490, rs1440802, and IL-28B rs12979860 were analyzed by sequencing. Serum CXCL10 was measured by ELISA. Intrahepatic CXCL10 was determined by quantitative PCR and immunohistochemical semi-quantitative scoring. Liver necroinflammation and fibrosis were scored according to the METAVIR system. CXCL10 rs1439490 G/G was more prevalent in OCI patients ( n = 93/103; 90.3%) than in CHC patients ( n = 116/155; 74.8%; P = 0.008). OCI patients had lower serum CXCL10 levels than CHC patients (192.91 ± 46.50 pg/mL vs 354.78 ± 102.91 pg/mL, P < 0.0001). Of IL-28B rs12979860 C/C patients, OCI patients with rs1439490 G/G had lower serum and liver levels of CXCL10 and lower levels of liver necroinflammation and fibrosis than non-G/G patients. OCI patients had higher alanine aminotransferase normalization rates after Peg-interferon treatment than CHC patients (P < 0.05) and serum CXCL10 decreased significantly (P < 0.0001). Liver necroinflammation and fibrosis were alleviated in 8 OCI patients after treatment. Multivariate analysis indicated that rs1439490 G/G significantly influenced the occurrence of OCI in HCV infection (OR = 0.31, 95%CI: 0.15-0.66, P = 0.002). CXCL10 rs1439490 G/G is positively associated with OCI in HCV infection and antiviral outcome.

Genotype-Phenotype Study of the Middle Gangetic Plain in India Shows Association of rs2470102 with Skin Pigmentation.

PubMed

Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy

2017-03-01

Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

The FTO gene polymorphism (rs9939609) is associated with metabolic syndrome in morbidly obese subjects from southern Italy.

PubMed

Liguori, Rosario; Labruna, Giuseppe; Alfieri, Andreina; Martone, Domenico; Farinaro, Eduardo; Contaldo, Franco; Sacchetti, Lucia; Pasanisi, Fabrizio; Buono, Pasqualina

2014-08-01

Gene variants in MC4R, SIRT1 and FTO are associated with severe obesity and metabolic impairment in Caucasians. We investigated whether common variants in these genes are associated with metabolic syndrome (MetS) in a large group of morbidly obese young adults from southern Italy. One thousand morbidly obese subjects (62% women, mean body mass index 46.5 kg/m(2), mean age 32.6 years) whose families had lived in southern Italy for at least 2 generations were recruited. Single-nucleotide polymorphisms (SNPs) rs12970134, rs477181, rs502933 (MC4R locus), rs3818292, rs7069102, rs730821, rs2273773, rs12413112 (SIRT1 locus) and rs1421085, rs9939609, 9930506, 1121980 (FTO locus) were genotyped by Taqman assay; blood parameters were assayed by routine methods; the Fat Mass, Fat Free Mass, Respiratory Quotient, Basal Metabolic Rate (BMR) and waist circumference were also determined. Binomial logistic regression showed that the TA heterozygous genotype of SNP rs9939609 in the FTO gene was associated with the presence of MetS in our population [OR (95% CI): 2.53 (1.16-5.55)]. Furthermore, the FTO rs9939609 genotype accounted for 21.3% of the MetS phenotype together with total cholesterol, BMR and age. Our results extend the knowledge on genotype susceptibility for MetS in relation to a specific geographical area of residence. Copyright © 2014 Elsevier Ltd. All rights reserved.

ABCG2 Polymorphism rs2231142 and hypothyroidism in metastatic renal cell carcinoma patients treated with sunitinib.

PubMed

Werbrouck, Emilie; Bastin, Julie; Lambrechts, Diether; Verbiest, Annelies; Van Brussel, Thomas; Lerut, Evelyne; Machiels, Jean-Pascal; Verschaeve, Vincent; Richard, Vincent; Debruyne, Philip R; Decallonne, Brigitte; Schöffski, Patrick; Bechter, Oliver; Wolter, Pascal; Beuselinck, Benoit

2018-05-23

Background and aim Vascular endothelial growth factor receptor tyrosine kinase inhibitors (VEGFR-TKIs) cause significant adverse events including thyroid dysfunction, mainly hypothyroidism, in a considerable proportion of patients. In a series of metastatic renal cell carcinoma (mRCC) patients treated with sunitinib, we aimed to study the correlation between hypothyroidism and single nucleotide polymorphisms (SNPs) in genes involved in sunitinib pharmacokinetics and pharmacodynamics. Patients and methods We included 79 mRCC patients who started sunitinib between November 2005 and March 2016. Serum thyroid function markers were collected at start and during sunitinib therapy. Germ-line DNA genotyping for 16 SNPs in 8 candidate genes was performed. Endpoints were time to increase in thyroid stimulating hormone (TSH) and time to decrease in T4 or free T4 (FT4) on day 1 and day 28 of each sunitinib cycle. Results Patients with the ABCG2 rs2231142 CC-genotype had a significantly longer time-to-TSH-increase on day 1 (11 vs. 5 cycles; p = 0.0011), and time-to-T4/FT4-decrease on day 1 (not reached vs. 10 cycles; p = 0.013) and day 28 (28 vs. 7 cycles; p = 0.03) compared to CA-carriers. Patients with the CYP3A5 rs776746 GG-genotype had a significantly longer time-to-TSH-increase at day 1 compared to GA-patients: 11 vs. 5 cycles (p = 0.0071). Significant associations were also found between PDGFRA rs35597368 and rs1800812 and time-to-TSH-increase at day 28. Conclusion Polymorphism rs2231142 in the efflux pump ABCG2 is associated with hypothyroidism in mRCC patients treated with sunitinib.

Identification of Novel Single Nucleotide Polymorphisms Associated with Acute Respiratory Distress Syndrome by Exome-Seq

PubMed Central

Shortt, Katherine; Chaudhary, Suman; Grigoryev, Dmitry; Heruth, Daniel P.; Venkitachalam, Lakshmi; Zhang, Li Q.; Ye, Shui Q.

2014-01-01

Acute respiratory distress syndrome (ARDS) is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP) which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719) in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T) occurs within a histone mark (intron 6) of the Arylsulfatase D gene. rs9605146 (G>A) causes a deleterious coding change (proline to leucine) in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A) is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted. PMID:25372662

Association of the osteopontin rs1126616 polymorphism and a higher serum osteopontin level with lupus nephritis

PubMed Central

SALIMI, SAEEDEH; NOORA, MEHRANGIZ; NABIZADEH, SIMA; REZAEI, MAHNAZ; SHAHRAKI, HOSSAIN; MILAD, MOHAMMADOO-KHORASSANI; NAGHAVI, ANOOSH; FARAJIAN-MASHHADI, FARZANEH; ZAKERI, ZAHRA; SANDOUGHI, MAHNAZ

2016-01-01

Osteopontin (OPN) is a chemokine-like glycoprotein that has a prominent role in regulating inflammation and immunity. OPN polymorphisms and elevated OPN levels are associated with systemic lupus erythematosus (SLE) in several populations. The aim of present study was to evaluate the association between the OPN rs1126616 polymorphism and OPN level with SLE susceptibility. A total of 163 SLE patients and 180 age-, gender- and ethnically matched controls were genotyped for the rs1126616 polymorphism by the polymerase chain reaction-restriction fragment length polymorphism method. Serum OPN levels were assayed by the enzyme-linked immunosorbent assay. There was no association between the OPN rs1126616 C/T polymorphism and SLE. The frequency of the OPN rs1126616 CT genotype was significantly higher in SLE patients with nephritis compared to SLE patients without nephritis and controls. Additionally, the frequency of TT genotypes was higher in SLE patients with nephritis compared to controls. The serum OPN levels were significantly higher in SLE patients compared to controls (50.6±22 vs. 35.6±15.8 ng/ml, P<0.001). Increased serum OPN levels were observed in SLE patients with lupus nephritis and joint symptoms. There was no correlation between OPN levels and the OPN rs1126616 polymorphism. The present data suggest that the CT and TT genotypes of the OPN rs1126616 polymorphism could be a risk factor for lupus nephritis. The OPN level is associated with SLE and certain SLE manifestations. However, there was no association between the OPN rs1126616 C/T polymorphism and SLE susceptibility. PMID:26998275

Serum Interleukin-6 Level and the rs1800795 Polymorphism in its Gene Associated with Neuroblastoma Risk in Chinese Children.

PubMed

Zhao, Qian; Jin, Mei; Zhang, Da-Wei; Zhao, Wen; Wang, Xi-Si; Yue, Zhi-Xia; Duan, Chao; Huang, Cheng; Ma, Xiao-Li

2018-05-05

The pro-inflammatory cytokine, interleukin-6 (IL-6), stimulates the metastasis of several neoplasms. An association of its serum level and the single nucleotide polymorphism (SNP) rs1800795 with neuroblastoma (NB) has been reported in American and Italian cohorts. This study was to clarify whether the same association exists in Chinese children. A total of 130 NB patients, with 77 boys (59%), 53 girls (41%), mean age 41 ± 5 months, were assigned to two groups: high risk (HR) versus intermediate-low risk (non-HR), and 50 healthy children were randomly selected as the age- and gender-matched controls. Peripheral blood samples were analyzed to determine serum IL-6 level using enzyme linked immunosorbent assay and rs1800795 SNPs phenotype using polymerase chain reaction and gene sequencing. There were 87 NB patients in the HR group and 43 NB patients in the non-HR group. A comparison of allele and genotype frequencies of the rs1800795 polymorphism between patients and controls found no association with NB risk (P > 0.05). The frequency of GG+GC genotype was higher in HR-NB patients than in non-HR-NB patients (64.4% vs. 48.8%, P = 0.02), and serum IL-6 level was much higher in HR-NB patients with GG+GC genotype than in HR-NB patients with CC genotype (4.36 ± 1.1 pg/ml vs. 1.83 ± 0.5 pg/ml; P = 0.02), but not in Non-HR-NB patients. The polymorphism rs1800795 is associated with serum IL-6 level and level of NB risk. GG genotype might indicate that the tumor is highly malignant (prone to metastasis) and associated with poor prognosis.

High frequency of the PNPLA3 rs738409 [G] single-nucleotide polymorphism in Hmong individuals as a potential basis for a predisposition to chronic liver disease.

PubMed

Tepper, Clifford G; Dang, Julie H T; Stewart, Susan L; Fang, Dao M; Wong, Kimberly A; Liu, Stephenie Y; Davis, Ryan R; Dao, Doan Y; Gregg, Jeffrey P; Török, Natalie J; Chen, Moon S

2018-04-01

An exploratory study was performed to determine the prevalence of the patatin-like phospholipase domain-containing protein 3 (PNPLA3) rs78409 [G] allele among the Hmong as a risk factor for nonalcoholic fatty liver disease (NAFLD). NAFLD/nonalcoholic steatohepatitis is the world's most common chronic liver disease and is expected to replace viral hepatitis as the leading cause of cirrhosis and potential precursor to hepatocellular carcinoma (HCC). Of all populations in California, the Hmong experience the highest risk of death from HCC and the highest prevalence of metabolic syndrome risk factors among Asians that predispose them to NAFLD. Here a genetic explanation was sought for the high rates of chronic liver disease among the Hmong. The literature pointed to the PNPLA3 rs738409 [G] allele as a potential genetic culprit. Cell-free DNA was isolated from 26 serum samples previously collected in community settings. Quantitative polymerase chain reaction-based single-nucleotide polymorphism (SNP) genotyping was performed with a validated TaqMan SNP genotyping assay, and results were analyzed with TaqMan Genotyper software. The PNPLA3 rs738409 [C>G] variant occurred at a frequency of 0.46 (12 of 26; 95% confidence interval, 0.27-0.67). This carrier rate would rank the Hmong as the third highest population in the 1000 Genomes Project. Although this small sample size limits the generalizability, the high frequency rates of this allele along with the presence of metabolic syndrome risk factors warrant further studies into the etiology of NAFLD among the Hmong. Cancer 2018;124:1583-9. © 2018 American Cancer Society. © 2018 American Cancer Society.

The predictive value of IL28B rs12979860, rs11881222 and rs8099917 polymorphisms and IP-10 in the therapeutic response of Egyptian genotype 4 patients.

PubMed

Derbala, Moutaz; Rizk, Nasser M; Al-Kaabi, Saad; John, Anil; Sharma, Manik; El-dweik, Nazeeh; Yakoob, Rafie; Pasic, Fuad; Almohanadi, Muneera; Alejji, Khalid; Abdelmola, Abdulatif; Butt, Mohamed

2013-09-01

Interleukin-28B (IL28B) polymorphisms have previously been reported to be strongly associated with spontaneous and treatment-induced HCV viral clearance. To assess the impact of four different IL28B polymorphisms and their haplotype combination and interferon-c inducible protein 10 (IP-10) in response to treatment in Egyptian genotype 4 patients. 159 HCV-genotype 4 patients were included. All patients were treated with Peginterferon alph2a/Ribavirin for 48 wk. The following polymorphisms rs12979860, rs11881222, rs8103142 and rs8099917 and rs80803142 of Il-28 were known to be associated with the sustained virological response. They were genotyped using the TaqMan assay. IP-10 was assessed by Eliza. The data indicated that all SNPs are within the Hardy-Weinberg Equilibrium (HWE) except for rs8103142 (p=6.255(-9)), therefore it was excluded from the study since it deviates from HWE-P. The CC, AA and TT genotypes of rs12979860, rs11881222 and rs8099917 were the more frequent genotypes among the responders at RVR, EVR, ETR and SVR, respectively. The frequency of CC, CT, and TT genotype was 46.4%, 38.1% and 15.5% among responders of RVR, and was 46.9%, 45.9% and 7.2 among responders of SVR for rs12979860, respectively. The relapse rate was 18.0% and 16.0 % during EVR and ETR, while the response rate was 52.8%, 58.5%, 59.7% and 61.6% after 4, 12, 48 and 72 weeks of treatment. The transient virological response (TVR) was 6.9% among HCV patients. The results showed that the odds ratio and 95% CI of HCV genotype 4 patients to have a better sustained response to treatment (SVR) was 2.92, (1.83-4.68, p=2.01(-5)), 2.89 (1.79-4.70, p=2.53(-5)), and 2.73 (0.21-0.65, p=0.0007) for those with the major allele "C" of rs12979860, the "A" allele of rs11881222, and the "T" allele of rs8099917, respectively. Furthermore, the positive predictive value (PPV) of the major homozygous alleles for SVR with better response to therapy was in the following order: 78.69%, 68.42%, and 32.14% with

Association between ADAM metallopeptidase domain 33 gene polymorphism and risk of childhood asthma: a meta-analysis.

PubMed

Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B

2017-08-31

This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.

ESR1 single nucleotide polymorphisms predict breast cancer susceptibility in the central European Caucasian population.

PubMed

Lipphardt, Mark F; Deryal, Mustafa; Ong, Mei Fang; Schmidt, Werner; Mahlknecht, Ulrich

2013-01-01

Estrogen and progesterone hormones are key regulators of a wide variety of biological processes. In addition to their influence on reproduction, cell differentiation and apoptosis, they affect inflammatory response, cell metabolism and most importantly, they regulate physiological breast tissue proliferation and differentiation as well as the development and progression of breast cancer. In order to assess whether genetic variants in the steroid hormone receptor gene ESR1 (estrogen receptor alpha) had an effect on sporadic breast cancer susceptibility, we assessed 7 ESR1 single nucleotide polymorphisms (SNPs) for associations with breast cancer susceptibility and clinical parameters in 221 breast cancer patients and 221 controls, respectively. We identified ESR1 intron SNP +2464 C/T (rs3020314) and ESR1 intron SNP -4576 A/C (rs1514348) to correlate with breast cancer susceptibility and progesterone receptor expression status. Patients genotyped CT for ESR1 intron SNP +2464 (rs3020314) (p ≤ 0.045) or genotyped AC for ESR1 intron SNP -4576 (rs1514348) (p ≤ 0.000026) were identified to carry a significant risk as to the development of breast cancer in the Central European Caucasian population (both together: p ≤ 0.000488). Our study could confirm previous associations and revealed new associations of SNP rs1514348 with susceptibility to breast cancer and clinical outcome, which might be used as new additional SNP markers.

Relationships between FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms and the occurrence of selected metabolic and hormonal disorders in middle-aged and elderly men - a preliminary study.

PubMed

Rotter, Iwona; Skonieczna-Żydecka, Karolina; Kosik-Bogacka, Danuta; Adler, Grażyna; Rył, Aleksandra; Laszczyńska, Maria

2016-01-01

Metabolic disorders, including MetS, obesity, and lipid disorders, may be related to genetic factors. Metabolic disorders are associated with decreased TS levels in aging men. The aim of this study was to evaluate the relationship between FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms and the presence of MetS and its components, the concurrent lipid disorders, as well as sex hormone concentrations. This study involved 272 men of Caucasian descent aged 50-75 years. Lipid profile, including TCh, LDL, HDL, and TG, was evaluated by spectrophotometric method. Anthropometric measurements concerned WC and blood pressure. MetS was diagnosed according to the criteria of the IDF. Sex hormone profile, including TST, FTS, E 2 , DHEAS, and SHBG, was examined using enzyme-linked immunosorbent assay. Polymorphisms within FTO , MC4R , and PPARγ genes were identified using polymerase chain reaction-restriction fragments length polymorphism. This study did not show links between the analyzed genetic polymorphisms and the presence of MetS, T2DM, HT, and obesity. However, higher concentrations of TCh and LDL were found in men with the FTO rs9939609 polymorphism in the recessive mode of inheritance ( P =0.03 and P =0.05, respectively). Lower WC was found to be associated with MC4R rs17782313 gene inherited in the same model ( P =0.005). FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms seem to have little effect on the incidence of metabolic malfunctions and no effect on androgen-related disorders in the examined middle-aged and elderly men.

Association of COL1A1 rs1800012 polymorphism with musculoskeletal degenerative diseases: a meta-analysis

PubMed Central

Zhong, Binlong; Huang, Donghua; Ma, Kaige; Deng, Xiangyu; Shi, Deyao; Wu, Fashuai; Shao, Zengwu

2017-01-01

It has been reported that the single nucleotide polymorphism (SNP) rs1800012 in COL1A1 gene might be linked to the susceptibility of musculoskeletal degenerative diseases, such as osteoarthritis (OA) and intervertebral disc degeneration (IVDD). However, the data from different studies is contradictory. Here we aimed to comprehensively summarize and clarify the relationship between the SNP and musculoskeletal degenerative diseases. Seven eligible studies including 1339 cases and 5406 controls were screened out from PubMed, Web Of Science and Cochrane library databases. Significant association was identified in sub group analysis of IVDD in homozygote model (GG versus TT: OR = 0.33, 95% CI 0.14–0.78, P = 0.012), heterozygote model (GT versus TT: OR = 0.29, 95% CI 0.11–0.72, P = 0.008) and dominant model (GG/GT versus TT: OR = 0.31, 95% CI 0.13–0.74, P = 0.008). Additionally, significant relationship was also found in sub group analysis of severe degree of IVDD in homozygote model (GG versus TT: OR = 0.37, 95% CI 0.15–0.91, P = 0.031), heterozygote model (GT versus TT: OR = 0.33, 95% CI 0.13–0.87,P = 0.024) and dominant model (GG/GT versus TT: OR = 0.36, 95% CI 0.14–0.88, P = 0.025). Although no significance was observed, there is a trend that the more G allele at COL1A1 rs1800012 site, the less possibility of IVDD and severe IVDD would happen. Our results indicate that COL1A1 rs1800012 polymorphism associates with the susceptibility of IVDD. However, this polymorphism may not be associated with OA risk. PMID:29088884

CARD8 rs2043211 polymorphism is associated with gout in a Chinese male population.

PubMed

Chen, Ying; Ren, Xianfeng; Li, Changgui; Xing, Shichao; Fu, Zhengju; Yuan, Ying; Wang, Robin; Wang, Yangang; Lv, Wenshan

2015-01-01

BACKGROUND &AIM: Previous studies have suggested genetic factors are involved in the development of gout. We performed a case-control study to investigate the genetic association between CARD8 rs2043211 polymorphism and gout. A total of 396 male patients with gout and 403 age- and sex- matched healthy controls were included in this study. Genotyping was performed using TaqMan SNP Genotyping Assays. An association analysis was carried out using the χ² test. The genotype-phenotype analysis was also conducted. The genotype distribution of CARD8 rs2043211 polymorphism confirmed to HWE in the controls (P = 0.27). There was an obvious difference in the genotype distribution of CARD8 rs2043211 polymorphism between cases and controls (P = 0.017). In addition, there was an obvious association between CARD8 rs2043211 polymorphism and gout under the recessive comparison model (AA vs. OR = 0.65, 95%CI 0.47-0.88, P = 0.006). Patients carrying genotype TT of CARD8 rs2043211 polymorphism had higher triglycerides levels compared to those carrying the AA genotype (2.77±2.08 mmol/L vs. 2.07±1.15 mmol/L, P = 0.01). Patients with the TT genotype also had significantly higher systolic blood pressure compared with those with the AA genotype (142.11±21.10 mmHg vs. 135.38±14.66 mmHg, P = 0.03). Patients carrying TT genotype also had an increased risk of renal calculus compared with those carrying the AA genotype. CARD8 rs2043211 polymorphism is significantly associated with susceptibility to gout in Chinese Han males. © 2015 S. Karger AG, Basel.

Association Study between Coronary Artery Disease and rs1333049 and rs10757274 Polymorphisms at 9p21 Locus in South-West Iran

PubMed Central

Foroughmand, Ali Mohammad; Nikkhah, Emad; Galehdari, Hamid; Jadbabaee, Mohammad Hossin

2015-01-01

Objective Coronary artery disease (CAD) is a multi-factorial and heterogenic disease with atherosclerosis plaques formation in internal wall of coronary artery. Plaque formation results to limitation of the blood reaching to myocardium leading to appearance of some problems, such as ischemia, sudden thrombosis veins and myocardial infarction (MI). Several environmental and genetic factors are involved in prevalence and incident of CAD as follows: hypertension, high low density lipoprotein-cholesterol (LDL-C), age, diabetes mellitus, family history of early-onset heart disease and smoking. According to genome wide association studies (GWAS), five polymorphisms in the 9p21 locus seem to be associated with the CAD. We aimed to evaluate the remarkable association of two polymorphisms at 9p21 locus, rs1333049 and rs10757274, with CAD. Materials and Methods This experimental study was conducted in Golestan, Aria Hospitals and Genetics Lab of Shahid Chamran University in the city of Ahvaz, Iran, in 2010- 2011. The collected blood samples belonging to 170 CAD patients (case group) and 100 healthy individuals (control group) were analyzed by tetra-primer amplification refractory mutation system (ARMS)-polymerase chain reaction (PCR) technique. The results were analyzed using software package used for statistical analysis (SPSS; SPSS Inc., USA) version 16. A value of p<0.05 and an odd ratio (OR) with 95% confidence intervals (CI) were considered significant. Results The frequencies of CC, CG and GG genotypes for rs1333049 polymorphism in patients were 18.2, 65.3 and 16.5%, while in controls, the related values were 25, 67 and 8%, respectively. GG genotypes of rs1333049 polymorphism in CAD patients were more than control cases (OR: 0.354, 95%CI: 0.138-0.912, p=0.032). The frequencies of AA, AG and GG genotypes for rs10757274 in CAD patients were 8.2, 58.3 and 33.5%, while in controls, the related values were 35, 63 and 2%, respectively. GG Genotype in rs10757274 polymorphism

Polymorphism of the renalase gene in gestational diabetes mellitus.

PubMed

Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna

2017-01-01

Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

The polymorphism rs3024505 proximal to IL-10 is associated with risk of ulcerative colitis and Crohns disease in a Danish case-control study.

PubMed

Andersen, Vibeke; Ernst, Anja; Christensen, Jane; Østergaard, Mette; Jacobsen, Bent A; Tjønneland, Anne; Krarup, Henrik B; Vogel, Ulla

2010-05-28

Crohn's disease (CD) and ulcerative colitis (UC) are characterized by a dysregulated inflammatory response to normal constituents of the intestinal flora in the genetically predisposed host. Heme oxygenase-1 (HO-1/HMOX1) is a powerful anti-inflammatory and anti-oxidant enzyme, whereas the pro-inflammatory interleukin 1 beta (IL-1 beta/IL1B) and anti-inflammatory interleukin 10 (IL-10/IL10) are key modulators for the initiation and maintenance of inflammation. We investigated whether single nucleotide polymorphisms (SNPs) in the IL-1 beta, IL-10, and HO-1 genes, together with smoking, were associated with risk of CD and UC. Allele frequencies of the IL-1 beta T-31C (rs1143627), and IL-10 rs3024505, G-1082A (rs1800896), C-819T (rs1800871), and C-592A (rs1800872) and HO-1 A-413T (rs2071746) SNPs were assessed using a case-control design in a Danish cohort of 336 CD and 498 UC patients and 779 healthy controls. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated by logistic regression models. Carriers of rs3024505, a marker polymorphism flanking the IL-10 gene, were at increased risk of CD (OR = 1.40, 95% CI: 1.06-1.85, P = 0.02) and UC (OR = 1.43, 95% CI: 1.12-1.82, P = 0.004) and, furthermore, with risk of a diagnosis of CD and UC at young age (OR = 1.47, 95% CI: 1.10-1.96) and OR = 1.35, 95% CI: 1.04-1.76), respectively). No association was found between the IL-1 beta, IL-10 G-1082A, C-819T, C-592A, and HO-1 gene polymorphisms and CD or UC. No consistent interactions between smoking status and CD or UC genotypes were demonstrated. The rs3024505 marker polymorphism flanking the IL-10 gene was significantly associated with risk of UC and CD, whereas no association was found between IL-1 beta or HO-1 gene polymorphisms and risk of CD and UC in this Danish study, suggesting that IL-10, but not IL-1 beta or HO-1, has a role in IBD etiology in this population.

The polymorphism rs3024505 proximal to IL-10 is associated with risk of ulcerative colitis and Crohns disease in a Danish case-control study

PubMed Central

2010-01-01

Background Crohns disease (CD) and ulcerative colitis (UC) are characterized by a dysregulated inflammatory response to normal constituents of the intestinal flora in the genetically predisposed host. Heme oxygenase-1 (HO-1/HMOX1) is a powerful anti-inflammatory and anti-oxidant enzyme, whereas the pro-inflammatory interleukin 1β (IL-1β/IL1B) and anti-inflammatory interleukin 10 (IL-10/IL10) are key modulators for the initiation and maintenance of inflammation. We investigated whether single nucleotide polymorphisms (SNPs) in the IL-1β, IL-10, and HO-1 genes, together with smoking, were associated with risk of CD and UC. Methods Allele frequencies of the IL-1β T-31C (rs1143627), and IL-10 rs3024505, G-1082A (rs1800896), C-819T (rs1800871), and C-592A (rs1800872) and HO-1 A-413T (rs2071746) SNPs were assessed using a case-control design in a Danish cohort of 336 CD and 498 UC patients and 779 healthy controls. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated by logistic regression models. Results Carriers of rs3024505, a marker polymorphism flanking the IL-10 gene, were at increased risk of CD (OR = 1.40, 95% CI: 1.06-1.85, P = 0.02) and UC (OR = 1.43, 95% CI: 1.12-1.82, P = 0.004) and, furthermore, with risk of a diagnosis of CD and UC at young age (OR = 1.47, 95% CI: 1.10-1.96) and OR = 1.35, 95% CI: 1.04-1.76), respectively). No association was found between the IL-1β, IL-10 G-1082A, C-819T, C-592A, and HO-1 gene polymorphisms and CD or UC. No consistent interactions between smoking status and CD or UC genotypes were demonstrated. Conclusions The rs3024505 marker polymorphism flanking the IL-10 gene was significantly associated with risk of UC and CD, whereas no association was found between IL-1β or HO-1 gene polymorphisms and risk of CD and UC in this Danish study, suggesting that IL-10, but not IL-1β or HO-1, has a role in IBD etiology in this population. PMID:20509889

Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

PubMed

Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

2015-04-01

Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

PubMed

Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

2017-01-01

Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

Genetic polymorphisms of surfactant protein D rs2243639, Interleukin (IL)-1β rs16944 and IL-1RN rs2234663 in chronic obstructive pulmonary disease, healthy smokers, and non-smokers.

PubMed

Issac, Marianne Samir M; Ashur, Wafaa; Mousa, Heba

2014-06-01

Chronic obstructive pulmonary disease (COPD) is a complex chronic inflammatory disease that involves the activity of various inflammatory cells and mediators. It has been suggested that susceptibility to COPD is, at least in part, genetically determined. The primary aim of this study was to investigate the association between surfactant protein D (SFTPD) rs2243639, interleukin (IL)-1β rs16944 and IL-1 receptor antagonist (IL-1RN) rs2234663 gene polymorphisms and COPD susceptibility, as well as examining the association between the various IL-1RN/IL-1β haplotypes and pulmonary function tests (PFT). Secondly, we aimed to examine the influence of SFTPD rs2243639 polymorphism on serum surfactant protein D (SP-D) level. A total of 114 subjects were recruited in this study and divided into three groups: 63 COPD patients, 25 asymptomatic smokers, and 26 healthy controls. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed for the detection of SFTPD rs2243639 and IL-1β rs16944 polymorphisms. Detection of variable numbers of an 86-bp tandem repeat (VNTR) of IL-1RN was done using PCR. Serum SP-D level was measured using enzyme linked-immunosorbent assay. PFTs were measured by spirometry. Carriers of the SFTPD AG and AA polymorphic genotypes constituted 71.4 % of COPD patients versus 48 % in asymptomatic smokers, with a statistically significant difference between the two groups (p = 0.049). Smokers who were carriers of the polymorphic SFTPD rs2243639 A allele (AG and AA genotypes) have a 2.708 times risk of developing COPD when compared with wild-type GG genotype carriers [odds ratio (OR) 2.708 (95 % CI 1.041-7.047)]. Forced expiratory flow (FEF) 25-75 % predicted was higher in IL-1RN*1/*1 when compared with *1/*2 (p = 0.013). FEF25-75 % predicted in carriers of haplotype IL-1RN *1/IL-1β T (49.21 ± 10.26) was statistically significantly higher than in carriers of IL-1RN *2/IL-1β T (39.67 ± 12.64) [p = 0

Association between the BRCA2 rs144848 polymorphism and cancer susceptibility: a meta-analysis.

PubMed

Li, Qiuyan; Guan, Rongwei; Qiao, Yuandong; Liu, Chang; He, Ning; Zhang, Xuelong; Jia, Xueyuan; Sun, Haiming; Yu, Jingcui; Xu, Lidan

2017-06-13

The BRCA2 gene plays an important role in cancer carcinogenesis, and polymorphisms in this gene have been associated with cancer risk. The BRCA2 rs144848 polymorphism has been associated with several cancers, but results have been inconsistent. In the present study, a meta-analysis was performed to assess the association between the rs144848 polymorphism and cancer risk. Literature was searched from the databases of PubMed, Embase and Google Scholar before April 2016. The fixed or random effects model was used to calculate pooled odd ratios on the basis of heterogeneity. Meta-regression, sensitivity analysis, subgroup analysis and publication bias assessment were also performed using STATA 11.0 software according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2009. A total of 40 relevant studies from 30 publications including 34,911 cases and 48,329 controls were included in the final meta-analysis. Among them, 22 studies focused on breast cancer, seven on ovarian cancer, five on non-Hodgkin lymphoma, and the remaining six studies examined various other cancers. The meta-analysis results showed that there were significant associations between the rs144848 polymorphism and cancer risk in all genetic models. Stratified by cancer type, the rs144848 polymorphism was associated with non-Hodgkin lymphoma. Stratified by study design, the allele model was associated with breast cancer risk in population-based studies. The meta-analysis suggests that the BRCA2 rs144848 polymorphism may play a role in cancer risk. Further well-designed studies are warranted to confirm these results.

APOC3 rs2070666 Is Associated with the Hepatic Steatosis Independently of PNPLA3 rs738409 in Chinese Han Patients with Nonalcoholic Fatty Liver Diseases.

PubMed

Zhang, Rui-Nan; Zheng, Rui-Dan; Mi, Yu-Qiang; Zhou, Da; Shen, Feng; Chen, Guang-Yu; Zhu, Chan-Yan; Pan, Qin; Fan, Jian-Gao

2016-08-01

The association between nonalcoholic fatty liver disease (NAFLD) and apolipoprotein C3 gene (APOC3) promoter region single-nucleotide polymorphisms (SNPs) rs2854117 and rs2854116 is controversial. The aim of this study was to investigate the relationship between other polymorphisms of APOC3 and NAFLD in Chinese. Fifty-nine liver biopsy-proven NAFLD patients and 72 healthy control subjects were recruited to a cohort representing Chinese Han population. The polymorphisms in the exons and flanking regions of APOC3 and patatin-like phospholipase domain-containing protein 3 (PNPLA3) rs738409 polymorphisms were genotyped. Among the five SNPs (rs4225, rs4520, rs5128, rs2070666, and rs2070667) in APOC3, only rs2070666 (c.179 + 62 T/A) was significantly different in genotype and allele frequency (both p < 0.01) between groups of NAFLD and control. After adjusting for sex, age, serum triglycerides, total cholesterol, body mass index, and the PNPLA3 rs738409 polymorphism, the APOC3 rs2070666 A allele was an independent risk factor for NAFLD with an odds ratio (OR) of 3.683 and 95 % confidence interval (CI) of 1.037-13.084. The APOC3 rs2070666 A allele was linked to the fourth quartile of the controlled attenuation parameter values (OR 2.769, 95 % CI 1.002-7.651) in 131 subjects, and also linked to the significant histological steatosis (OR 4.986, 95 % CI 1.020-24.371), but neither to liver stiffness measurement values nor to hepatic histological activity and fibrosis in NAFLD patients. The APOC3 rs2070666 A allele is a risk factor for NAFLD independent of obesity, dyslipidemia, and PNPLA3 rs738409, and it might contribute to increased liver fat content in Chinese Han population.

Toll-like receptor 3 polymorphism rs3775291 is not associated with choroidal neovascularization or polypoidal choroidal vasculopathy in Chinese subjects.

PubMed

Sng, Chelvin C A; Cackett, Peter D; Yeo, Ian Y; Thalamuthu, Anbupalam; Venkatraman, Anandalakshmi; Venkataraman, Divya; Koh, Adrian H; Tai, E-Shyong; Wong, Tien Y; Aung, Tin; Vithana, Eranga N

2011-01-01

Age-related macular degeneration (AMD) is a leading cause of visual impairment. A single-nucleotide polymorphism (SNP; rs3775291) in the Toll-like receptor 3 (TLR3) gene has recently been implicated in the pathogenesis of AMD in Caucasian populations. The aim of this study was to examine this association in Chinese persons with choroidal neovascularization (CNV) secondary to AMD and polypoidal choroidal vasculopathy (PCV). This was an observational cross-sectional study in Singapore. Study subjects were of Chinese ethnicity and included patients with exudative maculopathy and normal control subjects. The diagnoses of CNV and PCV were made based on fundus examination, fluorescein angiography and indocyanine green angiography findings. Genomic DNA was extracted, and genotypes were determined by bidirectional DNA sequencing. We compared the allele and genotype frequencies between subjects with CNV and PCV with controls using the software PLINK. A total of 246 subjects with exudative maculopathy (consisting of 126 with CNV and 120 with PCV) and 274 normal control subjects were recruited. The distribution of rs3775291 SNP genotypes for CNV and PCV was not significantly different from that for normal controls. This study indicates that the TLR3 rs3775291 gene polymorphism is not associated with CNV and PCV in Singaporean Chinese patients. Copyright © 2010 S. Karger AG, Basel.

Association of polymorphisms rs1800012 in COL1A1 with sports-related tendon and ligament injuries: a meta-analysis

PubMed Central

Wang, Chunguang; Li, Hao; Chen, Kang; Wu, Bing; Liu, Haifeng

2017-01-01

It has been reported that the single nucleotide polymorphism (SNP) rs1800012 in COL1A1 might be associated with the susceptibility to sports-related tendon and ligament injuries such as ACL injuries, Achilles tendon injuries, shoulder dislocations and tennis elbow. But the data from different studies have been conflicting. Here we attempted to systematically summarize and clarify the association between the SNP and sports-related tendon and ligament injuries risk. Six eligible studies including 933 cases and 1,381 controls were acquired from PubMed, Web Of Science and Cochrane library databases. Significant association was identified in homozygote model (TT versus GG: OR=0.17, 95%CI 0.08-0.35, PH=0.00) and recessive model (TT versus GT/GG: OR=0.21, 95%CI 0.10-0.44, PH=0.00). Our results indicated that COL1A1 rs1800012 polymorphism may be associated with the reduced risk of sports-related tendon or ligament injuries, especially in ACL injuries, and that rare TT may played as a protective role. PMID:28206959

Genetic polymorphisms of antioxidant enzymes CAT and SOD affect the outcome of clinical, biochemical, and anthropometric variables in people with obesity under a dietary intervention.

PubMed

Hernández-Guerrero, César; Parra-Carriedo, Alicia; Ruiz-de-Santiago, Diana; Galicia-Castillo, Oscar; Buenrostro-Jáuregui, Mario; Díaz-Gutiérrez, Carmen

2018-01-01

Genetic polymorphisms of antioxidant enzymes CAT, GPX, and SOD are involved in the etiology of obesity and its principal comorbidities. The aim of the present study was to analyze the effect of aforementioned SNPs over the output of several variables in people with obesity after a nutritional intervention. The study included 92 Mexican women, which received a dietary intervention by 3 months. Participants were genotyped and stratified into two groups: (1) carriers; mutated homozygous plus heterozygous (CR) and (2) homozygous wild type (WT). A comparison between CR and WT was done in clinical (CV), biochemical (BV), and anthropometric variables (AV), at the beginning and at the end of the intervention. Participants ( n  = 92) showed statistically significant differences ( p  < 0.05) at the end of the nutritional intervention in several CV, BV, and AV. However, two kinds of responses were observed after genotyping participants: (A) CR and WT showed statistically significant differences ( p  < 0.05) in several CV, BV, and AV for the SNPs 599C>T GPX1 (rs1050450), - 251A>G SOD1 (rs2070424), and - 262C>T CAT (rs1001179). (B) Only CR showed statistically changes ( p  < 0.05) in several CV, BV, and AV for the SNPs - 21A>T CAT (rs7943316) and 47C>T SOD2 (rs4880). The dietary intervention effect was statistically significantly between the polymorphisms of 47C>T SOD2 and BMI, SBP, TBARS, total cholesterol, and C-LCL ( p  < 0.05) and between the polymorphisms of - 21A>T CAT (rs7943316) and SBP, DBP, total cholesterol, and atherogenic index ( p  < 0.05). People with obesity display different response in several CV, BV, and AV after a nutritional intervention, depending on the antioxidant genetic background of SOD and CAT enzymes.

The IL18 Promoter Polymorphism, rs1946518, Is Associated with the Risk of Periodontitis in Japanese Women: The Kyushu Okinawa Maternal and Child Health Study.

PubMed

Tanaka, Keiko; Miyake, Yoshihiro; Hanioka, Takashi; Furukawa, Shinya; Miyatake, Nobuyuki; Arakawa, Masashi

2017-11-01

Interleukin-18 (IL-18) is a proinflammatory cytokine that plays an important role in periodontitis and its polymorphisms might modulate the individual susceptibility to periodontitis. Only a limited number of studies on the association between IL18 single-nucleotide polymorphisms (SNPs) and the risk of periodontitis have been realized, however. The aim of this case-control study among young post-partum Japanese women (18 to 45 years) was to determine the impact of SNPs, rs1946518 (-607 C/A) and rs187238 (-137G/C), on periodontitis. The two SNPs may be located within a transcription factor-binding element, thereby influencing transcription from the IL18 promoter. Subjects were 131 cases who had at least one tooth with a probing pocket depth of ≥ 4.0 mm and 1,017 periodontally healthy controls. Probing pocket depth measurements were performed between 1 and 12 months post-partum. In this population, the A allele of rs1946518 and the C allele of rs187238 are more common. After adjustment for age, education, smoking, and use of an interdental brush, compared with subjects with the AA or AC genotype of SNP rs1946518, those with the CC genotype had a significantly reduced risk of periodontitis (adjusted odds ratio = 0.54, 95% confidence interval = 0.29-0.97). No significant association was observed between rs187238 and the risk of periodontitis. Our study did not reveal any evidence of interaction between the IL18 polymorphisms and smoking. Our findings indicate that the IL18 promoter SNP, rs1946518, is a potential risk factor of periodontitis among young Japanese women.

Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

PubMed

Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

2017-03-01

Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

Nucleotide-binding oligomerization domain containing 1 (NOD1) haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

PubMed Central

Huebner, Claudia; Ferguson, Lynnette R; Han, Dug Yeo; Philpott, Martin; Barclay, Murray L; Gearry, Richard B; McCulloch, Alan; Demmers, Pieter S; Browning, Brian L

2009-01-01

Background The nucleotide-binding oligomerization domain containing 1 (NOD1) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1) was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p < 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line. Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population. PMID:19327158

Association of Toll-like receptor 3 and Toll-like receptor 9 single-nucleotide polymorphisms with hepatitis C virus persistence among Egyptians.

PubMed

Hamdy, Shaimaa; Osman, Ahmed M; Zakaria, Zainab A; Galal, Iman; Sobhy, Maha; Hashem, Mohamed; Allam, Walaa R; Abdel-Samiee, Mohamed; Rewisha, Eman; Waked, Imam; Abdelwahab, Sayed F

2018-06-02

Toll-like receptors (TLRs) give the innate immune system a considerable specificity for a large range of pathogens. TLR3 detects dsRNA of viruses while TLR9 recognizes bacterial and viral unmethylated CpG motifs. This study examined whether there is a potential association between single-nucleotide polymorphisms (SNPs) in the TLR3.rs3775290 (c.1377C/T), TLR9.rs5743836 (-1237T→C) and TLR9.rs352140 (G2848A) genes and HCV infection among Egyptian patients and healthcare workers (HCWs). We enrolled 546 subjects (409 HCWs and 137 patients) divided into four groups: group 1 included 265 seronegative, aviremic subjects; group 2 included 25 seronegative, viremic subjects; group 3 included 87 subjects with spontaneously resolved HCV infection; and group 4 included 169 chronic HCV patients. All subjects were genotyped for TLR3.rs3775290, TLR9.rs5743836 and TLR9.rs352140 SNPs by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis. TLR3.rs3775290 "CC" genotype was associated with chronic HCV infection, where there was a significantly greater frequency of this genotype among chronic patients when compared to subjects with spontaneously resolved infection (63.9% vs. 51.9%; p = 0.033; OR = 1.639 and 95% CI = 0.94-2.84). However, this SNP did not correlate with the HCV RNA load among the chronic subjects (p > 0.05). There was no significant difference in TLR9.rs5743836 and TLR9.rs352140 genotype distribution between groups (p > 0.05). Lack of association between the three SNPs was found, as the three SNPs are located on two different chromosomes. In conclusion, the TLR3.rs3775290 "CC" genotype was associated with HCV chronicity, while the TLR9 gene may not play a major role in HCV infection.

CLU rs2279590 polymorphism contributes to Alzheimer's disease susceptibility in Caucasian and Asian populations.

PubMed

Zhang, Shuyan; Zhang, Donghui; Jiang, Yongshuai; Wu, Lina; Shang, Hong; Liu, Jiafeng; Feng, Rennan; Liao, Mingzhi; Zhang, Liangcai; Liu, Yong; Liu, Guiyou; Li, Keshen

2015-03-01

It is reported that CLU rs2279590 polymorphism is significantly associated with Alzheimer's disease (AD) in European ancestry. Recent studies investigated rs2279590 polymorphism in Asian population (Chinese, Japanese and Korean). Four studies showed negative association and two studies showed weak association between rs2279590 and AD. We believe that the weak association or no association may be caused by the relatively small sample size in Asian population. Here, we reinvestigated the association in Asian population. Meanwhile, to investigate the genetic heterogeneity of the rs2279590 polymorphism in Asian and Caucasian populations, we searched the PubMed and AlzGene databases and selected 11 independent studies (6 studies in Asian population and 5 studies in Caucasian population) including 20,655 individuals (8,605 cases and 12,050 controls) for meta-analysis. Our results showed significant association between rs2279590 polymorphism and AD in Asian population with P = 2.00E-04 and P = 2.00E-04 using additive and recessive models, respectively. We observed no significant heterogeneity between Asian and Caucasian populations. We believe that our results may be helpful to understand the mechanisms of CLU in AD pathogenesis and will be useful for future genetic studies in AD.

[Association of IL-1β-511T gene rs16944 polymorphism with febrile seizures].

PubMed

Ren, Xiao-Tun; Sun, Su-Zhen; Liu, Fang; Wang, Xiao-Ming

2014-02-01

Despite substantial research efforts worldwide, the role of inflammatory cytokine IL-1β in the onset of febrile seizures (FS) remains controversial. The aim of this study was to assess the relationship between rs16944 polymorphism of the IL-1β-511T gene and occurrence of simple FS in a sample of Han children in northern China. The IL-1β-511T gene rs16944 was genotyped by SNaPshot SNP technique in 141 FS children and 130 healthy control subjects. The genotypic and allelic frequencies in the two groups were comparatively analyzed. There were no significant differences in genotypic and allelic frequencies of rs16944 polymorphism of the IL-1β-511T gene between FS patients and control subjects (P>0.05).When the clinical data on A/A, A/G and G/G genotypes of the rs16944 polymorphism in FS patients, there was statistically significant difference in age of first onset (χ(2)=19.491, P<0.01), temperature of first onset (χ(2)=9.317, P<0.05) and family history of FS (χ(2)=26.798, P<0.01). There is no association between rs16944 polymorphism of the IL-1β-511T gene and the incidence of FS in Han children in Northern China. However, the differences in genotypes of this polymorphism might be associated with pathogenesis and prognosis of simple FS in the population studied.

Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population.

PubMed

Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M

2015-05-01

Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

PubMed

Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

2017-07-01

The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Polymorphism of MDM2 promoter 309 (rs 2279744) and the risk of PCOS.

PubMed

Chan, Ying; Jiang, Hongguo; Yang, Xiaoling; Li, Dongya; Ma, Lan; Luo, Ying; Tang, Wenru

2016-01-01

This study aimed at evaluating possible association between MDM2 SNP309 polymorphism (rs 2279744) and polycystic ovary syndrome (PCOS). One hundred and twenty-five women with PCOS and two hundred and fifty women without PCOS were collected from the department of reproductive medicine of college hospital in this case-control study. Peripheral blood samples were collected from all participants and DNA was extracted, MDM2 SNP309 polymorphism (rs 2279744) was determined from the 125 cases and 250 controls. Women were grouped into PCOS (n = 125) group and control group (n = 250). Odds ratios (OR) and 95% confidence intervals (CI) were used to evaluate the association between MDM2 SNP309 polymorphism (rs 2279744) and PCOS. The distribution of T allele was significant higher in PCOS cases than controls. MDM2 SNP 309 T allele is associated with PCOS.

ANRIL rs2383207 polymorphism and coronary artery disease (CAD) risk: a meta-analysis with observational studies.

PubMed

Wang, P; Dong, P; Yang, X

2016-10-31

Some studies investigated the association of antisense non-coding RNA in the INK4 locus (ANRIL) rs2383207 polymorphism with coronary artery disease (CAD) risk. However, the result was still inconsistent. The aim of this study was to investigate whether there is an association between the ANRIL rs2383207 polymorphism and CAD risk. We carried out a PubMed (Medline), EMBASE database search covering all published articles. The strength of association between ANRIL rs2383207 polymorphism and CAD risk was assessed by calculating OR with 95% CI. A total of 13 case-control studies involving 6796 cases and 9956 controls were included in this meta-analysis. ANRIL rs2383207polymorphism was associated with a significantly an increased risk of CAD (OR=1.47; 95%CI, 1.33-1.62). We also found that this polymorphism increased CAD risk in Caucasians (OR=1.51; 95%CI, 1.28-1.77) and Asians (OR=1.42; 95%CI, 1.26-1.61). In the subgroup analysis according to gender, both women and men were significantly associated with the increased risk of CAD (OR=1.36; 95%CI, 1.03-1.79 and OR=1.58; 95%CI, 1.20-2.09). In the subgroup analysis by age, ANRIL rs2383207 polymorphism showed significant results in old CAD patients and young CAD patients (OR=1.32; 95%CI, 1.20-1.44 and OR=1.53; 95%CI, 1.32-1.77). Furthermore, this polymorphism also influenced myocardial infarction risk (OR=1.75; 95%CI, 1.24-2.47). Even the studies with adjustment for age, gender, smoking were included, the significant association was also observed (OR=1.43; 95%CI, 1.26-1.62). In conclusion, this meta-analysis suggested that ANRIL rs2383207 polymorphism is associated with CAD risk.

[Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

PubMed

Li, Su-Xia

2004-12-01

Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

Single-Nucleotide Polymorphisms Within the Thrombomodulin Gene (THBD) Predict Mortality in Patients With Graft-Versus-Host Disease.

PubMed

Rachakonda, Sivaramakrishna P; Penack, Olaf; Dietrich, Sascha; Blau, Olga; Blau, Igor Wolfgang; Radujkovic, Aleksandar; Isermann, Berend; Ho, Anthony D; Uharek, Lutz; Dreger, Peter; Kumar, Rajiv; Luft, Thomas

2014-10-20

Steroid-refractory graft-versus-host disease (GVHD) is a major and often fatal complication after allogeneic stem-cell transplantation (alloSCT). Although the pathophysiology of steroid refractoriness is not fully understood, evidence is accumulating that endothelial cell stress is involved, and endothelial thrombomodulin (THBD) plays a role in this process. Here we assess whether single-nucleotide polymorphisms (SNPs) within the THBD gene predict outcome after alloSCT. Seven SNPs within the THBD gene were studied (rs1962, rs1042579, rs1042580, rs3176123, rs3176124, rs3176126, and rs3176134) in a training cohort of 306 patients. The relevant genotypes were then validated in an independent cohort (n = 321). In the training cohort, an increased risk of nonrelapse mortality (NRM) was associated with three of seven SNPs tested: rs1962, rs1042579 (in linkage disequilibrium with rs3176123), and rs1042580. When patients were divided into risk groups (one v no high-risk SNP), a strong correlation with NRM was observed (hazard ratio [HR], 2.31; 95% CI, 1.36 to 3.95; P = .002). More specifically, NRM was predicted by THBD SNPs in patients who later developed GVHD (HR, 3.03; 95% CI, 1.61 to 5.68; P < .001) but not in patients without GVHD. In contrast, THBD SNPs did not predict incidence of acute GVHD. Multivariable analyses adjusting for clinical variables confirmed the independent effect of THBD SNPs on NRM. All findings could be reproduced in the validation cohort. THBD SNPs predict mortality of manifest GVHD but not the risk of acquiring GVHD, supporting the hypothesis that endothelial vulnerability contributes to GVHD refractoriness. © 2014 by American Society of Clinical Oncology.

High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

PubMed Central

Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

2006-01-01

Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

A single-nucleotide polymorphism in transferrin is associated with soluble transferrin receptor in Chinese adolescents.

PubMed

Piao, Wei; Wang, Li; Zhang, Ting; Wang, Zhen; Shangguan, Shaofang; Sun, Jing; Huo, Junsheng

2017-01-01

Associations between genetic variants in the hepcidin regulation pathway and iron status have been reported in previous studies. Most of these studies were conducted in populations of European descent and relatively few studies have been conducted in Chinese populations. In this study, we evaluated associations between single-nucleotide polymorphisms (SNPs) in the hepcidin regulation pathway, serum ferritin (SF) and soluble transferrin receptor (sTfR) in Chinese adolescents. In total, 692 students from rural boarding schools were selected from six cities in China. The participants were divided into case and control groups according to criteria for SF and sTfR. Furthermore, 33 SNPs in TMPRSS6, TF, TFR2, BMP2, BMP4, HJV, CYBRD1, HFE, IL6, PCSK7, HAMP, KIAA1468, and SRPRB were selected. Associations between the genetic variants and SF or sTfR were detected. For SF, rs4820268 in TMPRSS6 was associated with an SF <25 ng/mL status. Carriers of the G/G genotype of rs4820268 exhibited significantly lower SF levels than A allele carriers did (p=0.047). For sTfR, rs1880669 in TF, rs4901474 in BMP4, and rs7536827 in HJV were significantly associated with an sTfR >=4.4 mg/L status. However, in general linear model analysis, after adjustment for age, sex, and location, only rs1880669 exhibited a stable association with higher sTfR levels (p=0.032). We found rs4820268, in TMPRSS6 that was associated with a low SF level, as previously reported, and a new association between 1880669 in TF and sTfR.

Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.

PubMed

Martínez-Herrero, Sonia; Martínez, Alfredo

2013-04-01

The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.

PubMed

Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E

2014-02-01

The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.

Association analysis of SLC30A8 rs13266634 and rs16889462 polymorphisms with type 2 diabetes mellitus and repaglinide response in Chinese patients.

PubMed

Huang, Qiong; Yin, Ji-Ye; Dai, Xing-Ping; Wu, Jing; Chen, Xiang; Deng, Cai-Shu; Yu, Min; Gong, Zhi-Cheng; Zhou, Hong-Hao; Liu, Zhao-Qian

2010-12-01

Genome-wide association studies (GWASs) identified that SLC30A8 genetic polymorphism was a risk of type 2 diabetes mellitus (T2DM) in several populations. This study aimed to investigate whether the SLC30A8 rs13266634 and rs16889462 polymorphisms were associated with T2DM susceptibility and repaglinide therapeutic efficacy in Chinese T2DM patients. We conducted a case-control study of 443 T2DM patients and 229 healthy volunteers to identify SLC30A8 rs13266634 and rs16889462 genotypes by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. Forty-eight patients were randomly selected and underwent an 8-week repaglinide treatment (3 mg/d). Fasting plasma glucose (FPG), postprandial plasma glucose (PPG), glycated hemoglobin (HbAlc), fasting serum insulin (FINS), postprandial serum insulin (PINS), homeostasis model assessment for insulin resistance (HOMA-IR), serum triglyceride, total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-c) and high-density lipoprotein-cholesterol (HDL-c) were determined before and after repaglinide treatment. SLC30A8 rs13266634 risk C allele frequency was higher in T2DM patients than in healthy controls (P < 0.05). There was a better repaglinide response on FINS (P < 0.05) and PINS (P < 0.01) in patients with rs13266634 CT+TT genotypes compared with CC genotype carriers. Patients with rs16889462 GA genotype showed an enhanced repaglinide efficacy on FPG (P < 0.01), PPG (P < 0.01) and HbAlc (P < 0.05) compared with GG genotype individuals. SLC30A8 rs13266634 and rs16889462 polymorphisms were associated with repaglinide therapeutic efficacy in Chinese T2DM patients.

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels

PubMed Central

Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels.

PubMed

Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.

The rs3736228 polymorphism in the LRP5 gene is associated with calcaneal ultrasound parameter but not with body composition in a cohort of young Caucasian adults.

PubMed

Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; Rueda-Medina, Blanca

2017-11-01

The aim of the present study was to investigate the possible influence of low-density lipoprotein receptor-related protein 5 (LRP5) and sclerostin (SOST) genes as genetic factors contributing to calcaneal quantitative ultrasound (QUS) and body composition variables in a population of young Caucasian adults. The study population comprised a total of 575 individuals (mean age 20.41years; SD 2.36) whose bone mass was assessed through QUS to determine broadband ultrasound attenuation (BUA, dB/MHz). Body composition measurements were performed using a body composition analyser. Seven single-nucleotide polymorphisms (SNPs) of LRP5 (rs2306862, rs599083, rs556442 and rs3736228) and SOST (rs4792909, rs851054 and rs2023794) were selected as genetic markers and genotyped using TaqMan OpenArray ® technology. Linear regression analysis was used to test the possible association of the tested SNPs with QUS and body composition parameters. Linear regression analysis revealed that the rs3736228 SNP of LPR5 was significantly associated with BUA after adjustment for age, sex, weight, height, physical activity and calcium intake (P = 0.028, β (95% CI) = 0.089 (0.099-1.691). For the remaining SNPs, no significant association with the QUS measurement was observed. Regarding body composition, no significant association was found between LRP5 and SOST polymorphisms and body mass index, total fat mass and total lean mass after adjustment for age and sex as covariates. We concluded that the rs3736228 LRP5 genetic polymorphism influences calcaneal QUS parameter in a population of young Caucasian adults. This finding suggests that LRP5 might be an important genetic marker contributing to bone mass accrual early in life.

Correlation between protein kinase catalytic subunit alpha-1 gene rs13361707 polymorphism and gastric cancer susceptibility in asian populations

PubMed Central

Ni, Jianfeng; Shen, Nan; Tang, Jilei; Ren, Kewei

2017-01-01

A single nucleotide polymorphism (SNP) of the protein kinase catalytic subunit alpha-1 gene (PRKAA1) that confers susceptibility to gastric cancer (GC) was identified by genome-wide association in several case-control studies. However, the results remained controversial and ambiguous. Therefore, we performed a larger meta-analysis to confirm this association. We searched the PubMed, Embase, WanFang, and CNKI databases, without any restriction on language, covering all papers published until Feb 22, 2017. Overall, 14 case-control studies with 14,485 cases and 14,792 controls were retrieved based on the search criteria. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to quantify the strength of the association. Publication bias was assessed by Egger’s and Begg’s tests. We found that the PRKAA1 rs13361707 C/T polymorphism had no association with GC risk in any of the pooled genetic models (for example, the T-allele vs. C-allele allelic contrast model yielded the following estimates: OR = 0.87, 95% CI = 0.73–1.05, Pheterogeneity = 0.000). Furthermore, in analyses stratified by either source of control or geographical origin of subjects, a statistically significant inverse relationship was detected between PRKAA1 rs13361707 C/T polymorphism and GC risk. No obvious evidence of publication bias was detected in the pooled meta-analysis. Furthermore, we observed that individuals carrying T-allele (TT or TC) genotypes had a lower expression of PRKAA1. Our present study indicated that PRKAA1 rs13361707 C/T was not significantly associated with GC risk, despite few positive results in the subgroups. PMID:28978122

Single nucleotide polymorphism coverage and inference of N-acetyltransferase-2 acetylator phenotypes in wordwide population groups.

PubMed

Suarez-Kurtz, Guilherme; Fuchshuber-Moraes, Mateus; Struchiner, Claudio J; Parra, Esteban J

2016-08-01

Several algorithms have been proposed to reduce the genotyping effort and cost, while retaining the accuracy of N-acetyltransferase-2 (NAT2) phenotype prediction. Data from the 1000 Genomes (1KG) project and an admixed cohort of Black Brazilians were used to assess the accuracy of NAT2 phenotype prediction using algorithms based on paired single nucleotide polymorphisms (SNPs) (rs1041983 and rs1801280) or a tag SNP (rs1495741). NAT2 haplotypes comprising SNPs rs1801279, rs1041983, rs1801280, rs1799929, rs1799930, rs1208 and rs1799931 were assigned according to the arylamine N-acetyltransferases database. Contingency tables were used to visualize the agreement between the NAT2 acetylator phenotypes on the basis of these haplotypes versus phenotypes inferred by the prediction algorithms. The paired and tag SNP algorithms provided more than 96% agreement with the 7-SNP derived phenotypes in Europeans, East Asians, South Asians and Admixed Americans, but discordance of phenotype prediction occurred in 30.2 and 24.8% 1KG Africans and in 14.4 and 18.6% Black Brazilians, respectively. Paired SNP panel misclassification occurs in carriers of NATs haplotypes *13A (282T alone), *12B (282T and 803G), *6B (590A alone) and *14A (191A alone), whereas haplotype *14, defined by the 191A allele, is the major culprit of misclassification by the tag allele. Both the paired SNP and the tag SNP algorithms may be used, with economy of scale, to infer NAT2 acetylator phenotypes, including the ultra-slow phenotype, in European, East Asian, South Asian and American populations represented in the 1KG cohort. Both algorithms, however, perform poorly in populations of predominant African descent, including admixed African-Americans, African Caribbeans and Black Brazilians.

Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

PubMed

Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

2014-04-01

Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis.

PubMed

Valdivieso, Paola; Toigo, Marco; Hoppeler, Hans; Flück, Martin

2017-01-01

Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise.

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

PubMed Central

Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

2018-01-01

Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

Interaction of TLR-IFN and HLA polymorphisms on susceptibility of chronic HBV infection in Southwest Han Chinese.

PubMed

He, Dengming; Tao, Shiqi; Guo, Shimin; Li, Maoshi; Wu, Junqiu; Huang, Hongfei; Guo, Xinwu; Yan, Guohua; Zhu, Peng; Wang, Yuming

2015-08-01

The toll-like receptor-interferon (TLR-IFN) signalling pathway plays a crucial role in HBV infection. Human leucocyte antigen (HLA) polymorphisms are associated with chronic HBV infection by genome wide association study (GWAS). We aimed to explore interaction between TLR-IFN and HLA gene polymorphisms in susceptibility of chronic HBV infection. In the Chinese Southwest Han population, 1191 chronic HBV infection patients and 273 HBV clearance were selected. A total of 39 single nucleotide polymorphism loci in 23 genes of the TLR-IFN pathway and four HLA polymorphism loci associated with chronic HBV infection identified by GWAS were selected for genotyping. SNPStats, QVALUE, and multifactor dimensionality reduction were used for statistical analysis. A significant association was seen in several of the TLR-IFN pathway genes, TLR9 rs352140 (OR = 0.70, P = 0.0088), IL1B rs16944 (OR = 0.67, P = 0.016), IL12B rs3212227 (OR = 1.38, P = 0.021), IFNGR1 rs3799488 (OR = 1.48, P = 0.0048), IFNGR2 rs1059293 (OR = 0.27, P = 0.011), MX1 rs467960 (OR = 0.68, P = 0.022), as well as four loci in HLA, rs3077 (OR = 0.55, P < 0.0001), rs2856718 (OR = 0.60, P = 4e-04), rs9277535 (OR = 0.54, P < 0.0001) and rs7453920 (OR = 0.43, P < 0.0001). A synergistic relationship was seen between rs9277535 and rs16944 (0.13%), rs1143623 and rs6613 (0.10%). The combination of rs9277535 in HLA and rs16944 in IL1B was the best model to predict chronic HBV infection (testing accuracy = 0.6040, P = 0.0010, cross-validation consistency = 10/10). TLR-IFN pathway gene polymorphisms are associated with chronic HBV infection. Interactions with polymorphisms in these genes may be one mechanism by which HLA polymorphisms influence susceptibility to chronic HBV infection, as specific single nucleotide polymorphism combinations are highly predictive of chronic HBV infection. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.

Role of six single nucleotide polymorphisms, risk factors in coronary disease, in OLR1 alternative splicing

PubMed Central

Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan

2015-01-01

The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137

Single nucleotide polymorphisms related to cystic fibrosis in chronic rhinositus-a pilot study.

PubMed

Hull, Benjamin P; Jiramongkolchai, Pawina; Turner, Justin H; Olson, Lana; Chandra, Rakesh K

2017-05-01

The clinical association between cystic fibrosis (CF) and chronic rhinosinusitis (CRS) is well known. Studies have identified several non-CF transmembrane conductance regulator single nucleotide polymorphisms (SNPs) associated with disease severity in CF patients. We hypothesized that prevalence of these SNPs would be different between CRS patients and age/gender-matched non-CRS controls. This is a targeted SNP study of 1231 CRS patients identified through a large university hospital database who were compared with 8796 age- and gender-matched controls without a history of rhinitis, sinusitis, allergies, or asthma. Prevalence of 5 relevant SNPs was compared between groups, with p < 0.05 considered significant. Stratification by race and gender was performed among groups when statistically appropriate. CRS patients exhibited a statistically significant (p = 0.036) lower prevalence of rs12883884 (associated with an ion transporter) compared with controls. This association was lost when patients were stratified by race. CRS patients manifested a greater prevalence of rs1403543 (chromosome 23) in both Caucasian and African American subgroups (p = 0.036 and p = 0.026, respectively). Statistical significance disappeared among Caucasians when stratified by gender, but persisted among African American women (p = 0.047). rs12188164 and rs12793173 were both more prevalent in African Americans with CRS than controls (p = 0.042 and p = 0.020, respectively). A trend was also observed for decreased prevalence of rs12883884 in CRS patients compared with controls in the African American subgroup (p = 0.086). The identified SNPs were differentially prevalent in CRS compared with control groups, with some variability as a function of race and gender. Further research is required to confirm these findings and elucidate clinical significance. © 2017 ARS-AAOA, LLC.

Paraoxonase-1 (PON1) rs662 Polymorphism and Its Association with Serum Lipid Levels and Longevity in the Bama Zhuang Population.

PubMed

Li, You; Liang, Guiyun; Shi, Liwei; Liang, Xue; Long, Bingshuang; Qin, Jian; Zhang, Zhiyong

2016-12-27

BACKGROUND The present study was performed to identify the association of PON1 rs662 polymorphism with serum lipid levels and human longevity in the Bama Zhuang population. MATERIAL AND METHODS PON1 genotypes were determined by Taqman SNP Genotyping Assays in 110 long-lived inhabitants (longevity group, aged 90-110 years), 110 healthy inhabitants in Bama County (control 1 group, aged 43-82 years) and 110 healthy inhabitants in Nandan County (control 2 group, aged 28-82 years) without family history of longevity. RESULTS BMI (body mass index) and TG (serum total triglyceride) level were lower in the longevity group than in the two control groups, while the contents of serum LDL-c (low-density lipoprotein cholesterol) and HDL-c (high-density lipoprotein cholesterol) and the levels of SBP (systolic blood pressure) and DBP (diastolic blood pressure) in the longevity group were higher than in the two control groups (p<0.01). Significant differences in the frequencies of three genotypes (GG, AG, and AA) were observed between the longevity group and control 2 group (χ²=15.190, p=0.001). The minor allele frequency (MAF) of rs662 was significantly higher in the longevity group than in the two control groups. The levels of HDL-c in the longevity group were different among the three genotypes (p<0.05). The levels of TG for GG and GG+AG genotypes were significantly different, while the levels of TC (total cholesterol) and HDL-c for AG and GG+AG genotypes were significantly different among the three groups (p<0.05). Serum lipid parameters were correlated with several environmental factors, including age, gender, DBP, SBP, and BMI. The association of PON1 rs662 polymorphism and serum lipid levels was different among the three groups. CONCLUSIONS PON1 polymorphism might be one of the genetic factors of longevity in the Bama Zhuang population. The PON1 rs662 SNP (single nucleotide polymorphism) was associated with serum HDL-c levels in the longevity group.

Replication of endometriosis-associated single-nucleotide polymorphisms from genome-wide association studies in a Caucasian population.

PubMed

Sundqvist, J; Xu, H; Vodolazkaia, A; Fassbender, A; Kyama, C; Bokor, A; Gemzell-Danielsson, K; D'Hooghe, T M; Falconer, H

2013-03-01

Is it possible to replicate the previously identified genetic association of four single-nucleotide polymorphisms (SNPs), rs12700667, rs7798431, rs1250248 and rs7521902, with endometriosis in a Caucasian population? A borderline association was observed for rs1250248 and endometriosis (P = 0.049). However, we could not replicate the other previously identified endometriosis-associated SNPs (rs12700667, rs7798431 and rs7521902) in the same population. Endometriosis is considered a complex disease, influenced by several genetic and environmental factors, as well as interactions between them. Previous studies have found genetic associations with endometriosis for SNPs at the 7p15 and 2q35 loci in a Caucasian population. Allele frequencies of SNPs were investigated in patients with endometriosis and controls. Blood samples and peritoneal biopsies were taken from a Caucasian female population consisting of 1129 patients with endometriosis and 831 controls. DNA was extracted for genotyping. The study was performed at a University hospital and research laboratories. A weak association with endometriosis (all stages) was observed for rs1250248 (P = 0.049). No significant associations were observed for the SNPs rs12700667, rs7798431 and rs7521902. A non-significant trend towards the association of rs1250248 with moderate/severe endometriosis was observed (odds ratio 1.18, 95% confidence interval 0.97-1.44). The inability to confirm all previous findings may result from differences between populations and type II errors. Our result demonstrates the difficulty of identifying common genetic variants in complex diseases. This study was supported by grants from the Karolinska Institutet and Stockholm City County/Karolinska Institutet (ALF), Stockholm, Sweden, Swedish Medical Research Council (K2007-54X-14212-06-3, K2010-54X-14212-09-3), Stockholm, Sweden, Leuven University Research Council (Onderzoeksraad KU Leuven), the Leuven University Hospitals Clinical Research Foundation

Identification of Candidate Single-Nucleotide Polymorphisms in NRXN1 Related to Antipsychotic Treatment Response in Patients with Schizophrenia

PubMed Central

Jenkins, Aaron; Apud, José A; Zhang, Fengyu; Decot, Heather; Weinberger, Daniel R; Law, Amanda J

2014-01-01

Neurexins are presynaptic neuronal adhesion molecules that interact with postsynaptic neuroligins to form an inter-synaptic complex required for synaptic specification and efficient neurotransmission. Deletions and point mutations in the neurexin 1 (NRXN1) gene are associated with a broad spectrum of neuropsychiatric and neurodevelopmental disorders, including autism, intellectual disability, epilepsy, developmental delay, and schizophrenia. Recently, small nucleotide polymorphisms in NRXN1 have been associated with antipsychotic drug response in patients with schizophrenia. Based on previous suggestive evidence of an impact on clozapine response in patients with schizophrenia, we conducted an association study of NRXN1 polymorphisms (rs12467557 and rs10490162) with antipsychotic treatment response in 54 patients with schizophrenia in a double blind, placebo-controlled NIMH inpatient crossover trial and examined for association with risk for schizophrenia in independent case-control and family-based clinical cohorts. Pharmacogenetic analysis in the placebo controlled trial revealed significant association of rs12467557and rs10490162 with drug response, whereby individuals homozygous for the A allele, at either SNP, showed significant improvement in positive symptoms, general psychopathology, thought disturbance, and negative symptoms, whereas patients carrying the G allele showed no overall response. Although we did not find evidence of the same NRXN1 SNPs being associated with results of the NIMH sponsored CATIE trial, other SNPs showed weakly positive signals. The family and case-control analyses for schizophrenia risk were negative. Our results provide confirmatory evidence of genetically determined differences in drug response in patients with schizophrenia related to NRXN1 variation. Furthermore, these findings potentially implicate NRXN1 in the therapeutic actions of antipsychotic drugs. PMID:24633560

Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

PubMed

Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

2016-01-01

Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p rs11628722 polymorphism in SERPINA9 was associated with incident stroke in Whites and Blacks, even after taking into account traditional risk factors. The idea that ischemic stroke and CHD may share some common genetic factors, such as variation in SERPINA9, should be investigated in other studies. Copyright 2008 S. Karger AG, Basel.

Multiple single nucleotide polymorphism analysis and association of specific genotypes in FHIT, SAMD4A, and ANKRD17 in Indian patients with oral cancer.

PubMed

D'Souza, Wendy; Pradhan, Sultan; Saranath, Dhananjaya

2017-08-01

Oral cancer has a high incidence primarily because of tobacco chewing habits. However, a small proportion of habitués develop oral cancer, implying a role for genomic variants in its susceptibility. Thirteen single nucleotide polymorphisms (SNPs) in an Indian cohort comprising patients with oral cancer (n = 500) and healthy controls (n = 500) were genotyped using allelic discrimination real-time polymerase chain reaction (PCR). Prevalence of SNPs rs11130760, rs1957358, rs2306058, rs4883543, rs12637722, rs1457115, rs2353292, rs709821, rs2194861, rs4789378, rs3827538, rs2667552, and rs2886093 was determined in the Indian cohort. A significant association of rs11130760 GG (odds ratio [OR] 1.41; 95% confidence interval [CI] 1.08-1.84) and rs1957358 TT (OR 1.44; 95% CI 1.10-1.90) indicated increased risk; whereas rs1957358 TC (OR 0.67; 95% CI 0.53-0.87) and rs2306058 CT (OR 0.72; 95% CI 0.56-0.93) reflected decreased risk. The SNP rs11130760 wild-type (WT) allele G indicated an increased risk for oral cancer (OR 1.38; 95% CI 1.09-1.73), whereas SNP allele T indicated a decreased risk (OR 0.73; 95% CI 0.58-0.92) for oral cancer. Our study identified SNPs with susceptibility to oral cancer in high-risk populations. © 2017 Wiley Periodicals, Inc.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

PubMed

Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

2017-09-01

OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui

2011-07-15

Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP

Assessment of the rs4340 ACE gene polymorphism in acute coronary syndrome in a Western Mexican population.

PubMed

Valdez-Haro, A; Valle, Y; Valdes-Alvarado, E; Casillas-Muñoz, F; Muñoz-Valle, J F; Reynoso-Villalpando, G L; Flores-Salinas, H E; Padilla-Gutiérrez, J R

2017-09-27

Acute coronary syndrome (ACS) is considered one of the main causes of death worldwide. Contradictory findings concerning the impact of the angiotensin-converting enzyme (ACE) gene on cardiovascular diseases have been reported. Previous conclusions point out that the variability in results depends on ethnicity and genetic polymorphisms to determine the association of rs4340 polymorphisms of the ACE gene and ACE circulating levels in ACS. Genotyping of rs4340 polymorphisms was performed in a total of 600 individuals from Western Mexico divided into two groups: the ACS and the control group (CG). The polymorphisms were identified by polymerase chain reaction. Serum ACE concentration was determined by enzyme-linked immunosorbent assay. D/D carriers had higher ACE levels than I/I carriers (3.6 vs 2.8 ng/mL, P < 0.0021) in the CG. The D/D genotype of the rs4340 polymorphism is associated with higher ACE concentration levels; however, the polymorphism was not associated with ACS.

Face and emotion expression processing and the serotonin transporter polymorphism 5-HTTLPR/rs22531.

PubMed

Hildebrandt, A; Kiy, A; Reuter, M; Sommer, W; Wilhelm, O

2016-06-01

Face cognition, including face identity and facial expression processing, is a crucial component of socio-emotional abilities, characterizing humans as highest developed social beings. However, for these trait domains molecular genetic studies investigating gene-behavior associations based on well-founded phenotype definitions are still rare. We examined the relationship between 5-HTTLPR/rs25531 polymorphisms - related to serotonin-reuptake - and the ability to perceive and recognize faces and emotional expressions in human faces. For this aim we conducted structural equation modeling on data from 230 young adults, obtained by using a comprehensive, multivariate task battery with maximal effort tasks. By additionally modeling fluid intelligence and immediate and delayed memory factors, we aimed to address the discriminant relationships of the 5-HTTLPR/rs25531 polymorphisms with socio-emotional abilities. We found a robust association between the 5-HTTLPR/rs25531 polymorphism and facial emotion perception. Carriers of two long (L) alleles outperformed carriers of one or two S alleles. Weaker associations were present for face identity perception and memory for emotional facial expressions. There was no association between the 5-HTTLPR/rs25531 polymorphism and non-social abilities, demonstrating discriminant validity of the relationships. We discuss the implications and possible neural mechanisms underlying these novel findings. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

The KSR2-rs7973260 Polymorphism is Associated with Metabolic Phenotypes, but Not Psychological Phenotypes, in Chinese Elders.

PubMed

Wang, Yong; Ma, Teng; Zhu, Yin-Sheng; Chu, Xue-Feng; Yao, Shun; Wang, Hong-Fei; Cai, Jian; Wang, Xiao-Feng; Jiang, Xiao-Yan

2017-07-01

To examine the associations between genetic variants of KSR2 (kinase suppressor of RAS)-rs7973260, RAPGEF6 (guanine nucleotide exchange factor 6)-rs3756290, LOC105377703-rs4481363, and subjective well-being (SWB) and depressive symptoms (DSs) in Chinese elders, which were recently associated in a genome-wide association study conducted in Caucasians. The pleiotropic effects of KSR2-rs7973260 on metabolic phenotypes were also explored. We used data from 1788 older individuals aged 70-84 years from the aging arm of the Rugao Longevity and Aging Study, a population-based cohort study conducted in the Jiangsu province of China. No significant distributions of genotype frequencies were observed between life-satisfied and -unsatisfied groups across those with the three polymorphisms. The level of SWB components (positive affect, negative affect, and affect balance) and DSs did not differ among genotypes of the three variants. However, the presence of GA+AA of KSR2-rs7973260 was significantly higher in the metabolic syndrome (MetS), severe hypertriglyceridemia (HTG), and diabetes groups than in control groups (43.7% vs. 37.6%, 46.4% vs. 37.6%, 45.8% vs. 37.9%, respectively). The A allele of rs7973260 was associated with increased risk of MetS, severe HTG, and diabetes with an odds ratios (95% confidence intervals) of 1.289 (1.002-1.658), 1.438 (1.076-1.921), and 1.384 (1.022-1.875), which remained significant after multiple adjustments. Rs7973260, rs3756290, and rs4481363 were not associated with SWB and DSs in Chinese elders. However, the KSR2-rs7973260 A allele exhibited pleiotropic effects on some metabolic phenotypes in Chinese elders. These effects should be validated in future studies.

Association Between 17q12-21 Variants and Asthma in Japanese Women: rs11650680 Polymorphism as Potential Genetic Marker for Asthma

PubMed Central

Tanaka, Keiko; Arakawa, Masashi

2014-01-01

Epidemiological evidence on the relationship between single-nucleotide polymorphisms (SNPs) rs7216389 and rs11650680 on chromosome 17q12-21 and asthma is inconsistent. We examined this issue in young adult Japanese women. Case subjects were 202 women who had been diagnosed with asthma by a doctor, while 1290 women without doctor-diagnosed asthma served as control subjects. Adjustments were made for age and the presence of older siblings. There were no significant associations between SNP rs7216389 and asthma. Compared with the CC genotype of SNP rs11650680, the CT genotype, but not the TT genotype, was significantly inversely associated with asthma: the adjusted odds ratio for the CT genotype was 0.67 (95% confidence interval: 0.46–0.96). This inverse relationship was significant in women with late-onset asthma, but not in those with early-onset asthma. Under the dominant model, a significant inverse association was found between rs11650680 and asthma in women without older siblings, but not in those with older siblings; the interaction, however, was not significant. This is the first study to show that the CT genotype of SNP rs11650680 was significantly inversely associated with asthma, especially adult-onset asthma. We could not find evidence for interactions between rs11650680 and older siblings affecting asthma. PMID:24735179

Interleukin-1β rs1143627 polymorphism with susceptibility to periodontal disease

PubMed Central

Huang, Wei; He, Bing-Yang; Shao, Jun; Jia, Xiao-Wei; Yuan, Ya-Di

2017-01-01

Association between interleukin-1 beta (IL-1β) rs1143627 polymorphism and periodontal disease susceptibility was inconsistent; hence we performed this meta-analysis to explore the precise correlation between them. The degree of association was appraised through calculating pooled odds ratio (OR) and its 95% confidence interval (CI). The databases known as PubMed, Embase, and Chinese National Knowledge Infrastructure were searched up to October 26, 2016. A total of 8 eligible case-control studies were finally included, which involved 229 aggressive periodontitis patients, 382 chronic periodontitis patients, and 555 healthy controls. All the five genetic models revealed a non-significant association between IL-1β rs1143627 polymorphism and periodontal disease susceptibility (TT vs. CC: OR = 1.22, 95% CI = 0.80-1.87; CT+TT vs. CC: OR = 0.66, 95% CI = 0.44-1.01; TT vs. CT + CC: OR = 1.19, 95% CI = 0.81-1.74; T vs. C: OR = 0.92, 95% CI = 0.81-1.12; CT vs. CC: OR = 0.92, 95% CI = 0.69-1.23). Sensitivity analyses indicated that the results were robust and the subgroup analyses reached similar conclusions. IL-1β rs1143627 polymorphism is not related to periodontal disease susceptibility in the overall population based on the current evidence, but further studies are required in more large scale sample size with risk factor adjusted. PMID:28404906

Single nucleotide polymorphisms in the Trx2/TXNIP and TrxR2 genes of the mitochondrial thioredoxin antioxidant system and the risk of diabetic retinopathy in patients with Type 2 diabetes mellitus.

PubMed

Ramus, Sara Mankoc; Cilensek, Ines; Petrovic, Mojca Globocnik; Soucek, Miroslav; Kruzliak, Peter; Petrovic, Daniel

2016-03-01

Oxidative stress plays an important role in the pathogenesis of diabetes and its complications. The aim of this study was to examine the possible association between seven single nucleotide polymorphisms (SNPs) of the Trx2/TXNIP and TrxR2 genes encoding proteins involved in the thioredoxin antioxidant defence system and the risk of diabetic retinopthy (DR). Cross-sectional case-control study. A total of 802 Slovenian patients with Type 2 diabetes mellitus; 277 patients with DR and 525 with no DR were enrolled. Patients genotypes of the SNPs; including rs8140110, rs7211, rs7212, rs4755, rs1548357, rs4485648 and rs5748469 were determined by the competitive allele specific PCR method. Each genotype of examined SNPs was regressed in a logistic model, assuming the co-dominant, dominant and the recessive models of inheritance with covariates of duration of diabetes, HbA1c, insulin therapy, total cholesterol and LDL cholesterol levels. In the present study, for the first time we identified an association between the rs4485648 polymorphism of the TrxR2 gene and DR in Caucasians with Type 2 DM. The estimated ORs of adjusted logistic regression models were found to be as follows: 4.4 for CT heterozygotes, 4.3 for TT homozygotes (co-dominant genetic model) and 4.4 for CT+TT genotypes (dominant genetic model). In our case-control study we were not able to demonstrate any association between rs8140110, rs7211, rs7212, rs4755, rs1548357, and rs5748469 and DR, however, our findings provide evidence that the rs4485648 polymorphism of the TrxR2 gene might exert an independent effect on the development of DR. Copyright © 2016 Elsevier Inc. All rights reserved.

T/T homozygosity of the tenascin-C gene polymorphism rs2104772 negatively influences exercise-induced angiogenesis

PubMed Central

Toigo, Marco; Hoppeler, Hans

2017-01-01

Background Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Methods Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Results Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Conclusion Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise. PMID:28384286

HOTAIR gene polymorphisms contribute to increased neuroblastoma susceptibility in Chinese children.

PubMed

Yang, Xu; He, Jing; Chang, Yitian; Luo, Annie; Luo, Ailing; Zhang, Jiao; Zhang, Ruizhong; Xia, Huimin; Xu, Ling

2018-06-15

Neuroblastoma is the most frequently diagnosed extracranial solid tumor in children. Previous studies have shown that single-nucleotide polymorphisms in some genes are associated with the risk of multiple cancers, including neuroblastoma. Although Hox transcript antisense intergenic RNA (HOTAIR) gene polymorphisms have been investigated in a variety of cancers, to the authors' knowledge the relationships between HOTAIR gene polymorphisms and neuroblastoma susceptibility have not been reported to date. The objective of the current study was to evaluate the correlation between HOTAIR gene polymorphisms and neuroblastoma risk in Chinese children. The authors genotyped 6 polymorphisms (rs920778 A>G, rs12826786 C>T, rs4759314 A>G, rs7958904 G>C, rs874945 C>T, and rs1899663 C>A) of the HOTAIR gene in 2 Chinese populations including 393 neuroblastoma cases and 812 healthy controls. The strength of the associations was evaluated using odds ratios and 95% confidence intervals. Further stratification analyses were conducted to explore the association between the HOTAIR gene polymorphisms rs12826786 C>T, rs874945 C>T, and rs1899663 C>A with neuroblastoma susceptibility in terms of age, sex, clinical stage of disease, and sites of origin. The authors found that the rs12826786 C>T (P =.013), rs874945 C>T (P =.020), and rs1899663 C>A (P =.029) polymorphisms were significantly associated with increased neuroblastoma risk. In stratification analyses, these associations were more predominant in females and among patients with tumor in the retroperitoneal region or mediastinum. The remaining 3 polymorphisms were not found to be related to neuroblastoma susceptibility. The results of the current study verified that HOTAIR gene polymorphisms are associated with increased neuroblastoma risk and suggest that HOTAIR gene polymorphisms might be a potential biomarker for neuroblastoma susceptibility. Cancer 2018;124:2599-606. © 2018 American Cancer Society. © 2018 American Cancer Society.

Association of single nucleotide polymorphisms in VDR and DBP genes with HBV-related hepatocellular carcinoma risk in a Chinese population.

PubMed

Peng, Qiliu; Yang, Shi; Lao, Xianjun; Li, Ruolin; Chen, Zhiping; Wang, Jian; Qin, Xue; Li, Shan

2014-01-01

Polymorphisms of genes encoding components of the vitamin D pathway including vitamin D receptor (VDR) and vitamin D binding protein (DBP) have been widely investigated because of the complex role played by vitamin D in cancer tumorogenesis. In this study, we investigated the association between VDR and DBP gene polymorphisms and HBV-related HCC risk in a Chinese population. Study subjects were divided into three groups: 184 HBV patients with HCC, 296 HBV patients without HCC, and 180 healthy controls. The VDR rs2228570, and rs3782905 and the DBP rs7041 polymorphisms were genotyped using PCR-RFLP and the VDR rs11568820 polymorphism was genotyped by PCR-SSP, respectively. DNA sequencing was performed to validate the genotype results. We found that there were significant differences in the genotype and allele frequencies of the VDR rs2228570 and DBP rs7041 polymorphisms between HBV patients with HCC and healthy controls. The rs2228570 T allele was associated with a significant increased HBV-related HCC risk as compared with the C allele. The rs2228570 TT and TT/TC genotypes were correlated with a significant increased HBV-related HCC risk when compared with the wild-type CC homozygote. Similarly, the rs7041 G allele was associated with a significant increased HBV-related HCC risk as compared with the T allele. The rs7041 GG and GG/TG genotypes were correlated with a significant increased HBV-related HCC risk when compared with the wild-type TT homozygote. However, we did not observe any significant effect of VDR rs11568820, and rs3782905 polymorphisms on HBV-related HCC risk in this population. In haplotype analysis, we also did not find any significant differences in haplotype frequencies of the VDR gene between HBV patients with HCC and the healthy controls. We conclude that the VDR rs2228570 and DBP rs7041 polymorphisms may contribute to increased susceptibility to HBV-related HCC in the Chinese population. Due to the marginal significance, further large and well

High resolution melting curve assay for detecting rs12979860 IL28B polymorphisms involved in response of Iranian patients to chronic hepatitis C treatment.

PubMed

Fateh, Abolfazl; Aghasadeghi, Mohammad Reza; Keyvani, Hossein; Mollaie, Hamid Reza; Yari, Shamsi; Hadizade Tasbiti, Ali Reza; Ghazanfari, Morteza; Monavari, Seyed Hamid Reza

2015-01-01

A recent genome-wide association study (GWAS) on patients with chronic hepatitis C (CHC) treated with peginterferon and ribavirin (pegIFN-α/RBV) identified a single nucleotide polymorphism (SNP) on chromosome 19 (rs12979860) which was strongly associated with a sustained virological response (SVR). The aim of this study was twofold: to study the relationship between IL28B rs12979860 and sustained virological response (SVR) to pegIFN-α/RVB therapy among CHC patients and to detect the rs12979860 polymorphism by high resolution melting curve (HRM) assay as a simple, fast, sensitive, and inexpensive method. The study examined outcomes in 100 patients with chronic hepatitis C in 2 provinces of Iran from December 2011 to June 2013. Two methods were applied to detect IL28B polymorphisms: PCR-sequencing as a gold standard method and HRM as a simple, fast, sensitive, and inexpensive method. The frequencies of IL28B rs12979860 CC, CT, and TT alleles in chronic hepatitis C genotype 1a patients were 10% (10/100), 35% (35/100), and 6% (6/100) and in genotype 3a were 13% (13/100), 31% (31/100), and 5% (5/100), respectively. In genotype 3a infected patients, rs12979860 (CC and CT alleles) and in genotype 1a infected patients (CC allele) were significantly associated with a sustained virological response (SVR). The SVR rates for CC, CT and TT (IL28B rs12979860) were 18%, 34% and 4%, respectively. Multiple logistic regression analysis identified two independent factors that were significantly associated with SVR: IL-28B genotype (rs 12979860 CC vs TT and CT; odds ratio [ORs], 7.86 and 4.084, respectively), and HCV subtype 1a (OR, 7.46). In the present study, an association between SVR rates and IL28B polymorphisms was observed. The HRM assay described herein is rapid, inexpensive, sensitive and accurate for detecting rs12979860 alleles in CHC patients. This method can be readily adopted by any molecular diagnostic laboratory with HRM capability and will be clinically beneficial

Association of N-acetyltransferase-2 and glutathione S-transferase polymorphisms with idiopathic male infertility in Vietnam male subjects.

PubMed

Trang, Nguyen Thi; Huyen, Vu Thi; Tuan, Nguyen Thanh; Phan, Tran Duc

2018-04-25

N-acetyltransferase-2 (NAT2) and Glutathione S-transferases (GSTs) are phase-II xenobiotic metabolizing enzymes participating in detoxification of toxic arylamines, aromatic amines, hydrazines and reactive oxygen species (ROS), which are produced under oxidative and electrophile stresses. The purpose of this research was to investigate whether two common single-nucleotide polymorphisms (SNP) of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) associated with susceptibility to idiopathic male infertility. A total 300 DNA samples (150 infertile patients and 150 healthy control) were genotyped for the polymorphisms by ARMS - PCR. We revealed a significant association between the NAT2 variant genotypes (CT + TT (rs1799929), (OR: 3.74; p < 0.001)) and (GA + AA (rs1799930), (OR: 3.75; p < 0.001)) or GSTP1 variant genotypes (GA + AA (rs1695), (OR: 5.11; p < 0,001)) and (CT + TT (rs1138272), (OR: 7.42; p < 0,001) with idiopathic infertility risk. Our findings rate the effect of single-nucleotide polymorphisms of GSTP1 and/or NAT2 in modulation of the risk of male infertility in subjects from Vietnam. This pilot study is the first (as far as we know) to reveal that polymorphisms of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) are some novel genetic markers for susceptibility to idiopathic male infertility. Copyright © 2018 Elsevier B.V. All rights reserved.

Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

PubMed

Arruda, Mônica Barcellos; Campagnari, Francine; de Almeida, Tailah Bernardo; Couto-Fernandez, José Carlos; Tanuri, Amilcar; Cardoso, Cynthia Chester

2016-01-01

Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME) influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs) in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs), and 8 to protease inhibitors (PIs) containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001), while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009). Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

PubMed

Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

2016-04-01

Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

PubMed Central

Urschitz, Johann; Sultan, Omar; Ward, Kenneth

2011-01-01

Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

PubMed Central

2013-01-01

Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents.

PubMed

Zaharan, Nur Lisa; Muhamad, Nor Hanisah; Jalaludin, Muhammad Yazid; Su, Tin Tin; Mohamed, Zahurin; Mohamed, M N A; A Majid, Hazreen

2018-01-01

Several non-synonymous single-nucleotide polymorphisms (nsSNPs) have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA) in relation to adiposity parameters among adolescents in Malaysia. We examined whether (a) PA and (b) selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study ( n  = 1,151). Body mass indices, waist-hip ratio, and percentage body fat (% BF) were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C). Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3) rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS). Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model. PAQ-C scores were associated with % BF (β = -0.44 [95% confidence interval -0.72, -0.16], p  = 0.002). The CC genotype of ADRB3 rs4994 (β = -0.16 [-0.28, -0.05], corrected p  = 0.01) and AA genotype of MC3R rs3827103 (β = -0.06 [-0.12, -0.00], p  = 0.02) were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = -0.05 [-0.10, -0.01], p  = 0.02) and combined GRS (β = -0.03 [-0.04, -0.01], p  = 0.01) for % BF. Higher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention in this population.

Associations between the rs6010620 polymorphism in RTEL1 and risk of glioma: a meta-analysis of 20,711 participants.

PubMed

Wu, Yao; Tong, Xiang; Tang, Ling-Li; Zhou, Kai; Zhong, Chuan-Hong; Jiang, Shu

2014-01-01

Associations between the rs6010620 polymorphism in the regulator of telomere elongation helicase1 (RTEL1) gene and glioma have been widely reported but the results were not inconclusive. The aim of the current study was to investigate the association between the rs6010620 polymorphism in RTEL1 gene and risk of glioma by meta-analysis. We searched PubMed, Embase, Wanfang Weipu and CNKI (China National Knowledge Infrastructure) databases, which included all research published 05 May 2014. A total of 8,292 cases and 12,419 controls from 14 case-control studies involving the rs6010620 polymorphism in the RTEL1 gene were included. Statistical analysis was performed using STATA 12.0 software. The results indicated that the rs6010620 polymorphism in RTEL1 gene was indeed associated with risk of glioma (OR=1.474, 95%CI=1.282-1.694, p<0.001). On subgroup analysis by ethnicity, we found associations between the rs6010620 polymorphism in the RTEL1 gene and risk of glioma in both Caucasians and Asians. The current meta-analysis suggested that the rs6010620 polymorphism in the RTEL1 gene might increase risk of glioma. In future, larger case-control studies are needed to confirm our results.

Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study

PubMed Central

Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjuan; Li, Shanqu

2015-01-01

Background Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. Material/Methods In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Results Using the χ2 test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes “CC” of rs2297440 and “GG” of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Conclusions Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population. PMID:26156397

Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study.

PubMed

Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjun; Li, Shanqu

2015-07-09

Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Using the χ(2) test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes "CC" of rs2297440 and "GG" of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population.

Genes determining the severity of cerebral palsy: the role of single nucleotide polymorphisms on the amount and structure of apolipoprotein E

PubMed Central

Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein

2015-01-01

Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783

Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

PubMed

Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

2017-04-01

In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

Association of interleukin-1 family cytokines single nucleotide polymorphisms with susceptibility to systemic sclerosis: an independent case-control study and a meta-analysis.

PubMed

Huang, Xiao-Lei; Wu, Guo-Cui; Wang, Yu-Jie; Yang, Xiao-Ke; Yang, Guo-Jun; Tao, Jin-Hui; Duan, Yu; Yan, Jun-Wei; Li, Xiang-Pei; Ye, Dong-Qing; Wang, Jing

2016-08-01

The aim of our study was to investigate the association of five single nucleotide polymorphisms in interleukin-1 (IL-1) gene with susceptibility to systemic sclerosis (SSc) in a Chinese population. A total of 58 SSc patients and 113 healthy controls were enrolled. TaqMan allele discrimination assay was performed to detect the genotyping of IL-1A -889C/T (rs1800587), IL-1B -511C/T (rs16944), IL-18 -607C/A (rs1946518), IL-18 -137G/C (rs187238) and IL-33 rs7044343. The association between these SNPs and SSc risk was analyzed. Furthermore, a meta-analysis of relevant studies on the association of IL-1A -889C/T (rs1800587) and IL-1B -511C/T (rs16944) with the susceptibility to SSc was performed. Through the genotyping, significant associations for SSc were found for: IL-1A -889C/T genotype frequencies (P = 0.000), dominant model (P = 0.000), recessive model (P = 0.001) and allele T frequency (P = 0.000). Among SSc patients, dyspnea was significantly associated with IL-18 -607C/A genotype frequency and IL-33 rs7044343 allele frequency (P = 0.037, P = 0.042, respectively). In addition, elevated erythrocyte sedimentation rate was significantly associated with IL-18 -137G/C (rs187238) genotype and allele frequency (P = 0.019, P = 0.006, respectively). While meta-analysis showed there was no significant association between IL-1A -889C/T polymorphism and SSc, for IL-1B -511C/T (rs16944), significant associations were found in the comparison of allele C versus T (OR 1.267, 95 % CI 1.016-1.580) by combined different outcomes. Results showed that IL-1A -889C/T (rs1800587) was associated with SSc susceptibility in the Chinese population. However, this association was not supported by a meta-analysis of all relevant studies. Further investigations are required to verify our findings.

Single Nucleotide Polymorphisms in the TP53 Region and Susceptibility to Invasive Epithelial Ovarian Cancer

PubMed Central

Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat

2009-01-01

The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375

Association of Single-Nucleotide Polymorphisms in IL28B, but Not TNF-α, With Severity of Disease Caused by Andes Virus

PubMed Central

Angulo, Jenniffer; Pino, Karla; Echeverría-Chagas, Natalia; Marco, Claudia; Martínez-Valdebenito, Constanza; Galeno, Héctor; Villagra, Eliecer; Vera, Lilian; Lagos, Natalia; Becerra, Natalia; Mora, Judith; Bermúdez, Andrea; Cárcamo, Marcela; Díaz, Janepsy; Miquel, Juan Francisco; Ferrés, Marcela; López-Lastra, Marcelo

2015-01-01

Background. Andes virus (ANDV) is the sole etiologic agent of hantavirus cardiopulmonary syndrome (HCPS) in Chile, with a fatality rate of about 35%. Individual host factors affecting ANDV infection outcome are poorly understood. In this case-control genetic association analysis, we explored the link between single-nucleotide polymorphisms (SNPs) rs12979860, rs8099917 and rs1800629 and the clinical outcome of ANDV-induced disease. The SNPs rs12979860 and rs8099917 are known to play a role in the differential expression of the interleukin 28B gene (IL28B), whereas SNP rs1800629 is implicated in the expression of tumor necrosis factor α gene (TNF-α). Methods. A total of 238 samples from confirmed ANDV-infected patients collected between 2006 and 2014, and categorized according to the severity of the disease, were genotyped for SNPs rs12979860, rs8099917, and rs1800629. Results. Analysis of IL28B SNPs rs12979860 and rs8099917 revealed a link between homozygosity of the minor alleles (TT and GG, respectively), displaying a mild disease progression, whereas heterozygosity or homozygosity for the major alleles (CT/CC and TG/TT, respectively) in both IL28B SNPs is associated with severe disease. No association with the clinical outcome of HCPS was observed for TNF-α SNP rs1800629 (TNF −308G>A). Conclusions. The IL28B SNPs rs12979860 and rs8099917, but not TNF-α SNP rs1800629, are associated with the clinical outcome of ANDV-induced disease, suggesting a possible link between IL28B expression and ANDV pathogenesis. PMID:26394672

Rs1914663 of SFTPA 1 gene is associated with pediatric tuberculosis in Han Chinese population.

PubMed

Li, Jieqiong; Qi, Hui; Sun, Lin; Shen, Chen; Jiao, Weiwei; Xu, Fang; Xiao, Jing; Shen, Adong

2016-07-01

Surfactant protein A (SP-A), a part of the innate immune system of the lung, performs a vital role in the host defense against Mycobacterium tuberculosis (MTB) infection. In order to investigate the relationship between SFTPA polymorphism variations and Tuberculosis (TB) in a Chinese pediatric group, we conducted a case-control study using single-nucleotide polymorphism (SNP) analysis. Significant difference of the allelic distribution of rs1914663 in SFTPA gene was observed between TB group and control group and, T allele of rs1914663 was associated with increased risk for TB (control vs. 1.42, 95% CI: 1.10-1.81, P=0.005). In addition, the TC+TT genotype of rs1914663 was higher in PTB and non-severe TB than that in controls. The haplotype comprising rs17881720-A and rs17879335-G was a resistance factor while the haplotype comprising rs1914663-T and rs1059225-G was found to be a susceptibility factor to TB. Using a case-control study, we identified a genetic polymorphism in the SFTPA that regulates host susceptibility to pediatric TB in the Han Chinese population. Copyright © 2016 Elsevier B.V. All rights reserved.

CCDC26 rs4295627 polymorphisms associated with an increased risk of glioma: A meta-analysis.

PubMed

Zeng, Jie; Luo, Yueji; Yu, Min; Li, Jianming; Liu, Zhenghai

2017-11-01

Gliomas are the most common primary brain tumor in adults. Many studies have revealed associations between the rs4295627 polymorphism in the coiled-coil domain containing 26 (CCDC26) gene and the risk of glioma. However, the conclusions are still unclear because some studies have reported inconsistent results. The aim of the present meta-analysis was to determine the relationship and quantitatively evaluate the effect of the rs4295627 polymorphism on the risk of glioma. Data was extracted from PubMed, EMBASE and Google Scholar, with the most recent search up to December, 2015. Odds ratios (OR) and their 95% CIs were used to evaluate the effect of CCDC26 rs4295627 polymorphisms on glioma. A test of heterogeneity and an assessment of publication bias were also performed. A total of 11 studies (8292 cases and 12,419 controls) were selected for this meta-analysis. Significant associations were observed in all genetic analysis models (G vs T: OR = 1.26, 95% CI = 1.12-1.43; GG vs TT: OR = 1.72, 95% CI = 1.24-2.39; GT vs TT: OR = 1.33, 95% CI = 1.24-1.42; GG + GT vs TT: OR = 1.36, 95% CI = 1.20-1.53; GG vs GT + TT: OR = 1.65, 95% CI = 1.18-2.29, respectively). The results of the present study clearly show that the G allele of the rs4295627 polymorphism significantly increases the risk of glioma. Nevertheless, well-designed large-scale studies are needed to further evaluate the effect of the rs4295627 polymorphism on different types or degrees of glioma in different ethnic groups as well as to measure the combined effects on glioma risk.

AGXT2 rs37369 polymorphism predicts the renal function in patients with chronic heart failure.

PubMed

Hu, Xiao-Lei; Zeng, Wen-Jing; Li, Mu-Peng; Yang, Yong-Long; Kuang, Da-Bin; Li, He; Zhang, Yan-Jiao; Jiang, Chun; Peng, Li-Ming; Qi, Hong; Zhang, Ke; Chen, Xiao-Ping

2017-12-30

Patients with chronic heart failure (CHF) are often accompanied with varying degrees of renal diseases. The purpose of this study was to identify rs37369 polymorphism of AGXT2 specific to the renal function of CHF patients. A total of 1012 southern Chinese participants, including 487 CHF patients without history of renal diseases and 525 healthy volunteers, were recruited for this study. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to determine the genotypes of AGXT2 rs37369 polymorphism. Levels of blood urea nitrogen (BUN) and serum creatinine (SCr) were detected to indicate the renal function of the participants. BUN level was significantly higher in CHF patients without history of renal diseases compared with healthy volunteers (p=0.000). And the similar result was also obtained for SCr (p=0.000). Besides, our results indicated that the level of BUN correlated significantly with SCr in both the CHF patients without renal diseases (r=0.4533, p<0.0001) and volunteers (r=0.2489, p<0.0001). Furthermore, we found that the AGXT2 rs37369 polymorphism could significantly affect the level of BUN in CHF patients without history of renal diseases (p=0.036, AA+AG vs GG). Patients with rs37369 GG genotype showed a significantly reduced level of BUN compared to those with the AA genotype (p=0.024), and the significant difference was still observed in the smokers of CHF patients without renal diseases (p=0.023). In conclusion, we found that CHF might induce the impairment of kidney and cause deterioration of renal function. AGXT2 rs37369 polymorphism might affect the renal function of CHF patients free from renal diseases, especially in patients with cigarette smoking. Copyright © 2017. Published by Elsevier B.V.

Protective Role of BST2 Polymorphisms in Mother-to-Child Transmission of HIV-1 and Adult AIDS Progression.

PubMed

Kamada, Anselmo J; Bianco, Anna M; Zupin, Luisa; Girardelli, Martina; Matte, Maria C C; Medeiros, Rúbia Marília de; Almeida, Sabrina Esteves de Matos; Rocha, Marineide M; Segat, Ludovica; Chies, José A B; Kuhn, Louise; Crovella, Sergio

2016-07-01

Bone marrow stromal cell antigen-2 (BST-2)/Tetherin is a restriction factor that prevents Human immunodeficiency virus type 1 (HIV-1) release from infected cells and mediates pro-inflammatory cytokine production. This study investigated the risk conferred by single nucleotide polymorphisms (rs919266, rs9192677, and rs9576) at BST-2 coding gene (BST2) in HIV-1 mother-to-child transmission and in disease progression. Initially, 101 HIV-1+ pregnant women and 331 neonates exposed to HIV-1 from Zambia were enrolled. Additional BST2 single nucleotide polymorphism analyses were performed in 2 cohorts with acquired immunodeficiency syndrome (AIDS) progression: an adult Brazilian cohort (37 rapid, 30 chronic and 21 long-term non-progressors) and an Italian pediatric cohort (21 rapid and 67 slow progressors). The rs9576A allele was nominally associated with protection during breastfeeding (P = 0.019) and individuals carrying rs919266 GA showed slower progression to AIDS (P = 0.033). Despite the influence of rs919266 and rs9576 on BST2 expression being still undetermined, a preventive role by BST2 polymorphisms was found during HIV-1 infection.

Quantitative Assessment the Relationship between p21 rs1059234 Polymorphism and Cancer Risk.

PubMed

Huang, Yong-Sheng; Fan, Qian-Qian; Li, Chuang; Nie, Meng; Quan, Hong-Yang; Wang, Lin

2015-01-01

p21 is a cyclin-dependent kinase inhibitor, which can arrest cell proliferation and serve as a tumor suppressor. Though many studies were published to assess the relationship between p21 rs1059234 polymorphism and various cancer risks, there was no definite conclusion on this association. To derive a more precise quantitative assessment of the relationship, a large scale meta-analysis of 5,963 cases and 8,405 controls from 16 eligible published case-control studies was performed. Our analysis suggested that rs1059234 was not associated with the integral cancer risk for both dominant model [(T/T+C/T) vs C/C, OR=1.00, 95% CI: 0.84-1.18] and recessive model [T/T vs (C/C+C/T), OR=1.03, 95% CI: 0.93-1.15)]. However, further stratified analysis showed rs1059234 was greatly associated with the risk of squamous cell carcinoma of head and neck (SCCHN). Thus, larger scale primary studies are still required to further evaluate the interaction of p21 rs1059234 polymorphism and cancer risk in specific cancer subtypes.

MSH3 rs26279 polymorphism increases cancer risk: a meta-analysis

PubMed Central

Miao, Hui-Kai; Chen, Li-Ping; Cai, Dong-Ping; Kong, Wei-Ju; Xiao, Li; Lin, Jie

2015-01-01

Previous studies have investigated the association of mutS homolog 3 (MSH3) rs26279 G > A polymorphism with the risk of different types of cancers including colorectal cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, ovarian cancer and oesophageal cancer. However, its association with cancer remains conflicting. We performed a comprehensive meta-analysis to derive a more precise estimation of the relationship between MSH3 rs26279 G > A polymorphism and cancer susceptibility. Systematically searching the PubMed and EMBASE databases yielded 11 publications with 12 studies of 3282 cases and 6476 controls. The strength of the association was determined by crude odds ratios (OR) and 95% confidence intervals (CI). Overall, pooled risk estimates demonstrated that MSH3 rs26279 G > A was significantly associated with an increased overall cancer risk under all the genetic models (GG vs. AA: OR = 1.27, 95% CI = 1.09-1.48, P = 0.002; AG vs. AA: OR = 1.10, 95% CI = 1.00-1.21, P = 0.045; GG vs. AG + AA: OR = 1.23, 95% CI = 1.06-1.42, P = 0.005; AG + GG vs. AA: OR = 1.13, 95% CI = 1.04-1.24, P = 0.006; G vs. A: OR = 1.13, 95% CI = 1.05-1.20, P = 0.001). The association was more evident for colorectal cancer and breast cancer. Moreover, the significant association was also observed in the following subgroups: Europeans, Asians, population-based studies, hospital-based studies, and studies comprising relatively large sample size (≥ 200). Our meta-analysis results demonstrated that MSH3 rs26279 G > A polymorphism is associated with an increased risk of overall cancer, especially for the colorectal cancer and breast cancer. PMID:26617824

MSH3 rs26279 polymorphism increases cancer risk: a meta-analysis.

PubMed

Miao, Hui-Kai; Chen, Li-Ping; Cai, Dong-Ping; Kong, Wei-Ju; Xiao, Li; Lin, Jie

2015-01-01

Previous studies have investigated the association of mutS homolog 3 (MSH3) rs26279 G > A polymorphism with the risk of different types of cancers including colorectal cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, ovarian cancer and oesophageal cancer. However, its association with cancer remains conflicting. We performed a comprehensive meta-analysis to derive a more precise estimation of the relationship between MSH3 rs26279 G > A polymorphism and cancer susceptibility. Systematically searching the PubMed and EMBASE databases yielded 11 publications with 12 studies of 3282 cases and 6476 controls. The strength of the association was determined by crude odds ratios (OR) and 95% confidence intervals (CI). Overall, pooled risk estimates demonstrated that MSH3 rs26279 G > A was significantly associated with an increased overall cancer risk under all the genetic models (GG vs. AA: OR = 1.27, 95% CI = 1.09-1.48, P = 0.002; AG vs. AA: OR = 1.10, 95% CI = 1.00-1.21, P = 0.045; GG vs. AG + AA: OR = 1.23, 95% CI = 1.06-1.42, P = 0.005; AG + GG vs. AA: OR = 1.13, 95% CI = 1.04-1.24, P = 0.006; G vs. A: OR = 1.13, 95% CI = 1.05-1.20, P = 0.001). The association was more evident for colorectal cancer and breast cancer. Moreover, the significant association was also observed in the following subgroups: Europeans, Asians, population-based studies, hospital-based studies, and studies comprising relatively large sample size (≥ 200). Our meta-analysis results demonstrated that MSH3 rs26279 G > A polymorphism is associated with an increased risk of overall cancer, especially for the colorectal cancer and breast cancer.

The association between MMP2 -1306 C > T (rs243865) polymorphism and risk of prostate cancer.

PubMed

Shajarehpoor Salavati, L; Tafvizi, F; Manjili, H K

2017-02-01

Prostate cancer is the second most common cancer in men. Matrix metalloproteinase-2 (MMP2) is the most important member of the matrix metalloproteinase family. MMP2 digests the basement membrane and causes changes in the extracellular matrix which in turn facilitate cancer invasion. It, therefore, has a major role in tumor angiogenesis. Previous studies have identified a single-nucleotide polymorphism C/T at position -1306 of MMP2 gene promoter which is a key regulatory factor in cancer progression. The present study aimed to determine the association between MMP2 polymorphism and the risk of prostate cancer in Iranian men. This case-control study was performed on 50 paraffin-embedded prostate cancer tissue samples and 54 blood samples from healthy men. Genotyping of the samples was performed using high-resolution melting analysis (HRM). Finally, 20 % of the genotypes were confirmed by sequencing. No significant associations were found between CT and TT genotypes and the risk of prostate cancer. However, there were no significant relationships between the genotypes and the studied factors, e.g., age, pathological stage, and Gleason Score. MMP2 -1306 C > T (rs243865) polymorphism was not significantly related with prostate cancer susceptibility in Iranian men.

Analysis of RANKL gene polymorphism (rs9533156 and rs2277438) in Iranian patients with chronic periodontitis and periimplantitis.

PubMed

Kadkhodazadeh, Mahdi; Ebadian, Ahmad Reza; Gholami, Gholam Ali; Khosravi, Alireza; Tabari, Zahra Alizadeh

2013-05-01

RANK/OPG/RANKL pathway plays a significant role in osteoclastogenesis, osteoclast activation, and regulation of bone resorption. The aim of this study was to investigate the association of RANKL gene polymorphisms (rs9533156 and rs2277438) with chronic periodontitis and peri-implantitis in an Iranian population. 77 patients with chronic periodontitis, 40 patients with peri-implantitis and 89 periodontally healthy patients were enrolled in this study. 5cc of blood was obtained from the cephalic vein of subjects arms and transferred into tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP) technique. Differences in the frequencies of genotypes and alleles in the disease and control groups were analyzed using Chi-square and Fisher's exact statistical tests. Comparison of frequency of alleles in SNP rs9533156 of RANKL gene between the chronic periodontitis group with the control and peri-implantitis groups revealed statistically significant differences (P=0.024 and P=0.027, respectively). Comparison of genotype expression of SNP rs9533156 on RANKL gene between the peri-implantitis group with chronic periodontitis and control groups revealed statistically significant differences (P=0.001); the prevalence of CT genotype was significantly higher amongst the chronic periodontitis group. Regarding SNP rs2277438 of RANKL gene, comparison of prevalence of genotypes and frequency of alleles did not reveal any significant differences (P=0.641/P=0.537, respectively). The results of this study indicate that CT genotype of rs9533156 RANKL gene polymorphism was significantly associated with peri-implantitis, and may be considered as a genetic determinant for peri-implantitis. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

PubMed

Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

2012-05-01

Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

Single nucleotide polymorphisms in long noncoding RNA, ANRIL, are not associated with severe periodontitis but with adverse cardiovascular events among patients with cardiovascular disease.

PubMed

Schulz, S; Seitter, L; Werdan, K; Hofmann, B; Schaller, H-G; Schlitt, A; Reichert, S

2018-05-06

Biological plausibility of an association between severe periodontitis and cardiovascular disease (CVD) has been proven. Genetic characteristics play an important role in both complex inflammatory diseases. Polymorphisms (single nucleotide polymorphisms [SNPs]) in the long noncoding RNA, antisense noncoding RNA in the INK4 locus (ANRIL), were shown to play a leading role in both diseases. The primary objectives of the study were to assess, among cardiovascular (CV angiographically proven ≥50% stenosis of a main coronary artery) patients, the impact of ANRIL SNPs rs133049 and rs3217992 on the severity of periodontitis and the previous history of coronary events, as well as on the occurrence of further adverse CV events. The prevalence of severe periodontitis was analyzed in 1002 CV patients. ANRIL SNPs rs133049 and rs3217992 were genotyped. The prognostic value of both ANRIL SNPs for combined CV endpoint (stroke/transient ischemic attack [TIA], myocardial infarction, death from a CV-related event, death from stroke) was evaluated after a 3-year follow-up period. Hazard ratios (HRs) were adjusted for established CV risk factors applying Cox regression. ANRIL SNPs rs133049 and rs3217992 were not associated with severe periodontitis or history of CVD in CV patients. In the Kaplan-Meier survival curve including the log rank-test (P = .036) and Cox regression (hazard ratio = 1.684, P = .009) the AA genotype of rs3217992 was shown to be an independent predictor for adverse CV events after 3 years of follow-up. SNPs in ANRIL are not risk modulators for severe periodontitis and history of CVD in CV patients. The AA genotype of ANRIL SNPs rs3217992 possesses prognostic power for further CV events within 3 years of follow-up. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

USDA-ARS?s Scientific Manuscript database

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

Association between single nucleotide polymorphisms of the transforming growth factor β1 gene and the risk of severe radiation esophagitis in patients with lung cancer.

PubMed

Guerra, Jose Luis Lopez; Gomez, Daniel; Wei, Qingyi; Liu, Zhengshen; Wang, Li-E; Yuan, Xianglin; Zhuang, Yan; Komaki, Ritusko; Liao, Zhongxing

2012-12-01

We investigated the association between single nucleotide polymorphisms (SNPs) in the transforming growth factor β1 (TGFβ1) gene and the risk of radiation-induced esophageal toxicity (RE) in patients with non-small-cell lung cancer (NSCLC). Ninety-seven NSCLC patients with available genomic DNA samples and mostly treated with intensity modulated radio(chemo)therapy from 2003 to 2006 were used as a test dataset and 101 NSCLC patients treated with 3-dimensional conformal radio(chemo)therapy from 1998 to 2002 were used as a validation set. We genotyped three SNPs of the TGFβ1 gene (rs1800469:C-509T, rs1800471:G915C, and rs1982073:T869C) by the polymerase chain reaction restriction fragment length polymorphism method. In the test dataset, the CT/TT genotypes of TGFβ1 rs1800469:C-509T were associated with a statistically significant higher risk of RE grade⩾3 in univariate (P=0.026) and multivariate analysis (P=0.045) when compared with the CC genotype. These results were again observed in both univariate (P=0.045) and multivariate (P=0.023) analysis in the validation dataset. We found and validated that the TGFβ1 rs1800469:C-509T genotype is associated with severe RE. This response marker may be used for guiding therapy intensity in an individual patient, which would further the goal of individualized therapy. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Effects of IL1B single nucleotide polymorphisms on depressive and anxiety symptoms are determined by severity and type of life stress.

PubMed

Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy

2016-08-01

Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Association of PTPN22 rs2476601 Polymorphism with Rheumatoid Arthritis and Celiac Disease in Khuzestan Province, Southwestern Iran.

PubMed

Abbasi, Zahra; Kazemi Nezhad, Seyed Reza; Pourmahdi-Broojeni, Mahdi; Rajaei, Elham

2017-01-01

Single-nucleotide polymorphism (SNP) rs2476601 within protein tyrosine phosphatase non-receptor type 22 gene (PTPN22) has been shown to be a risk factor for different autoimmune diseases. This study explored the association of 1858 C/T SNP with rheumatoid arthritis (RA) and celiac disease (CD) in a region covering south-west of Iran. Totally, 52 patients with CD, 120 patients with RA, and 120 healthy subjects were selected. The samples were genotyped for the rs2476601 in PTPN22 gene using the tetra-amplification refractory mutation system polymerase chain reaction. The frequency of +1858T risk allele was significantly increased in both RA (P=0.021, OR=2.56, 95%CI=1.19-5.47) and CD (P=0.002, OR=3.87, 95%CI=1.68-8.95) patients, as compared to the control group. However, no association was found between the +1858C/T PTPN22 gene SNP and the anti-cyclic citrullinated peptide and rheumatoid factor positivity in RA patients. PTPN22 gene could play a crucial role in people's susceptibility to certain autoimmune diseases.

A Meta-Analysis of the Association between DNMT1 Polymorphisms and Cancer Risk.

PubMed

Li, Hao; Liu, Jing-Wei; Sun, Li-Ping; Yuan, Yuan

2017-01-01

Previous studies have examined the associations of DNA methyltransferase 1 ( DNMT1 ) polymorphisms, including single nucleotide polymorphisms rs16999593 (T/C), rs2228611 (G/A), and rs2228612 (A/G), with cancer risk. However, the results are inconclusive. The aim of this meta-analysis is to elucidate the associations between DNMT1 polymorphisms and cancer susceptibility. The PubMed, Embase, Web of Science, and Chinese National Knowledge Infrastructure databases were searched systematically to identify potentially eligible reports. Odd ratios and 95% confidence intervals were used to evaluate the strength of association between three DNMT1 polymorphisms and cancer risk. A total of 16 studies were finally included in the meta-analysis, namely, nine studies of 3378 cases and 4244 controls for rs16999593, 11 studies of 3643 cases and 3866 controls for rs2228611, and three studies of 1343 cases and 1309 controls for rs2228612. The DNMT1 rs2228612 (A/G) polymorphism was significantly related to cancer risk in the recessive model. The meta-analysis also suggested that DNMT1 rs16999593 (T/C) may be associated with gastric cancer, while rs2228611 (G/A) may be associated with breast cancer. In future research, large-scale and well-designed studies are required to verify these findings.

Genetic Polymorphisms in Cytokine Genes in Colombian Patients with Ocular Toxoplasmosis.

PubMed

Naranjo-Galvis, C A; de-la-Torre, A; Mantilla-Muriel, L E; Beltrán-Angarita, L; Elcoroaristizabal-Martín, X; McLeod, R; Alliey-Rodriguez, N; Begeman, I J; López de Mesa, C; Gómez-Marín, J E; Sepúlveda-Arias, J C

2018-04-01

Toxoplasmosis is caused by infection with the protozoan parasite Toxoplasma gondii , which has the capacity to infect all warm-blooded animals worldwide. Toxoplasmosis is a major cause of visual defects in the Colombian population; however, the association between genetic polymorphisms in cytokine genes and susceptibility to ocular toxoplasmosis has not been studied in this population. This work evaluates the associations between polymorphisms in genes coding for the cytokines tumor necrosis factor alpha (TNF-α) (rs1799964, rs1800629, rs1799724, rs1800630, and rs361525), interleukin 1β (IL-1β) (rs16944, rs1143634, and rs1143627), IL-1α (rs1800587), gamma interferon (IFN-γ) (rs2430561), and IL-10 (rs1800896 and rs1800871) and the presence of ocular toxoplasmosis (OT) in a sample of a Colombian population (61 patients with OT and 116 healthy controls). Genotyping was performed with the "dideoxynucleotide (ddNTP) primer extension" technique. Functional-effect predictions of single nucleotide polymorphisms (SNPs) were done by using FuncPred. A polymorphism in the IL-10 gene promoter (-1082G/A) was significantly more prevalent in OT patients than in controls ( P = 1.93e-08; odds ratio [OR] = 5.27e+03; 95% confidence interval [CI] = 3.18 to 8.739; Bonferroni correction [BONF] = 3.48e-07). In contrast, haplotype "AG" of the IL-10 gene promoter polymorphisms (rs1800896 and rs1800871) was present at a lower frequency in OT patients ( P = 7e-04; OR = 0.10; 95% CI = 0.03 to 0.35). The +874A/T polymorphism of IFN-γ was associated with OT ( P = 3.37e-05; OR = 4.2; 95% CI = 2.478 to 7.12; BONF = 6.07e-04). Haplotype "GAG" of the IL-1β gene promoter polymorphisms (rs1143634, rs1143627, and rs16944) appeared to be significantly associated with OT ( P = 0.0494). The IL-10, IFN-γ, and IL-1β polymorphisms influence the development of OT in the Colombian population. Copyright © 2018 American Society for Microbiology.

TSHR intronic polymorphisms (rs179247 and rs12885526) and their role in the susceptibility of the Brazilian population to Graves' disease and Graves' ophthalmopathy.

PubMed

Bufalo, N E; Dos Santos, R B; Marcello, M A; Piai, R P; Secolin, R; Romaldini, J H; Ward, L S

2015-05-01

Intronic thyroid-stimulating hormone receptor polymorphisms have been associated with the risk for both Graves' disease and Graves' ophthalmopathy, but results have been inconsistent among different populations. We aimed to investigate the influence of thyroid-stimulating hormone receptor intronic polymorphisms in a large well-characterized population of GD patients. We studied 279 Graves' disease patients (231 females and 48 males, 39.80 ± 11.69 years old), including 144 with Graves' ophthalmopathy, matched to 296 healthy control individuals. Thyroid-stimulating hormone receptor genotypes of rs179247 and rs12885526 were determined by Real Time PCR TaqMan(®) SNP Genotyping. A multivariate analysis showed that the inheritance of the thyroid-stimulating hormone receptor AA genotype for rs179247 increased the risk for Graves' disease (OR = 2.821; 95 % CI 1.595-4.990; p = 0.0004), whereas the thyroid-stimulating hormone receptor GG genotype for rs12885526 increased the risk for Graves' ophthalmopathy (OR = 2.940; 95 % CI 1.320-6.548; p = 0.0083). Individuals with Graves' ophthalmopathy also presented lower mean thyrotropin receptor antibodies levels (96.3 ± 143.9 U/L) than individuals without Graves' ophthalmopathy (98.3 ± 201.9 U/L). We did not find any association between the investigated polymorphisms and patients clinical features or outcome. We demonstrate that thyroid-stimulating hormone receptor intronic polymorphisms are associated with the susceptibility to Graves' disease and Graves' ophthalmopathy in the Brazilian population, but do not appear to influence the disease course.

The association of rs4307059 and rs35678 markers with autism spectrum disorders is replicated in Italian families.

PubMed

Prandini, Paola; Pasquali, Alessandra; Malerba, Giovanni; Marostica, Andrea; Zusi, Chiara; Xumerle, Luciano; Muglia, Pierandrea; Da Ros, Lucio; Ratti, Emiliangelo; Trabetti, Elisabetta; Pignatti, Pier Franco

2012-08-01

The objective of this study was to replicate an association study on a newly collected Italian autism spectrum disorder (ASD) cohort by studying the genetic markers associated with ASDs from recent genome-wide and candidate gene association studies. We have genotyped 746 individuals from 227 families of the Italian Autism Network using allelic discrimination TaqMan assays for seven common single-nucleotide polymorphisms: rs2292813 (SLC25A12 gene), rs35678 (ATP2B2 gene), rs4307059 (between CDH9 and CDH10 genes), rs10513025 (between SEMA5A and TAS2R1 genes), rs6872664 (PITX1 gene), rs1861972 (EN2 gene), and rs4141463 (MACROD2 gene). A family-based association study was conducted. A significant association was found for two of seven markers: rs4307059 T allele (odds ratio: 1.758, SE=0.236; P-value=0.017) and rs35678 TC genotype (odds ratio: 0.528, SE=0.199; P-value=0.0013). A preferential allele transmission of two markers located at loci previously associated with social and verbal communication skill has been confirmed in patients of a new ASD family sample.

Choline dehydrogenase polymorphism rs12676 is a functional variation and is associated with changes in human sperm cell function.

PubMed

Johnson, Amy R; Lao, Sai; Wang, Tongwen; Galanko, Joseph A; Zeisel, Steven H

2012-01-01

Approximately 15% of couples are affected by infertility and up to half of these cases arise from male factor infertility. Unidentified genetic aberrations such as chromosomal deletions, translocations and single nucleotide polymorphisms (SNPs) may be the underlying cause of many cases of idiopathic male infertility. Deletion of the choline dehydrogenase (Chdh) gene in mice results in decreased male fertility due to diminished sperm motility; sperm from Chdh(-/-) males have decreased ATP concentrations likely stemming from abnormal sperm mitochondrial morphology and function in these cells. Several SNPs have been identified in the human CHDH gene that may result in altered CHDH enzymatic activity. rs12676 (G233T), a non-synonymous SNP located in the CHDH coding region, is associated with increased susceptibility to dietary choline deficiency and risk of breast cancer. We now report evidence that this SNP is also associated with altered sperm motility patterns and dysmorphic mitochondrial structure in sperm. Sperm produced by men who are GT or TT for rs12676 have 40% and 73% lower ATP concentrations, respectively, in their sperm. rs12676 is associated with decreased CHDH protein in sperm and hepatocytes. A second SNP located in the coding region of IL17BR, rs1025689, is linked to altered sperm motility characteristics and changes in choline metabolite concentrations in sperm.

Choline Dehydrogenase Polymorphism rs12676 Is a Functional Variation and Is Associated with Changes in Human Sperm Cell Function

PubMed Central

Johnson, Amy R.; Lao, Sai; Wang, Tongwen; Galanko, Joseph A.; Zeisel, Steven H.

2012-01-01

Approximately 15% of couples are affected by infertility and up to half of these cases arise from male factor infertility. Unidentified genetic aberrations such as chromosomal deletions, translocations and single nucleotide polymorphisms (SNPs) may be the underlying cause of many cases of idiopathic male infertility. Deletion of the choline dehydrogenase (Chdh) gene in mice results in decreased male fertility due to diminished sperm motility; sperm from Chdh−/− males have decreased ATP concentrations likely stemming from abnormal sperm mitochondrial morphology and function in these cells. Several SNPs have been identified in the human CHDH gene that may result in altered CHDH enzymatic activity. rs12676 (G233T), a non-synonymous SNP located in the CHDH coding region, is associated with increased susceptibility to dietary choline deficiency and risk of breast cancer. We now report evidence that this SNP is also associated with altered sperm motility patterns and dysmorphic mitochondrial structure in sperm. Sperm produced by men who are GT or TT for rs12676 have 40% and 73% lower ATP concentrations, respectively, in their sperm. rs12676 is associated with decreased CHDH protein in sperm and hepatocytes. A second SNP located in the coding region of IL17BR, rs1025689, is linked to altered sperm motility characteristics and changes in choline metabolite concentrations in sperm. PMID:22558321

The Relationship Between Gene Polymorphism of Leptin and Leptin Receptor and Growth Hormone Deficiency.

PubMed

He, Jinshui; Fang, Yanling; Lin, Xinfu; Zhou, Huowang; Zhu, Shaobo; Zhang, Yugui; Yang, Huicong; Ye, Xiaoling

2016-02-26

BACKGROUND Growth hormone deficiency (GHD) is a major cause of congenital short stature. GHD patients have significantly decreased serum leptin levels, which are regulated by gene polymorphism of leptin and leptin receptor. This study thus investigated the relationship between gene polymorphism and susceptibility to GHD. MATERIAL AND METHODS A case-control study was performed using 180 GHD children in addition to 160 healthy controls. After the extraction of whole genomic DNA, the genotypes of leptin and leptin receptor gene loci were analyzed by sequencing for single-nucleotide polymorphism. RESULTS The frequency distribution of all alleles identified in leptin gene (loci rs7799039) and leptin receptor gene (loci rs1137100 and rs1137101) fit Hardy-Weinberg equilibrium. There was a significant difference in allele frequency at loci rs7799039 or rs1137101, as individuals with heterozygous GA allele had lower (rs7799039) or higher (rs1137101) GHD risk. No significant difference in allele frequency was discovered at loci rs1137100 (p>0.05), which was unrelated to GHD susceptibility. CONCLUSIONS Gene polymorphism of leptin (loci rs7799039) and leptin receptor (loci rs1137101) are correlated with GHD susceptibility.

Polymorphism rs3123554 in the cannabinoid receptor gene type 2 (CNR2) reveals effects on body weight and insulin resistance in obese subjects.

PubMed

de Luis, Daniel Antonio; Izaola, Olatz; Primo, David; de la Fuente, Beatriz; Aller, Rocio

2017-10-01

Few studies assessing the relationship between single nucleotide polymorphisms in CNR2 and obesity or its related metabolic parameters are available. To investigate the influence of polymorphism rs3123554 in the CNR2 receptor gene on obesity anthropometric parameters, insulin resistance, and adipokines in subjects with obesity. The study population consisted of 1027 obese subjects, who were performed bioelectrical impedance analyses, blood pressure measurements, serial assessments of dietary intake during three days, and biochemical tests. Genotypes GG, GA, and AA were found in 339 (33.0%), 467 (45.5%), and 221 (21.5%) respectively. Body mass index, weight, fat mass, waist circumference, insulin, HOMA-IR, and triglyceride and leptin levels were higher in A-allele carriers as compared to non A-allele carriers. No differences were seen in these parameters between the GA and AA genotypes. There were no statistical differences in dietary intake. The main study finding was the association of the minor allele of the SNP rs3123554 in the CNR2 gene with body weight and triglyceride, HOMA-IR, insulin, and leptin levels. Copyright © 2017 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

Thr105Ile (rs11558538) polymorphism in the histamine N-methyltransferase (HNMT) gene and risk for Parkinson disease

PubMed Central

Jiménez-Jiménez, Félix Javier; Alonso-Navarro, Hortensia; García-Martín, Elena; Agúndez, José A.G.

2016-01-01

Abstract Background/aims: Several neuropathological, biochemical, and pharmacological data suggested a possible role of histamine in the etiopathogenesis of Parkinson disease (PD). The single nucleotide polymorphism (SNP) rs11558538 in the histamine N-methyltransferase (HNMT) gene has been associated with the risk of developing PD by several studies but not by some others. We carried out a systematic review that included all the studies published on PD risk related to the rs11558538 SNP, and we conducted a meta-analysis following Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Methods: We used several databases to perform the systematic review, the software Meta-DiSc 1.1.1 to perform the meta-analysis of the eligible studies, and the Q-statistic to test heterogeneity between studies. Results: The meta-analysis included 4 eligible case–control association studies for the HNMT rs11558538 SNP and the risk for PD (2108 patients, 2158 controls). The frequency of the minor allele positivity showed a statistically significant association with a decreased risk for PD, both in the total series and in Caucasians. Although homozygosity for the minor allele did not reach statistical significance, the test for trend indicates the occurrence of a gene–dose effect. Global diagnostic odds ratios (95% confidence intervals) for rs11558538T were 0.61 (0.46–0.81) for the total group, and 0.63 (0.45–0.88) for Caucasian patients. Conclusion: The present meta-analysis confirms published evidence suggesting that the HNMT rs11558538 minor allele is related to a reduced risk of developing PD. PMID:27399132

Association of Single-Nucleotide Polymorphisms in IL28B, but Not TNF-α, With Severity of Disease Caused by Andes Virus.

PubMed

Angulo, Jenniffer; Pino, Karla; Echeverría-Chagas, Natalia; Marco, Claudia; Martínez-Valdebenito, Constanza; Galeno, Héctor; Villagra, Eliecer; Vera, Lilian; Lagos, Natalia; Becerra, Natalia; Mora, Judith; Bermúdez, Andrea; Cárcamo, Marcela; Díaz, Janepsy; Miquel, Juan Francisco; Ferrés, Marcela; López-Lastra, Marcelo

2015-12-15

Andes virus (ANDV) is the sole etiologic agent of hantavirus cardiopulmonary syndrome (HCPS) in Chile, with a fatality rate of about 35%. Individual host factors affecting ANDV infection outcome are poorly understood. In this case-control genetic association analysis, we explored the link between single-nucleotide polymorphisms (SNPs) rs12979860, rs8099917 and rs1800629 and the clinical outcome of ANDV-induced disease. The SNPs rs12979860 and rs8099917 are known to play a role in the differential expression of the interleukin 28B gene (IL28B), whereas SNP rs1800629 is implicated in the expression of tumor necrosis factor α gene (TNF-α). A total of 238 samples from confirmed ANDV-infected patients collected between 2006 and 2014, and categorized according to the severity of the disease, were genotyped for SNPs rs12979860, rs8099917, and rs1800629. Analysis of IL28B SNPs rs12979860 and rs8099917 revealed a link between homozygosity of the minor alleles (TT and GG, respectively), displaying a mild disease progression, whereas heterozygosity or homozygosity for the major alleles (CT/CC and TG/TT, respectively) in both IL28B SNPs is associated with severe disease. No association with the clinical outcome of HCPS was observed for TNF-α SNP rs1800629 (TNF -308G>A). The IL28B SNPs rs12979860 and rs8099917, but not TNF-α SNP rs1800629, are associated with the clinical outcome of ANDV-induced disease, suggesting a possible link between IL28B expression and ANDV pathogenesis. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Association between Tryptophan Hydroxylase 2 Gene Polymorphism and Completed Suicide

ERIC Educational Resources Information Center

Fudalej, Sylwia; Ilgen, Mark; Fudalej, Marcin; Kostrzewa, Grazyna; Barry, Kristen; Wojnar, Marcin; Krajewski, Pawel; Blow, Frederic; Ploski, Rafal

2010-01-01

The association between suicide and a single nucleotide polymorphism (rs1386483) was examined in the recently identified tryptophan hydroxylase 2 (TPH2) gene. Blood samples of 143 suicide victims and 162 age- and sex-matched controls were examined. The frequency of the TT genotype in the TPH2 polymorphism was higher in suicide victims than in…

MYO9B gene polymorphisms are associated with the risk of inflammatory bowel diseases

PubMed Central

Yu, Qiang; Zhu, Chun-Fu; Kong, Zhi-Jun; Zhao, Hui; Tang, Li-Ming; Qin, Xi-Hu

2016-01-01

Myosin IXB (MYO9B) gene polymorphisms have been extensively investigated in terms of their associations with inflammatory bowel disease (IBD), with contradictory results. The aim of this meta-analysis was to evaluate associations between MY09B gene polymorphisms and the risk of IBD, Crohn's disease (CD) and ulcerative colitis (UC). Eligible studies from PubMed, Embase, and CNKI databases were identified. Pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated. Ten studies published in eight papers reporting 8,975 cases and 9,482 controls were included in this meta-analysis. Five MY09B gene polymorphisms were evaluated: rs1545620, rs962917, rs1457092, rs2305764, and rs2305767. Our data suggested that the rs1545620 polymorphism was associated with a decreased risk of IBD. A similar result was found for rs2305767 and UC. The rs962917 single nucleotide polymorphism (SNP) increased the risk of IBD, CD and UC. Moreover, rs1457092 increased the risk of IBD and UC. Rs2305764 was also associated with an increased risk of IBD. Furthermore, stratification analyses indicated that rs1545620 decreased the risk of IBD, while rs962917 increased the risk of IBD, CD and UC in Caucasian populations. To sum up, our data indicate that these five SNPs in MY09B are significantly associated with the risk of IBD. PMID:27556856

A single nucleotide polymorphism in APOA5 determines triglyceride levels in Hong Kong and Guangzhou Chinese

PubMed Central

Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil

2010-01-01

Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505

Association between AMELX polymorphisms and dental caries in Koreans.

PubMed

Kang, S W; Yoon, I; Lee, H W; Cho, J

2011-05-01

Dental caries is greatly influenced disease by environmental factors, but recently there are increasing evidences for a genetic component in caries susceptibility. AMELX is the gene coding amelogenin, which is the most important factor for normal enamel development. The aim of this study was to examine the relationship between dental caries and single nucleotide polymorphisms (SNPs) in AMELX. For this study, we used DNA samples collected from 120 unrelated individuals older than 12 years of age. All of them were examined for their oral and dental status under the WHO recommended criteria, and clinical information such as DMFT and DMFS were evaluated. Individuals whose DMFT and DMFS index lower than 2 were designated 'very low caries experience' and higher than 3 were designated 'higher caries experience'. Genomic DNA was extracted from hair samples, and single nucleotide polymorphisms of AMELX were genotyped. Genotyping of three SNPs (rs17878486, rs5933871, rs5934997, intron) in AMELX gene was determined by direct sequencing and analyzed with SNPStats. There were significant associations between rs5933871 and rs5934997 SNP and caries susceptibility in the water fluoridation group. These results suggest that SNPs of AMELX might be associated with dental caries susceptibility in Korean population. © 2010 John Wiley & Sons A/S.

FADS1 rs174549 Polymorphism May Predict a Favorable Response to Chemoradiotherapy in Oral Cancer Patients.

PubMed

Chen, Fa; He, Baochang; Yan, Lingjun; Qiu, Yu; Lin, Lisong; Cai, Lin

2017-01-01

The fatty acid desaturase 1 (FADS1) gene variant is a novel susceptibility marker for laryngeal squamous cell carcinoma identified by a recent genome-wide association study, but it is still unclear whether this genetic variant continues to influence oral cancer recurrence or death. The purpose of this study was to evaluate the role of FADS1 rs174549 polymorphism and its interaction with postoperative chemoradiotherapy in the prognosis of oral cancer. A prospective cohort study involving 304 oral cancer patients with surgical resection was conducted in Fujian, China. Demographic and clinical data (adjuvant therapy types, histologic types, clinical stage, etc.) were extracted from medical records, and follow-up data were obtained by telephone interviews. We collected 5 to 8 mL of venous blood from all patients for DNA extraction, and rs174549 genotypes were determined by TaqMan assays (Life Technologies, Carlsbad, CA). A Cox proportional hazards model and Kaplan-Meier curve were used to assess the association between FADS1 rs174549 polymorphism and progression-free survival (PFS), as well as overall survival, in oral cancer. Carrying the AA genotype was significantly associated with a decreased risk of PFS: The hazard ratio was 0.52 (95% confidence interval, 0.29 to 0.93) for the codominant model and 0.54 (95% confidence interval, 0.31 to 0.94) for the recessive model. Moreover, better PFS was particularly obvious in patients who had received chemoradiotherapy. A positive multiplicative interaction between FADS1 rs174549 polymorphism and chemoradiotherapy was observed for PFS (P = .036). No significant association was found between FADS1 rs174549 polymorphism and overall survival. Our study suggests, for the first time, that FADS1 rs174549 polymorphism is a potentially independent and favorable factor in predicting oral cancer PFS especially for patients who undergo chemoradiotherapy, and it may serve as a potential target for individualized treatment in the future

JAK2 rs10758669 polymorphisms and susceptibility to ulcerative colitis and Crohn's disease: a meta-analysis.

PubMed

Zhang, Ji-Xiang; Song, Jia; Wang, Jun; Dong, Wei-Guo

2014-06-01

In this meta-analysis, we aimed to clarify the impact of Janus kinase 2 (JAK2) rs10758669 polymorphisms on ulcerative colitis (UC) and Crohn's disease (CD) risk. Data were extracted, and pooled odd ratios (ORs) as well as 95% confidence intervals (95%CIs) were calculated. Eleven studies with 7009 CD patients, 7929 UC patients, and 19235 controls were included. The results showed that JAK2 rs10758669 polymorphism was associated with CD (AC vs. AA, OR = 1.16, 95%CI, 1.08-1.24; CC vs. AA, OR = 1.29, 95%CI, 1.17-1.43; AC + CC vs. AA, OR = 1.19, 95%CI, 1.11-1.27; CC vs. AA + AC, OR = 1.19, 95%CI, 1.09-1.31; C vs. A, OR = 1.14, 95%CI, 1.09-1.20) and UC susceptibility (AC vs. AA, OR = 1.14, 95%CI, 1.06-1.22; CC vs. AA, OR = 1.33, 95%CI, 1.20-1.47; AC + CC vs. AA, OR = 1.18, 95%CI, 1.10-1.27; CC vs. AA + AC, OR = 1.24, 95%CI, 1.12-1.36; C vs. A, OR = 1.15, 95%CI, 1.10-1.21). But no significant association was found between JAK2 rs10758669 polymorphism with CD in Asian. Either in adult-onset group or multi-age group, hospital-based group or population-based group, JAK2 rs10758669 polymorphism was associated with CD and UC susceptibility. This meta-analysis indicated that JAK2 rs10758669 polymorphism was a risk factor both for CD and UC, especially in Caucasian. The differences in age of onset and study design did not influence the associations obviously. Gene-gene and gene-environment interactions should be investigated in the future.

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

GAD65 Promoter Polymorphism rs2236418 Modulates Harm Avoidance in Women via Inhibition/Excitation Balance in the Rostral ACC.

PubMed

Colic, Lejla; Li, Meng; Demenescu, Liliana Ramona; Li, Shija; Müller, Iris; Richter, Anni; Behnisch, Gusalija; Seidenbecher, Constanze I; Speck, Oliver; Schott, Björn H; Stork, Oliver; Walter, Martin

2018-05-30

Anxiety disorders are common and debilitating conditions with higher prevalence in women. However, factors that predispose women to anxiety phenotypes are not clarified. Here we investigated potential contribution of the single nucleotide polymorphism rs2236418 in GAD2 gene to changes in regional inhibition/excitation balance, anxiety-like traits, and related neural activity in both sexes. One hundred and five healthy individuals were examined with high-field (7T) multimodal magnetic resonance imaging (MRI); including resting-state functional MRI in combination with assessment of GABA and glutamate (Glu) levels via MR spectroscopy. Regional GABA/Glu levels in anterior cingulate cortex (ACC) subregions were assessed as mediators of gene-personality interaction for the trait harm avoidance and moderation by sex was tested. In AA homozygotes, with putatively lower GAD2 promoter activity, we observed increased intrinsic neuronal activity and higher inhibition/excitation balance in pregenual ACC (pgACC) compared with G carriers. The pgACC drove a significant interaction of genotype, region, and sex, where inhibition/excitation balance was significantly reduced only in female AA carriers. This finding was specific for rs2236418 as other investigated single nucleotide polymorphisms of the GABA synthesis related enzymes ( GAD1 , GAD2 , and GLS ) were not significant. Furthermore, only in women there was a negative association of pgACC GABA/Glu ratios with harm avoidance. A moderated-mediation model revealed that pgACC GABA/Glu also mediated the association between the genotype variant and level of harm avoidance, dependent on sex. Our data thus provide new insights into the neurochemical mechanisms that control emotional endophenotypes in humans and constitute predisposing factors for the development of anxiety disorders in women. SIGNIFICANCE STATEMENT Anxiety disorders are among the most common and burdensome psychiatric disorders, with higher prevalence rates in women

Association of the IL6 rs1800796, but not of the IL6 rs1800795, IL6R rs4845617 and rs2228145 polymorphisms with hip fracture in elderly Mexican women.

PubMed

Ponce de León-Suárez, Valeria; Valdés-Flores, Margarita; Miranda-Duarte, Antonio; Ramírez-Pérez, Esperanza; Pérez-Ríos, Alin; Barredo-Prieto, Blanca; Hidalgo-Bravo, Alberto; Casas-Avila, Leonora

2018-04-01

Polymorphisms in Interleukin-6 (IL6) and its receptor (IL6R) have been associated with bone mineral density. In this work, the G-174C and G-572C polymorphisms in IL6, G-208A, and Asp358Ala in IL6R were analyzed in Mexican women with hip fracture. Postmenopausal Mexican women (60 years or over) with hip fragility fracture (77.97 ± 8 years) and without hip fracture (70.5 ± 7.02 years) were genotyped by real-time PCR. The rs1800796 GG genotype was associated with low risk of fracture (p = 0.05), while GC genotype was associated with high risk of fracture [p = 0.047, OR 2.3 (95% CI 1.013-5.2)]. The AA genotype of the rs2228145 SNP (IL6R) was significantly different [p = 0.033, OR 1.94 (95% CI 1.01-3.75)], but when data were adjusted by age and body mass index, there were no differences (p = 0.9). Our results suggest that the IL6 rs1800796 SNP is a good marker for hip fracture risk in Mexican women.

Prospects for inferring pairwise relationships with single nucleotide polymorphisms

Treesearch

Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

2003-01-01

An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

Association between Six CETP Polymorphisms and Metabolic Syndrome in Uyghur Adults from Xinjiang, China

PubMed Central

Hou, Huixian; Ma, Rulin; Guo, Heng; He, Jia; Hu, Yunhua; Mu, Lati; Yan, Yizhong; Ma, Jiaolong; Li, Shugang; Zhang, Jingyu; Ding, Yusong; Zhang, Mei; Niu, Qiang; Liu, Jiaming; Guo, Shuxia

2017-01-01

Objective: To explore the association between CETP gene polymorphisms and metabolic syndrome (MS), as well as the relationship between the CETP gene polymorphisms and each component of MS. Methods: A total of 571 individuals which were randomly selected from 5692 Uyghur adults were subdivided into two groups, including 280 patients with MS and 291 control subjects, using the group-matching method after matching for gender. We detected CETP polymorphisms (rs5882, rs1800775, rs3764261, rs12149545, rs711752, and rs708272) by using the Snapshot method. Results: (1) Significant differences were found involving the frequency distribution of genotypes and alleles of rs1800775, rs3764261, rs12149545, rs711752, and rs708272 between the control and MS groups (all p < 0.05). (2) rs1800775, rs3764261, rs12149545, rs711752, and rs708272 polymorphisms were significantly related to the risk of MS (all p < 0.05). (3) The rs1800775 polymorphism was associated with high fasting blood glucose levels and low high density lipoprotein cholesterol (HDL-C); rs3764261 and rs12149545 polymorphisms were associated with all components of MS except high blood pressure; rs711752 and rs708272 polymorphisms were associated with low HDL-C (all p < 0.05). (4) Complete linkage disequilibrium (LD) was identified for two pairs of single nucleotide polymorphisms (SNPs) (rs3764261 and rs12149545 (D’ = 1.000, r2 = 0.931), rs711752 and rs708272 (D’ = 1.000, r2 = 0.996)). (5) The A-G-G-G-C (p = 0.013, odds ratio [OR] = 0.622, 95% confidence interval [95% CI] = 0.427–0.906) and A-T-A-A-T (p < 0.001, OR = 0.519, 95% CI = 0.386–0.697) haplotypes were more frequent in the control group than in the case group. Conclusions: The rs1800775, rs3764261, rs12149545, rs711752, and rs708272 polymorphisms of CETP were associated with MS and its components among the Uyghur ethnic group. Complete LD was found between two pairs of SNPs (rs3764261 and rs12149545, rs711752, and rs708272). The A-G-G-G-C and A

Association of ADORA1 rs2228079 and ADORA2A rs5751876 Polymorphisms with Gilles de la Tourette Syndrome in the Polish Population

PubMed Central

Safranow, Krzysztof; Żekanowski, Cezary

2015-01-01

Background Gilles de la Tourette syndrome (GTS) is a neurodevelopmental disorder characterized by motor and vocal tics. Hyperactivity of dopaminergic transmission is considered a prime abnormality in the pathophysiology of tics. There are reciprocal antagonistic interactions between adenosine and dopamine transmission. The aim of the study was to analyze the association of two polymorphisms, rs2228079 in ADORA1 and rs5751876 in ADORA2A, with the risk of GTS and co-morbid disorders. Material and Methods A total of 162 Polish GTS patients and 270 healthy persons were enrolled in the study. Two polymorphisms were selected on the basis of knowledge of SNPs frequencies in ADORA1 and ADORA2A. Chi-square test was used for allelic and genotypic association studies. Association of genotypes with age of tic onset was analyzed with Mann-Whitney test. Multivariate logistic regression was used to find independent predictors of GTS risk. Results We found that the risk of GTS was associated with rs2228079 and rs5751876 polymorphisms. The GG+GT genotypes of rs2228079 in ADORA1 were underrepresented in GTS patients (p = 0.011), whereas T allele of rs5751876 in ADORA2A was overrepresented (p = 0.017). The GG genotype of rs2228079 was associated with earlier age of tic onset (p = 0.046). We found also that the minor allele G of rs2228079 was more frequent in GTS patients with depression as compared to the patients without depression (p = 0.015). Also the genotype GG was significantly more frequent in patients with obsessive compulsive disorder/behavior (OCD/OCB, p = 0.021) and depression (p = 0.032), as compared to the patients without these co-morbidities. The minor allele T frequency of rs5751876 was lower in GTS patients with co-morbid attention deficit hyperactivity disorder (p = 0.022), and TT+TC genotypes were less frequent in the non-OCD anxiety disorder group (p = 0.045). Conclusion ADORA1 and ADORA2A variants are associated with the risk of GTS, co-morbid disorders, and may

SLC11A1 polymorphisms and host susceptibility to cutaneous leishmaniasis in Pakistan.

PubMed

Sophie, Mariam; Hameed, Abdul; Muneer, Akhtar; Samdani, Azam J; Saleem, Saima; Azhar, Abid

2017-01-07

The vector-borne cutaneous leishmaniasis (CL) is endemic in several regions of Pakistan mainly affecting poor populations. Host genetic factors, particularly SLC11A1 (solute carrier transmembrane protein) within macrophages, play a crucial role in disease pathology and susceptibility. Association of SLC11A1 with cutaneous leishmaniasis, a neglected tropical disease, is not well established. Inconsistencies have been observed within different populations worldwide with respect to genetic susceptibility. This study was designed to investigate genetic variation(s) in SLC11A1 and to assess possible association with cutaneous leishmaniasis in Pakistan. Eight polymorphisms (rs2276631, rs3731864, rs2290708, rs2695342, rs201565523, rs17215556, rs17235409, rs17235416) were genotyped across SLC11A1 in 274 patients and 119 healthy controls. Six polymorphisms were studied by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing. Two single nucleotide polymorphisms were analyzed with newly designed semi-nested PCR assays. Case-control analysis showed no association between selected polymorphisms in SLC11A1 and cutaneous leishmaniasis. No significant difference was observed in the distribution of alleles between leishmaniasis patients and healthy individuals. Strong pairwise linkage disequilibrium was observed between rs2276631 and rs2290708 (r 2  = 64); and rs17235409 and rs17235416 (r 2  = 78). This study shows that genetic variations in the candidate gene SLC11A1 do not affect susceptibility to cutaneous leishmaniasis in the sample population from Pakistan.

Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

PubMed

Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

2016-06-01

Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

PubMed

Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

2014-07-01

Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

Single nucleotide polymorphisms in an Indian cohort and association of CNTN4, MMP2 and SNTB1 variants with oral cancer.

PubMed

Yete, Subuhi; Pradhan, Sultan; Saranath, Dhananjaya

2017-08-01

Oral cancer is a high incidence cancer in India primarily due to the prevalent tobacco/areca nut chewing habits and hence a major health concern. India constitutes 26% of the global oral cancer burden. Besides the well-established risk factors, the genomic constitution of an individual plays a role in oral cancer. The aim of the current study was to analyse genomic variants represented as single nucleotide polymorphisms (SNPs), analyse their prevalence and investigate risk association of allelotypes/genotypes to oral cancers. Eleven SNPs in genes associated with biological functions were analysed in an Indian cohort (n = 1000) comprising 500 oral cancer patients and 500 long term tobacco habitués as controls, using Allelic discrimination Real-Time PCR assay with SYBR Green dye. Fisher's exact test and Odds Ratio were used for statistical analysis. Increased risk was observed for rs9849237 CC [P = 0.008; OR 1.412 (1.09-1.82)] and rs243865 CT [P = 0.004; OR 1.469 (1.13-1.90)] genotypes, whereas rs9849237 CT [P = 0.034; OR 0.755 (0.58-0.97)], rs243865 CC [P = 0.002; OR 0.669 (0.51-0.86)] and rs10090787 CC [P = 0.049; OR 0.774 (0.60-0.99)] genotypes indicated decreased risk to oral cancer. The other SNPs showed equidistribution in both groups. Our data indicated genotypes and alleles in specific SNPs rs9849237, rs243865 and rs10090787 with increased/decreased risk to oral cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

The rs4846049 polymorphism in the 3'UTR region of the MTHFR gene increases the migraine susceptibility in an Iranian population.

PubMed

Salehi, Mohaddeseh; Amin-Beidokhti, Mona; Safarpour Lima, Behnam; Gholami, Milad; Javadi, Gholam-Reza; Mirfakhraie, Reza

2018-01-01

Migraine is a painful complex neurovascular disease characterized by recurrent moderate-to-severe headaches. Increased level of homocysteine is related to dilation of cerebral vessels and endothelial injury that could trigger migraine attacks. Functional polymorphisms in the MTHFR gene affect homocysteine metabolism and, therefore, play an important role in the etiology of the disease. We aimed to investigate the possible association between MTHFR gene rs4846049, C677T, and A1298C polymorphisms and the risk of migraine in Iranian population. In this genetic association study, 498 individuals were enrolled, including 223 migraine patients and 275 healthy controls. Genotyping was performed using tetra-primer ARMS-PCR for rs4846049 and PCR-restriction fragment length polymorphism for C677T and A1298C polymorphisms. The association between rs4846049 and C677T polymorphisms and migraine was observed. For the rs4846049 polymorphism, the association was detected under a dominant model ( P =0.007; odds ratio [OR] =0.60; 95% confidence interval [CI], 0.41-0.87), and for the C677T polymorphism, the TT genotype frequency was significantly different in the studied groups ( P =0.009; OR =2.48; 95% CI, 1.25-4.92). No significant differences in the genotype or allele frequencies were found for the A1298C polymorphism between the migraineurs and controls. Present data provide evidence for the association of rs4846049 and C677T polymorphisms in the MTHFR gene and migraine. Further studies are required to validate the significance of the studied genetic variations in diverse ethnic populations.

[Polymorphisms of TLR7 rs3853839 and rs179010 are associated with susceptibility to and severity of hand, foot and mouth disease caused by enterovirus 71 in male children].

PubMed

Li, Yaping; Zhai, Song; Li, Mei; Wang, Yuan; Lu, Tong; Deng, Huiling; Zhang, Xin; Dang, Shuangsuo

2017-07-01

Objective To investigate whether the polymorphisms of TLR7/MyD88 signaling pathway is associated with the susceptibility to and severity of hand, foot and mouth disease (HFMD) caused by enterovirus 71 (EV71) in children. Methods We collected 180 EV71 HFMD cases and 201 healthy controls from both the Second Affiliated Hospital of Xi'an Jiaotong University and Xi'an Children's Hospital. The genotypes including rs3853839, rs179010 of TLR7, and rs7744 of MyD88 were detected in the 381 samples by SNPscan kit. Results The susceptibility risk (OR=2.343, 95%CI:1.516-3.621) and severity risk (OR=1.939, 95%CI: 1.064-3.521) of TLR7 rs3853839 allele C significantly increased in the male children with EV71 HFMD. Also, the susceptibility risk (OR=1.701, 95%CI: 1.142-2.535) and severity risk (OR=1.852, 95%CI: 1.038-3.305) of TLR7 rs179010 allele T significantly increased in the male children with EV71 HFMD. But there was no significant difference in the distribution of TLR7 rs179010 and rs3853839 genes between female children with EV71 HFMD and female controls. There was no correlation between the genetic polymorphisms of MyD88 rs7744 and the susceptibility to and severity of EV71 HFMD in the children. Conclusion Polymorphisms of TLR7 rs3853839 and rs179010 are correlated to the susceptibility to and severity of EV71 HFMD in male children.

A family study of DRD3 rs6280, SLC1A2 rs3794087 and MAPT rs1052553 variants in essential tremor.

PubMed

Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Lorenzo-Betancor, Oswaldo; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Agúndez, José A G

2016-10-01

Despite many data suggesting a role of genetic factors in the risk for essential tremor (ET), the responsible genes have not been identified. We analyzed in ET Spanish families three single nucleotide polymorphisms (SNPs): DRD3 rs6280, SLC1A2 rs3794087, and MAPT rs1052553) previously related to an increased risk for developing the disease. We recruited 45 subjects with ET and 13 subjects without tremor belonging to 11 families who were evaluated because of familial tremor. Diagnosis of probable or definite ET was done according to TRIG criteria. Genotyping of the 3 SNPs was done using TaqMan-based qPCR assays. Data were compared with those of healthy controls of our laboratory. Family-based association testing for disease traits was performed as well. rs6280 and rs3794087 genotype and allelic frequencies did not differ significantly between subjects with ET and healthy controls. However, rs1052553AA genotype and the allele rs1052553A allele were significantly more frequent among ET patients. rs1052553A allele was non-significantly overrepresented in ET patients compared with controls when considering only the more severely affected member of each ET family. Family-based association test for disease traits showed lack of association between ET and the three SNPs studied. Our results showed a lack of association between rs6280 and rs3794087 with the risk for ET, though a marginal increased risk for ET was observed among the rs1052553A allele carriers, which was not confirmed with a family-based association study.

The OSR1 rs12329305 polymorphism contributes to the development of congenital malformations in cases of stillborn/neonatal death.

PubMed

Lozić, Bernarda; Krželj, Vjekoslav; Kuzmić-Prusac, Ivana; Kuzmanić-Šamija, Radenka; Čapkun, Vesna; Lasan, Ružica; Zemunik, Tatijana

2014-08-28

Involvement of development-related gene polymorphisms in multifactorial/polygenic etiology of stillborn/neonatal deaths due to malformations has been insufficiently tested. Since these genes showed evolutional stability and their mutations are very rare, we can assume that their polymorphic variants may be a risk factor associated with the occurrence of developmental disorders of unknown etiology or can enhance the phenotypic variability of known genetic disorders. To determine the association of 3 polymorphisms involved in the regulation of the early embryonic development of different organs, we conducted an association study of their relation to the particular malformation. We selected 140 samples of archived paraffin tissue samples from deceased patients in which fetal/neonatal autopsy examination had shown congenital abnormalities as the most likely cause of death. The polymorphisms of OSR1 rs12329305, rs9936833 near FOXF1, and HOXA1 rs10951154 were genotyped using the TaqMan allelic discrimination assay. After Bonferroni correction for multiple testing, significant allelic association with stillborn/neonatal deaths was observed for rs12329305 (p=7×10-4). In addition, association analysis for the same polymorphism was shown in the subgroup with isolated anomalies (1.25×10^-5), particularly in the subgroup of cases with kidney and heart anomalies (p=4.18×10^-5, p=5.12×10^-8, respectively). The findings of the present study showed, for the first time, the role of the OSR1 rs12329305 polymorphism in the development of congenital malformations in cases of stillborn/neonatal death, particularly in those with congenital kidney and heart developmental defects.

Single nucleotide polymorphisms in the CD40 gene associate with the disease susceptibility and severity in knee osteoarthritis in the Chinese Han population: a case-control study.

PubMed

Deng, Zhen-Han; Sun, Ming-Hua; Li, Yu-Sheng; Luo, Wei; Zhang, Fang-Jie; Tian, Jian; Wu, Ping; Xiao, Wen-Feng

2017-03-21

This study explored the association between single nucleotide polymorphisms (SNPs) in the CD40 gene, rs4810485 G > T and rs1883832 C > T, as well as disease susceptibility and severity in knee osteoarthritis (KOA) in the Chinese Han population. Peripheral venous blood was collected from 133 KOA patients (KOA group) and 143 healthy people (control group) from December 2012 to November 2013. The patients in the KOA group were classified into mild, moderate and severe groups according to disease severity. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to test the genotypes of all subjects. Binary logistic regression analyses were performed to analyze the risk factors for KOA. The KOA group was significantly different from the control group in living environment (P < 0.05). The KOA group had a lower frequency of TT genotype and T allele distribution of rs4810485 G > T compared with the control group, and rs4810485 G > T TT genotype and T allele may associate with low incidence of KOA (all P < 0.05). Besides, T allele and mutant homozygous TT genotype of rs1883832 C > T increased the susceptibility to KOA. Genotype and allele distribution of rs4810485 G > T and rs1883832 C > T were significantly different among the mild, moderate and severe groups (P < 0.05). There were more patients with rs4810485 G > T GG genotype and rs1883832 C > T TT genotype in the severe group than other genotypes of these two SNPs. According to binary logistic regression analysis, rs4810485 G > T TT genotype could alleviate disease severity in KOA, rs1883832 C > T TT genotype increase the severity of KOA and living environment is an important external factor that affects KOA severity. These data provide evidences that rs4810485 G > T and rs1883832 C > T in the CD40 gene may be associated with disease susceptibility and severity in KOA.

Genetic polymorphisms that affect selenium status and response to selenium supplementation in United Kingdom pregnant women1

PubMed Central

Mao, Jinyuan; Vanderlelie, Jessica J; Perkins, Anthony V; Redman, Christopher WG; Ahmadi, Kourosh R; Rayman, Margaret P

2016-01-01

Background: Low selenium status in pregnancy has been associated with a number of adverse conditions. In nonpregnant populations, the selenium status or response to supplementation has been associated with polymorphisms in dimethylglycine dehydrogenase (DMGDH), selenoprotein P (SEPP1) and the glutathione peroxidases [cytosolic glutathione peroxidase (GPx1) and phospholipid glutathione peroxidase (GPx4)]. Objective: We hypothesized that, in pregnant women, these candidate polymorphisms would be associated with selenium status in early pregnancy, its longitudinal change, and the interindividual response to selenium supplementation at 60 μg/d. Design: With the use of stored samples and data from the United Kingdom Selenium in Pregnancy Intervention (SPRINT) study in 227 pregnant women, we carried out genetic-association studies, testing for associations between selenium status, its longitudinal change, and response to supplementation and common genetic variation in DMGDH (rs921943), SEPP1 (rs3877899 and rs7579), GPx1 (rs1050450) and GPx4 (rs713041). Selenium status was represented by the concentration of whole-blood selenium at 12 and 35 wk of gestation, the concentration of toenail selenium at 16 wk of gestation, and plasma glutathione peroxidase (GPx3) activity at 12 and 35 wk of gestation. Results: Our results showed that DMGDH rs921943 was significantly associated with the whole-blood selenium concentration at 12 wk of gestation (P = 0.032), which explained ≤2.0% of the variance. This association was replicated with the use of toenail selenium (P = 0.043). In unsupplemented women, SEPP1 rs3877899 was significantly associated with the percentage change in whole-blood selenium from 12 to 35 wk of gestation (P = 0.005), which explained 8% of the variance. In supplemented women, SEPP1 rs3877899 was significantly associated with the percentage change in GPx3 activity from 12 to 35 wk of gestation (P = 0.01), which explained 5.3% of the variance. Selenium status was

The obesity-related polymorphism PCSK1 rs6235 is associated with essential hypertension in the Han Chinese population.

PubMed

Li, Xiao-Mu; Ling, Yan; Lu, Da-Ru; Lu, Zhi-Qiang; Liu, Ying; Chen, Hong-Yan; Gao, Xin

2012-10-01

Proprotein convertase subtilisin/kexin-type 1 (PCSK1) is a prohormone convertase that has an important role in prohormone maturation including the process of prorenin to renin. We studied the association of the PCSK1 single-nucleotide polymorphism (SNP) rs6235 (encoding an S690T substitution) with essential hypertension (EH), obesity and related traits in the Han Chinese population. The rs6235 SNP in the PCSK1 gene was investigated using a case-control study design, with 1034 hypertension cases and 1112 normotensive controls. In this study, the rs6235 SNP was significantly associated with hypertension (OR=1.26, 95% CI (1.10-1.46), P=0.001); the odds ratios of GC vs GG and CC vs GG were 1.30 (95% CI (1.06-1.58), P=0.010) and 1.55 (95% CI (1.12-2.13), P=0.007), respectively. In the controls, the C-allele was associated with increased systolic (P=0.010) and diastolic (P=0.010) blood pressure levels. In all of the EH patients and EH patients without a history of renin-angiotensin-aldosterone (RAA) system-related antagonists, the C-allele was associated with increased plasma renin activity (P=0.00004 and 0.002, respectively) and aldosterone levels (P=0.018 and 0.005, respectively). The C-allele was also associated with increased body mass index (BMI) (P=0.010) in the normotensive controls. In conclusion, the PCSK1 SNP rs6235 was associated with EH and blood pressure in the Han Chinese population, and this association may be mediated by the SNP's effect on RAA levels. rs6235 was also associated with BMI in this population.

Associations of the single-nucleotide polymorphisms of the Mina gene with the development of asthma in Chinese Han children: a case-control study.

PubMed

Chen, Yun; Yang, Xiqiang; Huang, Ying; Liu, Enmei; Wang, Lijia

2011-01-01

The single-nucleotide polymorphisms (SNPs) of the Mina gene in animals are associated with the development of Th2-mediated diseases. However, there is no information whether the association occurs in humans. This case-control study aimed at examining the potential association of the SNP of the Mina gene with the development of asthma in Chinese Han children. The DNA genotypes and serum immunoglobulin E and interleukin-4 levels of 202 asthmatic patients and 191 nonasthmatic subjects were determined by matrix-assisted laser desorption ionization-time of flight mass spectrometry method and enzyme-linked immunosorbent assay, respectively. We found that the frequency of the T allele of rs4857304, but not rs832081, rs832078, rs9879532, and rs17374916, in the Mina gene in asthmatic patients was significantly higher than that of controls (p = 0.0199). Using a recessive model, we found that the percentage of patients with TT homozygous rs4857304 was significantly higher than that of controls (p = 0.0282, odds ratio=1.568, 95% confidence interval=1.048-2.346). Further, the mean levels of serum immunoglobulin E and interleukin-4 in the patients with TT genotype of rs4857304 were significantly higher than that of patients with the G allele (p = 0.000 and p = 0.03, respectively). Apparently, the T allele of rs4857304 of the Mina gene may be associated with increased risk for the development of asthma in Chinese Han children.

Association between BMP4 rs17563 polymorphism and NSCL/P risk: a meta-analysis.

PubMed

Hu, Yuan-Yuan; Qin, Chuan-Qi; Deng, Mo-Hong; Niu, Yu-Ming; Long, Xing

2015-01-01

To investigate the association between bone morphogenetic protein 4 (BMP4) rs17563 polymorphism and nonsyndromic cleft lip with or without palate (NSCL/P) risk. Four online databases were researched and the related publications were collected. Odds ratio (OR) with 95% confidence interval (CI) was applied to assess the relationship; publication bias, metaregression, and sensitivity analysis were conducted to guarantee the strength of results. Six published case-control studies were collected. Overall, no significant association between BMP4 rs17563 polymorphism and NSCL/P risk was found. It was notable that significant susceptibility on different ethnicity was observed in the stratified analysis. For Chinese population, the BMP4 rs17563 polymorphism was a significantly increased risk for NSCL/P (C versus T: OR = 1.52, 95% CI = 1.28-1.82, P < 0.01, I (2) = 0%; CC versus TT: OR = 2.58, 95% CI = 1.74-3.82, P < 0.01, I (2) = 0%; TC + CC versus TT: OR = 1.45, 95% CI = 1.14-1.84, P < 0.01, I (2) = 0%; CC versus TT + TC: OR=2.46, 95% CI = 1.46-4.14, P < 0.01, I(2) = 47.0%). On the contrary, significantly protective effects were found in Brazilian population (C versus T: OR = 0.69, 95% CI = 0.50-0.96, P = 0.03, I(2) = 68.5%; TC versus TT: OR = 0.52, 95% CI = 0.40-0.68, P < 0.01, I(2) = 0%; TC + CC versus TT: OR = 0.52, 95% CI = 0.35-0.78, P < 0.010, I(2) = 54.4%). This meta-analysis indicated that BMP4 rs17563 polymorphism could play a different role during the development of NSCL/P based on ethnicity diversity.

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

Peroxisome proliferator-activated receptor gamma (PPARG) rs1801282 C>G polymorphism is associated with cancer susceptibility in asians: an updated meta-analysis

PubMed Central

Wang, Yafeng; Chen, Yu; Jiang, Heping; Tang, Weifeng; Kang, Mingqiang; Liu, Tianyun; Guo, Zengqing; Ma, Zhiqiang

2015-01-01

Peroxisome proliferator-activated receptor gamma (PPARG) is related to inflammation and plays an important role in the development of cancer. PPARG rs1801282 C>G polymorphism might influence the risk of cancer by regulating production of PPARG gene. Hence, a comprehensive meta-analysis was conducted to explore the association of PPARG rs1801282 C>G polymorphism with cancer susceptibility. An extensive search of PubMed and Embase databases for all relevant publications was carried out. A total of 38 publications with 16,844 cancer cases and 23,736 controls for PPARG rs1801282 C>G polymorphism were recruited in our study. Our results indicated that PPARG rs1801282 C>G variants were associated with an increased cancer risk in Asian populations and gastric cancer. In summary, the findings suggest that PPARG rs1801282 C>G polymorphism may play a crucial role in malignant transformation and the development of cancer. PMID:26550180

Peroxisome proliferator-activated receptor gamma (PPARG) rs1801282 C>G polymorphism is associated with cancer susceptibility in asians: an updated meta-analysis.

PubMed

Wang, Yafeng; Chen, Yu; Jiang, Heping; Tang, Weifeng; Kang, Mingqiang; Liu, Tianyun; Guo, Zengqing; Ma, Zhiqiang

2015-01-01

Peroxisome proliferator-activated receptor gamma (PPARG) is related to inflammation and plays an important role in the development of cancer. PPARG rs1801282 C>G polymorphism might influence the risk of cancer by regulating production of PPARG gene. Hence, a comprehensive meta-analysis was conducted to explore the association of PPARG rs1801282 C>G polymorphism with cancer susceptibility. An extensive search of PubMed and Embase databases for all relevant publications was carried out. A total of 38 publications with 16,844 cancer cases and 23,736 controls for PPARG rs1801282 C>G polymorphism were recruited in our study. Our results indicated that PPARG rs1801282 C>G variants were associated with an increased cancer risk in Asian populations and gastric cancer. In summary, the findings suggest that PPARG rs1801282 C>G polymorphism may play a crucial role in malignant transformation and the development of cancer.

ADIPOQ rs266729 G/C gene polymorphism and plasmatic adipocytokines connect metabolic syndrome to colorectal cancer

PubMed Central

Divella, Rosa; Daniele, Antonella; Mazzocca, Antonio; Abbate, Ines; Casamassima, Porzia; Caliandro, Cosimo; Ruggeri, Eustachio; Naglieri, Emanuele; Sabbà, Carlo; De Luca, Raffaele

2017-01-01

Background: ADIPOQ gene, which encode for Adiponectin (APN), is sited on chromosome 3q27 and linked to a susceptibility locus for metabolic syndrome (MetS). The ADIPOQ rs266729 G/C gene polymorphism is significantly associated with low APN levels and linked to susceptibility to develop cancer. In addition, decreased APN serum levels are linked with tumor development and progression and inversely associated with markers of inflammation. Here, we investigate the influence of APN rs266729 G/C polymorphism on adipocytokine circulating levels and their association with MetS in colorectal cancer patients (CRC). Methods: Blood samples from 105 CRC patients (50 women and 55 men) with and without MetS were genotyped for APN rs266729 G/C polymorphism by TETRA ARMS PCR. ELISA assay was used to measure plasma levels of APN and inflammatory TNF-α cytokine. Biochemical and anthropometric parameters of MetS were also analyzed. Results: We found that CRC patients (N=75) with genotype rs266729G/C or carriers of G allele were associated with a significantly increased risk of MetS development (OR =2.9) compared to those with CC genotype (N=30). Also, CG/GG genotypes were associated with significantly lower plasma APN levels and higher TNF-α levels in comparison to CC genotype (P=0.034) and APN levels were decreased in relation to BMI increases (P=0.001). Conclusions: Our findings show that APN rs266729 G/C polymorphism is associated with lower APN levels in CRC patients, indicating that decreased circulating levels of APN may be a determinant risk factor for CRC in MetS patients. PMID:28529612

Analysis of single nucleotide polymorphisms in case-control studies.

PubMed

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

[The role of single nucleotide polymorphisms in GIPR gene in the changes of secretion in hormones and adipokines in patients with obesity with type 2 diabetes].

PubMed

Skuratovskaia, D A; Vulf, M A; Kirienkova, E V; Mironyuk, N I; Zatolokin, P A; Litvinova, L S

2018-03-01

The relationship between the rs2302382, rs8111428 and Glu354Gln (rs1800437) polymorphisms in GIPR (glucosedependent insulinotropic polypeptide receptor) gene and plasma levels of mediators involved in the regulation of carbohydrate metabolism in obese patients with type 2 diabetes (before and after a test breakfast) was investigated. The contribution of polymorphic variants of rs2302382, rs8111428 in GIPR gene in the predisposition to type 2 diabetes in individuals belonging to the Slavic population of Russia was found. Polymorphisms rs2302382 and rs8111428 in the GIPR gene were characterized by the nonequilibrium cohesion. The decrease in the level of expression of the GIPR gene in adipose tissue of the small intestine mesentery in the carriers of the CC genotype rs2302382 and AA rs8111428 was associated with the increase in the plasma leptin level, whereas during normal expression, the plasma content of insulin, and GIP (in persons with the genotype of the polymorphism rs2302382 and AG polymorphism rs8111428), resistin and ghrelin (in individuals with the genotype of the polymorphism rs2302382) increased. We propose the stimulating effect of GIP on the secretion of resistin, leptin and ghrelin, with an increase in insulin production in obese patients with type 2 diabetes.

Single nucleotide polymorphisms in MLH1 predict poor prognosis of hepatocellular carcinoma in a Chinese population.

PubMed

Zhu, Xiaonian; Liu, Wei; Qiu, Xiaoqiang; Wang, Zhigang; Tan, Chao; Bei, Chunhua; Qin, Linyuan; Ren, Yuan; Tan, Shengkui

2017-10-03

Hepatocellular carcinoma (HCC) is a malignant cancer causing deleterious health effect worldwide, especially in China. So far clinical cure rate and long-term survival rate of HCC remains low. Most HCC patients after cancer resection have recurrence or metastasis within 5 years. This study aims to explore the genetic association of mutL homolog 1 ( MLH1 ) polymorphisms with HCC risk and prognosis. Four candidate MLH1 polymorphisms, rs1800734, rs10849, rs3774343 and rs1540354 were studied from a hospital-based case-control study including 1,036 cases (HCC patients) and 1,036 controls (non-HCC patients) in Guangxi, China. All these SNPs interacted with environmental risk factors, such as HBV infection, alcohol intake and smoking in the pathogenesis of HCC. However, only rs1800734 had significant difference between cases and controls. Compared to the AA genotype, patients with AG, GG and AG/GG genotype of rs1800734 had an increased risk of HCC [ORs (95% CI) = 1.217 (1.074∼1.536), 1.745 (1.301∼2.591) and 1.291 (1.126∼1.687)] and a decreased survival time [co-dominant, HR (95% CI) = 1.553 (1.257∼1.920); dominant, HR (95% CI) = 2.207 (1.572∼3.100)]. Furthermore, we found that tumor number, tumor staging, metastasis and rs1800734 were associated with the overall survival of HCC patients by multivariate COX regression analysis. No significant difference was found between the other three MLH1 polymorphisms with HCC risk and prognosis. Our study suggests MLH1 SNP, rs1800734 as a new predictor for poor prognosis of HCC patients.

The gender-specific association of rs334558 in GSK3β with major depressive disorder.

PubMed

Liu, Sha; Wang, Le; Sun, Ning; Yang, Chunxia; Liu, Zhifen; Li, Xinrong; Cao, Xiaohua; Xu, Yong; Zhang, Kerang

2017-01-01

Major depressive disorder (MDD) is one of the most prevalent psychiatric illnesses with a heritability ranging from 40% to 50%. The single nucleotide polymorphism (SNP) rs334558 on the glycogen synthase kinase-3β (GSK3β) gene has been identified as a genetic risk loci associated with schizophrenia and bipolar disorder. However, results from replication studies examining the association between rs334558 and MDD remain inconsistent.In the present study, first, we conducted a meta-analysis of the association between rs334558 and MDD by combining 5 available case-control samples totaling 2311 cases and 2535 controls. Second, genotyping data from patients with MDD at our institution, after further stratification by gender, were analyzed to determine the association between rs334558 and MDD.All studies retrieved and included in the meta-analysis were from Korea and China. The meta-analysis suggested that the functional polymorphism rs334558 within the GSK3β promoter region was associated with MDD risk (P < 0.05). The associations were observed both in the allelic and genetic models. Analysis of the genotyping data extracted from our hospital database revealed that rs334558 exhibited exclusive association with MDD in female patients (P=0.015).Our findings suggest that GSK3β rs334558 polymorphisms might be a potential risk for MDD, and females with GSK3β rs334558 polymorphisms might have higher penetrance of MDD. If validated in larger scale samples and in different ethnic populations, these findings might be of value as diagnostic references for MDD.

Genetic Association for P2X7R rs3751142 and CARD8 rs2043211 Polymorphisms for Susceptibility of Gout in Korean Men: Multi-Center Study.

PubMed

Lee, Sung Won; Lee, Shin Seok; Oh, Dong Ho; Park, Dong Jin; Kim, Hyun Sook; Choi, Jung Ran; Chae, Soo Cheon; Yun, Ki Jung; Chung, Won Tae; Choe, Jung Yoon; Kim, Seong Kyu

2016-10-01

The aim of this study was to determine the association between P2X7R rs3751142 and CARD8 rs2043211 polymorphisms and gout susceptibility in male Korean subjects. This study enrolled a total of 242 male patients with gout and 280 healthy controls. The polymorphisms of two individual genes including rs3751142(C>A) in the P2X7R gene and rs2043211(A>T) in the CARD8 gene were assessed using Taq-Man analysis. Statistical analyses were performed using the Chi-square test, Kruskal-Wallis test, and logistic regression analyses. A difference in genotypic frequency of the P2X7R rs3751142 and CARD8 rs2043211 genes was not detected between gout and control patients. Clinical parameters including age, onset age, disease duration, body mass index, and serum uric acid levels were not different among the three genotypes for either P2X7R or CARD8 (P > 0.05 for all). A pair-wise comparison of P2X7R rs3751142 and CARD8 rs2043211 genotype combinations revealed that subjects with the CA P2X7R rs3751142 genotype and the TT CARD8 rs2043211 genotype had a trend toward a higher risk of gout compared to the CC/AA combination (P = 0.056, OR = 2.618, 95% CI 0.975 - 7.031). In conclusion, this study revealed that genetic variability of the P2X7R rs3751142 and CARD8 rs2043211 genes might, in part, be associated with susceptibility for gout.

LINGO1 rs9652490 and rs11856808 polymorphisms are not associated with risk for multiple sclerosis

PubMed Central

2013-01-01

Background Some recent experimental data suggest a possible role of LINGO-1 in the pathogenesis of multiple sclerosis (MS). In an attempt to identify genetic biomarkers related to MS susceptibility, we genotyped two common SNPs in the LINGO1 gene which have been associated to other neurological conditions, in patients with MS and in healthy subjects. These SNPs are linked to several SNPs within the LINGO1 gene, especially in individuals of Oriental or Caucasian descent. Methods We analyzed the allelic and genotype frequency of two LINGO1 variants (rs9652490 and rs11856808) in 293 patients with MS and 318 healthy controls, using KASPar assays. Results LINGO1 rs9652490 and rs11856808 allelic and genotype frequencies did not differ significantly between MS patients and controls. The minor allele frequencies for rs9652490 were 0.171 (95% CI = 0.140-0.201) and 0.167 (95% CI = 0.138-0.196 for cases and controls respectively (p = 0.853). For rs11856808 the minor allele frequencies were 0.317 (95% CI = 0.280-0.355) and 0.310 (95% CI = 0.274-0.346) for cases and controls, respectively (p = 0.773). Allele and genotype frequencies were unrelated with the age of onset of MS, gender, and clinical course of MS. In addition, haplotype analyses did not reveal any putative risk related to haplotypes. Conclusions These results suggest that LINGO1 rs9652490 and rs11856808 polymorphisms are not related with risk for MS. This study adds to other published evidence indicating that, to date, the LINGO1 SNPs studied here could be useful risk biomarkers of developing essential tremor, but not other movement disorders. PMID:23574883

Allelic clustering and ancestry-dependent frequencies of rs6232, rs6234, and rs6235 PCSK1 SNPs in a Northern Ontario population sample.

PubMed

Sirois, Francine; Kaefer, Nadine; Currie, Krista A; Chrétien, Michel; Nkongolo, Kabwe K; Mbikay, Majambu

2012-10-01

The PCSK1 (proprotein convertase subtilisin/kexin type 1) locus encodes proprotein convertase 1/3, an endoprotease that converts prohormones and proneuropeptides to their active forms. Spontaneous loss-of-function mutations in the coding sequence of its gene have been linked to obesity in humans. Minor alleles of two common non-synonymous single-nucleotide polymorphisms (SNPs), rs6232 (T > C, N221D) and rs6235 (C > G, S690T), have been associated with increased risk of obesity in European populations. In this study, we compared the frequencies of the rs6232 and rs6234 (G > C, Q665E) SNPs in Aboriginal and Caucasian populations of Northern Ontario. The two SNPs were all relatively less frequent in Aboriginals: The minor allele frequency of the rs6232 SNP was 0.01 in Aboriginals and 0.08 in Caucasians (P < 4.10(-6)); for the rs6234 SNP, it was 0.20 and 0.32, respectively (P < 0.001). Resequencing revealed that the rs6234 SNP variation was tightly linked to that of the rs6235 SNP, as previously reported. Most interestingly, all carriers of the rs6232 SNP variation also carried the rs6234/rs6235 SNP clustered variations, but not the reverse, suggesting the former occurred later on an allele already carrying the latter. These data indicate that, in Northern Ontario Aboriginals, the triple-variant PCSK1 allele is relatively rare and might be of lesser significance for obesity risk in this population.

TIMP-2 SNPs rs7342880 and rs4789936 are linked to risk of knee osteoarthritis in the Chinese Han Population

PubMed Central

Jin, Tianbo; Wang, Jihong; Fan, Dongsheng; Hao, Zengtao; Jing, Shangfei; Han, ChaoQian; Du, Jieli; Jiang, Dong; Wen, Shuzheng; Wang, Jianzhong

2017-01-01

This study aimed to investigate whether functional polymorphisms in the tissue inhibitors of metalloproteinase-2 (TIMP-2) gene are associated with susceptibility to knee osteoarthritis (OA) in the Chinese Han population. Six TIMP-2 single nucleotide polymorphisms (SNPs) were assayed using MassARRAY in 300 patients clinically and radiographically diagnosed with knee OA and in 428 controls. Allelic and genotypic frequencies were compared between groups. Logistic regression adjusting for age and gender was used to estimate risk associations between specific genotypes and knee OA by computing odds ratios (ORs) and 95% confidence intervals (95% CIs). We found that allele “A” in rs7342880 was significantly associated with increased risk of knee OA (OR = 1.44, 95%CI = 1.09-1.91, p = 0.035). In addition, in the over-dominant model, rs4789936 correlated with reduced risk of knee OA, adjusting for age and gender (OR = 0.69, 95%CI = 0.49-0.98, p = 0.036). Finally, rs7342880 correlated with increased risk of knee OA in females. This study provides evidence that TIMP-2 is a knee OA susceptibility gene in the Chinese population and a potential diagnostic and preventive marker for the disease. PMID:27901480

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

[Polymorphism of genes encoding proteins of DNA repair vs. occupational and environmental exposure to lead, arsenic and pesticides].

PubMed

Bukowski, Karol; Woźniak, Katarzyna

2018-03-09

Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(2):225-235. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

The NLRP3 rs10754558 Polymorphism Is Associated with the Occurrence and Prognosis of Coronary Artery Disease in the Chinese Han Population.

PubMed

Zhou, Dong; Wang, Xinhong; Chen, Tao; Wen, Wen; Liu, Yang; Wu, Yue; Yuan, Zuyi

2016-01-01

The objective of this study is to investigate the potential association of the NLRP3 rs10754558 and CARD8 rs2043211 polymorphisms with the occurrence and prognosis of CAD. Gene polymorphisms were analyzed using the ABI PRISM-Snapshot multiplex method in 515 CAD patients and 401 control subjects. The serum level of IL-1β was investigated by ELISA assays. The clinical endpoints were evaluated during a median follow-up period of 32 months. The NLRP3 rs10754558 gene polymorphism was significantly associated with the occurrence of CAD, while the CARD8 rs2043211 gene polymorphism was not involved. Patients carrying G allele of NLRP3 rs10754558 had more severe coronary artery stenosis. Multivariable analysis revealed a significant association of the G allele with major adverse cardiac event. The serum IL-1β concentrations in patients with GG genotype were significantly increased compared with those in the patients with CC genotype. Our findings for the first time show that the NLRP3 rs10754558 polymorphism is involved in the occurrence of CAD in the Chinese Han population; and G allele can effectively predict clinical outcome of CAD. The G allele susceptibility to CAD is maybe associated with the increased level of serum IL-1β.

The OSR1 rs12329305 Polymorphism Contributes to the Development of Congenital Malformations in Cases of Stillborn/Neonatal Death

PubMed Central

Lozić, Bernarda; Krželj, Vjekoslav; Kuzmić-Prusac, Ivana; Kuzmanić-Šamija, Radenka; Čapkun, Vesna; Lasan, Ružica; Zemunik, Tatijana

2014-01-01

Background Involvement of development-related gene polymorphisms in multifactorial/polygenic etiology of stillborn/neonatal deaths due to malformations has been insufficiently tested. Since these genes showed evolutional stability and their mutations are very rare, we can assume that their polymorphic variants may be a risk factor associated with the occurrence of developmental disorders of unknown etiology or can enhance the phenotypic variability of known genetic disorders. Material/Methods To determine the association of 3 polymorphisms involved in the regulation of the early embryonic development of different organs, we conducted an association study of their relation to the particular malformation. We selected 140 samples of archived paraffin tissue samples from deceased patients in which fetal/neonatal autopsy examination had shown congenital abnormalities as the most likely cause of death. The polymorphisms of OSR1 rs12329305, rs9936833 near FOXF1, and HOXA1 rs10951154 were genotyped using the TaqMan allelic discrimination assay. Results After Bonferroni correction for multiple testing, significant allelic association with stillborn/neonatal deaths was observed for rs12329305 (p=7×10−4). In addition, association analysis for the same polymorphism was shown in the subgroup with isolated anomalies (1.25×10−5), particularly in the subgroup of cases with kidney and heart anomalies (p=4.18×10−5, p=5.12×10−8, respectively). Conclusions The findings of the present study showed, for the first time, the role of the OSR1 rs12329305 polymorphism in the development of congenital malformations in cases of stillborn/neonatal death, particularly in those with congenital kidney and heart developmental defects. PMID:25164089

Association study of two functional single nucleotide polymorphisms of neuropeptide y gene with multiple sclerosis.

PubMed

Mohammadi, Seyed Mahdi; Shirvani Farsani, Zeinab; Dosti, Rozita; Sahraian, Mohammad Ali; Behmanesh, Mehrdad

2016-12-01

Multiple sclerosis (MS) is an autoimmune disease of the central nervous system characterized by brain inflammation, demyelination and axonal loss. Neuropeptide Y (NPY) has a critical role in the maintenance of homeostasis in the immune system and coping of stress condition. In the current study we analyzed 188 patients suffering from MS and 204 unrelated healthy controls for two functional single nucleotide polymorphisms (SNPs), NPY 20T>C (rs16139) and NPY -485T>C (rs16147) using PCR-RFLP and Mismatch PCR-RFLP methods. Our results demonstrated that homozygocity in the minor allele for NPY -485T>C polymorphism is associated with the MS risk in patients in compare with healthy controls (CC vs. TT, P=0.033; CC vs. TT+TC, P=0.02). In addition, by comparison with allele T, the frequency of NPY -485C allele was higher in cases than in control subjects and present increased risk of MS, but statistically significant was borderline (P=0.053). The stratification for disease progression revealed a significant difference in the allelic and genotypic distribution between subgroups of MS and controls. The frequency of the CC genotype and C allele was higher in the primary progressive MS patients when compared with control group (CC vs. TT, P=0.019; CC vs. TT+TC, P=0.008; C vs. T, P=0.022). In addition, the frequency of CC genotype was higher in the relapsing remitting MS patients when compared with control group (CC vs. TT, P=0.034; CC vs. TT+TC, P=0.016). Haplotype analysis demonstrated that the haplotype 3 (CT) is more common in RR MS (P=0.041), and PP MS (P=0.031) than control group. In conclusion, the obtained results demonstrate the probable role of NPY SNPs in susceptibility to MS within the Iranian population. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cognitive function in adolescence: testing for interactions between breast-feeding and FADS2 polymorphisms.

PubMed

Martin, Nicolas W; Benyamin, Beben; Hansell, Narelle K; Montgomery, Grant W; Martin, Nicholas G; Wright, Margaret J; Bates, Timothy C

2011-01-01

Breast-fed C-allele carriers of the rs174575 single nucleotide polymorphism in the fatty acyl desaturase 2 (FADS2) gene have been reported to show a 6.4 to 7 IQ point advantage over formula-fed C-allele carriers, with no effect of breast-feeding in GG carriers. An Australian sample was examined to determine if an interaction between breast-feeding and the rs174575 single nucleotide polymorphism had any effect on IQ. This hypothesis was tested in more than 700 families of adolescent twins assessed for IQ and breast-feeding, birth weight, and FADS2 polymorphisms, and parental socioeconomic status and education, and maternal FADS2 status. No significant evidence for a moderating effect on IQ of rs174575 C-carrier status and breast-feeding was found, and there no effects of maternal FADS2 status on offspring IQ. In addition, no main effects of any FADS2 polymorphisms on IQ were found when the genotype was kept as two-homozygote and one-heterozygote categories and indeed no evidence for effects of breast-feeding on IQ scores after controlling for parental socioeconomic status and education. The investigation was extended to two additional FADS2 polymorphisms (rs1535 and rs174583), but again, although these polymorphisms code alleles affecting fatty acid metabolism, no main or interaction effects were found on IQ. These results support the view that apparent effects of breast-feeding on IQ reflect differential likelihood of breast-feeding as a function of parental education and did not support the predicted interaction effect of FADS2 and breast-feeding on IQ. Copyright © 2011 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

PubMed

Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

2017-06-13

We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

Association of FCGR2A rs1801274 polymorphism with susceptibility to autoimmune diseases: A meta-analysis.

PubMed

Zhang, Chang'e; Wang, Wenju; Zhang, Hong'e; Wei, Lulu; Guo, Shuping

2016-06-28

The aim of this meta-analysis was to estimate the association between the FCGR2A rs1801274 polymorphism and the susceptibility to autoimmune diseases more precisely. A meta-analysis was conducted on the association between the FCGR2A gene variants and ADs by allelic contrast, homozygote contrast, the recessive model, and the dominant model. A total of 17 studies with 30 comparisons in different populations and genotype-methods were available for this meta-analysis, including 10 Kawasaki disease (KD), 7 Ulcerative colitis (UC), 6 Crohn's disease (CD), 3 Rheumatoid arthritis (RA), 2 Systemic lupus erythematosus (SLE), 1 Autoimmune thyroid disease (ATD) and 1 diabetes mellitus type 1 (T1D). A significant association between FCGR2A rs1801274 polymorphism were found in KD (OR = 1.409, P < 0.001) and UC (OR = 1.237, P < 0.001). A overall meta-analysis increased risk of AD significant association between FCGR2A rs1801274 gene polymorphism and ADs under allelic (OR = 1.378, P=0.000), homozygous (OR: 1.866, P=0.001), dominant (OR = 1.667, P = 0.000) and recessive (OR = 1.434, P=0.000) in Asian population. Meanwhile, a decreased risk of AD was detected in the allelic (OR= 0.882, P = 0.011), homozygous (OR = 0.777, P = 0.013), dominant (OR = 0.850, P = 0.032) and recessive (OR = 0.840, P = 0.048) in African-American population. This meta-analysis demonstrates that the FCGR2A rs1801274 G-allele confers susceptibility to KD and UC. Data also suggests that the FCGR2A rs1801274 polymorphism may be associated with the susceptibility of multiple ADs in Asian and African-American populations.

Association of FCGR2A rs1801274 polymorphism with susceptibility to autoimmune diseases: A meta-analysis

PubMed Central

Wei, Lulu; Guo, Shuping

2016-01-01

Objectives The aim of this meta-analysis was to estimate the association between the FCGR2A rs1801274 polymorphism and the susceptibility to autoimmune diseases more precisely. Methods A meta-analysis was conducted on the association between the FCGR2A gene variants and ADs by allelic contrast, homozygote contrast, the recessive model, and the dominant model. Results A total of 17 studies with 30 comparisons in different populations and genotype-methods were available for this meta-analysis, including 10 Kawasaki disease (KD), 7 Ulcerative colitis (UC), 6 Crohn's disease (CD), 3 Rheumatoid arthritis (RA), 2 Systemic lupus erythematosus (SLE), 1 Autoimmune thyroid disease (ATD) and 1 diabetes mellitus type 1 (T1D). A significant association between FCGR2A rs1801274 polymorphism were found in KD (OR = 1.409, P < 0.001) and UC (OR = 1.237, P < 0.001). A overall meta-analysis increased risk of AD significant association between FCGR2A rs1801274 gene polymorphism and ADs under allelic (OR = 1.378, P=0.000), homozygous (OR: 1.866, P=0.001), dominant (OR = 1.667, P = 0.000) and recessive (OR = 1.434, P=0.000) in Asian population. Meanwhile, a decreased risk of AD was detected in the allelic (OR= 0.882, P = 0.011), homozygous (OR = 0.777, P = 0.013), dominant (OR = 0.850, P = 0.032) and recessive (OR = 0.840, P = 0.048) in African-American population. Conclusions This meta-analysis demonstrates that the FCGR2A rs1801274 G-allele confers susceptibility to KD and UC. Data also suggests that the FCGR2A rs1801274 polymorphism may be associated with the susceptibility of multiple ADs in Asian and African-American populations. PMID:27270653

PPARD rs2016520 polymorphism affects repaglinide response in Chinese Han patients with type 2 diabetes mellitus.

PubMed

Song, Jin-Fang; Wang, Tao; Zhu, Jing; Zhou, Xue-Yan; Lu, Qian; Guo, Hao; Zhang, Fan; Wang, Yan; Li, Wei; Wang, Dan-Dan; Cui, Ya-Wen; Lv, Dong-Mei; Yin, Xiao-Xing

2015-01-01

Repaglinide is a short-acting insulin secretagogue, which often results in considerable interindividual variability in therapeutic efficacy when widely used in a clinical setting. Among various reasons under discussion is genetic polymorphism, especially the genes related to insulin secretion and resistance. Recent studies have described the importance of PPARD in regulating the secretion and resistance of insulin. However, little is known about the impacts of PPARD genetic polymorphism on the efficacy of repaglinide. Therefore, the current study was designed to investigate the associations of PPARD rs2016520 polymorphism with type 2 diabetes mellitus (T2DM) susceptibility and repaglinide therapeutic efficacy in Chinese Han T2DM patients. A total of 338 T2DM patients and 200 healthy subjects were genotyped for PPARD rs2016520 polymorphism by polymerase chain reaction-restriction fragment length polymorphism assay. A total of 84 patients with the same genotypes of CYP2C8*3 139Arg and OATP1B1 521TT were randomized to orally take repaglinide for 8 weeks. Then the pharmacodynamic parameters of repaglinide and biochemical indicators were determined before and after repaglinide treatment. No significant difference was found in either allelic frequency (P = 0.298) or genotype distribution (P = 0.151) of PPARD rs2016520 between T2DM patients and healthy subjects. However, T2DM patients carrying genotype TC showed a significantly lower increase in postprandial serum insulin (mU/L) than those with wild-type TT (P < 0.05). These findings suggest that PPARD rs2016520 polymorphism might influence the therapeutic effect of repaglinide rather than T2DM susceptibility in Chinese Han T2DM patients. © 2014 Wiley Publishing Asia Pty Ltd.

Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.

PubMed

Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M

2015-01-01

Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.

Association of donor and recipient SUMO4 rs237025 genetic variant with new-onset diabetes mellitus after liver transplantation in a Chinese population.

PubMed

Zhang, Tao; Liu, Yuan; Hu, Yibo; Zhang, Xiaoqing; Zhong, Lin; Fan, Junwei; Peng, Zhihai

2017-09-05

New-onset diabetes mellitus (NODM) is a common complication after liver transplantation (LT). The small ubiquitin-like modifier 4 (SUMO4) rs237025 polymorphism has been reported to be associated with type 2 diabetes mellitus (T2DM). In this study, we aimed to evaluate the association of donor and recipient SUMO4 rs237025 polymorphisms with NODM and the long-term consequences of NODM after LT. A total of 126 liver transplant patients were enrolled in the study. One single nucleotide polymorphism, SUMO4 rs237025, was genotyped in both donors and recipients. Both donor and recipient SUMO4 rs237025 polymorphisms were found to be significantly associated with NODM after LT. In multivariate analysis, recipient age>50 years, tacrolimus trough concentrations>10ng/mL at 1month after LT, donor and recipient rs237025 genetic variant, and the combined donor and recipient rs237025 genetic variant were independent predictive factors of NODM. Area under the receiver operating characteristic curve (AUROC) analysis indicated the higher predictive ability of the model containing combined donor and recipient rs237025 polymorphisms than the clinical model (p=0.046). Furthermore, Kaplan-Meier survival analysis demonstrated that NODM was related to significantly poorer patient survival in comparison with non-NODM patients (p=0.041). Both donor and recipient SUMO4 rs237025 polymorphisms contribute to the development of NODM after LT and NODM is a frequent complication that negatively affects patient survival. Copyright © 2017. Published by Elsevier B.V.

Meta-Analysis of the Relation Between IL10 Promoter Polymorphisms and Autoimmune Liver Disease Risk.

PubMed

Qian, Bao-Xin; Ye, Qing; Zhao, Xin-Yu; Han, Tao; Wang, Feng-Mei; Yang, Jie

2018-05-01

Single nucleotide polymorphisms of the IL10 gene have been linked to the occurrence of autoimmune liver disease. We performed a meta-analysis to assess the association between three IL10 promoter polymorphisms (rs1800896, rs1800871, and rs1800872) and the risk of autoimmune hepatitis, primary biliary cholangitis, and primary sclerosing cholangitis. In total, 1420 articles were initially identified through database retrieval. After screening, seven eligible articles were ultimately included in the meta-analysis. A fixed-effect model was used for all Mantel-Haenszel statistics due to the absence of large between-study heterogeneity (all I 2 < 50%, p > 0.1). No association between any of the studied polymorphisms and risk of autoimmune liver disease was detected in the allele, homozygote, heterozygote, dominant, recessive, or carrier genetic models (p association > 0.05). Potential publication bias was excluded using Begg's and Egger's tests. Similar negative results were observed in subgroup analyses and in an analysis of the three haplotypes of rs1800896/rs1800871/rs1800872 (G/C/C, A/C/C, and A/T/A). Our meta-analysis strongly suggests that the IL10 rs1800896, rs1800871, and rs1800872 polymorphisms are not associated with the risk of autoimmune liver disease.

Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

ERIC Educational Resources Information Center

Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

2012-01-01

Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

PubMed

Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J

2017-11-01

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1

Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern.

PubMed

Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F

2016-04-01

Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage  = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.

Single nucleotide polymorphisms associated with nonsyndromic cryptorchidism in Mexican patients.

PubMed

Chávez-Saldaña, M; Vigueras-Villaseñor, R M; Yokoyama-Rebollar, E; Landero-Huerta, D A; Rojas-Castañeda, J C; Taja-Chayeb, L; Cuevas-Alpuche, J O; Zambrano, E

2018-02-01

Cryptorchidism is a frequent genitourinary malformation considered as an important risk factor for infertility and testicular malignancy. The aetiology of cryptorchidism is multifactorial in which certain SNPs, capable of inhibiting the development of the gubernaculum, are implicated. We analysed 16 SNPs by allelic discrimination and automated sequencing in 85 patients and 99 healthy people, with the objective to identify the association between these variants and isolated cryptorchidism. In two different patients with unilateral cryptorchidism, we found the variants rs121912556 and p.R105R of INSL3 gene in a heterozygous form associated with cryptorchidism, so we could considered them as risk factors for cryptorchidism. On the other hand, SNPs rs10421916 of INSL3 gene, as well as the variants rs1555633 and rs7325513 in the RXFP2 gene, and rs3779456 variant of the HOXA10 gene were statistically significant, when the patients and controls were compared and could be considered as protective factors since are predominantly present in controls. The genotype-phenotype correlation did not show statistical significance. With these results, we could conclude that these polymorphisms can be considered as important variants in our population and would contribute in the future knowledge of the aetiology and physiopathology of cryptorchidism. © 2017 Blackwell Verlag GmbH.

Association of calcium sensing receptor polymorphisms at rs1801725 with circulating calcium in breast cancer patients.

PubMed

Wang, Li; Widatalla, Sarrah E; Whalen, Diva S; Ochieng, Josiah; Sakwe, Amos M

2017-08-02

Breast cancer (BC) patients with late-stage and/or rapidly growing tumors are prone to develop high serum calcium levels which have been shown to be associated with larger and aggressive breast tumors in post and premenopausal women respectively. Given the pivotal role of the calcium sensing receptor (CaSR) in calcium homeostasis, we evaluated whether polymorphisms of the CASR gene at rs1801725 and rs1801726 SNPs in exon 7, are associated with circulating calcium levels in African American and Caucasian control subjects and BC cases. In this retrospective case-control study, we assessed the mean circulating calcium levels, the distribution of two inactivating CaSR SNPs at rs1801725 and rs1801726 in 199 cases and 384 age-matched controls, and used multivariable regression analysis to determine whether these SNPs are associated with circulating calcium in control subjects and BC cases. We found that the mean circulating calcium levels in African American subjects were higher than those in Caucasian subjects (p < 0.001). As expected, the mean calcium levels were higher in BC cases compared to control subjects (p < 0.001), but the calcium levels in BC patients were independent of race. We also show that in BC cases and control subjects, the major alleles at rs1801725 (G/T, A986S) and at rs1801726 (C/G, Q1011E) were common among Caucasians and African Americans respectively. Compared to the wild type alleles, polymorphisms at the rs1801725 SNP were associated with higher calcium levels (p = 0.006) while those at rs1801726 were not. Using multivariable linear mixed-effects models and adjusting for age and race, we show that circulating calcium levels in BC cases were associated with tumor grade (p = 0.009), clinical stage (p = 0.003) and more importantly, with inactivating mutations of the CASR at the rs1801725 SNP (p = 0.038). These data suggest that decreased sensitivity of the CaSR to calcium due to inactivating polymorphisms at rs1801725, may predispose

Financial and Psychological Risk Attitudes Associated with Two Single Nucleotide Polymorphisms in the Nicotine Receptor (CHRNA4) Gene

PubMed Central

Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.

2009-01-01

With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

Can Non-HLA Single Nucleotide Polymorphisms Help Stratify Risk in TrialNet Relatives at Risk for Type 1 Diabetes?

PubMed

Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto

2017-08-01

Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society

A Polymorphism of the Renin Gene rs6682082 Is Associated with Essential Hypertension Risk and Blood Pressure Levels in Korean Women

PubMed Central

Park, Jongkeun; Song, Kijun; Jang, Yangsoo

2015-01-01

Purpose The aim of the present study was to investigate associations between the renin gene (REN) and the risk of essential hypertension and blood pressure (BP) levels in Koreans. Materials and Methods To outline the functional role of a single nucleotide polymorphism in the transcription of the REN gene, we conducted a case-control study of 1975 individuals: 646 hypertension (HT) patients and 1329 ethnically and age-matched normotensive subjects. Results Logistic regression analysis indicated that the genotypes AA/AG were strongly associated with risk of HT (odds ratio, 1.493; 95% confidence interval, 1.069-2.086, p=0.018) in female subjects. The genotypes AA/AG also showed significant association with higher blood pressure levels, both systolic and diastolic, in postmenopausal HT women (p=0.003 and p=0.017, respectively). Analysis of the promoter containing rs6682082 revealed a 2.4±0.01-fold higher activity in the A variant promoter than the G variant promoter, suggesting that rs6682082 is itself a functional variant. Conclusion We suggest that the A allele of rs6682082 is a positive genetic marker for predisposition to essential hypertension and high BP in Korean women and may be mediated through the transcriptional activation of REN. PMID:25510769

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Absence of association of FCGR2A gene polymorphism rs1801274 with Kawasaki disease in Greek patients.

PubMed

Chatzikyriakidou, Anthoula; Aidinidou, Louiza; Giannopoulos, Andreas; Papadopoulou-Legbelou, Kyriaki; Kalinderi, Kallirhoe; Fidani, Liana

2015-04-01

Kawasaki disease is an acute, febrile syndrome in infancy, characterised by vasculitis of medium-sized arteries, and affects predominantly young children. Family-based studies on Kawasaki disease supports the contribution of genetic factors in disorder manifestation. In a recent genome-wide association study, the polymorphism rs1801274 of FCGR2A [Fc fragment of immunoglobulin G, low-affinity IIa, receptor] gene has been implicated in disease pathogenesis. The aim of the present study was to explore the association of this variant, for the first time, in a group of Kawasaki-diseased patients of Greek origin. A total of 47 Kawasaki-diseased children and 50 control subjects were enrolled in the study. Polymerase chain reaction-restriction fragment length polymorphism assay was performed in rs1801274 genotyping. No association was observed between this polymorphism genotypes' or alleles' distribution between Kawasaki-diseased patients and controls. Furthermore, no association was revealed between this polymorphism and cardiovascular complications in Kawasaki-diseased patients. In the literature, the reported data over this polymorphism association with Kawasaki disease in Caucasian patients are contradictory. In addition, the disease shows low prevalence in the Caucasian populations. Therefore, the independent genetic association studies on rs1801274 with Kawasaki disease in various Caucasian groups increase the amount of genetic data, which could be used in a future meta-analysis, increasing the statistical power of the resultant conclusions.

Association of vdr, cyp27b1, cyp24a1 and mthfr gene polymorphisms with oral lichen planus risk.

PubMed

Kujundzic, Bojan; Zeljic, Katarina; Supic, Gordana; Magic, Marko; Stanimirovic, Dragan; Ilic, Vesna; Jovanovic, Barbara; Magic, Zvonko

2016-05-01

The current study investigated the association between VDR EcoRV (rs4516035), FokI (rs2228570), ApaI (rs7975232) and TaqI (rs731236), CYP27B1 (rs4646536), CYP24A1 (rs2296241), and MTHFR (rs1801133) gene polymorphisms and risk of oral lichen planus (OLP) occurrence. The study group consisted of 65 oral lichen planus patients and 100 healthy blood donors in the control group. Single nucleotide polymorphisms were genotyped by real time PCR or PCR-restriction fragment length polymorphism (RFLP) method. Heterozygous as well as mutated genotype of vitamin D receptor (VDR) FokI (rs2228570) polymorphism was associated with increased oral lichen planus risk in comparison with wild type genotype (odds ratio (OR) = 3.877, p = 0.017, OR = 38.153, p = 0.001, respectively). A significantly decreased OLP risk was observed for heterozygous genotype of rs2296241 polymorphism in CYP24A1 gene compared with the wild type form (OR = 0.314, p = 0.012). VDR gene polymorphisms ApaI and TaqI were in linkage disequilibrium (D' = 0.71, r(2) = 0.22). Identified haplotype AT was associated with decreased OLP risk (OR = 0.592, p = 0.047). Our results highlight the possible important role of VDR FokI (rs2228570) and CYP24A1 rs2296241 gene polymorphisms for oral lichen planus susceptibility. Identification of new molecular biomarkers could potentially contribute to determination of individuals with OLP predisposition.

Association between MC4R rs17782313 polymorphism and overeating behaviors.

PubMed

Yilmaz, Z; Davis, C; Loxton, N J; Kaplan, A S; Levitan, R D; Carter, J C; Kennedy, J L

2015-01-01

Melanocortins have a crucial role in appetite and weight regulation. Although the melanocortin 4 receptor (MC4R) gene has been repeatedly linked to obesity and antipsychotic-induced weight gain, the mechanism behind how it leads to this effect in still undetermined. The goal of this study was to conduct an in-depth and sophisticated analysis of MC4R polymorphisms, body mass index (BMI), eating behavior and depressed mood. We genotyped 328 individuals of European ancestry on the following MC4R markers based on the relevant literature on obesity and antipsychotic-induced weight gain: rs571312, rs17782313, rs489693, rs11872992, and rs8087522. Height and weight were measured, and information on depressed mood and overeating behaviors was obtained during the in-person assessment. BMI was associated with rs17782313 C allele; however, this finding did not survive correction for multiple testing (P = 0.018). Although rs17782313 was significantly associated with depressed mood and overeating behaviors, tests of indirect effects indicated that emotional eating and food cravings, rather than depressed mood, uniquely accounted for the effect of this marker and BMI (n = 152). To our knowledge, this is the first study to investigate the link between MC4R rs17782313, mood and overeating behavior, as well as to demonstrate possible mechanisms behind MC4R's influence on body weight. If replicated in a larger sample, these results may have important clinical implications, including potential for the use of MC4R agonists in the treatment of obesity and disordered eating.

The effects of noncoding aquaporin-4 single-nucleotide polymorphisms on cognition and functional progression of Alzheimer's disease.

PubMed

Burfeind, Kevin G; Murchison, Charles F; Westaway, Shawn K; Simon, Matthew J; Erten-Lyons, Deniz; Kaye, Jeffrey A; Quinn, Joseph F; Iliff, Jeffrey J

2017-09-01

The glymphatic system is a brain-wide perivascular network that facilitates clearance of proteins, including amyloid β, from the brain interstitium through the perivascular exchange of cerebrospinal fluid and interstitial fluid. The astrocytic water channel aquaporin-4 (AQP4) is required for glymphatic system function, and impairment of glymphatic function in the aging brain is associated with altered AQP4 expression and localization. In human cortical tissue, alterations in AQP4 expression and localization are associated with Alzheimer's disease (AD) status and pathology. Although this suggests a potential role for AQP4 in the development or progression of AD, the relationship between of naturally occurring variants in the human AQP4 gene and cognitive function has not yet been evaluated. Using data from several longitudinal aging cohorts, we investigated the association between five AQP4 single-nucleotide polymorphisms (SNPs) and the rate of cognitive decline in participants with a diagnosis of AD. None of the five SNPs were associated with different rates of AD diagnosis, age of dementia onset in trial subjects. No association between AQP4 SNPs with histological measures of AD pathology, including Braak stage or neuritic plaque density was observed. However, AQP4 SNPs were associated with altered rates of cognitive decline after AD diagnosis, with two SNPS (rs9951307 and rs3875089) associated with slower cognitive decline and two (rs3763040 and rs3763043) associated with more rapid cognitive decline after AD diagnosis. These results provide the first evidence that variations in the AQP4 gene, whose gene product AQP4 is vital for glymphatic pathway function, may modulate the progression of cognitive decline in AD.

Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

PubMed

García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

2013-12-01

Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

rs10499194 polymorphism in the tumor necrosis factor-α inducible protein 3 (TNFAIP3) gene is associated with type-1 autoimmune hepatitis risk in Chinese Han population

PubMed Central

Lin, Liming; Liu, Honglong

2017-01-01

Previous studies have found that the polymorphisms of tumor necrosis factor-α induced protein 3 (TNFAIP3) were associated with several autoimmune diseases. However, the role of TNFAIP3 polymorphisms in type-1 autoimmune hepatitis (AIH-1) remained unclear. The present study aimed to clarify the association of TNFAIP3 polymorphisms with AIH-1 risk in a Chinese Han population. The TaqMan SNP genotyping assay was used to determine the distribution of TNFAIP3 polymorphisms in 432 AIH-1 patients and 500 healthy controls. The association of TNFAIP3 polymorphisms and clinical characteristic was further evaluated. Five TNFAIP3 polymorphisms (rs2230926, rs5029939, rs10499194, rs6920220, rs582757) were analyzed in the present study. No significant association could be observed between rs2230926, rs5029939, rs6920220, rs582757 and the susceptibility to AIH-1 in Chinese Han population. Compared with wild-type genotype CC at rs10499194, individuals carrying CT genotype had a significantly increased risk for developing AIH-1 (OR = 2.32, 95%CI 1.44–3.74). Under a dominant model, CT/TT carriers have a 140% increased risk of AIH-1 than CC carriers (OR = 2.40, 95%CI 1.50–3.87). The rs10499194 T allele was also found to be significantly associated with AIH-1 risk (OR = 2.41, 95%CI 1.51–3.82). In addition, higher serum ALT, AST levels and more common cirrhosis were observed in AIH-1 patients with T allele (CT/TT) than those with CC genotype. In conclusion, TNFAIP3 rs10499194 T allele and CT genotype were associated with an increased risk for AIH-1, suggesting rs10499194 polymorphism as a candidate of susceptibility locus to AIH-1. PMID:28448618

Association of the Risk of Dental Caries and Polymorphism of MBL2 rs11003125 Gene in Iranian Adults.

PubMed

Mokhtari, Mohammad Javad; Koohpeima, Fatemeh; Hashemi-Gorji, Feyzollah

2018-06-14

This case-control study aimed to investigate the effect of rs11003125 in dental caries. For this purpose, a total number of 404 individuals - from Fars Province in Iran - were studied. The technique of this research was the tetra-primer amplification-refractory mutation system (ARMS)-PCR. Dental caries prevalence among the 404 individuals was assessed by counting the number of decayed, missing, and filled teeth. In this research, individuals were divided into two groups: cases (n = 238) and controls (n = 166), and the peripheral blood samples were used to extract the genomic DNA. For genotyping of DNA, the tetra-primer ARMS-PCR method was conducted using specific primer pairs. While examining MBL2 rs11003125 polymorphism, we found significant differences in the genotype frequencies between the case and the control group. The pooled estimates indicated that the GG and GC genotypes of MBL2 rs11003125 polymorphism significantly increased, and therefore caries risk (OR = 2.40, 95% CI = 1.31-4.40, p = 0.004) under the dominant model. These findings suggested that polymorphism in MBL2 gene was associated with dental caries in Iranian adults. Further verification is needed with more ethnic groups and larger sample sizes to determine whether rs11003125 polymorphism is related to dental caries in other regions or not. © 2018 S. Karger AG, Basel.

VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.

PubMed

Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

2015-01-01

Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.

The role of the RTEL1 rs2297440 polymorphism in the risk of glioma development: a meta-analysis.

PubMed

Zhang, Cuiping; Lu, Yu; Zhang, Xiaolian; Yang, Dongmei; Shang, Shuxin; Liu, Denghe; Jiang, Kongmei; Huang, Weiqiang

2016-07-01

The regulator of the telomere elongation helicase1 (RTEL1) gene plays a crucial role in the DNA double-stand break-repair pathway by maintaining genomic stability. Recent epidemiological studies showed that the rs2297440 polymorphism in the RTEL1 gene was a potential risk locus for glioma development, but the results were inconclusive. To clarify the association between this polymorphism and the risk of glioma, we performed a comprehensive meta-analysis. The PubMed, EMBASE, Web of Science, and China National Knowledge Infrastructure databases were systematically searched to identify all relevant published studies up to 30 August 2015. Four eligible studies were finally included. The pooled results indicated that the RTEL1 rs2297440 polymorphism moderately increased the risk of glioma in all genetic models. A comparison of the dominant model CT + CC versus TT (OR 1.40; 95 % CI 1.24-1.60; p < 0.001) indicated that having the C allele conferred a 40 % increased risk of developing glioma. In a subgroup analysis based on geographic location (Europe, Asia, and America), there was an association between the rs2297440 polymorphism and the risk of glioma in all three areas. The results of the subgroup analysis based on source of control indicated an elevated risk of glioma in population-based control studies. This meta-analysis demonstrates that the RTEL1 rs2297440 polymorphism plays a moderate, but significant role in the risk of glioma. Further studies with larger sample sizes are necessary to confirm this finding.

Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene.

PubMed

Matveeva, Marina Yu; Kashina, Elena V; Reshetnikov, Vasily V; Bryzgalov, Leonid O; Antontseva, Elena V; Bondar, Natalia P; Merkulova, Tatiana I

2016-12-22

Germline mutations in the coding sequence of the tumour suppressor APC gene give rise to familial adenomatous polyposis (which leads to colorectal cancer) and are associated with many other oncopathologies. The loss of APC function because of deletion of putative promoter 1A or 1B also results in the development of colorectal cancer. Since the regions of promoters 1A and 1B contain many single nucleotide polymorphisms (SNPs), the aim of this study was to perform functional analysis of some of these SNPs by means of an electrophoretic mobility shift assay (EMSA) and a luciferase reporter assay. First, it was shown that both putative promoters of APC (1A and 1B) drive transcription in an in vitro reporter experiment. From eleven randomly selected SNPs of promoter 1A and four SNPs of promoter 1B, nine and two respectively showed differential patterns of binding of nuclear proteins to oligonucleotide probes corresponding to alternative alleles. The luciferase reporter assay showed that among the six SNPs tested, the rs75612255 C allele and rs113017087 C allele in promoter 1A as well as the rs138386816 T allele and rs115658307 T allele in promoter 1B significantly increased luciferase activity in the human erythromyeloblastoid leukaemia cell line K562. In human colorectal cancer HCT-116 cells, none of the substitutions under study had any effect, with the exception of minor allele G of rs79896135 in promoter 1B. This allele significantly decreased the luciferase reporter's activity CONCLUSION: Our results indicate that many SNPs in APC promoters 1A and 1B are functionally relevant and that allele G of rs79896135 may be associated with the predisposition to colorectal cancer.

Smoking attenuated the association between IκBα rs696 polymorphism and defective spermatogenesis in humans.

PubMed

Yu, B; Ding, Q; Zheng, T; Jiang, L; Li, Q; Sun, X; Bai, C; Huang, Z

2015-11-01

Defective spermatogenesis is prevalent in infertile men, but the molecular mechanisms underlying its aetiology are largely unknown. In this study, a proposed association between IκBα SNPs, smoking-related ROS and sperm quality was investigated. Two polymorphisms in the IκBα gene, rs2233406 and rs696 were genotyped in 342 controls and 338 patients with defective spermatogenesis from a southern Chinese population. The results showed the rs696 AA genotype to be significantly more common (21.60% versus 14.33%, P = 0.013) and the rs696 GG genotype to be significantly rarer (28.99% versus 37.13%, P = 0.024) in the cases than in the controls. After subjects were stratified into smokers and nonsmokers, these differences were only observed in nonsmokers. Further analysis showed the rs696 AA genotype to be significantly closely associated with defective spermatogenesis in all subjects (P = 0.014, OR = 1.647) and in nonsmokers (P = 0.036, OR = 1.889). In a TM3 cell model, exposure to cigarette smoke condensate was found to activate NF-κB luciferase activity and altered transcriptional level of NF-κB pathway genes. In conclusion, this study demonstrates an association between functional polymorphisms of the IκBα rs696 and cigarette smoking with the risk of defective spermatogenesis, suggesting some interaction between the NF-κB signalling pathway and smoking-related ROS in human spermatogenesis. © 2014 Blackwell Verlag GmbH.

Relationship between miR-146a rs2910164 (G>C) Polymorphism and Digestive System Cancer Susceptibility: A Meta-Analysis.

PubMed

Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong

2017-08-01

MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.

Matrix-Gla Protein rs4236 [A/G] gene polymorphism and serum and GCF levels of MGP in patients with subgingival dental calculus.

PubMed

Doğan, Gülnihal Emrem; Demir, Turgut; Aksoy, Hülya; Sağlam, Ebru; Laloğlu, Esra; Yildirim, Abdulkadir

2016-10-01

Matrix-Gla Protein (MGP) is one of the major Gla-containing protein associated with calcification process. It also has a high affinity for Ca 2+ and hydroxyapatite. In this study we aimed to evaluate the MGP rs4236 [A/G] gene polymorphism in association with subgingival dental calculus. Also a possible relationship between MGP gene polymorphism and serum and GCF levels of MGP were examined. MGP rs4236 [A/G] gene polymorphism was investigated in 110 patients with or without subgingival dental calculus, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques. Additionally, serum and GCF levels of MGP of the patients were compared according to subgingival dental calculus. Comparison of patients with and without subgingival dental calculus showed no statistically significant difference in MGP rs4236 [A/G] gene polymorphism (p=0.368). MGP concentrations in GCF of patients with subgingival dental calculus were statistically higher than those without subgingival dental calculus (p=0.032). However, a significant association was not observed between the genotypes of AA, AG and GG of the MGP rs4236 gene and the serum and GCF concentrations of MGP in subjects. In this study, it was found that MGP rs4236 [A/G] gene polymorphism was not to be associated with subgingival dental calculus. Also, that GCF MGP levels were detected higher in patients with subgingival dental calculus than those without subgingival dental calculus independently of polymorphism, may be the effect of adaptive mechanism to inhibit calculus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

IL-1B rs16944 polymorphism is related to septic shock and death.

PubMed

Jiménez-Sousa, María Ángeles; Medrano, Luz M; Liu, Pilar; Almansa, Raquel; Fernández-Rodríguez, Amanda; Gómez-Sánchez, Esther; Rico, Lucía; Heredia-Rodríguez, María; Gómez-Pesquera, Estefanía; Tamayo, Eduardo; Resino, Salvador

2017-01-01

IL-1β is a primary mediator of systemic inflammatory response syndrome (SIRS) and it may lead to shock septic. Our aim was to analyse whether IL-1B rs16944 polymorphism is associated with the onset of septic shock and death after major surgery. We performed a case-control study on 467 patients who underwent major cardiac or abdominal surgery. Of them, 205 patients developed septic shock (cases, SS group) and 262 patients developed SIRS (controls, SIRS group). The primary outcome variables were the development of septic shock and death within 90 days after diagnosis of septic shock. The IL-1B rs16944 polymorphism was genotyped by Sequenom's MassARRAY platform. The association analysis was performed under a recessive genetic model (AA vs. GG/GC). The frequency of septic shock was higher in patients with IL-1B rs16944 AA genotype than in patients with IL-1B rs16944 GG/AG genotype when all patients were taken into account (63·6% vs. 41·8%; P = 0·006), cardiac surgery (52·2% vs. 33·3%; P = 0·072) and abdominal surgery (76·2% vs. 50·2%; P = 0·023). However, the IL-1B rs16944 AA genotype was only associated with higher likelihood of septic shock in the analysis of all population [adjusted odds ratio (aOR) = 2·26 (95%CI = 1·03; 4·97; P = 0·042], but not when it was stratified by cardiac surgery (P = 0·175) or abdominal surgery (P = 0·467). Similarly, IL-1B rs16944 AA genotype was also associated with higher likelihood of septic shock-related death in all population [aOR = 2·67 (95%CI = 1·07; 4·97); P = 0·035]. IL-1B rs16944 AA genotype seems to be related to the onset of septic shock and death in patients who underwent major surgery. © 2016 Stichting European Society for Clinical Investigation Journal Foundation.

Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

PubMed

Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

2017-01-01

Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

The association between the miRNA-146a rs2910164 C>G polymorphism and Kawasaki disease in a southern Chinese population.

PubMed

Zhang, Li; Wang, Jinxin; Che, Di; Wang, Yanfei; Rong, Xing; Pi, Lei; Xu, Yufen; Li, Wei; Huang, Ping; Chu, Maoping; Gu, Xiaoqiong

2018-06-14

miRNA-146a plays a critical role in innate immune and inflammatory responses. Kawasaki disease involves immune-mediated inflammatory responses, which lead to vascular endothelial injury. However, there has been no study on the association between the miRNA-146a rs2910164 C>G polymorphism and Kawasaki disease risk. We enrolled 532 Kawasaki disease patients and 623 healthy controls from a southern Chinese population, and the miRNA-146a rs2910164 C>G polymorphism was genotyped by the TaqMan method. There was no evidence that this polymorphism was associated with Kawasaki disease. Stratified analysis also showed no significant association. This study indicates that the miRNA-146a rs2910164 C>G polymorphism may not be associated with Kawasaki disease in a southern Chinese population. Larger, multicenter studies are needed to confirm our conclusions. ©2018 The Author(s).

Association between ErbB4 single nucleotide polymorphisms and susceptibility to schizophrenia: A meta-analysis of case-control studies.

PubMed

Feng, Yanguo; Cheng, Dejun; Zhang, Chaofeng; Li, Yuchun; Zhang, Zhiying; Wang, Juan; Feng, Xiao

2017-02-01

Accumulating studies have reported inconsistent association between ErbB4 single nucleotide polymorphisms (SNPs) and predisposition to schizophrenia. To better interpret this issue, here we conducted a meta-analysis using published case-control studies. We conducted a systematic search of MEDLINE (Pubmed), Embase (Ovid), Web of Science (Thomson-Reuters) to identify relevant references. The association between ErbB4 SNPs and schizophrenia was assessed by odds ratios (ORs) and 95% confidence intervals (CIs). Between-study heterogeneity was evaluated by I squared (I) statistics and Cochran's Q test. To appraise the stability of results, we employed sensitivity analysis by omitting 1 single study each time. To assess the potential publication bias, we conducted trim and fill analysis. Seven studies published in English comprising 3162 cases and 4264 controls were included in this meta-analysis. Meta-analyses showed that rs707284 is statistically significantly associated with schizophrenia susceptibility among Asian and Caucasian populations under the allelic model (OR = 0.91, 95% CI: 0.83-0.99, P = 0.035). Additionally, a marginal association (P < 0.1) was observed between rs707284 and schizophrenia risk among Asian and Caucasian populations under the recessive (OR = 0.85, 95% CI: 0.72-1.01, P = 0.065) and homozygous (OR = 0.84, 95% CI: 0.68-1.03, P = 0.094) models. In the Asian subgroup, rs707284 was also noted to be marginally associated with schizophrenia under the recessive model (OR = 0.84, 95% CI: 0.70-1.00, P = 0.053). However, no statistically significant association was found between rs839523, rs7598440, rs3748962, and rs2371276 and schizophrenia risk. This meta-analysis suggested that rs707284 may be a potential ErbB4 SNP associated with susceptibility to schizophrenia. Nevertheless, due to the limited sample size in this meta-analysis, more large-scale association studies are still needed to confirm the results.

Tumor necrosis factor −308 polymorphism (rs1800629) is associated with mortality and ventilator duration in 1057 Caucasian patients

PubMed Central

Watanabe, Eizo; Zehnbauer, Barbara A.; Oda, Shigeto; Sato, Yasunori; Hirasawa, Hiroyuki; Buchman, Timothy G.

2012-01-01

Purpose Management of sepsis in critically ill patients remains difficult and requires prolonged intensive care. Genetic testing has been proposed as a strategy to identify patients at risk for adverse outcome of critical illnesses. Therefore, we wished to determine the influence of heredity on predisposition to poor outcome and on duration of ventilator support of intensive care unit (ICU) patients. Methods A study was conducted from July 2001 to December 2005 in heterogeneous population of patients from 12 US ICUs represented by the Genetic Predisposition to Severe Sepsis (GenPSS) archive. In 1057 Caucasian critically ill patients with SAPS II probability of survival of >0.2 in the US, six functional single nucleotide polymorphisms in relation to inflammatory cytokines and innate immunity (rs1800629, rs16944, rs1800795, rs1800871, rs2569190, and rs909253) were evaluated in terms of mortality and ventilator free days. Results The AA homozygote of TNF(−308) (rs1800629) was most over-represented in the deceased patient group (P = 0.015 with recessive model). The carriage of the TNF(−308)* AA genotype showed significantly higher odds ratio of 2.67(1.29–5.55) (P = 0.008) after adjustment with the covariates. However, the presence of 1, 2, or 3 acute organ dysfunctions was larger prognostic factors for the adverse outcome (OR(95%CI) = 2.98(2.00–4.45), 4.01(2.07–7.77), or 19.95(4.99–79.72), P < 0.001 for all). Kaplan–Mayer plot on ventilator duration of TNF(−308)* AA patient significantly diverged from that of TNF(−308)* (GG + GA) ((AA v GG + GA), Adjusted HR(95%CI) = 2.53(1.11–5.79) with Cox regression, P = 0.028). Conclusions TNF(−308)* AA is significantly associated with susceptibility to adverse outcome and to longer ventilator duration. Therefore, heredity likely affects both predisposition to ICU prognosis as well as the resource utilization. PMID:22749237

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Single-nucleotide polymorphism in the 5-α-reductase gene (SRD5A2) is associated with increased prevalence of metabolic syndrome in chemotherapy-treated testicular cancer survivors.