Wu, Lei; He, Yao; Zhang, Di
2015-11-01
To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.
Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej
2016-01-01
Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.
Imaizumi, Takahiro; Ando, Masahiko; Nakatochi, Masahiro; Maruyama, Shoichi; Yasuda, Yoshinari; Honda, Hiroyuki; Kuwatsuka, Yachiyo; Kato, Sawako; Kondo, Takaaki; Iwata, Masamitsu; Nakashima, Toru; Yasui, Hiroshi; Takamatsu, Hideki; Okajima, Hiroshi; Yoshida, Yasuko; Matsuo, Seiichi
2017-06-01
Blood pressure is influenced by hereditary factors and dietary habits. The objective of this study was to examine the effect of dietary salt consumption and single-nucleotide polymorphisms (SNPs) on blood pressure (BP). This was a cross-sectional analysis of 2728 male participants who participated in a health examination in 2009. Average dietary salt consumption was estimated using electronically collected meal purchase data from cafeteria. A multivariate analysis, adjusting for clinically relevant factors, was conducted to examine whether the effect on BP of salt consumption, SNPs, and interaction between salt consumption and each SNP. This study examined the SNPs AGT rs699 (Met235Thr), ADD1 rs4961 (Gly460Trp), NPPA rs5063 (Val32Met), GPX1 rs1050450 (Pro198Leu), and AGTR1 rs5186 (A1166C) in relation to hypertension and salt sensitivity. BP was not significantly associated with SNPs or salt consumption. The interaction between salt consumption and SNPs with systolic BP showed a significant association in NPPA rs5063 (Val32Met) (P = 0.023) and a marginal trend toward significance in rs4961 and rs1050450 (P = 0.060 and 0.067, respectively). The effect of salt consumption on BP differed by genotype. Dietary salt consumption and genetic variation can predict a high risk of hypertension.
Phababpha, Suphawadee; Kukongviriyapan, Upa; Pakdeechote, Poungrat; Senggunprai, Laddawan; Kukongviriyapan, Veerapol; Settasatian, Chatri; Tatsanavivat, Pyatat; Intharaphet, Phongsak; Senthong, Vichai; Komanasin, Nantarat; Settasatian, Nongnuch; Greenwald, Stephen E
2013-06-21
Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. A total of 208 Thai subjects, aged 35-75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai population.
2013-01-01
Background Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. Methods A total of 208 Thai subjects, aged 35–75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Results Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Conclusions Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai
Park, Robin; Lee, Won Jin; Ji, Jong Dae
2016-11-01
Studies suggest associations between the miR-146a single nucleotide polymorphisms (SNPs) and susceptibility to autoimmune diseases. However, the results are inconsistent and inconclusive. Therefore, the aim of this study was to arrive at a conclusion about the association between the three functional miR-146a SNPs and autoimmune disease risk. Studies were identified through PubMed/MEDLINE searches for studies published up to January 2016 using as keywords rs2910164, rs57095329, rs2431697, and miR-146a polymorphisms. Thirty studies were included in the meta-analysis. The SNP rs2910164 G > C was found to be associated with increased risk of multiple sclerosis (CC + CG versus GG, OR = 1.25, 95% CI: 1.01-1.55), with decreased risks of psoriasis (C versus G, OR = 0.81, 95% CI: 0.69-0.96; CC versus GC + GG, OR = 0.73, 95% CI: 0.56-0.94), Behcet's disease (CC versus GC + GG, OR = 0.60, 95% CI: 0.50-0.73), asthma (C versus G, OR = 0.80, 95% CI: 0.69-0.93; CC versus GC + GG, OR = 0.65, 95% CI: 0.48-0.86), and uveitis (CC + CG versus GG, OR = 0.61, 95% CI: 0.49-0.77). The SNP rs2431697 C > T was found to be associated with an increased risk of SLE (T versus C, OR = 1.26, 95% CI: 1.15-1.38; TC + TT versus CC, OR = 1.28, 95% CI: 1.03-1.58; TT versus TC + CC, OR = 1.40, 95% CI: 1.21-1.62). The SNP rs57095329 A > G was found to be associated with an increased risk of SLE (G versus C, OR = 1.25, 95% CI: 1.17-1.35). The miR-146a SNPs rs2910164, rs57095329, rs2431697 are associated with susceptibility to certain autoimmune diseases. However, for other autoimmune diseases, they may be protective or insignificant.
Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q
2010-11-01
Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.
Hashemi, Mohammad; Hanafi Bojd, Hamideh; Eskandari Nasab, Ebrahim; Bahari, Ali; Hashemzehi, Noor Allah; Shafieipour, Sara; Narouie, Behzad; Taheri, Mohsen; Ghavami, Saeid
2013-01-01
Background Genetic and environmental factors are important for the development of nonalcoholic fatty liver disease (NAFLD). Adiponectin is a white and brown adipose tissue hormone, and have been found to play essential roles in the regulation of energy homoeostasis. Recent reports have identified a possible role of adiponectin in NAFLD via PPARγ pathway. Objectives The present study was designed to find out the impact of adiponectin rs1501299 (276G/T) and rs266729 (-11377C/G) gene polymorphisms in NAFLD. Patients and Methods Eighty-three patients with diagnosis of NAFLD, and 93 healthy subjects were included in the study. Tetra ARMS-PCR was designed to detect single nucleotide polymorphisms. Results A significant difference was found between NAFLD and control group regarding the rs266729 polymorphism (χ2 = 7.35, P = 0.025). The rs266729 polymorphism increased the risk of NAFLD in codominant (CC vs. CG: OR = 2.18, 95% CI = 1.16 - 4.12, P = 0.016) and dominant (CC vs. CG/GG: OR = 2.31, 95% CI = 1.25 - 4.27; P = 0.008) inheritance tested models. The G allele increased the risk of NAFLD (OR = 1.63, 95% CI = 1.03 - 2.57, P = 0.037) in comparison with C allele. No significant difference was found between the groups concerning adiponectin rs1501299 gene polymorphism (χ2 = 0.70, P = 0.697). Conclusions adiponectin rs266729 polymorphism might be a candidate gene, which determines the susceptibility to NAFLD. Larger studies are necessary to confirm these findings in various populations. PMID:23922565
Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S
2017-06-26
Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.
Yu, M Y; Zhao, P Q; Yan, X H; Liu, B; Zhang, Q Q; Wang, R; Ma, C H; Liang, X H; Zhu, F L; Gao, L F
2013-09-10
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is expressed in different tissues and cells, including the pancreas and lymphocytes, and it can selectively induce apoptosis in tumor cells but not in most normal cells. TRAIL plays critical roles in type 1 diabetes mellitus, and is involved in type 2 diabetes mellitus (T2DM). We recently discovered the association of nonalcoholic fatty liver disease, a risk factor for T2DM, with a single nucleotide polymorphism (SNP) in the TRAIL (TNFSF10) gene at site 1595C/T (rs1131580), indicating the possible association of T2DM with this TRAIL polymorphism. The aim of this study was to investigate the relationship of the TRAIL SNP at site 1595C/T (rs1131580) with T2DM susceptibility and the biometabolic parameters of T2DM in a Han Chinese population. The polymerase chain reaction-restriction fragment length polymorphism method was used to genotype SNP rs1131580 in 292 patients with T2DM and 266 healthy controls. We found that the frequency of the CC genotype and that of the C allele of rs1131580 were significantly higher in T2DM patients than in the control group. Additionally, the triglyceride and serum creatinine levels of T2DM patients with the CC genotype were significantly higher than those of patients with the TT genotype. Thus, the CC genotype of the TRAIL SNP at 1595C/T (rs1131580) confers increased susceptible to T2DM in a Han Chinese population from Shandong Province. These data suggest that the CC genotype at this SNP is related to diabetic severity and it might be a candidate for the prognostic assessment of T2DM.
NASA Astrophysics Data System (ADS)
Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.
2015-11-01
Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.
ERIC Educational Resources Information Center
Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli
2010-01-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…
TERT rs2736098 polymorphism and cancer risk: results of a meta-analysis.
Qi, Hao-Yu; Zou, Peng; Zhao, Lin; Zhu, Jue; Gu, Ai-Hua
2012-01-01
Several studies have demonstrated associations between the TERT rs2736098 single nucleotide polymorphisms (SNPs) and susceptibility to cancer development. However, there are conflicting results. A systematic meta-analysis was therefore performed to establish the cancer risk associated with the polymorphism. In this meta-analysis, a total of 6 case-control studies, including 5,567 cases and 6,191 controls, were included. Crude odds ratios with 95% confidence intervals were used to assess the strength of associations in several genetic models. Our results showed no association reaching the level of statistical significance for overall risk. Interestingly, in the stratified analyses (subdivided by ethnicity), significantly increased risks were found in the Asian subgroup which indicates the TERT rs2736098 polymorphism may have controversial involvement in cancer susceptibility. Overall, this meta-analysis indicates that the TERT rs2736098 polymorphism may have little involvement in cancer susceptibility.
Association between rs6812193 polymorphism and sporadic Parkinson's disease susceptibility.
Huo, Qiang; Li, Tao; Zhao, Peiqing; Wang, Lianqing
2015-08-01
Recently, the association of a single nucleotide polymorphism rs6812193 C/T with sporadic Parkinson's disease (PD) susceptibility has been widely evaluated, but the results remained inconsistent. This association should be clarified because of the importance of it on human health and quality of life. We performed a comprehensive meta-analysis to evaluate the association between the rs6812193 polymorphism and sporadic PD. PubMed was used to retrieve articles published up to June 2014 for all studies evaluating the rs6812193 polymorphism and PD in humans. Ethnicity-specific subgroup analysis was also performed based on ethnicity susceptibility. A total of 17 independent study samples (15 Caucasians and 2 Asians) including 17,956 cases and 52,751 controls were used in the presented study. The MAFT (minor allele T frequency) in PD patients of European descent is obviously higher than Asian cases (p < 0.01). The results suggested the rs6812193 polymorphism (allele T vs. C) is significantly associated with PD susceptibility among overall samples (OR 0.882, 95 % CI 0.856-0.908) and Caucasian population (OR 0.881, 95 % CI 0.856-0.907), but not in Asian samples (OR 0.918, 95 % CI 0.721-1.168). No evidence of publication bias was observed. Throughout our analysis, the rs6812193 polymorphism is significantly associated with sporadic PD susceptibility in Caucasian samples, and ethnicity might be the key point of inconsistency in rs6812193 studies. Further studies are warranted to re-examine the observed associations, especially in different ethnicities.
USDA-ARS?s Scientific Manuscript database
Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...
Polymorphisms of Interlukin-1β rs16944 confer susceptibility to myelodysplastic syndromes.
Yin, Congcong; He, Na; Li, Peng; Zhang, Chen; Yu, Jie; Hua, Mingqiang; Ji, Chunyan; Ma, Daoxin
2016-11-15
Genetic factors have been shown to be associated with Myelodysplastic syndromes (MDS) susceptibility. In recent years, the role of inflammation in the promotion of tumor growth is supported by a broad range of experimental and clinical evidence. But the relationship between polymorphisms in NOD-like receptor protein 3 (NLRP3) inflammasome and MDS is rarely reported. Thus, we conducted a case-control study, and genotyped five single nucleotide polymorphisms (SNPs) (NLRP3, IL-1β, IL-18, CARD8, and NF-κB) in MDS patients and healthy controls. The association of different genotypes with patient characteristics was analyzed. Comparing MDS patients with controls, GG genotype of IL-1β (rs16944) was observed to be associated with a significantly increased risk of MDS 78/166 (48.8%) vs 26/96 (27.0%), OR=2.1, CI (1.0-4.4). No significant association was identified regarding the rest of investigated polymorphisms and MDS susceptibility. Complex karyotypes were more frequent in patients with GG genotype of IL-1β (rs16944). Patients with IL-1β polymorphisms (rs16944) GG and GA had lower hemoglobin than those without. Patients with IL-1β polymorphisms (rs16944) GG had higher IPSS scores than those without IL-1β polymorphisms. In conclusion, our present data shows that the IL-1β polymorphisms (rs16944) GG were frequently occurred in MDS. IL-1β (rs16944) GG genotype might serve as a novel biomarker and potential targets for MDS. Copyright © 2016 Elsevier Inc. All rights reserved.
The Drosha rs10719 T>C polymorphism is associated with preeclampsia susceptibility.
Rezaei, Mahnaz; Eskandari, Fatemeh; Mohammadpour-Gharehbagh, Abbas; Teimoori, Batool; Yaghmaei, Minoo; Mokhtari, Mojgan; Salimi, Saeedeh
2018-01-01
Drosha is a member of the micro RNA (miRNA) processing machinery that affects miRNA processing. Single-nucleotide polymorphisms (SNPs) in the Drosha gene might affect microRNA processing and the expression of various genes. The aim of this study is to investigate the association between SNPs in the Drosha gene and preeclampsia (PE) in the southeast of Iran. Genotyping of Drosha rs10719 and rs6877842 was performed using blood samples from 219 PE women and 205 healthy control subjects by a polymerase chain reaction-restriction fragment length polymorphism method. The Drosha rs10719TC genotype was significantly associated with 1.6-fold higher risk of PE (odds ratio (OR, 1.6 [95% CI, 1.1-2.4], P = 0.026). In addition, the frequency of the Drosha rs10719CC genotype was significantly higher in PE women and was associated with threefold higher risk of PE (OR 3 [95% CI 1.4-6.3], P = 0.004). There was no association between the Drosha rs6877842 polymorphism and PE susceptibility. The CC-GG combined genotype was associated with 3.4-fold higher risk of PE (OR 3.4 [95% CI 1.4-8.1], P = 0.007). The haplotype-based association analysis showed higher frequency of C-G haplotype of Drosha rs10719 and rs6877842 polymorphisms with the increased risk of PE 1.5-fold (OR 1.5 [95% CI 1.1 - 2], P = 0.01). The Drosha rs10719TC and CC genotypes were associated with PE risk. The CC-GG combined genotype and C-G haplotype of Drosha rs10719 and rs6877842 polymorphisms may increase PE susceptibility.
Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang
2014-11-01
Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.
Wang, Hong; Hua, Mingqiang; Wang, Shukang; Yu, Jie; Chen, Chen; Zhao, Xueyun; Zhang, Chen; Zhong, Chaoqin; Wang, Ruiqing; He, Na; Hou, Ming; Ma, Daoxin
2017-03-01
Though the pathogenesis of AML is still unknown, accumulating evidence revealed that immune response plays a vital part in it. NLRP3 inflammasome as a component of immune system has been found related to several cancers. The single nucleotide polymorphisms (SNPs) of NLRP3 inflammasome genes may be related to pathogenesis and prognosis of AML. We determined polymorphisms of NLRP3 (rs35829419), CARD8 (rs2043211), IL-1β (rs16944), IL-18 (rs1946518) and NF-κB -94 ins/del ATTG in de novo AML patients to find out whether they play roles in the susceptibility and severity of AML. In our study, 383 AML cases and 300 randomly selected healthy individuals were examined for the polymorphisms and expression of NLRP3 genes. IL-1β (rs16944) polymorphism in different risk AML subgroups was found statistically different, with more GA genotype in favorable-risk cytogenetics group. We also demonstrated that the bone marrow blasts of patients carrying IL-18 (rs1946518) GG or GT genotype were higher than patients of TT genotype. IL-18 plasma level of patients with IL-18 (rs1946518) GT or TT genotype was higher than GG genotype. Moreover, the GT genotype of IL-18 (rs1946518) led to statistically poorer AML-specific survival. IL-1β (rs16944) and IL-18 (rs1946518) may be served as potential predictors for AML.
Liu, Ding; Liu, Lei; Hu, Zhongyang; Song, Zhi; Wang, Yaqin; Chen, Zhiheng
2018-01-01
Type 2 diabetes mellitus is a polygenic metabolic disorder resulting from oxidative stress, the root cause of insulin resistance, β-cell dysfunction and impaired glucose tolerance. The aim of this study was to investigate the role of oxidative stress-related genes ALOX5, ALOX5AP, GPX1, GPX3 and MPO in type 2 diabetes mellitus susceptibility in the Chinese Han population. A total of 396 type 2 diabetes mellitus patients and 678 controls were recruited. The ALOX5 rs10900213, ALOX5AP rs4293222, GPX1 rs1050450, GPX3 rs3828599 and MPO rs2107545 gene polymorphisms were genotyped. We found one single-nucleotide polymorphism in the MPO gene was associated with type 2 diabetes mellitus susceptibility [rs2107545: odds ratio = 1.563 (1.166-2.096); p = 0.003], after adjusting for covariates. Furthermore, we also considered the likely complexity of effects of genetic and conventional risk factors in type 2 diabetes mellitus-related vascular complications, such as carotid plaques. Our analysis revealed that the GPX1 rs1050450 and MPO rs2107545 were significantly associated with increased risk of carotid plaques in type 2 diabetes mellitus patients. Our study presents novel evidence for main effects of MPO gene on type 2 diabetes mellitus susceptibility. Furthermore, our study supported the association between variants of oxidative stress-related genes ( GPX1 and MPO) and carotid plaques in type 2 diabetes mellitus patients, which indicated a modulation of type 2 diabetes mellitus-related vascular complication susceptibility by genetic predisposition.
Mbikay, Majambu; Sirois, Francine; Nkongolo, Kabwe K; Basak, Ajoy; Chrétien, Michel
2011-12-01
Proprotein convertase 1/3 (PC1/3) is one of the endoproteases initiating the proteolytic activation of prohormones and proneuropeptides in the secretory pathway. It is produced as a zymogen that is subsequently modified by activity-determining cleavages at the amino and the carboxyl termini. In human, it is encoded by the PCSK1 locus on chromosome 5. Spontaneous inactivating mutations in its gene have been linked to obesity. Minor alleles of the common non-synonymous single-nucleotide polymorphisms (SNPs) rs6232 (T>C, N221D), rs6234 (G>C, Q665E) and rs6235 (C>G, S690T) have been associated with increased risk of obesity. We have shown that the variations associated with these SNPs are linked on minor PCSK1 alleles. In this study, we examined the impact of amino acid substitutions specified by the minor PCSK1 alleles on PC1/3 biosynthesis and prohormone processing activity in cultured cells. The common and variant isoforms of PC1/3 were expressed in transfected rat pituitary GH4C1 cells with or without proopiomelanocortin (POMC) as a substrate. Secreted PC1/3- or POMC-related proteins and peptides were analyzed by immunoblotting and immunoprecipitation. When expressed in GH4C1 cells, the triple-variant PC1/3 underwent significantly more proteolytic processing at the amino and carboxyl termini than the common and double-variant isoforms. However, there was no detectable difference among these isoforms in their ability to process POMC in the transfected cells. Since truncation of PC1/3 in its C-terminal region reportedly renders the enzyme unstable, we speculate that the accentuated processing of the triple variant in this region may, in vivo, create a subtle deficit of PC1/3 enzymatic activity in endocrine and neuroendocrine cells, causing impaired processing of prohormones and proneuropeptides to their bioactive forms. Copyright © 2011 Elsevier Inc. All rights reserved.
Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.
Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima
2017-06-01
Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.
Dou, Xin-Man; Cheng, Hui-Juan; Meng, Ling; Zhou, Lin-Lin; Ke, Yi-Hong; Liu, Li-Ping; Li, Yu-Min
2017-04-30
The aim of the present study is to investigate association between septic shock (SS) and angiotensin I-converting enzyme ( ACE ) single nucleotide polymorphisms (SNPs). From October 2009 to December 2016, 238 SS patients and 242 healthy individuals were selected for our study. ACE activity was detected, ACE rs4291 and rs4646994 polymorphisms were detected using PCR-restriction fragment length polymorphism (PCR-RFLP). The Kaplan-Meier survival curve was employed to evaluate the association between ACE SNPs and patients' survival and univariate and multivariate analyses to estimate risk factors for SS. ACE activity in the case group was increased in comparison with the control group. Allele and genotype frequencies of rs4291 and rs4646994 were different between the case and control groups. The TT genotype frequency of the rs4291 polymorphisms and the DD genotype of the rs4646994 polymorphisms of the case group were higher than those in the control group. The AT and TT genotypes indicated a significant elevation of ACE activity than the AA genotype, while a significant decline was found in the DI and II genotypes in comparison with the DI genotype. Patients with TT or DD genotypes had increased fatality rate within 7 and 30 days when compared with those with non-TT or non-DD genotypes. Lower sepsis-related organ failure assessment (SOFA) scores, rs4291, serum ACE and rs4646994 were all considered as risky factors for SS patients. The study demonstrates that TT genotype of rs4291 or DD genotype of rs4646994 may be indicative of a higher risk of SS and a poorer prognosis in SS patients. © 2017 The Author(s).
Eriksen, Mette B; Brusgaard, Klaus; Andersen, Marianne; Tan, Qihua; Altinok, Magda L; Gaster, Michael; Glintborg, Dorte
2012-07-01
Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women. To investigate the association between rs13405728 (LHCGR gene), rs13429458 (THADA gene) and rs2479106 (DENND1A gene), PCOS, hirsutism and metabolic and hormonal parameters in a well characterized cohort of Caucasian patients of Danish descendant with PCOS or hirsutism. Patients underwent clinical examination, hormone analyses, oral glucose tolerance test and transvaginal ultrasound. Genetic variation was tested using allelic discrimination by real-time PCR. 268 patients referred to The Department of Endocrinology, Odense University Hospital, Denmark with PCOS or hirsutism between 1997 and 2011. Two hundred and forty-eight healthy females were included as controls. Genotype distributions and allele frequencies of rs13405728, rs13429458, and rs2479106 were comparable in patients and controls. The rs2479106 G allele was associated with a decreased PCOS susceptibility. None of the SNPs were associated with hirsutism or increased metabolic parameters. The rs2479106 G allele was associated with decreased PCOS susceptibility, thus confirming previously reported findings of association between rs2479106 and PCOS. Metabolic and hormonal parameters were comparable between genotypes of rs13405728 and rs2479106. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Hernández Guerrero, César; Hernández Chávez, Paulina; Martínez Castro, Noemí; Parra Carriedo, Alicia; García Del Rio, Sandra; Pérez Lizaur, Ana
2015-10-01
obesity affects more than a third of Mexican population. Oxidative stress participates actively in the etiology of this phenomenon. Glutathione peroxidase-1 (GPX-1) plays a protective role against oxidative stress. The SNP Pro200Leu (rs10504050) has been reported to affect the activity of the enzyme. to determine the frequency of rs10504050 polymorphism in women with obesity and normal weight control, asses the concentration of peripheral TBARS and evaluate the consumption of pro and antioxidants. 104 women with obesity and 70 healthy controls (CG) were included in the study. Anthropometric, biochemical, clinical and dietary features were evaluated. GPx-1 rs10504050 was determined by PCR/RFLP method. TBARS was assayed spectrophotometrically in plasma. The subjects were stratified and compared by obesity grades and by subgroups of prediabetes and diabetes condition. Statistical analysis included ANOVA of Kruskal Wallis, Xi squared and Pearson correlation. for rs10504050 polymorphism there were differences (Xi2 = 6; p = 0.01) between frequency (0.61) of obese carriers (Pro/Leu plus Leu/Leu) and CG carriers (0.42), and between (Xi2 = 8; p = 0.004) morbid (IMC > 40) obesity (0.74) and CG carriers. The obese group (OB) showed a prevalence of 66% of prediabetes plus diabetes. There were no differences in frequencies of rs10504050 in OB with pre or diabetes versus CG, or versus obese participants without diabetes. TBARS concentration was greater in all the degrees of OB versus CG. GPx-1 Pro200Leu polymorphism was associated with obesity especially with morbid obesity, but not with obese participants with prediabetes or diabetes. Oxidative stress is present in all grades of obesity significantly. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.
Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.
2012-01-01
Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577
Zhang, Shuyan; Li, Xuling; Ma, Guoda; Jiang, Yongshuai; Liao, Mingzhi; Feng, Rennan; Zhang, Liangcai; Liu, Jiafeng; Wang, Guangyu; Zhao, Bin; Jiang, Qinghua; Li, Keshen; Liu, Guiyou
2016-04-01
Large-scale genome-wide association studies (GWAS) identified three single nucleotide polymorphisms rs11136000, rs2279590, and rs9331888 in CLU gene to be significantly associated with Alzheimer's disease (AD) in Caucasian ancestry. Both rs11136000 and rs2279590 variants were successfully replicated in Asian population. However, previous studies reported either a weak association or no association between rs9331888 polymorphism and AD in Asian population. Here, we searched the PubMed, AlzGene, and Google Scholar databases. We selected 12 independent studies that evaluated the association between the rs9331888 polymorphism and AD using a case-control design. Using an additive model, we did not identify significant heterogeneity among these 12 studies. We observed significant association between rs9331888 polymorphism and AD in pooled populations (P = 2.26E - 07, odds ratio (OR) = 1.10, 95% confidence interval (CI) 1.06-1.14). In subgroup analysis, we did not identify significant heterogeneity in both Asian and Caucasian populations. We identified significant association in Caucasian population (P = 1.67E - 08, OR = 1.13, 95% CI 1.08-1.18) but not in East Asian population (P = 0.49, OR = 1.02, 95% CI 0.96-1.10).
Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.
Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S
2012-11-10
We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.
Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof; Pawlik, Andrzej
2017-08-01
Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04-2.28; p = 0.035). The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity.
Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu
2012-10-01
To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.
Lee, Mi-Na; Kang, Ben; Choi, So Yoon; Kim, Mi Jin; Woo, Sook Young; Kim, Jong-Won; Choe, Yon Ho; Lee, Soo-Youn
2015-12-01
Thiopurine-related toxicity results in discontinuation of therapy in up to 30% of patients with inflammatory bowel disease. Although thiopurine S-methyltransferase (TPMT) is implicated in toxicity, not all toxicity can be attributed to TPMT polymorphisms. We investigated the effects of polymorphisms of genes involved in thiopurine and folate metabolism pathways on 6-thioguanine nucleotide levels and toxicity. Retrospective clinical data and blood samples were collected from 132 pediatric patients with inflammatory bowel disease treated with azathioprine. Eighty-seven genetic polymorphisms of 30 genes were screened using the MassARRAY system, and 70 polymorphisms of 28 genes were selected for further analysis. TPMT genotype (P < 0.001), concurrent use of mesalazine (P = 0.006), ABCC5 (rs2293001) (P < 0.001), ITPA (rs2236206 and rs8362) (P = 0.010 and P = 0.003), and ABCB1 (rs2032582) (P = 0.028) were all associated with the ratio of 6-thioguanine nucleotides to azathioprine dose. ADK (rs10824095) (P = 0.004, odds ratio [OR] = 6.220), SLC29A1 (rs747199) (P = 0.016, OR = 5.681), and TYMS (rs34743033) (P = 0.045, OR = 3.846) were associated with neutropenia. ABCC1 (rs2074087) (P = 0.022, OR = 3.406), IMPDH1 (rs2278294) (P = 0.027, OR = 0.276), and IMPDH2 (rs11706052) (P = 0.034, OR = 3.639) had a significant impact on lymphopenia. This study describes genetic polymorphisms in genes whose products may affect pharmacokinetics and which may predict the relative likelihood of benefit or risk from thiopurine treatment. These findings may serve as a basis for personalized thiopurine therapy in pediatric patients with inflammatory bowel disease, although our data need to be validated in further studies.
Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina
2014-06-01
Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.
A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers.
Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado
2017-11-01
Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.
Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei
2017-09-01
It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.
Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof
2017-01-01
Introduction Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. Material and methods We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. Results There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04–2.28; p = 0.035). Conclusions The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity. PMID:28883856
Apalasamy, Y D; Moy, F M; Rampal, S; Bulgiba, A; Mohamed, Z
2014-07-04
A genome-wide association study showed that the tagging single nucleotide polymorphism (SNP) rs7566605 in the insulin-induced gene 2 (INSIG2) was associated with obesity. Attempts to replicate this result in different populations have produced inconsistent findings. We aimed to study the association between the rs7566605 SNP with obesity and other metabolic parameters in Malaysian Malays. Anthropometric and obesity-related metabolic parameters and DNA samples were collected. We genotyped the rs7566605 polymorphism in 672 subjects using real-time polymerase chain reaction. No significant associations were found between the rs7566605 tagging SNP of INSIG2 with obesity or other metabolic parameters in the Malaysian Malay population. The INSIG2 rs7566605 SNP may not play a role in the development of obesity-related metabolic traits in Malaysian Malays.
Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J
2018-03-01
Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.
Sorokin, Alexander V; Kotani, Kazuhiko; Bushueva, Olga Y; Polonikov, Alexey V
2016-04-01
The cardio-ankle vascular index is a measure of arterial stiffness, whereas oxidative stress underlies arterial pathology. This study aimed to investigate the association between the cardio-ankle vascular index and antioxidant-related gene polymorphisms in young Russians. A total of 89 patients (mean age, 21.6 years) were examined by the cardio-ankle vascular index and for 15 gene polymorphisms related to antioxidant enzymes including FMO3 (flavin-containing monooxygenase 3), GPX1 (glutathione peroxidase 1), and GPX4 (glutathione peroxidase 4). A higher cardio-ankle vascular index level was detected in carriers with the KK-genotype of FMO3 polymorphism rs2266782 than in those without (mean levels: 6.2 versus 5.6, respectively, p<0.05). Similarly, a higher cardio-ankle vascular index level was seen in carriers with the CC-genotype of GPX4 polymorphism rs713041 than in those without (6.0 versus 5.5, respectively, p<0.05). We did not observe significant associations between the cardio-ankle vascular index levels and the other gene polymorphisms. Although carriers with the LL-genotype of GPX1 polymorphism rs1050450 showed a higher diastolic blood pressure level than those without, the polymorphism did not affect the cardio-ankle vascular index level. This study showed a significant association between rs2266782 and rs713041 polymorphisms and arterial stiffness, as measured by the cardio-ankle vascular index, in young Russians. The pathways utilised by antioxidant enzymes may be responsible for early arterial stiffening in the Russian population.
Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel
2017-07-01
To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.
Moniuszko, Anna; Wawrusiewicz-Kurylonek, Natalia; Bossowska, Anna; Gościk, Joanna; Łuczyński, Włodzimierz; Głowińska-Olszewska, Barbara; Krętowski, Adam; Bossowski, Artur
2015-01-01
A potential role of preproghrelin polymorphisms on autoimmune thyroid diseases (AITDs) has not been established equivocally yet. To estimate the association of two polymorphisms of preproghrelin gene with the predisposition to Graves' disease (GD) and Hashimoto's thyroiditis (HT) in children. The study was performed in 145 patients with GD, 87 with HT and 161 healthy volunteers. The two single nucleotide polymorphisms (SNPs) rs696217 (C_3151003_20) and rs4684677 (C_25607748_10) in the preproghrelin gene were genotyped by TaqMan SNP genotyping assay using the real-time PCR. Rs4684677 T alleles were more frequent in HT patients (99% in women and 100% in men) in comparison to healthy subjects (p = 0.002) with OR = 8.0 and 95% confidence interval for OR: 1.8-206.7. In women group, rs4684677 T alleles were more frequent compared to healthy controls (99%) in HT (p = 0.02) with OR = 6.7 and 95% confidence interval for OR: 1.2-168.37. Frequency of the SNP rs696217 did not differ between the groups. There was a significant relationship between rs696217 polymorphisms and anti-TSHR antibodies level (p = 0.036) in women from GD/HT groups. A significant relationship between rs696217 polymorphisms and anti-TG antibodies level in GD women group (p = 0.038) and between rs696217 polymorphisms and fT4 concentration (p = 0.03) were found. Rs4684677 T/A polymorphisms in preproghrelin gene could contribute to development of AITDs in children and T allele is the main risk factor.
Shokouhi, Shabnam; Delpisheh, Ali; Haghani, Karimeh; Mahdizadeh, Mohsen; Bakhtiyari, Salar
2014-01-01
Single nucleotide polymorphisms (SNPs) within the transcription factor 7-like 2 (TCF7L2) gene are well known risk variants for type 2 diabetes mellitus (T2DM). The association between TCF7L2 SNPs and T2DM has been investigated in several studies, but the results are controversial. In this study, we investigated whether the rs7903146, rs12255372, and rs290487 polymorphisms of TCF7L2 are associated with T2DM per se or metabolic traits related to this disease in a Kurdish ethnic group of Iran. In all, 173 patients with T2DM and 173 normoglycemic subjects were included in this study. All subjects were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Genotypic and allelic frequencies were then analyzed in each group. Serum lipids, fasting glucose, fasting serum insulin, HOMA-IR, and HbA1c levels were determined by conventional methods. T-allele and genotype frequencies of rs7903146, rs12255372, and rs290487 were significantly different between T2DM and control subjects. The CT genotype (OR = 1.98, p = 0.008), TT genotype (OR = 3.54, p = 0.024), and the dominant model (OR = 2.16, p = 0.002) of rs7903146 were associated with T2DM. The GT genotype (OR = 2.23, p = 0.005), TT genotype (OR = 4.25, p = 0.046), and the dominant model (OR = 2.2, p = 0.001) of rs12255372 gave a higher risk for T2DM. The carriers of CT genotype of rs290487 showed a significantly increased risk for T2DM (OR = 2.24, p = 0.003). Similarly, the dominant model of this SNP was found to be significantly associated with T2DM (OR = 2.25, p = 0.002). The control subjects carrying the T-allele of rs7903146 had higher levels of total cholesterol (CC; 4.52 +/- 1.03 vs. CT + TT; 5.00 +/- 1.2 mmol/L, p = 0.009) than those with CC genotype. Normoglycemic subjects carrying GT + TT genotypes of rs12255372 had a significantly higher WHR (GG; 0.90 +/- 0.059 vs. GT + TT; 0.93 +/- 0.07, p = 0.038) as compared with those with the GG genotype. The T-allele of rs12255372, rs
Genetic association of polymorphism rs1333049 with gout.
Wang, Binbin; Meng, Dongmei; Wang, Jing; Liu, Shiguo; Zhou, Sirui; Miao, Zhimin; Han, Lin; Chu, Nan; Zhang, Kun; Ma, Xu; Li, Changgui
2011-09-01
We suspect that genes or loci that contribute to coronary artery disease (CAD) may also play a role in the pathogenesis of gout, since hyperuricaemia leads to gout, and serum uric acid (SUA) levels are potential risk factors for CAD. The single nucleotide polymorphism (SNP) rs1333049 (C/G) on chromosome 9p21 has been implicated in previous studies to be associated with CAD. The aim of this study was to evaluate the relationship between this SNP and gout pathogenesis. Nine hundred Chinese Han were recruited for this study (461 gout patients and 439 gout-free individuals). The rs1333049 SNP and surrounding sequences were PCR sequenced. There was a clear link between the rs1333049 genotypic and allelic frequencies between gout cases and controls (χ(2) = 6.81, df = 2, P = 0.033 by genotype; χ(2) = 6.63, df = 1, P = 0.01 by allele). There was a significantly increased risk of gout in carriers of the CC genotype (odds ratio = 1.43, 95% CI 1.07, 1.91). To the best of our knowledge, our findings are the first to establish an association of rs1333049 with gout in a Chinese Han population. Meanwhile, this SNP is homologous to miR-519 and miR-520.
Barra, Gustavo Barcelos; Dutra, Ludmila Alves Sanches; Watanabe, Sílvia Conde; Costa, Patrícia Godoy Garcia; Cruz, Patrícia Sales Marques da; Azevedo, Monalisa Ferreira; Amato, Angélica Amorim
2012-11-01
To investigate the association of the T allele of the single nucleotide polymorphism (SNP) rs7903146 of TCF7L2 with the occurrence of T2D in a sample of subjects followed up at the Brasilia University Hospital. The SNP rs7903146 of TCF7L2 was genotyped by allele-specific PCR in 113 patients with known T2D and in 139 non-diabetic controls in Brasilia, Brazil. We found that the T allele of the SNP rs7903146 of TCF7L2 was significantly associated with T2D risk (odds ratio of 3.92 for genotype TT in the recessive genetic model, p = 0.004 and 1.5 for T allele, p = 0.032). These results reinforce previous findings on the consistent association of this genetic factor and the risk of T2D in populations of diverse ethnic backgrounds.
Is the COL5A1 rs12722 gene polymorphism associated with running economy?
Bertuzzi, Rômulo; Pasqua, Leonardo A; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H
2014-01-01
The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km · h(-1)) and 12 km · h(-1)) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km · h(-1) (p = 0.232) and 12 km · h(-1) (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running.
Is the COL5A1 rs12722 Gene Polymorphism Associated with Running Economy?
Bertuzzi, Rômulo; Pasqua, Leonardo A.; Bueno, Salomão; Lima-Silva, Adriano Eduardo; Matsuda, Monique; Marquezini, Monica; Saldiva, Paulo H.
2014-01-01
The COL5A1 rs12722 polymorphism is considered to be a novel genetic marker for endurance running performance. It has been postulated that COL5A1 rs12722 may influence the elasticity of tendons and the energetic cost of running. To date, there are no experimental data in the literature supporting the relationship between range of motion, running economy, and the COL5A1 rs12722 gene polymorphism. Therefore, the main purpose of the current study was to analyze the influence of the COL5A1rs12722 polymorphism on running economy and range of motion. One hundred and fifty (n = 150) physically active young men performed the following tests: a) a maximal incremental treadmill test, b) two constant-speed running tests (10 km•h−1 and 12 km•h−1) to determine the running economy, and c) a sit-and-reach test to determine the range of motion. All of the subjects were genotyped for the COL5A1 rs12722 single-nucleotide polymorphism. The genotype frequencies were TT = 27.9%, CT = 55.8%, and CC = 16.3%. There were no significant differences between COL5A1 genotypes for running economy measured at 10 km•h−1 (p = 0.232) and 12 km•h−1 (p = 0.259). Similarly, there were no significant differences between COL5A1 genotypes for range of motion (p = 0.337). These findings suggest that the previous relationship reported between COL5A1 rs12722 genotypes and running endurance performance might not be mediated by the energetic cost of running. PMID:25188268
Rocha, Renato Marano; Barra, Gustavo Barcelos; Rosa, Érica Carine Campos Caldas; Garcia, Érica Correa; Amato, Angélica Amorim; Azevedo, Monalisa Ferreira
2015-08-01
This study aimed to get the genotypic and allelic frequencies of rs1801282 in 179 volunteer donors and 154 patients with Metabolic syndrome (MetS) in Brasilia, Brazil and also examine the association with anthropometric, biochemical and hemodynamic variables in the latter group. MetS comprises a group of diseases resulting from insulin resistance, in-creased risk of type 2 diabetes and atherosclerotic cardiovascular disease. MetS is defined by the presence of increased visceral fat, atherogenic dyslipidemia (elevated triglycerides (TGL)), with decreased high density lipoprotein (HDL) and increased low density lipoprotein (LDL) levels, hypertension (BPH) and disturbances in glucose homeostasis representing a significant burden across the world due to the alarming increase in the incidence over the last decades besides their significant morbidity and mortality. Peroxisome proliferator activated receptor-gamma (PPARg) has been mentioned as a candidate gene for determining the risk of MetS. It is a member of the nuclear receptors superfamily and a ligand-activated transcription factor, which regulates the expression of genes involved in the network lipogenesis and adipogenesis, insulin sensitivity, energy balance, inflammation, angiogenesis and atherosclerosis. Among the PPARG genetic variants, single nucleotide polymorphism rs1801282 has been the most extensively studied one since it was first described by Yen and cols. in 1997. This polymorphism is characterized by the replacement of a proline (CCC) to an alanine (GCA) at codon 12 of exon B, due to the exchange of a cytosine with a guanine. The Ala allele frequency varies in different ethnic groups. DNA was extracted using Chelex-100 method and determinations of genotypes were performed by allele-specific chain reaction. The distribution of genotype frequency of the MetS group was not statistically different from the frequency in the donor population at large. In the first group, genotype frequency was CC to 0
Aledo, Rosa; Padró, Teresa; Mata, Pedro; Alonso, Rodrigo; Badimon, Lina
2015-04-01
Recent genome-wide association studies have identified a locus on chromosome 12q13.3 associated with plasma levels of triglyceride and high-density lipoprotein cholesterol, with rs11613352 being the lead single nucleotide polymorphism in this genome-wide association study locus. The aim of the study is to investigate the involvement of rs11613352 in a population with high cardiovascular risk due to familial hypercholesterolemia. The single nucleotide polymorphism was genotyped by Taqman(®) assay in a cohort of 601 unrelated familial hypercholesterolemia patients and its association with plasma triglyceride and high-density lipoprotein cholesterol levels was analyzed by multivariate methods based on linear regression. Minimal allele frequency was 0.17 and genotype frequencies were 0.69, 0.27, and 0.04 for CC, CT, and TT genotypes, respectively. The polymorphism is associated in a recessive manner (TT genotype) with a decrease in triglyceride levels (P=.002) and with an increase in high-density lipoprotein cholesterol levels (P=.021) after adjusting by age and sex. The polymorphism rs11613352 may contribute to modulate the cardiovascular risk by modifying plasma lipid levels in familial hypercholesterolemia patients. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.
Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli
2010-09-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.
Tahir, Imtiaz Mahmood; Iqbal, Tahira; Saleem, Sadaf; Perveen, Sofia; Farooqi, Aboubakker
2017-01-01
Interindividual variability in polymorphic uridine diphosphate-glucuronosyltransferase 1A1 (UGT1A1) ascribed to genetic diversity is associated with relative glucuronidation level among individuals. The present research was aimed to study the effect of 2 important single nucleotide polymorphisms (SNPs; rs8330 and rs10929303) of UGT1A1 gene on glucuronidation status of acetaminophen in healthy volunteers (n = 109). Among enrolled volunteers, 54.13% were male (n = 59) and 45.87% were female (n = 50). The in vivo activity of UGT1A1 was investigated by high-performance liquid chromatography-based analysis of glucuronidation status (ie, acetaminophen and acetaminophen glucuronide) in human volunteers after oral intake of a single dose (1000 mg) of acetaminophen. The TaqMan SNP genotyping assay was used for UGT1A1 genotyping. The wild-type genotype (C/C) was observed the most frequent one for both SNPs (rs8330 and rs10929303) and associated with fast glucuronidator phenotypes. The distribution of variant genotype (G/G) for SNP rs8330 was observed in 5% of male and 8% of the female population; however, for SNP rs10929303, the G/G genotype was found in 8% of both genders. A trimodal distribution (fast, intermediate, and slow) based on phenotypes was observed. Among the male participants, the glucuronidation phenotypes were observed as 7% slow, 37% intermediate, and 56% fast glucuronidators; however, these findings for the females were slightly different as 8%, 32%, and 60% respectively. The k-statistics revealed a compelling evidence for good concordance between phenotype and genotype with a k value of 1.00 for SNP rs8330 and 0.966 for SNP rs10929303 in our population. PMID:28932176
Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun
2016-05-01
To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p < 0.001, OR = 2.864, 95% C.I. 1.631-4.968) and the A allele of rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.
Functional analysis of regulatory single-nucleotide polymorphisms.
Pampín, Sandra; Rodríguez-Rey, José C
2007-04-01
The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.
Zhang, Daofa; Xie, Maowei; Yang, Xiaohong; Zhang, Yin; Su, Yan; Wang, Yanni; Huang, Haiyang; Han, Hui; Li, Wenning; Fu, Keying; Su, Huiluan; Xu, Wentan; Han, Yeguang; Wang, Ru; Zhang, Pei; Wu, Wei; Huang, Yun; Chen, Daojun; Jin, Tianbo; Wei, Jiali
2017-09-22
IgA nephropathy (IgAN) is the most common form of primary glomerulonephritis worldwide, but etiology and pathogenesis continue to be poorly understood. Polymorphisms in the cytokine genes may play a role in the etiology and pathogenesis of IgAN. The incidence of different between diverse ethnic groups suggested important genetic influences on its pathogenesis. We genotype 10 single nucleotide polymorphisms (SNPs) in IL-1B and IL-6 gene using Sequenom Mass-ARRAY technology from 417 IgAN patients and 463 healthy controls of the Chinese Han population. We evaluated these SNPs associated with IgAN utilising the chi-square tests and genetic model analysis. We identified that the minor alleles of rs16944 ("A"), rs1800796 ("G") in IL-1B, IL-6 were involved in an increasingly risk of IgAN in allelic model analysis, respectively. The rs16944 in IL-1B and rs1800796 in IL-6 were associated with 1.23-fold (95% CI, 1.02-1.48, P = 0.031) and 1.33-fold (95% CI, 1.11-1.66, P = 0.003) increases in the risk of developing IgAN, respectively. There was only rs1800796 still correlated with IgAN in the allelic model after adjustment by age and gender and the Bonferroni correction. In addition, Haplotype G rs1800796 A rs2069837 G rs2069840 ( P = 0.037) and G rs1800796 A rs2069837 C rs2069840 ( P = 0.042) in IL-6 were considered to be associated with increased IgAN risk. This study verified the IL-6, IL-1B genetic variants polymorphisms contributed to IgAN susceptibility in a Chinese Han population. Although we identified SNPs susceptibility, however, replication studies and functional research are required to confirm the genetic contribution in IgAN.
Wang, Meng; Wang, Zheng; Wang, Xi-Jing; Jin, Tian-Bo; Dai, Zhi-Ming; Kang, Hua-Feng; Guan, Hai-Tao; Ma, Xiao-Bin; Liu, Xing-Han; Dai, Zhi-Jun
2016-01-01
In recent years, studies have demonstrated that polymorphisms in the promoters of Fas and FasL are significantly associated with breast cancer risk. However, the results of these studies were inconsistent. This case-control study was performed to explore the associations between Fas rs1800682 and FasL rs763110 polymorphisms and breast cancer. A hospital-based case-control study of 560 Han Chinese females with breast cancer (583 controls) was conducted. The MassARRAY system was used to search for a possible association between the disease risk and the two single nucleotide polymorphisms, Fas rs1800682 and FasL rs763110. Statistical analyses were performed using SNPStats software to conduct Pearson's chi-square tests in five different genetic models. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated after adjustment to age and body mass index. PHASE v2.1 software was used to reconstruct all common haplotypes. A statistically significant association was found between Fas rs1800682 and increased breast cancer risk (AG vs AA: OR =1.37, 95% CI =1.06-1.78; AA+AG vs GG: OR =1.32, 95% CI =1.04-1.66), and also it was found that the FasL rs763110 polymorphism may decrease the risk. Stratified analyses demonstrated that the rs763110 polymorphism was associated with lower breast cancer risk among postmenopausal females (heterozygote model: OR =0.69, 95% CI =0.49-0.97; dominant model: OR =0.70, 95% CI =0.51-0.96). The T allele of rs763110 was also associated with a decreased risk of lymph node metastasis (allele model: OR =0.75, 95% CI =0.57-0.97) and an increased risk of the breast cancer being human epidermal growth factor receptor 2 positive (allele model: OR =1.37, 95% CI =1.03-1.18). Moreover, haplotype analysis showed that Ars1800682Trs763110 was associated to a statistically significant degree with lower risk of breast cancer (OR =0.70, 95% CI =0.53-0.91). These data suggest that the presence of Fas rs1800683 is an important risk factor for breast
Williams, F M K; Popham, M; Hart, D J; de Schepper, E; Bierma-Zeinstra, S; Hofman, A; Uitterlinden, A G; Arden, N K; Cooper, C; Spector, T D; Valdes, A M; van Meurs, J
2011-01-01
Objective Lumbar disc degeneration (LDD) is a serious social and medical problem which has been shown to be highly heritable. It has similarities with peripheral joint osteoarthritis (OA) in terms of both epidemiology and pathologic processes. A few known genetic variants have been identified using a candidate gene approach, but many more are thought to exist. GDF5 is a gene whose variants have been shown to play a role in skeletal height as well as predisposing to peripheral joint OA. In vitro, the gene product growth differentiation factor 5 has been shown to promote growth and repair of animal disc. This study was undertaken to investigate whether the GDF5 gene plays a role in LDD. Methods We investigated whether the 5′ upstream single-nucleotide polymorphism (SNP) variant rs143383 was associated with LDD, using plain radiography and magnetic resonance imaging to identify disc space narrowing and osteophytes, in 5 population cohorts from Northern Europe. Results An association between LDD and the SNP rs143383 was identified in women, with the same risk allele as in knee and hip OA (odds ratio 1.72 [95% confidence interval 1.15–2.57], P = 0.008). Conclusion Our findings in 5 population cohorts from Northern Europe indicate that a variant in the GDF5 gene is a risk factor for LDD in women. Many more such variants are predicted to exist, but this result highlights the growth and differentiation cellular pathway as a possible route to a better understanding of the process behind lumbar disc degeneration. PMID:21360499
Wang, Mengyun; Li, Qiaoxin; Gu, Chengyuan; Zhu, Yao; Yang, Yajun; Wang, Jiucun; Jin, Li; He, Jing; Ye, Dingwei; Wei, Qingyi
2017-04-11
Genetic variants of nucleotide excision repair (NER) genes have been extensively investigated for their roles in the development of prostate cancer (PCa); however, the published results have been inconsistent. In a hospital-based case-control study of 1,004 PCa cases and 1,055 cancer-free controls, we genotyped eight potentially functional single nucleotide polymorphisms (SNPs) of NER genes (i.e., XPC, rs2228001 T>G and rs1870134 G>C; XPD, rs13181 T>G and rs238406 G>T; XPG, rs1047768 T>C, rs751402 C>T, and rs17655 G>C; and XPF, rs2276464 G>C) and assessed their associations with risk of PCa by using logistic regression analysis. Among these eight SNPs investigated, only XPC rs1870134 CG/CC variant genotypes were associated with a decreased risk of prostate cancer under a dominant genetic model (adjusted odds ratio [OR] = 0.77, 95% confidence interval [CI] = 0.64-1.91, P = 0.003). Phenotype-genotype analysis also suggested that the XPC rs1870134 CG/CC variant genotypes were associated with significantly decreased expression levels of XPC mRNA in a mix population of different ethnicities. These findings suggested that XPC SNPs may contribute to risk of PCa in Eastern Chinese men.
Kruzliak, Peter; Haley, Andreana P; Starcevic, Jovana Nikolajevic; Gaspar, Ludovit; Petrovic, Daniel
2015-04-28
The aim of this study was to clarify whether common single nucleotide polymorphisms (SNPs) of the Peroxisome Proliferator-Activated Receptor-γ (PPAR-γ) gene (rs1801282) and the Peroxisome Proliferator-Activated Receptor-γ Coactivator-1 (PGC-1α) gene (rs8192673) are associated with obesity indexes (BMI, waist circumference) in subjects with type 2 diabetes mellitus (T2DM) in Caucasian population. The second aim was to find an association of both polymorphisms with T2DM. Two exonic SNPs of both genes rs1801282 of the PPAR-γ gene and rs8192673 of the PGC-1α gene) were genotyped in 881 unrelated Slovene subjects (Caucasians) with T2DM and in 348 subjects without T2DM (control subjects). Female homozygotes with the CC genotype of the rs8192673 had higher waist circumference in comparison with subjects with other genotypes. Homozygotes (females, males) with wild allele (Pro) of the rs1801282 (Pro12Ala polymorphism) had higher waist circumference in comparison with subjects with other genotypes. In the study, there were no differences in the distributions of the rs8192673 and the rs1801282 genotypes between patients with T2DM and controls. Linear regression analyses for both polymorphisms were performed and demonstrated an independent effect of the rs1801282 of the PPAR-γ on waist circumference in subjects with T2DM, whereas an independent effect on waist circumference was not demonstrated for the rs8192673 of the PGC-1α gene. In a large sample of the Caucasians the rs8192673 of the PGC-1α gene and the rs1801282 of the PPAR-γ gene were associated with waist circumference in subjects with T2DM.
Zhang, Yin; Su, Yan; Wang, Yanni; Huang, Haiyang; Han, Hui; Li, Wenning; Fu, Keying; Su, Huiluan; Xu, Wentan; Han, Yeguang; Wang, Ru; Zhang, Pei; Wu, Wei; Huang, Yun; Chen, Daojun; Jin, Tianbo; Wei, Jiali
2017-01-01
IgA nephropathy (IgAN) is the most common form of primary glomerulonephritis worldwide, but etiology and pathogenesis continue to be poorly understood. Polymorphisms in the cytokine genes may play a role in the etiology and pathogenesis of IgAN. The incidence of different between diverse ethnic groups suggested important genetic influences on its pathogenesis. We genotype 10 single nucleotide polymorphisms (SNPs) in IL-1B and IL-6 gene using Sequenom Mass-ARRAY technology from 417 IgAN patients and 463 healthy controls of the Chinese Han population. We evaluated these SNPs associated with IgAN utilising the chi-square tests and genetic model analysis. We identified that the minor alleles of rs16944 (“A”), rs1800796 (“G”) in IL-1B, IL-6 were involved in an increasingly risk of IgAN in allelic model analysis, respectively. The rs16944 in IL-1B and rs1800796 in IL-6 were associated with 1.23-fold (95% CI, 1.02-1.48, P = 0.031) and 1.33-fold (95% CI, 1.11-1.66, P = 0.003) increases in the risk of developing IgAN, respectively. There was only rs1800796 still correlated with IgAN in the allelic model after adjustment by age and gender and the Bonferroni correction. In addition, Haplotype Grs1800796A rs2069837G rs2069840 (P = 0.037) and G rs1800796A rs2069837C rs2069840 (P = 0.042) in IL-6were considered to be associated with increased IgAN risk. This study verified the IL-6, IL-1B genetic variants polymorphisms contributed to IgAN susceptibility in a Chinese Han population. Although we identified SNPs susceptibility, however, replication studies and functional research are required to confirm the genetic contribution in IgAN. PMID:29069743
Chen, Yun; Zhu, Meiling; Zhang, Zhen; Jiang, Guoliang; Fu, Xiaolong; Fan, Min; Sun, Menghong; Wei, Qingyi; Zhao, Kuaile
2013-12-01
To assess the association between single nucleotide polymorphisms (SNPs) of base-excision repair genes and clinical outcomes, the roles of genetic variants of 3 selected genes-flap structure-specific endonuclease 1 (FEN1), 8-hydroxyguanine DNA glycosylase (hOGG1), and nei endonuclease VIII-like 1 (NEIL1)--were investigated in radiation-induced esophageal toxicity (RIET), radiation pneumonitis (RP), and overall survival (OS) after radio(chemo)therapy in patients with esophageal squamous cell carcinoma (ESCC). NEIL1 reference SNP 4462560 (rs4462560) and rs7402844, hOGG1 rs1052133 and rs293795, and FEN1 rs4246215 and rs174538 were genotyped in 187 patients with ESCC who received definitive radiotherapy with or without chemotherapy. Kaplan-Meier cumulative probabilities and Cox proportional hazards regression models were used to assess the effect of the genotypes on the risk of RIET, RP, and OS. The authors observed that patients who had the NEIL1 rs4462560 GC/CC genotype had a statistically significantly lower risk of both grade ≥ 2 acute radiation-induced esophageal toxicity (RIET) (adjusted hazard ratio [HR], 0.421; 95% confidence interval [CI], 0.207-0.856; P = .017) and grade ≥ 2 acute radiation pneumonitis (RP) (adjusted HR, 0.392; 95% CI, 0.163-0.946; P = .037) compared with patients who had the GG genotype, but the genotype did not affect OS (adjusted HR, 0.778; 95% CI, 0.471-1.284; P = .326). There were no significant findings for other the SNPs under investigation. The NEIL1 rs4462560 SNP may serve as a predictor of acute RIET and RP risk but not of OS. Larger prospective studies are needed to validate these findings. © 2013 American Cancer Society.
Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.
Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima
2016-07-25
Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.
Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P
2015-09-25
ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.
Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.
Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe
2017-01-01
Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.
Jablonska, E; Raimondi, S; Gromadzinska, J; Reszka, E; Wieczorek, E; Krol, M B; Smok-Pieniazek, A; Nocun, M; Stepnik, M; Socha, K; Borawska, M H; Wasowicz, W
2016-12-01
Selenium, both essential and toxic element, is considered to protect against cancer, though human supplementation trials have generated many inconsistent data. Genetic background may partially explain a great variability of the studies related to selenium and human health. The aim of this study was to assess whether functional polymorphisms within two selenoprotein-encoding genes modify the response to selenium at the level of oxidative stress, DNA damage, and mRNA expression, especially in the individuals with a relatively low selenium status. The trial involved 95 non-smoking individuals, stratified according to GPX1 rs1050450 and SEPP1 rs3877899 genotypes, and supplemented with selenium yeast (200 µg) for 6 weeks. Blood was collected at four time points, including 4 weeks of washout. After genotype stratification, the effect of GPX1 rs1050450 on lower GPx1 activity responsiveness was confirmed; however, in terms of DNA damage, we failed to indicate that individuals homozygous for variant allele may especially benefit from the increased selenium intake. Surprisingly, considering gene and time interaction, GPX1 polymorphism was observed to modify the level of DNA strand breaks during washout, showing a significant increase in GPX1 wild-type homozygotes. Regardless of the genotype, selenium supplementation was associated with a selectively suppressed selenoprotein mRNA expression and inconsistent changes in oxidative stress response, indicating for overlapped, antioxidant, and prooxidant effects. Intriguingly, DNA damage was not influenced by supplementation, but it was significantly increased during washout. These results point to an unclear relationship between selenium, genotype, and DNA damage.
Zhao, Danrui; Liu, Shuzhen; Sun, Lingling; Zhao, Zhenzhen; Liu, Song; Kuang, Xiaojing; Shu, Jun; Luo, Bing
2016-07-15
Gastric cancer (GC) is one of the most common malignant tumors in China and single nucleotide polymorphisms (SNPs) have been found to be highly related to GC carcinogenesis. Glypican-4 (GPC4), a member of the heparan sulphate proteoglycan family, plays an important role in the regulation of cell growth and differentiation. However, little is known about polymorphisms of GPC4 gene and their associated susceptibility to GC, especially to Epstein-Barr virus-associated GC (EBVaGC). Here we studied the GPC4 polymorphism (rs1048369) in GC individuals, especially those with EBVaGC, and we explored an association between the GPC4 gene polymorphism (rs1048369) and susceptibility to EBVaGC and Epstein-Barr virus-negative GC (EBVnGC) in a population from Northern China. The GPC4 gene polymorphism (rs1048369) was detected in 54 cases of EBVaGC and 73 cases of EBVnGC using polymerase chain reaction (PCR). One hundred and seven peripheral blood samples from healthy individuals were also measured as a control group. There were significant differences in both the genotype and allelic frequency of GPC4 gene (rs1048369) between the EBVaGC and EBVnGC patients. Meanwhile, the distribution of genotype and allelic frequency of GPC4 (rs1048369) differed between EBVaGC and control groups. Distribution of the GPC4 genotype also revealed differences between EBVnGC and control groups, no significant differences in the allelic frequency of the GPC4 gene (rs1048369) were observed. The frequency of the T allele in EBVaGC group was significantly higher than that in control and EBVnGC groups. The GPC4 gene polymorphism and the allele of GPC4 are both associated with susceptibility to EBVaGC. The T allele of GPC4 may represent a risk factor for EBVaGC. Copyright © 2016 Elsevier B.V. All rights reserved.
Murillo-Zamora, Efrén; Moreno-Macías, Hortensia; Ziv, Elad; Romieu, Isabelle; Lazcano-Ponce, Eduardo; Ángeles-Llerenas, Angélica; Pérez-Rodríguez, Edelmiro; Vidal-Millán, Silvia; Fejerman, Laura; Torres-Mejía, Gabriela
2014-01-01
Background and Aims The rs2981582 single nucleotide polymorphism in the Fibroblast Growth Factor Receptor 2 gene has been consistently associated with an increased risk of breast cancer. We evaluated the effect of rs2981582 polymorphism in the FGFR2 gene on the risk of breast cancer and its interaction with non-genetic risk factors. Methods A population based case control study was conducted in Mexico. Data from 687 cases and 907 controls were analyzed. Results The T allele of the rs2981582 polymorphism was associated with an increased risk of breast cancer (OR per allele =1.24, 95% CI 1.06 – 1.46). There was also an interaction between this polymorphism and alcohol consumption (p = 0.043); the effect of alcohol consumption on the risk of breast cancer varied according to the allelic variants of the rs2981582 polymorphism in the FGFR2 gene: OR = 3.97 (95% CI 2.10 – 7.49), OR = 2.01 (95% CI 1.23 − 3.29) and OR = 1.21 (95% CI 0.48 − 3.05) for genotypes CC, CT and TT, respectively. Conclusions This is the first study exploring the association between rs2981582 polymorphism in the FGFR2 gene and breast cancer risk in Mexican women. The interaction found may be of great public health interest, since alcohol consumption is a modifiable breast cancer risk factor. Therefore, replication of this finding is of foremost importance. PMID:24054997
Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease
Heidari, Mohammad Mehdi; Soheilyfar, Sorour
2016-01-01
Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013
Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis.
Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N
2013-01-01
Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.
Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli
2015-01-01
Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive–compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples. PMID:20155310
Pooley, Karen A; Tyrer, Jonathan; Shah, Mitul; Driver, Kristy E; Leyland, Jean; Brown, Judith; Audley, Tina; McGuffog, Lesley; Ponder, Bruce A J; Pharoah, Paul D P; Easton, Douglas F; Dunning, Alison M
2010-07-01
A recent study reported genetic variants in the TERT-CLPTM1L locus that were associated with mean telomere length, and with risk of multiple cancers. We evaluated the association between single nucleotide polymorphism (SNP) rs401681 (C > T) and mean telomere length, using quantitative real-time PCR, in blood-extracted DNA collected from 11,314 cancer-free participants from the Sisters in Breast Screening study, the Melanoma and Pigmented Lesions Evaluative Study melanoma family study, and the SEARCH Breast, Colorectal, Melanoma studies. We also examined the relationship between rs401618 genotype and susceptibility to breast cancer (6,800 cases and 6,608 controls), colorectal cancer (2,259 cases and 2,181 controls), and melanoma (787 cases and 999 controls). The "per T allele" change in mean telomere length (DeltaCt), adjusted for age, study plate, gender, and family was 0.001 [95% confidence intervals (CI), 0.01-0.02; P trend = 0.61]. The "per T allele" odds ratio for each cancer was 1.01 for breast cancer (95% CI, 0.96-1.06; P trend = 0.64), 1.02 for colorectal cancer (95% CI, 0.94-1.11; P trend = 0.66), and 0.99 for melanoma (95% CI, 0.84-1.15; P trend = 0.87). We found no evidence that this SNP was associated with mean telomere length, or with risk of breast cancer, colorectal cancer, or melanoma. Our results indicate that the observed associations between rs401681 and several cancer types might be weaker than previously described. The lack of an association in our study between this SNP and mean telomere length suggests that any association with cancer risk at this locus is not mediated through TERT.
The RTEL1 rs6010620 polymorphism and glioma risk: a meta-analysis based on 12 case-control studies.
Du, Shu-Li; Geng, Ting-Ting; Feng, Tian; Chen, Cui-Ping; Jin, Tian-Bo; Chen, Chao
2014-01-01
The association between the RTEL1 rs6010620 single nucleotide polymorphism (SNP) and glioma risk has been extensively studied. However, the results remain inconclusive. To further examine this association, we performed a meta-analysis. A computerized search of the PubMed and Embase databases for publications regarding the RTEL1 rs6010620 polymorphism and glioma cancer risk was performed. Genotype data were analyzed in a meta-analysis. Odds ratios (ORs) with 95% confidence intervals (CIs) were estimated to assess the association. Sensitivity analyses, tests of heterogeneity, cumulative meta-analyses, and assessments of bias were performed in our meta-analysis. Our meta-analysis confirmed that risk with allele A is lower than with allele G for glioma. The A allele of rs6010620 in RTEL1 decreased the risk of developing glioma in the 12 case-control studies for all genetic models: the allele model (OR=0.752, 95%CI: 0.715-0.792), the dominant model (OR=0.729, 95%CI: 0.685-0.776), the recessive model (OR=0.647, 95%CI: 0.569-0.734), the homozygote comparison (OR=0.528, 95%CI: 0.456-0.612), and the heterozygote comparison (OR=0.761, 95%CI: 0.713-0.812). In all genetic models, the association between the RTEL1 rs6010620 polymorphism and glioma risk was significant. This meta-analysis suggests that the RTEL1 rs6010620 polymorphism may be a risk factor for glioma. Further functional studies evaluating this polymorphism and glioma risk are warranted.
Raza, Syed Tasleem; Abbas, Shania; Siddiqi, Zeba; Mahdi, Farzana
2017-01-01
Diabetic dyslipidemia is one of the leading causes of coronary artery disease (CAD) death. Genetic and environmental factors play an important role in the development of type 2 diabetes mellitus (T2DM) and dyslipidemia. The present study was aimed to investigate the association of ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133) and FTO (rs9939609) genes polymorphism in T2DM with dyslipidemia. Totally, 559 subjects including 221 T2DM cases with dyslipidemia, 158 T2DM without dyslipidemia and 180 controls were enrolled. ACE genes polymorphism was evaluated by polymerase chain reaction (PCR), while MTHFR , FABP2 , FTO genes polymorphisms were evaluated by PCR and restriction fragment length polymorphism (RFLP). Significant association of ACE and MTHFR genes polymorphisms were found in both group of cases [T2DM with dyslipidemia (P<0.001, and P=0.008, respectively) and T2DM without dyslipidemia (P=0.003, and P=0.010, respectively)] while FABP2 and FTO genes polymorphisms were significantly associated with T2DM without dyslipidemia (P=0.038, and P= 0.019, respectively). This study concludes that ACE , FABP2 , FTO and MTHFR genes are associated with T2DM. Additionally, it also seems that ACE and MTHFR genes might be further associated with the development of dyslipidemia in T2DM cases.
Hashemi, Mohammad; Mokhtari, Mojgan; Yazdani-Shahrbabaki, Vajiheh; Danesh, Hiva; Bizhani, Fatemeh; Taheri, Mohsen
2018-03-14
It has been proposed that transcobalamin 2 (TCN2) and the transcobalamin 2 receptor (TCN2R) are associated with idiopathic recurrent spontaneous abortion (RSA). The aim of the present study was to investigate the impact of TCN2 rs1801198 and TCN2R rs2336573 polymorphism on RSA in a sample of Iranian population. This case-control study was done on 92 RSA patients and 93 normal, fertile women. Genotyping of the TCN2 rs1801198 and TCN2R rs2336573 variants was done by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP). The findings showed no significant association between the TCN2 rs1801198 and TCN2R rs2336573 polymorphisms and the risk/protection of RSA. Our results did not support an association between the TCN2 polymorphism and the risk of RSA in a sample of southeast Iranian population. Larger studies with different ethnicities are needed to evaluate the possible impact of TCN2 and TCN2R polymorphisms on the pathogenesis of RSA. Impact statement What is already known on this subject? Recurrent spontaneous abortion (RSA), a multifactorial condition, is one of the most common complications of pregnancy. It has been proposed that genetic polymorphisms play a role in the pathogenesis of RSA. Few studies have examined the association between TNC2 and TCN2R polymorphisms and the RSA risk and the findings were inconsistent. The aim of the current study was to determine the possible association between the TCN2 rs1801198 and TCN2R rs2336573 polymorphisms and the RSA in a sample of the southeast Iranian population. What do the results of the study add? The findings of the present case-control study did not support an association between the TCN2 rs1801198 and TCN2R rs2336573 polymorphisms and the risk of RSA in a sample of the Iranian population. What are the implications of these findings for clinical practice and future research? The findings of this study may provide a basis for future studies with larger sample sizes and different ethnicities
Kanu, Joseph Sam; Gu, Yulu; Zhi, Sun; Yu, Mingxi; Lu, Yuping; Cong, Yetong; Liu, Yunkai; Li, Yong; Yu, Yaqin; Cheng, Yi; Liu, Yawen
2016-01-12
Coronary Heart Disease (CHD) is one of the leading causes of death in the world with a projected global 82 million DALYs by 2020. Genetic and environmental factors contribute to CHD development. Here, the authors investigate the association between CHD risk and three Single Nucleotide Polymorphisms (SNPs) in the AdipoQ gene (rs3774261, rs1063537 and rs2082940); and the interaction of this association with environmental factors, in Northeast Han Chinese population. Using a case-control study design, 1514 participants (754 cases and 760 controls) were investigated. Three variants in the AdipoQ gene (rs3774261, rs1063537 and rs2082940) were selected and genotyped. The online SNPstats program and SPSS 21.0 software were used for data analyses. The authors found that the rs3774261G allele is associated with the risk of CHD but that the rs2082940T allele protects against CHD. No significant association was found between rs1063537 and CHD risk. The study also found significant interactions between triglyceride levels and the SNPs studied (P < 0.0001 for rs3774261, P = 0.014 for rs1063537, and P = 0.031 for rs2082940). Variations in AdipoQ gene can protect against CHD (as with rs2082940T) or associated with CHD risk (as with rs3774261G) in Northeast Han Chinese - findings that will help shed light on the reported conflicting roles of AdipoQ in cardiovascular diseases. Serum triglycerides levels also interact in the AdipoQ - CHD association, thus further highlighting the roles environmental factors play in the genetic aspect of diseases.
The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.
Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S
2014-01-01
Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.
Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata
2010-05-01
Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.
Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi
2017-04-01
Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.
Zhao, Linlu; Roffey, Darren M; Chen, Suzan
2017-06-01
A systematic review and meta-analysis. The aim of this study was to assess and synthesize the current evidence on the association between the rs1256120 single nucleotide polymorphism (SNP) of the estrogen receptor beta gene (ESR2) and adolescent idiopathic scoliosis (AIS). Hormonal disturbance has been postulated as a potential etiological factor in the development of AIS. As estrogen receptors are important mediators of estrogen response, mutations in these genes, including rs1256120 of ESR2, have been chosen as susceptibility candidates for AIS predisposition. The association of rs1256120 with AIS has been investigated in several recent studies, but showed conflicting evidence. We conducted a systematic review to evaluate the strength of this body of evidence and quantitative synthesis to examine sources of heterogeneity. This study conformed to PRISMA guidelines. Using a sensitive search strategy, PubMed (MEDLINE), EMBASE, and HuGE Literature Finder databases were searched to identify relevant studies for inclusion in the systematic review and meta-analysis. Risk of bias was assessed using a modified Newcastle-Ottawa Scale. The inverse variance model was used to calculate summary odds ratios (ORs) and corresponding 95% confidence intervals (CIs) for the allelic (C vs. T) and genotypic comparisons. Planned subgroup and sensitivity analyses were performed. Three studies were included for systematic review and meta-analysis (n = 1264 AIS cases and n=1020 controls). A null relationship was found between rs1256120 and AIS (allelic OR = 1.20, 95% CI: 0.81-1.78, P = 0.36, I = 84.9%), with the first reported association likely to be false-positive and contributing substantially to heterogeneity. Findings from the systematic review and meta-analysis suggest that rs1256120 of ESR2 is unlikely to be a predisposing or disease-modifying genetic risk factor for AIS. 2.
Vinitha, A; Kutty, V Raman; Vivekanand, A; Reshmi, G; Divya, G; Sumi, S; Santosh, K R; Pratapachandran, N S; Ajit, Mullassari S; Kartha, C C; Ramachandran, Surya
2016-01-01
Plasma level of cyclophilin A is a promising marker of vascular disease in patients with type 2 diabetes. Genetic variants in the peptidylprolyl isomerase A gene, encoding human cyclophilin may alter protein synthesis thus affecting its activity, function, and circulating plasma levels. We examined the effect of single-nucleotide polymorphisms (SNPs) within the PPIA gene on plasma levels of cyclophilin A and coupled this with status of vascular disease in patients with and without type 2 diabetes in 212 South Indian subjects. The regulatory region of PPIA gene was sequenced for SNPs. The association of SNPs with known blood markers of type 2 diabetes and coronary artery disease such as HbA1c, low- and high-density lipoproteins, triglycerides, fasting and postprandial blood sugar levels, and cyclophilin A were probed. We identified three SNPs namely, rs6850: A > G; (AG/-) c.*227_*228delAG and (-/T) c.*318_*319insT. Welchs two-sample t test indicated an association of SNP rs6850: A > G, located at the 5' UTR region with increased plasma levels of cyclophilin A in patients with coronary artery disease and with coronary artery disease associated with diabetes. The presence of rs6850: A > G variant was significantly associated with coronary artery disease irrespective of whether the patients had diabetes or not. In silico analysis of the sequence using different tools and matrix libraries did not predict any significant differential binding sites for rs6850: A > G, c.*227_*228delAG and c.*318_*319insT. Our results indicate that the SNP rs6850: A > G is associated with increased risk for elevated plasma levels of cyclophilin A and coronary artery disease in patients with and without type 2 diabetes.
D'Avolio, Antonio; De Nicolò, Amedeo; Cusato, Jessica; Ciancio, Alessia; Boglione, Lucio; Strona, Silvia; Cariti, Giuseppe; Troshina, Giulia; Caviglia, Gian Paolo; Smedile, Antonina; Rizzetto, Mario; Di Perri, Giovanni
2013-10-01
Functional variants rs7270101 and rs1127354 of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of no functional rs6051702 polymorphism. Since a simultaneous evaluation of the three ITPA SNPs for hemolytic anemia has not yet been investigated, we aimed to understand the contribution of each SNPs and its potential clinical use to predict anemia in HCV treated patients. A retrospective analysis included 379 HCV treated patients. The ITPA variants rs6051702, rs7270101 and rs1127354 were genotyped and tested for association with achieving anemia at week 4. We also investigated, using multivariate logistic regression, the impact of each single and paired associated polymorphism on anemia onset. All SNPs were associated with Hb decrease. The carrier of at least one variant allele in the functional ITPA SNPs was associated with a lower decrement of Hb, as compared to patients without a variant allele. In multivariate logistic regression analyses the carrier of a variant allele in the rs6051702/rs1127354 association (OR=0.11, p=1.75×10(-5)) and Hb at baseline (OR=1.51, p=1.21×10(-4)) were independently associated with protection against clinically significant anemia at week 4. All ITPA polymorphisms considered were shown to be significantly associated with anemia onset. A multivariate regression model based on ITPA genetic polymorphisms was developed for predicting the risk of anemia. Considering the characterization of pre-therapy anemia predictors, rs6051702 SNP in association to rs1127354 is more informative in order to avoid this relevant adverse event. Copyright © 2013 Elsevier B.V. All rights reserved.
Zhang, L M; Zhang, X P; Chen, Y Q; Ye, W
2015-05-12
We assessed the CHRNA4 exon 5 rs1044396 and rs1044397 polymorphisms and investigated their relationship with Parkinson's disease (PD) severity and several non-motor symptoms. Ninety-seven patients with primary PD and 108 controls were recruited, and their smoking history identified. Patients with PD were assessed using the unified PD rating scale (UPDRS), Hoehn & Yahr (H&Y) grade, Hamilton depression rating scale (HAMD), visual analogue 10-points scale (VAS), and the Pittsburgh sleep quality index (PSQI). Polymerase chain reaction amplification and direct sequencing was performed on genomic DNA to identify polymorphic variants. Statistical analysis demonstrated that there were no gender differences in rs1044396(C→T) and rs1044397(G→A) frequencies. More smokers were identified among carriers of rs1044396 CT/TT genotypes. We also found no differences between PD and control groups in frequencies of either polymorphism. However, in women, PD onset was latest in rs1044397 GA/AA (P = 0.015). rs1044396 CT/TT genotype carriers and rs1044397 GG genotype patients with PD had higher VAS scores. No differences were found on the course of PD, H&Y grade, or UPDRS-II or -III scores between various genotypes, nor were differences found on scores of HAMD, nocturia, or PSQI in PD patients. Our results suggested that the CHRNA4 rs1044396 CT/TT genotype is related to cigarette smoking, that the rs1044397 polymorphism may associate with PD age of onset in women, and that rs1044396 and rs1044397 may relate to pain in PD patients, but not to the course or severity of disease, or to depression or nocturnal or sleeping disorders.
Feng, Shouhao; Lin, Shengli; Zou, Jidong; Wang, Yulong; Ji, Qinghai; Lv, Zhenghua
2015-01-01
The aim of this study was to investigate the possible influence of different genotypes of the lead single nucleotide polymorphisms (SNPs) rs10917468 and rs12045440 in the CAPZB gene on the thyroid function in papillary thyroid carcinoma (PTC) and benign thyroid neoplasm (BN) patients. In the study, a significant association was detected between rs12045440 and serum TSH concentrations in thyroid tumor patients (p = 0.001). After the adjustment of relevant covariates, the difference between the mean serum TSH levels in different genotypes of rs12045440 was still significant in the BN group (p = 0.003) but was not significant in the PTC cases (p = 0.115). No significant association of rs10917468 with TSH levels was found. The SNP rs12045440 was associated with the serum TSH concentrations in Chinese thyroid tumor patients, especially in benign thyroid tumor cases. PMID:26273293
Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto
2013-01-01
To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.
Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz
2016-11-20
BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.
Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz
2016-01-01
Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211
Xavier-Carvalho, Caroline; Cezar, Renata Duarte da Silva; Freire, Naishe Matos; Vasconcelos, Carla Maria Mola de; Solorzano, Victor Edgar Fiestas; de Toledo-Pinto, Thiago Gomes; Fialho, Luciana Gomes; do Carmo, Rodrigo Feliciano; Vasconcelos, Luydson Richardson Silva; Cordeiro, Marli Tenório; Baptista, Paulo; de Azeredo, Elzinandes Leal; da Cunha, Rivaldo Venâncio; de Souza, Luiz José; Pacheco, Antonio Guilherme; Kubelka, Claire Fernandes; Moura, Patrícia Muniz Mendes Freire de; Moraes, Milton Ozorio
2017-10-01
Outbreaks of the Zika, dengue, and chikungunya viruses, especially in the Americas, pose a global threat due to their rapid spread and difficulty controlling the vector. Extreme phenotypes are often observed, from asymptomatic to severe clinical manifestations, which are well-studied in dengue. Host variations are also important contributors to disease outcomes, and many case-control studies have associated single nucleotide polymorphisms (SNPs) with severe dengue. Here, we found that the TC genotype and T-carriers for SNP rs1285933 in the C-type lectin superfamily member 5 (CLEC5A) gene was associated with severe dengue in a Northern Brazilian population (OR=2.75 and p-value=0.01, OR=2.11 and p-value=0.04, respectively). We also tested the functional effect of the CLEC5A protein and found that it is upregulated on the surface of human monocytes after in vitro dengue infection. CLEC5A was correlated with viral load inside the monocytes (Spearman r=0.55, p=0.008) and TNF production in culture supernatants (Spearman r=0.72, p=0.03). Analysis of mRNA in blood samples from DENV4-infected patients exhibiting mild symptoms showed that CLEC5A mRNA expression is correlated with TNF (r=0.67, p=0.0001) and other immune mediators. Monocytes from rs1285933 TT/TC individuals showed lower CLEC5A expression compared to CC genotypes. However, in these cells, CLEC5A was not correlated with TNF production. In summary, we confirmed that CLEC5A is genetically associated with dengue severity outcome, playing a central role during the immune response triggered by a dengue viral infection, and rs1285933 is a relevant SNP that is able to regulate signaling pathways after interactions between the dengue virus and CLEC5A receptors. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Polymorphisms in TRPV1 and TAS2Rs associate with sensations from sampled ethanol.
Allen, Alissa L; McGeary, John E; Hayes, John E
2014-10-01
Genetic variation in chemosensory genes can explain variability in individual's perception of and preference for many foods and beverages. To gain insight into variable preference and intake of alcoholic beverages, we explored individual variability in the responses to sampled ethanol (EtOH). In humans, EtOH elicits sweet, bitter, and burning sensations. Here, we explore the relationship between variation in EtOH sensations and polymorphisms in genes encoding bitter taste receptors (TAS2Rs) and a polymodal nociceptor (TRPV1). Caucasian participants (n = 93) were genotyped for 16 single nucleotide polymorphisms (SNPs) in TRPV1, 3 SNPs in TAS2R38, and 1 SNP in TAS2R13. Participants rated sampled EtOH on a generalized Labeled Magnitude Scale. Two stimuli were presented: a 16% EtOH whole-mouth sip-and-spit solution with a single time-point rating of overall intensity and a cotton swab saturated with 50% EtOH on the circumvallate papillae (CV) with ratings of multiple qualities over 3 minutes. Area-under-the-curve (AUC) was calculated for the time-intensity data. The EtOH whole-mouth solution had overall intensity ratings near "very strong." Burning/stinging had the highest mean AUC values, followed by bitterness and sweetness. Whole-mouth intensity ratings were significantly associated with burning/stinging and bitterness AUC values on the CV. Three TRPV1 SNPs (rs224547, rs4780521, rs161364) were associated with EtOH sensations on the CV, with 2 (rs224547 and rs4780521) exhibiting strong linkage disequilibrium. Additionally, the TAS2R38 SNPs rs713598, rs1726866, and rs10246939 formed a haplotype, and were associated with bitterness on the CV. Last, overall intensity for whole-mouth EtOH associated with the TAS2R13 SNP rs1015443. These data suggest genetic variation in TRPV1 and TAS2Rs influence sensations from sampled EtOH and may potentially influence how individuals initially respond to alcoholic beverages. Copyright © 2014 by the Research Society on Alcoholism.
Niemiec, Pawel; Nowak, Tomasz; Iwanicki, Tomasz; Gorczynska-Kosiorz, Sylwia; Balcerzyk, Anna; Krauze, Jolanta; Grzeszczak, Wladyslaw; Wiecha, Maria; Zak, Iwona
2015-01-01
Single nucleotide polymorphisms (SNPs) of the USF1 gene (upstream stimulatory factor 1) influence plasma lipid levels. This study aims to determine whether USF1 SNPs interact with traditional risk factors of atherosclerosis to increase coronary artery disease (CAD) risk. In the present study serum lipid levels and USF1 gene polymorphisms (rs2516839 and rs3737787) were determined in 470 subjects: 235 patients with premature CAD and 235 controls. A trend of increasing triglycerides (TG) levels in relation to the C allele dose of rs2516839 SNP was observed. The synergistic effect of cigarette smoking and C allele carrier state on CAD risk was also found (SIM = 2.69, p = 0.015). TG levels differentiated significantly particular genotypes in smokers (1.53 mmol/L for TT, 1.80 mmol/L for CT and 2.27 mmol/L for CC subjects). In contrast, these differences were not observed in the non-smokers subgroup (1.57 mmol/L for TT, 1.46 mmol/L for CT and 1.49 mmol/L for CC subjects). In conclusion, the rs2516839 polymorphism may modulate serum triglyceride levels in response to cigarette smoking. Carriers of the C allele seem to be particularly at risk of CAD, when exposed to cigarette smoking. PMID:26068452
Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José
2014-02-01
Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.
Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał
2017-09-01
It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.
Laczmanski, Lukasz; Lwow, Felicja; Mossakowska, Malgorzata; Puzianowska-Kuznicka, Monika; Szwed, Małgorzata; Kolackov, Katarzyna; Krzyzanowska-Swiniarska, Barbara; Bar-Andziak, Ewa; Chudek, Jerzy; Sloka, Natalia; Milewicz, Andrzej
2015-03-15
Vitamin D co-regulates the synthesis of sex hormones in part by interaction with its nuclear receptor. The aim of this study was to determine whether there is an association of vitamin D concentration vs the level of sex hormones in elderly Polish individuals with different genotypes of the vitamin D receptor (VDR) gene. Rs10735810, rs1544410, rs7975232, and rs731236 polymorphisms of VDR, the serum sex hormone level, free estrogen index (FEI) and free androgen index (FAI) as well as vitamin D, were evaluated in 766 persons (362 women and 404 men) selected from 5695 Polish population, aged 65-90years from the PolSenior survey. We observed that women with GG (rs731236), TT (rs7975232), BB (rs1544410) and FF (rs10735810) genotypes were characterized by a significant correlation between vitamin D vs testosterone concentration and FAI value. We found a significant correlation between testosterone level and FAI vs vitamin D concentration in men with heterozygote AG in the rs731236 polymorphism and in the GG (rs7975232), the BB (rs1544410), and the Ff (rs10735810) genotypes. In elderly selected Polish population with different genotypes of VDR polymorphisms, a statistically significant relationship between vitamin D concentration vs testosterone level was observed. Copyright © 2015 Elsevier B.V. All rights reserved.
Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen
2014-01-01
Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391
Mo, Xingbo; Liu, Xuehui; Wang, Laiyuan; Lu, Xiangfeng; Chen, Shufeng; Li, Hongfan; Huang, Jianfeng; Chen, Jichun; Cao, Jie; Li, Jianxin; Tang, Yida; Gu, Dongfeng
2013-03-01
Many single-nucleotide polymorphisms (SNPs) have been reported to be associated with lipid concentrations in recent genome-wide association studies. The aim of this study was to validate the associations of rs2197089 in the lipoprotein lipase (LPL) gene with serum lipid concentrations and gene expression levels in the Chinese Han population and examine the potential interactions. A total of 9339 participants were recruited and genotyped for rs2197089. Gene expression levels of LPL in blood cells of 309 participants were evaluated by real-time PCR. We observed significant associations between rs2197089 and decreased triglycerides (TG) (P=0.0006), but not high-density lipoprotein cholesterol (HDL-C) concentration (P=0.0881). However, weak evidence of interaction between cigarette smoking and rs2197089 was detected (P=0.0362). In smokers, significant association between rs2197089 and increased HDL-C concentration was found (P=0.0068). Participants with the minor allele A had higher expression levels of LPL (P=0.0243). The results of our study indicated that rs2197089 was significantly associated with TG but it was associated with HDL-C only in smokers. This SNP seemed to have influence on the expression level of LPL.
Al-Lahham, Y; Mendes, A K B; Souza, E M; Alberton, D; Rego, F G M; Valdameri, G; Picheth, G
2017-09-21
Type 1 diabetes (T1D) is an autoimmune disease with a strong genetic component that has been associated with several genetic loci. Interleukin 18 (IL-18) is a potent proinflammatory cytokine, which is involved in the innate and adaptive immune responses, and in the pathogenesis of various diseases including T1D. Glucose transporter 4 (GLUT4) is known to be an insulin-responsive glucose transporter and has been associated with various diseases, including diabetes mellitus. We investigated the association of the polymorphisms rs187238 (IL-18) and rs5435 (GLUT4) in a case-control study in Euro-Brazilians with T1D (N = 136) and healthy subjects (N = 144). Real-time PCR with TaqMan ® fluorescent probes were applied for genotyping. All polymorphisms were in Hardy-Weinberg equilibrium. The minor allele frequencies for the G-allele (rs187238; IL-18) in healthy and T1D groups were 28.5% [95%CI = 23-34%] vs 31.6% [95%CI = 26-37%], P = 0.416, and for the T-allele (rs5435, GLUT4) were 33% [95%CI = 28-39] vs 27% [95%CI = 23-33%], P = 0.167, respectively. Genotype comparisons for both polymorphisms showed no significant differences (P > 0.05). The polymorphisms rs187238 and rs5435 were not associated with T1D in the studied population. The minor allele frequencies for both polymorphisms were similar to those of other Caucasian populations.
Colorectal cancer-susceptibility single-nucleotide polymorphisms in Korean population.
Hong, Sung Noh; Park, Changho; Kim, Jong-Il; Kim, Duk-Hwan; Kim, Hee Cheol; Chang, Dong Kyung; Rhee, Poong-Lyul; Kim, Jae J; Rhee, Jong Chul; Son, Hee Jung; Kim, Young-Ho
2015-05-01
Considering the significant racial and ethnic diversity in genetic variation, it is unclear whether the genome-wide association studies-identified colorectal cancer (CRC)-susceptibility single-nucleotide polymorphisms (SNPs) discovered in European populations are also relevant to the Korean population. However, studies on CRC-susceptibility SNPs in Koreans are limited. To investigate the racial and ethnic diversity of CRC-susceptibility genetic variants, we genotyped for the established European CRC-susceptibility SNPs in 198 CRC cases and 329 controls in Korea. To identify novel genetic variants using genome-wide screening in Korea, Illumina HumanHap 370K/610K BeadChips were performed on 105 CRC patients, and candidate CRC-susceptibility SNPs were selected. Subsequently, genotyping for replication was done in 189 CRC cases and 190 controls. Among the European CRC-susceptibility SNPs, rs4939827 in SMAD7 was associated with a significant decreased risk of Korean CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 0.67 [95% CI, 0.47-0.95]; dominant model, 0.59 [95% CI, 0.39-0.91]). rs4779584 and rs10795668 were associated with CRC risk in females and males, respectively. Among candidate CRC-susceptibility SNPs selected from genome-wide screening, novel SNP, rs17051076, was found to be associated with a significantly increased risk of microsatellite instability-high CRC (age-/gender-adjusted odds ratio [95% confidence interval]: additive model, 4.25 [95% CI, 1.51-11.98]; dominant model, 3.52 [95% CI, 1.13-10.94]) in the replication study. rs4939827, rs4779584, and rs10795668 may contribute to the risk of CRC in the Korean population as well as in European populations. Novel rs17051076 could be associated with microsatellite instability-high CRC in Koreans. These associations support the ethnic diversity of CRC-susceptibility SNPs and should be taken into account in large-scale studies. © 2013 Journal of Gastroenterology and Hepatology
Cytokine single-nucleotide polymorphisms and risk of non-small-cell lung cancer.
Pérez-Ramírez, Cristina; Alnatsha, Ahmed; Cañadas-Garre, Marisa; Villar, Eduardo; Valdivia-Bautista, Javier; Faus-Dáder, María J; Calleja-Hernández, Miguel Á
2017-12-01
Lung cancer, particularly the non-small-cell lung cancer (NSCLC) subtype, is the leading cause of cancer-related death worldwide. Several functional polymorphisms in inflammatory cytokine genes, such as IL1B, IL6, IL12A, IL13 and IL16, have been associated with the risk of NSCLC. The aim of this study was to evaluate the association between ILs gene polymorphisms and the risk of developing NSCLC. A retrospective case-control study was carried out, including 174 NSCLC cases and 298 controls of Spanish origin. IL1B (rs1143634), IL1B (rs12621220), IL1B (rs1143623), IL1B (rs16944), IL1B (rs1143627), IL12A (rs662959), IL13 (rs1881457), IL6 (rs1800795) and IL16 (rs7170924) gene polymorphisms were analysed by TaqMan. The genotypic logistic regression model adjusted by smoking status showed that the IL1B rs1143634-TT genotype was associated with a lower risk of NSCLC (P=0.04312; odds ratio=0.226; 95% confidence interval=0.044-0.840). No other gene polymorphisms showed an association with NSCLC in any of the models tested. In conclusion, IL1B rs1143634 was significantly associated with a higher risk of NSCLC. No influence of IL1B rs12621220, rs1143623, rs16944, rs1143627, IL12A rs662959, IL13 rs1881457 and IL16 rs7170924 on the risk of developing NSCLC was found in our study.
2013-01-01
Introduction Rheumatoid arthritis (RA) is a complex polygenic disease associated with chronic inflammation, accelerated atherosclerosis and increased cardiovascular (CV) mortality. A recent meta-analysis has described the ZC3HC1 rs11556924 polymorphism as one of the most important signals associated with coronary artery disease (CAD) in non-rheumatic Caucasian individuals. In this study we evaluated the potential association of this gene polymorphism with subclinical atherosclerosis assessed by the evaluation of carotid intima-media thickness (cIMT) in RA patients. Methods This study included 502 RA patients from Northern Spain. The ZC3HC1 rs11556924 polymorphism was genotyped with TaqMan single-nucleotide polymorphism (SNP) genotyping assays (C__31283062_10) in a 7900HT real-time polymerase chain reaction (PCR) system. cIMT was also assessed in these patients by carotid ultrasonography (US) technology. Results RA patients carrying the TT genotype had significantly higher cIMT values than those homozygous for the CC genotype (mean ± standard deviation (SD): 0.76 ± 0.18 mm and mean ± SD: 0.71 ± 0.16 mm respectively; P = 0.03) even after adjusting the results for sex, age at the time of US study, follow-up time and traditional CV risk factors (P = 0.04) evidencing that the effect conferred by ZC3HC1 rs11556924 polymorphism is independent of the traditional CV risk factors. Conclusion Our results indicate that ZC3HC1 rs11556924 polymorphism is associated with subclinical atherosclerosis in RA. PMID:24286297
Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto
2013-01-01
Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507
Meta-analysis of the rs2075650 polymorphism and risk of Alzheimer disease.
He, Ya; Li, Chen; Yang, Ying; Li, Yizhou; Wang, Yuan; Yang, Hua; Jin, Tianbo; Chen, Songsheng
2016-10-01
Several researchers have suggested that the rs2075650 polymorphism is significantly associated with an increased risk of developing Alzheimer disease (AD) in European. However, some others found inconsistent results in Asian (Chinese and Korean). We addressed the controversy through performing a meta-analysis of the relationship between rs2075650 in TOMM40 (translocase of outer mitochondrial membrane 40 homologue) and Alzheimer disease. We selected eight case-control studies involving 4290 cases of Alzheimer disease and 5556 healthy individuals. The association between the TOMM40 rs2075650 polymorphism and Alzheimer disease was examined by overall odds ratio (OR) with a 95 % confidence interval (CI). We used different genetic model analysis, sensitivity analysis, and assessments of bias in our meta-analysis. The pooled analysis showed the inconsistent results that TOMM40 rs2075650 polymorphism was associated with Alzheimer disease in European and Korean population in all genetic models, but there was no significant association between the TOMM40 rs2075650 polymorphism and Alzheimer disease risk in Chinese population. We conclude that rs2075650 in TOMM40 gene may increase the risk of Alzheimer disease.
Hirvonen, Katariina; Korhonen, Tellervo; Salomaa, Veikko; Männistö, Satu; Kaprio, Jaakko
2017-09-01
Genetic variations in DBH-gene and its surroundings have been shown to associate with smoking behavior including smoking cessation in several studies. In this study we replicate and measure the effect size for association between DBH polymorphism rs3025343 and smoking cessation in a large population-based sample while examining environmental factors that could relate to the association. We studied 11 926 adult subjects from four surveys of the National FINRISK Study. The analysis was restricted to either current or former smokers. Logistic and linear regression analyses were conducted to investigate the relationships of the single nucleotide polymorphism (SNP), covariates, smoking cessation, and smoking severity (cotinine, CPD). Gene-environment interactions were tested by likelihood-ratio test. The association between rs3025343 and smoking cessation (prevalence odds ratio, OR = 1.12, p = .094, 95%CI = 0.98-1.30) was replicated identically with the GWAS study of The Tobacco and Genetics Consortium (OR = 1.12, 95%CI = 1.08-1.18). None of our tested phenotypes significantly influenced the association between rs3025343 and smoking cessation. Overall, marital status, education, depression, alcohol use, self-rated health, and chronic obstructive pulmonary disease (COPD) showed phenotypic associations with smoking cessation, but the association of various phenotypes with smoking cessation did not vary by genotype. The current study replicates the effect size for the association between rs3025343 and smoking cessation despite lack of overall significance due to smaller sample size. We could not show environmental influences on the association of rs3025343 with smoking cessation. Our study replicates the direction and strength of the association of DBH polymorphism rs3025343 with smoking cessation. We could not detect environmental influences on the strength of the association of rs3025343 with smoking cessation, but the limited power of our analysis needs to be taken into
Zheng, Liang; Yin, Jun; Wang, Liming; Wang, Xu; Shi, Yijun; Shao, Aizhong; Tang, Weifeng; Ding, Guowen; Liu, Chao; Chen, Suocheng; Gu, Haiyong
2013-10-01
Esophageal cancer is the sixth leading cause of cancer-associated deaths worldwide and represents a particularly aggressive type of cancer. Genetic polymorphisms may partly explain individual differences in esophageal cancer susceptibility. We conducted a hospital-based case-control study to evaluate the genetic effects of functional single nucleotide polymorphisms (SNPs) in the interleukin 1 (IL1A and IL1B), IL1f7, IL3 and IL7Ra genes on the development of esophageal cancer. A total of 380 esophageal squamous cell carcinoma (ESCC) cases and 380 controls were recruited for this study. The genotypes were determined using a custom-by-design 48-Plex SNPscan™ Kit. When the IL1B rs16944 GG homozygote genotype was used as the reference group, the GA genotype was associated with a significantly decreased risk of ESCC (GA vs. GG: adjusted OR=0.69, 95% CI=0.49-0.99, p=0.041). However, there were no significant associations between the other five SNPs and ESCC risk. Stratified analyses indicated no significantly different risks of ESCC associated with the IL1B rs16944 G>A polymorphism according to sex, age, smoking status or alcohol consumption. IL3 rs2073506 G>A polymorphism was associated with an increased risk for ESCC higher tumor, nodal, and metastatic (TNM) stages. These findings indicated that the functional IL1B rs16944 G>A polymorphism might contribute to ESCC susceptibility. IL3 rs2073506 G>A polymorphism was associated with an increased risk for ESCC higher TNM stages. However, the results were based on a limited sample size and larger well-designed studies are warranted to confirm these initial findings. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
CR1 rs3818361 Polymorphism Contributes to Alzheimer's Disease Susceptibility in Chinese Population.
Li, Yongning; Song, Dongjing; Jiang, Yongshuai; Wang, Jingwei; Feng, Rennan; Zhang, Liangcai; Wang, Guangyu; Chen, Zugen; Wang, Renzhi; Jiang, Qinghua; Liu, Guiyou
2016-08-01
Recent genome-wide association studies (GWAS) reported CR1 rs3818361 polymorphism to be an Alzheimer's disease (AD) susceptibility variant in European ancestry. Three independent studies investigated this association in Chinese population. However, these studies reported weak or no significant association. Here, we reinvestigated the association using all the samples from three independent studies in Chinese population (N = 4047, 1244 AD cases and 2803 controls). We also selected three independent studies in European ancestry population (N = 11787, 3939 AD cases and 7848 controls) to evaluate the effect of rs3818361 polymorphism on AD risk in different ethnic backgrounds. In Chinese population, we did not identified significant heterogeneity using additive, recessive, and dominant genetic models. Meta-analysis showed significant association between rs3818361 and AD with P = 6.00E-03 and P = 5.00E-03. We further identified no heterogeneity of rs3818361 polymorphism between Chinese and European populations. We found that rs3818361 polymorphism contributed to AD with similar genetic risk in Chinese and European populations. In summary, this is the first study to show significant association between rs3818361 polymorphism and AD in Chinese population by a meta-analysis method. Our findings indicate that the effect of CR1 rs3818361 polymorphism on AD risk in Chinese cohorts is consistent with the increased risk observed in European AD cohorts.
KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud
2017-01-01
Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324
C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.
Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio
2015-01-01
Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.
Muñoz-Yáñez, C; Pérez-Morales, R; Moreno-Macías, H; Calleros-Rincón, E; Ballesteros, G; González, R A; Espinosa, J
2016-01-01
Concerning the genetic factors of obesity, no consistent association between populations has been reported, which may be due to the frequency of polymorphisms, the lifestyle of studied populations and its interaction with other factors. We studied a possible association of polymorphisms FTO rs9939609, PPARG rs1801282, and ADIPOQ rs4632532 and rs182052 with obesity phenotypes in 215 Mexican children. Glucose, triglycerides, cholesterol, HDL and LDL were measured. In addition, weight, height, waist circumference and triceps skin thickness were recorded. High-energy diets and sedentary behavior were evaluated with a validated questionnaire. In contrast with other reports, only FTO rs9939609 was associated with obesity related-traits, including BMI (p = 0.03), waist circumference (p = 0.02), triceps skinfold (p = 0.03) and waist/height ratio (p = 0.01), and also with cholesterol levels (p = 0.02) and LDL (p = 0.009). Lower levels of triglycerides (p=0.04) were related with presence of PPARG rs1801282, while ADIPOQ rs4632532 showed an effect on HDL (p = 0.03) levels. On the other hand, diet, physical activity and screen time were not related with obesity. In summary, only FTO rs9939609 was associated with obesity related-traits, while PPARG2 rs1801282 and ADIPOQ rs4632532 were involved in lipid metabolism.
Muñoz-Yáñez, C; Pérez-Morales, R; Moreno-Macías, H; Calleros-Rincón, E; Ballesteros, G; González, R. A; Espinosa, J
2016-01-01
Abstract Concerning the genetic factors of obesity, no consistent association between populations has been reported, which may be due to the frequency of polymorphisms, the lifestyle of studied populations and its interaction with other factors. We studied a possible association of polymorphisms FTO rs9939609, PPARG rs1801282, and ADIPOQ rs4632532 and rs182052 with obesity phenotypes in 215 Mexican children. Glucose, triglycerides, cholesterol, HDL and LDL were measured. In addition, weight, height, waist circumference and triceps skin thickness were recorded. High-energy diets and sedentary behavior were evaluated with a validated questionnaire. In contrast with other reports, only FTO rs9939609 was associated with obesity related-traits, including BMI (p = 0.03), waist circumference (p = 0.02), triceps skinfold (p = 0.03) and waist/height ratio (p = 0.01), and also with cholesterol levels (p = 0.02) and LDL (p = 0.009). Lower levels of triglycerides (p=0.04) were related with presence of PPARG rs1801282, while ADIPOQ rs4632532 showed an effect on HDL (p = 0.03) levels. On the other hand, diet, physical activity and screen time were not related with obesity. In summary, only FTO rs9939609 was associated with obesity related-traits, while PPARG2 rs1801282 and ADIPOQ rs4632532 were involved in lipid metabolism. PMID:27560839
Paradowska-Gorycka, Agnieszka; Malinowski, Damian; Haladyj, Ewa; Olesinska, Marzena; Safranow, Krzysztof; Pawlik, Andrzej
2018-01-19
Rheumatoid arthritis (RA) is an autoimmune diseases, where different genetic variants in cytokine genes may play a pathogenic role. A GWAS in autoimmune diseases highlighted the IL-23R gene as a one of the susceptibility factors. We examined three candidate single nucleotide polymorphisms (SNPs) rs10889677, rs11209026 and rs2201841 of the IL-23R gene, as well as determined their possible association with RA in a Polish population. The IL-23R gene polymorphisms were genotyped for 422 RA patients and 348 healthy individuals using TaqMan SNP genotyping assay. The genotypes frequency did not deviate from HWE in each examined group. A comparison of the allele as well as genotype frequencies of the IL-23R polymorphisms under codominant, dominant and recessive genetic model revealed no significant differences between RA patients and healthy subjects. We also demonstrated that IL-23R rs2201841 and rs11209026 as well as rs11209026 and rs10889677 were in complete linkage disequilibrium (D'=1.0). Our genotype-phenotype analysis demonstrated that in carriers of rs10889677C and/or rs2201841A allele the RF, extra-articular manifestations and erosion were more frequent present than in patients with rs10889677A and/or rs2201841A allele, although this association was not significant. Present findings indicated that the autoimmune disease-associated genetic variants in IL-23R gene are not associated with RA in the Polish population. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.
Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L
2016-01-01
Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529
Volobaev, Valentin P; Larionov, Aleksey V; Kalyuzhnaya, Ekaterina E; Serdyukova, Ekaterina S; Yakovleva, Svetlana; Druzhinin, Vladimir G; Babich, Olga O; Hill, Elena G; Semenihin, Victor A; Panev, Nikolay I; Minina, Varvara I; Sivanesan, Saravana Devi; Naoghare, Pravin; da Silva, Juliana; Barcelos, Gustavo R M; Prosekov, Alexander Y
2018-04-13
Anthracosilicosis (AS), a prevalent form of pneumoconiosis among coal miners, results from the accumulation of carbon and silica in the lungs from inhaled coal dust. This study investigated genotoxic effects and certain cytokine genes polymorphic variants in Russian coal miners with АS. Peripheral leukocytes were sampled from 129 patients with AS confirmed by X-ray and tissue biopsy and from 164 asymptomatic coal miners. Four single-nucleotide polymorphisms were genotyped in the extracted DNA samples: IL1β T-511C (rs16944), IL6 C-174G (rs1800795), IL12b A1188C (rs3212227) and VEGFA C634G (rs2010963). Genotoxic effects were assessed by the analysis of chromosome aberrations in cultured peripheral lymphocytes. The mean frequency of chromatid-type aberrations and chromosome-type aberrations, namely, chromatid-type breaks and dicentric chromosomes, was found to be higher in AS patients [3.70 (95% confidence interval {CI}, 3.29-4.10) and 0.28 (95% CI, 0.17-0.38)] compared to the control group [2.41 (95% CI, 2.00-2.82) and 0.09 (95% CI, 0.03-0.15)], respectively. IL1β gene T/T genotype (rs16944) was associated with AS [17.83% in AS patients against 4.35% in healthy donors, odds ratio = 4.77 (1.88-12.15), P < 0.01]. A significant increase in the level of certain chromosome interchanges among AS donors is of interest because such effects are typical for radiation damage and caused by acute oxidative stress. IL1β T allele probably may be considered as an AS susceptibility factor among coal miners.
Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A G
2017-03-01
A recent meta-analysis suggests an association between the rs11558538 single nucleotide polymorphism in the histamine-N-methyl-transferase (HNMT) gene and the risk for Parkinson's disease. Based on the possible relationship between PD and restless legs syndrome (RLS), we tried to establish whether rs11558538 SNP is associated with the risk for RLS. We studied the genotype and allelic variant frequencies of HNMT rs11558538 SNP 205 RLS patients and 410 healthy controls using a TaqMan assay. The frequencies of the HNMT rs11558538 genotypes allelic variants were similar between RLS patients and controls, and were not influenced by gender, family history of RLS, or RLS severity. RLS patients carrying the genotype rs11558538TT had an earlier age at onset, but this finding was based on three subjects only. These results suggest a lack of major association between HNMT rs11558538 SNP and the risk for RLS.
Zhou, Xin; Wang, Chunrong; Chen, Zhao; Peng, Yun; Peng, Huirong; Hou, Xuan; Ye, Wei; Qiu, Rong; Xia, Kun; Tang, Beisha; Jiang, Hong
2018-01-07
Recent evidence suggested that several single nucleotide polymorphisms (SNPs) of inflammation-related genes (TNF-α rs1799964, IL-1α rs1800587, IL-1β rs16944, IL-8 rs4073, ICAM-1 rs5498) were associated with multiple system atrophy (MSA). Herein, we conducted this case-control study to evaluate the possible correlation between the five SNPs related to inflammation and MSA in Chinese Han population. We recruited 154 sporadic patients with MSA and 223 health controls in this study. All subjects were genotyped for the five SNPs using polymerase chain reaction amplification and Sanger sequencing. TNF-α rs1799964, genotype distribution and minor allele frequency (MAF) showed significant differences between patients and controls, which might illustrate the minor allele C may increase the risk for MSA (genotype, P = 0.006, OR = 1.245, 95% CI = [1.066-1.455]; allele, P = 0.001, OR = 1.887, 95% CI = [1.303-2.733]). For rs16944, patients carrying AA genotype showed a nearly 5-year early age at onset (AAO) than GG genotype (50.52 ± 7.45 years vs. 54.90 ± 7.21 years, P = 0.037). No differences were found in genotype distribution and MAF of the five SNPs between patients with MSA with predominant cerebellar ataxia (MSA-C) and with predominant Parkinsonism (MSA-P). Our study suggests that rs1799964 of TNF-α may act as a risk factor for MSA and the IL-1β rs16944 might be a genetic factor that modifies the AAO in MSA. Moreover, the exact mechanism of neuroinflammatory response in MSA deserves further exploration.
Méndez-Hernández, Alejandra; Gallegos-Arreola, Martha Patricia; Moreno-Macías, Hortensia; Espinosa Fematt, Jorge; Pérez-Morales, Rebeca
2017-10-01
Obesity plays a major role in the pathogenesis of breast cancer. Leptin (LEP) and adiponectin (ADIPOQ) are important in the regulation of adipose tissue. The response to cancer treatment depends on the histological and molecular tumor type, clinical stage, and genetic variability that might promote carcinogenic development. The aim of this study was to investigate the association between overweight/obesity and polymorphisms in the LEP (rs7799039), LEP receptor (LEPR; rs1137101), and ADIPOQ genes (rs2241766, rs1501299) with the response to breast cancer treatment in Mexican women. A sample of 177 patients with primary breast cancer (stage I-III) and who received neoadjuvant therapy were included. Polymorphisms were genotyped and their serum LEP concentrations (n = 59) were quantified. The patients' median age was 53.1 years, the frequency of overweight and obesity was 57 and 84 patients, respectively, 117 were postmenopausal, and 64 of the patients did not respond to chemotherapy. An association of the LEP rs7799039, LEPR rs1137101, and ADIPOQ rs1501299 polymorphisms with overweight/obesity was found. The patients who did not respond to treatment were more frequently obese, at clinical stage III, had metastases, and high levels of glucose. Moreover, in samples that were positive for estrogen receptor, higher levels of LEP were found, and in wild type genotypes for LEP rs7799039 and LEPR rs1137101. There was a direct association between the polymorphisms in LEP rs7799039 and ADIPOQ rs1501299 with overweight/obesity, and these genotypes affected the response to chemotherapeutic treatment, suggesting that an obesogenic microenvironment is more favorable for tumoral progression. Copyright © 2017 Elsevier Inc. All rights reserved.
Yang, Po-Yu; Miao, Nae-Fang; Lin, Chiao-Wen; Chou, Ying-Erh; Yang, Shun-Fa; Huang, Hui-Chuan; Chang, Hsiu-Ju; Tsai, Hsiu-Ting
2016-01-01
The purpose of this study was to identify gene polymorphisms of mammary serine protease inhibitor (Maspin) specific to patients with oral cancer susceptibility and clinicopathological status. Three single-nucleotide polymorphisms (SNPs) of the Maspin gene from 741 patients with oral cancer and 601 non-cancer controls were analyzed by real-time PCR. The participants with G/G homozygotes or with G/C heterozygotes of Maspin rs2289520 polymorphism had a 2.07-fold (p = 0.01) and a 2.01-fold (p = 0.02) risk of developing oral cancer compared to those with C/C homozygotes. Moreover, gene-gene interaction increased the risk of oral cancer susceptibility among subjects expose to oral cancer related risk factors, including areca, alcohol, and tobacco consumption. G allele of Maspin rs2289520 polymorphism may be a factor that increases the susceptibility to oral cancer. The interactions of gene to oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development.
Quevedo, Edhit Guadalupe Cruz; Aguilar, Gabriela Monserrat Mimendi; Aguilar, Luis Anselmo Juárez; Rubio, Susan Andrea Gutierrez; Martínez, Silvia Esperanza Flores; Rodríguez, Ingrid Patricia Dávalos; Corona, José Sánchez; Morán, Martha Isabel Torres; Gómez, Roberto Carlos Rosales; Moguel, María Cristina Morán
2015-01-01
KiSS1 is a metastasis suppressor gene associated with inhibition of cellular chemotaxis and invasion attenuating the metastasis in melanoma and breast cancer cell lines. Along the KiSS-1 gene at least 294 SNPs have been described; however the association of these polymorphisms as genetic markers for metastasis in breast cancer studies has not been investigated. Here we describe two simple PCR-RFLPs protocols to identify the rs5780218 (9DelT) and the rs12998 (E20K) KiSS1 polymorphisms and the allelic, genotypic, and haplotypic frequencies in Mexican general population (GP) and patients with benign breast disease (BBD) or breast cancer (BC). The rs5780218 polymorphism was individually associated with breast cancer (P = 0.0332) and the rs12998 polymorphism shows statistically significant differences when GP versus case (BC and BBD) groups were compared (P < 0.0001). The H1 Haplotype (G/-) occurred more frequently in BC group (0.4256) whereas H2 haplotype (G/T) was the most prevalent in BBD group (0.4674). Our data indicated that the rs5780218 polymorphism individually confers susceptibility for development of breast cancer in Mexican population and a possible role as a genetic marker in breast cancer metastasis for H1 haplotype (Wt/variant) in KiSS1 gene must be analyzed in other populations.
Lakbakbi El Yaagoubi, F; Charoute, H; Bakhchane, A; Ajjemami, M; Benrahma, H; Errouagui, A; Kandil, M; Rouba, H; Barakat, A
2015-12-01
The aim of the present study is to explore the association between the APOA5 polymorphisms and haplotypes with obesity in Moroccan patients. The study was performed in 459 subjects, Obese (n=164) and non-obese (n=295). All subjects were genotyped for the APOA5 -1131T>C (rs662799) and c.56C>G (rs3135506) polymorphisms. The contribution of APOA5 polymorphisms and haplotypes in the increased risk of obesity were explored using logistic regression analyses. The -1131T>C and c.56C>G polymorphisms were significantly associated with obesity. Both polymorphisms were strongly associated with increased BMI. Analysis of constructed haplotypes showed a significant association between CG haplotype and susceptibility to obesity (OR [95%CI]=3.09 [1.93-4.97]; P<0.001). These results support a potential role for APOA5 common variants and related haplotypes as risk factors for obesity. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Schnitzler, Fabian; Friedrich, Matthias; Wolf, Christiane; Stallhofer, Johannes; Angelberger, Marianne; Diegelmann, Julia; Olszak, Torsten; Tillack, Cornelia; Beigel, Florian; Göke, Burkhard; Glas, Jürgen; Lohse, Peter; Brand, Stephan
2015-01-01
A previous study suggested an association of the single nucleotide polymorphism (SNP) rs72796353 (IVS4+10 A>C) in the NOD2 gene with susceptibility to Crohn's disease (CD). However, this finding has not been confirmed. Given that NOD2 variants still represent the most important predictors for CD susceptibility and phenotype, we evaluated the association of rs72796353 with inflammatory bowel disease (IBD) susceptibility and the IBD phenotype. Genomic DNA from 2256 Caucasians, including 1073 CD patients, 464 patients with ulcerative colitis (UC), and 719 healthy controls, was genotyped for the NOD2 SNP rs72796353 and the three main CD-associated NOD2 mutations rs2066844, rs2066845, and rs2066847. Subsequently, IBD association and genotype-phenotype analyses were conducted. In contrast to the strong associations of the NOD2 SNPs rs2066844 (p=3.51 x 10(-3)), rs2066845 (p=1.54 x 10(-2)), and rs2066847 (p=1.61 x 10(-20)) with CD susceptibility, no significant association of rs72796353 with CD or UC susceptibility was found. However, in CD patients without the three main CD-associated NOD2 mutations, rs72796353 was significantly associated with the development of perianal fistulas (p=2.78 x 10(-7), OR 5.27, [95% CI 2.75-10.12] vs. NOD2 wild-type carriers). Currently, this study represents the largest genotype-phenotype analysis of the impact of the NOD2 variant rs72796353 on the disease phenotype in IBD. Our data demonstrate that in CD patients the IVS4+10 A>C variant is strongly associated with the development of perianal fistulas. This association is particularly pronounced in patients who are not carriers of the three main CD-associated NOD2 mutations, suggesting rs72796353 as additional genetic marker for the CD disease behaviour.
Temesszentandrási, György; Vörös, Krisztián; Márkus, Bernadett; Böröcz, Zoltán; Kaszás, Edit; Prohászka, Zoltán; Falus, András; Cseh, Károly; Kalabay, László
2016-08-04
BACKGROUND Human fetuin A (AHSG) has been associated with the development of obesity, insulin resistance, type 2 diabetes mellitus, and atherosclerosis. Observations on the role of AHSG rs4918 single-nucleotide polymorphism are contradictory. We investigated the association between variants of rs4918 and parameters of obesity, lipid status, tumor necrosis factor-α (TNFα), adipokines (adiponectin, resistin, leptin), and insulin resistance in healthy persons and in patients with previous myocardial infarction. MATERIAL AND METHODS This was a cross-sectional study comprising cohort 1 (81 healthy individuals) and cohort 2 (157 patients with previous myocardial infarction). We used the allele-specific KASP genotyping assay to detect rs4918 polymorphism. RESULTS In cohort 1, G-nucleotide carriers had significantly lower serum TNFα, adiponectin, and higher leptin concentrations than in non-G carriers. These differences, however, were not observed in cohort 2. In cohort 2, G-carriers had lower BMI and waist circumferences than in non-G carriers. The G allele was more frequent among lean than obese patients (RR=1.067, 95%CI=1.053-2.651, p=0.015). An association between BMI and rs4918 polymorphism was observed among patients without diabetes (CC/CG/GG genotypes: p=0.003, G vs. non-G allele: p=0.008) but not in diabetics. In addition, a strong linearity between BMI and the CC/CG/GG genotypes (association value: 4.416, p=0.036) and the frequency of the G allele (7.420, p=0.006) could be identified. In cohort 2, non-obese, non-diabetic G-carriers still had lower BMI and waist circumferences than in non-G carriers. CONCLUSIONS The rs4918 minor variant is associated with lower TNFα and adiponectin, higher leptin levels in healthy persons, and more favorable anthropomorphic parameters of obesity in cohort 2.
Temesszentandrási, György; Vörös, Krisztián; Márkus, Bernadett; Böröcz, Zoltán; Kaszás, Edit; Prohászka, Zoltán; Falus, András; Cseh, Károly; Kalabay, László
2016-01-01
Background Human fetuin A (AHSG) has been associated with the development of obesity, insulin resistance, type 2 diabetes mellitus, and atherosclerosis. Observations on the role of AHSG rs4918 single-nucleotide polymorphism are contradictory. We investigated the association between variants of rs4918 and parameters of obesity, lipid status, tumor necrosis factor-α (TNFα), adipokines (adiponectin, resistin, leptin), and insulin resistance in healthy persons and in patients with previous myocardial infarction. Material/Methods This was a cross-sectional study comprising cohort 1 (81 healthy individuals) and cohort 2 (157 patients with previous myocardial infarction). We used the allele-specific KASP genotyping assay to detect rs4918 polymorphism. Results In cohort 1, G-nucleotide carriers had significantly lower serum TNFα, adiponectin, and higher leptin concentrations than in non-G carriers. These differences, however, were not observed in cohort 2. In cohort 2, G-carriers had lower BMI and waist circumferences than in non-G carriers. The G allele was more frequent among lean than obese patients (RR=1.067, 95%CI=1.053–2.651, p=0.015). An association between BMI and rs4918 polymorphism was observed among patients without diabetes (CC/CG/GG genotypes: p=0.003, G vs. non-G allele: p=0.008) but not in diabetics. In addition, a strong linearity between BMI and the CC/CG/GG genotypes (association value: 4.416, p=0.036) and the frequency of the G allele (7.420, p=0.006) could be identified. In cohort 2, non-obese, non-diabetic G-carriers still had lower BMI and waist circumferences than in non-G carriers. Conclusions The rs4918 minor variant is associated with lower TNFα and adiponectin, higher leptin levels in healthy persons, and more favorable anthropomorphic parameters of obesity in cohort 2. PMID:27487851
Single-Nucleotide Polymorphisms of FAS and FASL Genes and Risk of Idiopathic Aplastic Anemia.
Rehman, Sadia; Saba, Nusrat; Naz, Madiha; Ahmed, Parvez; Munir, Saeeda; Sajjad, Sumaira; Tabassum, Sobia; Naseem, Lubna
2018-04-03
FAS/FASL signaling system plays a vital role in the regulation of apoptosis, envisaged as a death process required for immune surveillance to prevent autoimmunity and tumorigenesis along with several other biological activities. Several single-nucleotide polymorphisms (SNPs) of FAS/FASL system can result in aberrant apoptosis, which can cause different cancers and autoimmune diseases. Aplastic anemia (AA) is an autoimmune dysfunction characterized by peripheral blood pancytopenia associated with hypoplasia of bone marrow. The aim of this study was to screen Pakistani AA patients and controls for two Fas SNPs rs2234767 and rs1800682 and two FASLG SNPs rs763110 and rs5030772. Genotyping of 392 DNA samples was done by Tetra-ARMS polymerase chain reaction. Genotypic frequencies of Fas rs1800682 and FASLG rs5030772 showed significance difference in their distribution in both controls and patients, while Fas rs2234767 and FASLG rs763110 SNPs had no such difference. Carriers of rs1800682 AG+GG had a very odd ratio of 4.63, with 95% confidence interval (CI) of 3.01-7.11, while individuals with FASLG rs5030772 AG+GG were more common in controls than patients with OR 0.53 and 95% CI of 0.34-0.83. Cumulative effects of these SNPs were analyzed, and they showed almost similar trends; however, Fas rs2234767 and FASLG rs763110 genotypes in combination with Fas rs1800682 and FASLG rs5030772 demonstrated significant association. This study provided information that endorsed the involvement of FAS/FASL system SNPs in the pathogenesis of AA; further studies should be designed to understand the exact role of SNPs that can help in early diagnosis and treatment.
Han, Rongbo; Wei, Jingsun; Zhang, Honghong; Su, Xinyu; Chu, Xia; Chen, Yuetong; Gong, Yang; Wang, Xiujuan; Shi, Junfeng; Chen, Jinfei
2018-01-01
This study aimed to explore the clinical correlation of single-nucleotide polymorphisms of thymidylate synthase (TS) and runt-related transcription factor 1 (RUNX1) in patients with postoperative stage II and III gastric cancer (GC). Samples were obtained from 661 patients with postoperative stage II and III GC. TS (rs34743033) and RUNX1 (rs2014300) were genotyped in 261 patients who received postoperative basic platinum and fluorouracil chemotherapy regimens and 400 patients who did not accept chemotherapy. TS (rs34743033) variant genotypes significantly prolonged the median overall survival (OS) time compared to the patients who only received adjuvant chemotherapy (HR 1.604, 95% CI 1.068-2.410, p =0.021). Moreover, 3R/3R variant genotypes were demonstrated to have a positive effect on the OS of patients who received chemotherapy based on cisplatin (HR 1.754, 95% CI 1.041-2.954, p =0.031) compared to oxaliplatin. A stratification analysis indicated that 2R/3R and 2R/2R variant genotypes were associated with inferior survival in GC patients with intestinal-type tumors, tumor less than 5 cm in size, and poorly differentiated tumors ( p <0.05). However, RUNX1 (rs2014300) AA genotypes markedly increased the risk of death in GC patients compared with the GG/GA genotypes ( p =0.007), but no significant difference was observed between chemotherapy based on platinum. The stratification analysis showed that the GA/AA genotype was significantly associated with inferior survival in well to moderately differentiated tumors (HR 2.001, 95% CI 1.082-3.703, p =0.023). These preliminary results indicated that the two polymorphisms had a significant effect on postoperative adjuvant chemotherapy. TS (rs34743033) and RUNX1 (rs2014300) may be used as biomarkers to predict prognosis and select chemotherapy regimens in GC patients.
Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.
Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun
2013-01-01
Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.
Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-11-01
Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.
Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun
2016-01-01
Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242
Echeverría, Natalia; Chiodi, Daniela; López, Pablo; Sanchez Ciceron, Adriana; Angulo, Jenniffer; López-Lastra, Marcelo; Silvera, Paola; Canavesi, Adrian; Bianchi, Carla; Colistro, Valentina; Cristina, Juan; Hernandez, Nelia; Moreno, Pilar
2018-03-02
Host single-nucleotide polymorphisms (SNPs) near the interleukin 28B (IL28B) locus are associated with sustained virological response to antiviral therapy and with spontaneous Hepatitis C Virus (HCV) clearance. Prevalence of these SNPs varies depending on ethnicity. The impact of IL28B SNPs in HCV-infected patients is currently unknown in Uruguay. Therefore, the aim of this study was to evaluate and compare the distribution of polymorphisms in the IL28B gene (rs12979860 and rs8099917) among HCV-infected patients and healthy individuals in Uruguay and thus assess their possible association with the establishment of HCV infection. DNA was recovered from 92 non-infected individuals and 78 HCV-infected patients and SNPs were determined by RFLP and allelic discrimination by real-time PCR. The distribution of rs12979860 genotypes for the infected population was 29.5%-CC, 47.4%-CT and 23.1%-TT and for the control group 45.7%, 42.4% and 11.9%, respectively. Prevalence in both infected and uninfected individuals is similar to that reported in other countries with admixed populations. The distribution of rs8099917 genotypes for the infected population was 57.7%-TT, 27.2%-TG and 14.1%-GG and for the control group 60.9%, 33.7% and 5.4%, respectively. The comparison of rs12979860 genotype distribution between the two populations evidenced a higher prevalence of the favourable genotype (CC) in the uninfected control group (p < 0.05). Additionally, results generated using logistic regression analysis show that individuals carrying rs12979860-TT or CT genotypes have a higher likelihood of developing chronic hepatitis upon infection with HCV, when compared to CC carriers, considering rs8099917 genotype as constant. Patients with HCV infection have a statistically significant lower prevalence of the favourable rs12979860 genotype when compared to uninfected individuals; therefore we can establish that only IL28B rs12979860-CT and TT genotypes seem to contribute to the occurrence
C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population
Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio
2015-01-01
Introduction: Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. Objective: To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Methods: Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics®). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Results: Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Conclusions: Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies. PMID:26309343
Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma
Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John J; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M; Asmann, Yan W; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I; Bertrand, Kimberly A; Birmann, Brenda M; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M; Brennan, Paul; Brooks-Wilson, Angela R; Cerhan, James R; Chanock, Stephen J; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J; de Sanjose, Silvia; Di Lollo, Simonetta; Diver, W Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G; Glimelius, Bengt; Habermann, Thomas M; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R; Holly, Elizabeth A; Jackson, Rebecca D; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S; Klein, Robert J; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry J; Monnereau, Alain; Morton, Lindsay M; Nieters, Alexandra; North, Kari E; Novak, Anne J; Offit, Kenneth; Purdue, Mark P; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K; Skibola, Christine F; Slager, Susan L; Smith, Alex; Smith, Martyn T; Southey, Melissa C; Staines, Anthony; Teras, Lauren R; Thompson, Carrie A; Tilly, Hervé; Tinker, Lesley F; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E
2017-01-01
Objective Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL. Methods GWAS data on European Caucasians from the International Lymphoma Epidemiology Consortium (InterLymph) provided a total of 3857 DLBCL cases and 7666 general-population controls. Data were pooled in a random-effects meta-analysis. Results Among the 28 SLE-related SNPs investigated, the two most convincingly associated with risk of DLBCL included the CD40 SLE risk allele rs4810485 on chromosome 20q13 (OR per risk allele=1.09, 95% CI 1.02 to 1.16, p=0.0134), and the HLA SLE risk allele rs1270942 on chromosome 6p21.33 (OR per risk allele=1.17, 95% CI 1.01 to 1.36, p=0.0362). Of additional possible interest were rs2205960 and rs12537284. The rs2205960 SNP, related to a cytokine of the tumour necrosis factor superfamily TNFSF4, was associated with an OR per risk allele of 1.07, 95% CI 1.00 to 1.16, p=0.0549. The OR for the rs12537284 (chromosome 7q32, IRF5 gene) risk allele was 1.08, 95% CI 0.99 to 1.18, p=0.0765. Conclusions These data suggest several plausible genetic links between DLBCL and SLE. PMID:29214033
Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae
2010-08-02
To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.
PICALM gene rs3851179 polymorphism contributes to Alzheimer's disease in an Asian population.
Liu, Guiyou; Zhang, Shuyan; Cai, Zhiyou; Ma, Guoda; Zhang, Liangcai; Jiang, Yongshuai; Feng, Rennan; Liao, Mingzhi; Chen, Zugen; Zhao, Bin; Li, Keshen
2013-06-01
PICALM gene rs3851179 polymorphism was reported to an Alzheimer's disease (AD) susceptibility locus in a Caucasian population. However, recent studies reported consistent and inconsistent results in an Asian population. Four studies indicated no association between rs3851179 and AD in a Chinese population and one study reported weak association in a Japanese population. We consider that the failure to replicate the significant association between rs3851179 and AD may be caused by at least two reasons. The first reason may be the genetic heterogeneity in AD among different populations, and the second may be the relatively small sample size compared with large-scale GWAS in Caucasian ancestry. In order to confirm this view, in this research, we first evaluated the genetic heterogeneity of rs3851179 polymorphism in Caucasian and Asian populations. We then investigated rs3851179 polymorphism in an Asian population by a pooled analysis method and a meta-analysis method. We did not observe significant genetic heterogeneity of rs3851179 in the Caucasian and Asian populations. Our results indicate that rs3851179 polymorphism is significantly associated with AD in the Asian population by both pooled analysis and meta-analysis methods. We believe that our findings will be very useful for future genetic studies in AD.
[Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].
Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo
2012-06-01
To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.
Guo, Min; Cheng, Zhifeng; Li, Changgui; Li, Shanshan; Li, Ming; Wang, Mingli; Xu, Jinmei; Tang, Yingying; Wang, Yujing; Qiu, Wenli; Liu, Xiaomin
2015-05-10
Gout is a genetic or acquired metabolic disease caused by increase of uric acid synthesis resulted from purine metabolic abnormalities. Whether cGMP-dependent protein kinase 2 (cGKII/PRKG2) is correlated with gout remains controversial. The objective of the present study was to investigate whether there is a correlation between polymorphism of cGKII/PRKG2 and gout susceptibility of Han population in northern China. Four hundred and five male patients with gout in the case group and 429 controls in the control group were collected from the Department of Endocrinology and Metabolic Disease, the Fourth Affiliated Hospital of Harbin Medical University. A case-control study method was used to study the correlation between cGKII/PRKG2 polymorphism rs7688672 and rs10033237 and gout susceptibility. The genotype frequencies of rs7688672 and rs10033237 polymorphisms of cGKII/PRKG2 in the case group and the control group both were in accordance with Hardy-Weinberg equilibrium. There were significant differences of rs10033237 in the allele frequencies and genotype distributions (P<0.05) between the two groups, while no association was found between rs7688672 and gout. Combined mutation sites AA(*) from rs7688672 and rs10033237 were negatively correlated with gout susceptibility, whereas haplotype GG(*) was positively correlated with gout susceptibility. In conclusion, patients with rs10033237 polymorphism of cGKII/PRKG2 gene are more likely to suffer from gout. With regard to haplotypes of rs10033237 and rs7688672, both AA(*) and GG(*) are related to gout. AA(*) is a gout susceptible gene, whereas GG(*) is a protective gene. Copyright © 2015 Elsevier B.V. All rights reserved.
Jin, Huifeng; Cheng, Haojie; Chen, Wei; Sheng, Xiaoming; Levy, Mark A; Brown, Mark J; Tian, Junqiang
2018-05-01
The single nucleotide polymorphism of the gene 5,10-methylenetetrahydrofolate reductase (MTHFR) C677T (or rs1801133) is the most established genetic factor that increases plasma total homocysteine (tHcy) and consequently results in hyperhomocysteinemia. Yet, given the limited penetrance of this genetic variant, it is necessary to individually predict the risk of hyperhomocysteinemia for an rs1801133 carrier. We hypothesized that variability in this genetic risk is largely due to the presence of factors (covariates) that serve as effect modifiers, confounders, or both, such as folic acid (FA) intake, and aimed to assess this risk in the complex context of these covariates. We systematically extracted from published studies the data on tHcy, rs1801133, and any previously reported rs1801133 covariates. The resulting metadata set was first used to analyze the covariates' modifying effect by meta-regression and other statistical means. Subsequently, we controlled for this modifying effect by genotype-stratifying tHcy data and analyzed the variability in the risk resulting from the confounding of covariates. The data set contains data on 36 rs1801133 covariates that were collected from 114,799 participants and 256 qualified studies, among which 6 covariates (sex, age, race, FA intake, smoking, and alcohol consumption) are the most frequently informed and therefore included for statistical analysis. The effect of rs1801133 on tHcy exhibits significant variability that can be attributed to effect modification as well as confounding by these covariates. Via statistical modeling, we predicted the covariate-dependent risk of tHcy elevation and hyperhomocysteinemia in a systematic manner. We showed an evidence-based approach that globally assesses the covariate-dependent effect of rs1801133 on tHcy. The results should assist clinicians in interpreting the rs1801133 data from genetic testing for their patients. Such information is also important for the public, who increasingly
Mir, Atefeh; Sadegh, Mahdiyeh Harati; Ahmadinia, Zahra
2015-01-01
Phosphatidylinositol-3-kinase (PI3K) is a group of enzymes involved in cellular growth, proliferation, differentiation, cell motility, intracellular trafficking, and survival that play very important roles in developing breast cancer. PIK3CA is a gene that encodes α catalytic subunit of this enzyme. A common polymorphism of PIK3CA, rs7640662 (C/G), was analyzed, and its association to breast cancer cases was determined. In this study, DNA was extracted from peripheral blood samples of 278 women suffering from breast cancer and 128 healthy women. Tetra-primer amplification refractory mutation system polymerase chain reaction (T-ARMS-PCR) method was performed to genotype rs7640662. P values and ODD ratios were measured using SPSS. P value less than 0.05 and ODD ratios more than 1 were considered as significant. All ODD ratios were less than 1, and P values were more than 0.05 showing that rs7640662 (C/G) and breast cancer are not significantly associated. However, the genotypes observed in the Persian population, as an ancient population living in the Middle East, was significantly different from the genotypes reported by HapMap for Asian populations. As a conclusion, rs7640662 was not associated with the risk of breast cancer in a Persian population; however, it was observed that heterozygote (GC) is the most common genotypes in both case and control samples. PMID:25838920
Sun, Lin; Ma, Jun; Mao, Qian; Yang, Yun-Long; Ma, Lin-Lin; Niu, Ling; Liu, Li-Feng
2018-06-29
The present study was conducted to explore the correlations between single nucleotide polymorphisms (SNPs) in the calcium channel CACNA 1A, CACNA 1C, and CACNA 1H genes and diabetic peripheral neuropathy (DPN) amongst the Chinese population. In total, 281 patients diagnosed with type 2 diabetes participated in the present study. These patients were divided into the case group, which was subdivided into the DPN (143 cases) and the non-DPN groups (138 cases). Subsequently, 180 healthy individuals that had undergone routine health examinations were also recruited and assigned to the control group. PCR-restriction fragment length polymorphism (PCR-RFLP) was used to detect the genotype and allele frequencies of CACNA 1A, CACNA 1C, and CACNA 1H genes; logistic regression analysis to investigate the association of gene polymorphisms with DNP. Gene-gene interactions were then detected by generalized multifactor dimensionality reduction (GMDR). The results revealed that CACNA 1A rs2248069 and rsl6030, CACNA 1C rs216008 and rs2239050, and CACNA 1H rs3794619, and rs7191246 SNPs were all associated with DPN, while rs2248069, rsl6030, rs2239050, and rs7191246 polymorphisms were attributed to the susceptibility to DPN. It was also observed that the optimal models were three-, four- and five-dimensional models with a prediction accuracy of 61.05% and the greatest consistency of cross-validation was 10/10. In summary, these findings demonstrated that the SNPs in the CACNA 1A, CACNA 1C, and CACNA 1H genes were involved in the pathophysiology of DPN. In addition, polymorphisms in the CACNA 1A, CACNA 1C, and CACNA 1H genes and their interactions also had effects on DPN. © 2018 The Author(s).
Cahua-Pablo, Gabriel; Cruz, Miguel; Moral-Hernández, Oscar Del; Leyva-Vázquez, Marco A; Antúnez-Ortiz, Diana L; Cahua-Pablo, José A; Alarcón-Romero, Luz Del Carmen; Ortuño-Pineda, Carlos; Moreno-Godínez, Ma Elena; Hernández-Sotelo, Daniel; Flores-Alfaro, Eugenia
2016-07-01
Apolipoprotein E (ApoE) 4 isoform has been associated with elevated levels of cholesterol, low-density lipoprotein cholesterol (LDL-C), and triglycerides (TGs), meanwhile several polymorphisms in the LDL receptor (LDLR) gene have been associated with increased levels of total cholesterol and LDL-C. We studied 400 women from Southwest Mexico. Anthropometric features and biochemical profile were evaluated, and genotyping of single nucleotide polymorphisms rs429358 and rs7412 in the APOE gene and rs688 in the LDLR gene was determined by TaqMan assays. We found significant association between LDL-C (odds ratio [OR] = 3.3, 95% confidence interval [CI]: 1.9-5.7) and marginal association with TG (OR = 1.7, 95% CI: 1.0-2.9) of atherogenic risk in women carriers of the ApoE4 isoform compared to ApoE3. The TT genotype of rs688 in the LDLR gene was not found to be associated with elevated levels of total cholesterol or LDL-C. Our results show that carrier women of the ApoE4 isoform are more likely to have elevated levels of LDL-C and therefore increased risk of developing atherosclerosis. © The Author(s) 2015.
Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa
2012-01-01
We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708
Osman, A E; Mubasher, M; ElSheikh, N E; AlHarthi, H; AlZahrani, M S; Ahmed, N; ElGhazali, G; Bradley, B A; Fadil, A-S A
2016-05-23
Hematogenous osteomyelitis (HO) is a bone infection wherein bacteria penetrate to the bone through the blood stream. Several single nucleotide polymorphisms (SNPs) have been associated with susceptibility to infectious diseases. In this study, we investigated the contribution of SNPs in interleukin (IL)-1B1 (rs16944), IL1A (rs1800587), IL1B (rs1143634), toll-like receptor (TLR)-2 (rs3804099), TLR4 (rs4986790), TLR4 (rs4986791), IL1R (rs2234650), tumor necrosis factor (TNF)-α (rs1800629), TNF (rs361525), and IL1RN (rs315952) towards the development of HO in Saudi patients and compared to healthy controls. Fifty-two patients diagnosed with HO and 103 healthy individuals were genotyped. The frequencies of genotypes GG (rs16944) and AA (rs16944) were lower and higher in patients [odds ratio (OR) = 0.34, Pc = 0.05] and controls (OR = 1.33, Pc = 0.05), respectively, suggesting that SNPs at this locus could alter HO susceptibility. In addition, the patients and controls exhibited lower and higher frequencies of the alleles G (rs16944) (OR = 0.43, Pc = 0.007) and A (rs16944) (OR = 2.32, Pc = 0.007), respectively. The expression of alleles C (rs3804099) and T (rs3804099) were higher in patients (OR = 2.05, Pc = 0.04) and controls (OR = 0.49, Pc = 0.04), respectively. In conclusion, SNPs at rs16944 and rs3804099 were found to be associated with HO in the Saudi population.
Ningombam, Somorjit Singh; Chhungi, Varhlun; Newmei, Masan Kambo; Rajkumari, Sunanda; Devi, Naorem Kiranmala; Mondal, Prakash Ranjan; Saraswathy, Kallur Nava
2018-03-20
The fat mass and obesity associated (FTO) rs9939609 gene polymorphism is most widely studied in terms of obesity in various populations. Recently, the prevalence of obesity has been reported to be very high among the North-Eastern State of India. The major aim of the present study is to understand the extent of FTO rs9939609 gene polymorphism and its association with obesity among the two North-East Indian tribal populations with similar East Asian ancestry. Somatometric data and fasting blood sample were collected from 521 tribal individuals (258 Liangmai and 263 Mizo) of Manipur after obtaining written informed consent. Genotyping of FTO rs9939609 single nucleotide polymorphism (SNP) was done using restriction fragment length polymorphism method for PCR-amplified fragments. Both the presently studied populations were not following Hardy-Weinberg law. The prevalence of obesity and minor allele frequency of FTO rs9939609 polymorphism was found to be significantly higher among the Mizo tribe compared to that of Liangmai. The selected polymorphism was found to be significantly associated with obesity (BMI) only among the Liangmai tribe (Odds ratio-3.0; 95% CI-1.4, 6.4; p-0.003), after adjusting for age and occupation. Age-cohort wise distribution and absolute fitness analysis indicated the lower fitness of minor allele in the higher age group among the Liangmai tribe. To the best of the author's knowledge this is the first study, associating FTO rs9939609 gene polymorphism and obesity in the North-eastern Indian tribal populations with East-Asian ancestry. This study revealed the FTO rs9939609 polymorphism is observed to be associated with obesity only among the Liangmai tribe not among the Mizo tribe. The differential distribution and association observed in the two selected tribes, inhabited in a similar geographical region, could be attributed to differences in their migratory histories in terms of both route and time of settlement. Copyright © 2018 Elsevier B
Yang, Shuhan; Dong, Xiaopeng; Guo, Xuan; Han, Yu; Song, Hanbing; Gao, Lei; Dai, Wei; Su, Yuanyuan; Zhang, Xin
2017-01-01
The neuropeptide oxytocin (OT) and its receptor (OXTR) have been predicted to be involved in the regulation of social functioning in autism spectrum disorders (ASD). Objective of the study was to investigate serum OT levels and the OXTR rs2254298 polymorphism in Chinese Han children and adolescents with ASD as well as to identify their social deficits relevant to the oxytocinergic system. We tested serum OT levels using ELISA in 55 ASD subjects and 110 typically developing (TD) controls as well as genotyped the OXTR rs2254298 polymorphism using PCR-RFLP in 100 ASD subjects and 232 TD controls. Autistic symptoms were assessed by the Autism Behavior Checklist (ABC) and the Childhood Autism Rating Scale (CARS). There were no significant associations between OXTR rs2254298 polymorphism and ASD, serum OT levels and age, as well as serum OT levels and intelligent quotient (IQ) in both ASD and TD groups. However, ASD subjects exhibited elevated serum OT levels compared to TD controls and positive correlations between serum OT levels and “adaptation to change score” in the CARS and CARS total scores. Moreover, in the ASD group, significant relationships were revealed between the single-nucleotide polymorphism (SNP) rs2254298 and serum OT levels, the category “stereotypes and object use” in the ABC and the category “adaptation to change” in the CARS. These findings indicated that individuals with ASD may exhibit a dysregulation in OT on the basis of changes in OXTR gene expression as well as environmentally induced alterations of the oxytocinergic system to determine their social deficits. PMID:28484366
Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-De-La-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A.G.
2015-01-01
Abstract Several recent works suggest a possible role of vitamin D deficiency in the etiology or restless legs syndrome (RLS). We analyzed the possible relationship of 2 common single nucleotide polymorphisms (SNPs) in the vitamin D3 receptor (VDR) gene with the risk for RLS. We studied the genotype and allelic variant frequencies of VDR rs2228570 and VDR rs731236 SNPs in 205 RLS patients and 445 healthy controls using a TaqMan essay. The frequencies of the rs731236AA genotype and the allelic variant rs731236A were significantly lower in RLS patients than in controls (P < 0.005 and < 0.01, respectively). Restless legs syndrome patients carrying the allelic variant rs731236G had an earlier age at onset, and those carrying the rs731236GG genotype had higher severity of RLS, although these data disappeared after multivariate analyses. None of the SNPs studied was related with the positivity of family history of RLS. These results suggest a modest, but significant association between VDR rs731236 SNP and the risk for RLS. PMID:26632733
Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-De-La-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A G
2015-11-01
Several recent works suggest a possible role of vitamin D deficiency in the etiology or restless legs syndrome (RLS). We analyzed the possible relationship of 2 common single nucleotide polymorphisms (SNPs) in the vitamin D3 receptor (VDR) gene with the risk for RLS.We studied the genotype and allelic variant frequencies of VDR rs2228570 and VDR rs731236 SNPs in 205 RLS patients and 445 healthy controls using a TaqMan essay.The frequencies of the rs731236AA genotype and the allelic variant rs731236A were significantly lower in RLS patients than in controls (P < 0.005 and < 0.01, respectively). Restless legs syndrome patients carrying the allelic variant rs731236G had an earlier age at onset, and those carrying the rs731236GG genotype had higher severity of RLS, although these data disappeared after multivariate analyses. None of the SNPs studied was related with the positivity of family history of RLS.These results suggest a modest, but significant association between VDR rs731236 SNP and the risk for RLS.
The Single Nucleotide Polymorphism Consortium
NASA Technical Reports Server (NTRS)
Morgan, Michael
2003-01-01
I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.
Association between ALDH2 rs671 G>A polymorphism and gastric cancer susceptibility in Eastern Asia
Jiang, You; Zhang, Jun; Wu, Yuee; Wang, Jian; Li, Liang
2017-01-01
To date, the relationship between the aldehyde dehydrogenases-2 (ALDH2) rs671 G>A (Glu504Lys) polymorphism and gastric cancer (GC) risk has not been thoroughly elucidated. To derive a more precise estimation of the effect of the ALDH2 rs671 G>A polymorphism on GC, we conducted this meta-analysis. We searched for qualified studies in the Embase, PubMed, Wang Fan and China National Knowledge Infrastructure databases. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were calculated to assess the association. A total of 6,421 GC patients and 8,832 control subjects were included in the present study. The pooled results indicated no significant relationship between the ALDH2 rs671 G>A polymorphism and GC susceptibility in all genetic models. A stratified analysis by country showed that the ALDH2 rs671 G>A polymorphism might be a risk factor for GC in Japan (Allele model: P unadjusted = 0.034; Dominant model: P unadjusted = 0.040); however, the result was nonsignificant when the Bonferroni correction and false discovery rate (FDR) were applied. In subgroup analyses by drinking status in the dominant model, our study revealed that the ALDH2 rs671 G>A polymorphism significantly increased the risk of GC for drinkers (dominant model: P < 0.001). No relationship between the ALDH2 rs671 G>A polymorphism and GC risk was observed in any other subgroup. Our present study indicated no association between the ALDH2 rs671 G>A polymorphism and GC risk in Eastern Asian populations. However, the ALDH2 rs671 G>A polymorphism can significantly increase GC risk for drinkers. PMID:29254255
Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin
2015-07-01
To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.
Regulatory polymorphism of CXCL10 rs1439490 in seronegative occult hepatitis C virus infection.
Wang, Xu; Wang, Song; Liu, Zhen-Hua; Qi, Wen-Qian; Zhang, Qian; Zhang, Yong-Gui; Sun, De-Rong; Xu, Yan; Wang, Hong-Guang; Li, Zhong-Xie; Cong, Xian-Ling; Zhao, Ping; Zhou, Chang-Yu; Wang, Jiang-Bin
2018-05-28
To examine the relationship between the single nucleotide polymorphism CXCL10 rs1439490 and seronegative occult hepatitis C virus (HCV) infection (OCI). One hundred and three cases of seronegative OCI and 155 cases of seropositive chronic HCV infection (CHC) were diagnosed at five Liver Centers in Northeastern China, from 2012 to 2016. CXCL10 rs1439490, rs1440802, and IL-28B rs12979860 were analyzed by sequencing. Serum CXCL10 was measured by ELISA. Intrahepatic CXCL10 was determined by quantitative PCR and immunohistochemical semi-quantitative scoring. Liver necroinflammation and fibrosis were scored according to the METAVIR system. CXCL10 rs1439490 G/G was more prevalent in OCI patients ( n = 93/103; 90.3%) than in CHC patients ( n = 116/155; 74.8%; P = 0.008). OCI patients had lower serum CXCL10 levels than CHC patients (192.91 ± 46.50 pg/mL vs 354.78 ± 102.91 pg/mL, P < 0.0001). Of IL-28B rs12979860 C/C patients, OCI patients with rs1439490 G/G had lower serum and liver levels of CXCL10 and lower levels of liver necroinflammation and fibrosis than non-G/G patients. OCI patients had higher alanine aminotransferase normalization rates after Peg-interferon treatment than CHC patients (P < 0.05) and serum CXCL10 decreased significantly (P < 0.0001). Liver necroinflammation and fibrosis were alleviated in 8 OCI patients after treatment. Multivariate analysis indicated that rs1439490 G/G significantly influenced the occurrence of OCI in HCV infection (OR = 0.31, 95%CI: 0.15-0.66, P = 0.002). CXCL10 rs1439490 G/G is positively associated with OCI in HCV infection and antiviral outcome.
Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy
2017-03-01
Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Liguori, Rosario; Labruna, Giuseppe; Alfieri, Andreina; Martone, Domenico; Farinaro, Eduardo; Contaldo, Franco; Sacchetti, Lucia; Pasanisi, Fabrizio; Buono, Pasqualina
2014-08-01
Gene variants in MC4R, SIRT1 and FTO are associated with severe obesity and metabolic impairment in Caucasians. We investigated whether common variants in these genes are associated with metabolic syndrome (MetS) in a large group of morbidly obese young adults from southern Italy. One thousand morbidly obese subjects (62% women, mean body mass index 46.5 kg/m(2), mean age 32.6 years) whose families had lived in southern Italy for at least 2 generations were recruited. Single-nucleotide polymorphisms (SNPs) rs12970134, rs477181, rs502933 (MC4R locus), rs3818292, rs7069102, rs730821, rs2273773, rs12413112 (SIRT1 locus) and rs1421085, rs9939609, 9930506, 1121980 (FTO locus) were genotyped by Taqman assay; blood parameters were assayed by routine methods; the Fat Mass, Fat Free Mass, Respiratory Quotient, Basal Metabolic Rate (BMR) and waist circumference were also determined. Binomial logistic regression showed that the TA heterozygous genotype of SNP rs9939609 in the FTO gene was associated with the presence of MetS in our population [OR (95% CI): 2.53 (1.16-5.55)]. Furthermore, the FTO rs9939609 genotype accounted for 21.3% of the MetS phenotype together with total cholesterol, BMR and age. Our results extend the knowledge on genotype susceptibility for MetS in relation to a specific geographical area of residence. Copyright © 2014 Elsevier Ltd. All rights reserved.
Werbrouck, Emilie; Bastin, Julie; Lambrechts, Diether; Verbiest, Annelies; Van Brussel, Thomas; Lerut, Evelyne; Machiels, Jean-Pascal; Verschaeve, Vincent; Richard, Vincent; Debruyne, Philip R; Decallonne, Brigitte; Schöffski, Patrick; Bechter, Oliver; Wolter, Pascal; Beuselinck, Benoit
2018-05-23
Background and aim Vascular endothelial growth factor receptor tyrosine kinase inhibitors (VEGFR-TKIs) cause significant adverse events including thyroid dysfunction, mainly hypothyroidism, in a considerable proportion of patients. In a series of metastatic renal cell carcinoma (mRCC) patients treated with sunitinib, we aimed to study the correlation between hypothyroidism and single nucleotide polymorphisms (SNPs) in genes involved in sunitinib pharmacokinetics and pharmacodynamics. Patients and methods We included 79 mRCC patients who started sunitinib between November 2005 and March 2016. Serum thyroid function markers were collected at start and during sunitinib therapy. Germ-line DNA genotyping for 16 SNPs in 8 candidate genes was performed. Endpoints were time to increase in thyroid stimulating hormone (TSH) and time to decrease in T4 or free T4 (FT4) on day 1 and day 28 of each sunitinib cycle. Results Patients with the ABCG2 rs2231142 CC-genotype had a significantly longer time-to-TSH-increase on day 1 (11 vs. 5 cycles; p = 0.0011), and time-to-T4/FT4-decrease on day 1 (not reached vs. 10 cycles; p = 0.013) and day 28 (28 vs. 7 cycles; p = 0.03) compared to CA-carriers. Patients with the CYP3A5 rs776746 GG-genotype had a significantly longer time-to-TSH-increase at day 1 compared to GA-patients: 11 vs. 5 cycles (p = 0.0071). Significant associations were also found between PDGFRA rs35597368 and rs1800812 and time-to-TSH-increase at day 28. Conclusion Polymorphism rs2231142 in the efflux pump ABCG2 is associated with hypothyroidism in mRCC patients treated with sunitinib.
Shortt, Katherine; Chaudhary, Suman; Grigoryev, Dmitry; Heruth, Daniel P.; Venkitachalam, Lakshmi; Zhang, Li Q.; Ye, Shui Q.
2014-01-01
Acute respiratory distress syndrome (ARDS) is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP) which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719) in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T) occurs within a histone mark (intron 6) of the Arylsulfatase D gene. rs9605146 (G>A) causes a deleterious coding change (proline to leucine) in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A) is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted. PMID:25372662
SALIMI, SAEEDEH; NOORA, MEHRANGIZ; NABIZADEH, SIMA; REZAEI, MAHNAZ; SHAHRAKI, HOSSAIN; MILAD, MOHAMMADOO-KHORASSANI; NAGHAVI, ANOOSH; FARAJIAN-MASHHADI, FARZANEH; ZAKERI, ZAHRA; SANDOUGHI, MAHNAZ
2016-01-01
Osteopontin (OPN) is a chemokine-like glycoprotein that has a prominent role in regulating inflammation and immunity. OPN polymorphisms and elevated OPN levels are associated with systemic lupus erythematosus (SLE) in several populations. The aim of present study was to evaluate the association between the OPN rs1126616 polymorphism and OPN level with SLE susceptibility. A total of 163 SLE patients and 180 age-, gender- and ethnically matched controls were genotyped for the rs1126616 polymorphism by the polymerase chain reaction-restriction fragment length polymorphism method. Serum OPN levels were assayed by the enzyme-linked immunosorbent assay. There was no association between the OPN rs1126616 C/T polymorphism and SLE. The frequency of the OPN rs1126616 CT genotype was significantly higher in SLE patients with nephritis compared to SLE patients without nephritis and controls. Additionally, the frequency of TT genotypes was higher in SLE patients with nephritis compared to controls. The serum OPN levels were significantly higher in SLE patients compared to controls (50.6±22 vs. 35.6±15.8 ng/ml, P<0.001). Increased serum OPN levels were observed in SLE patients with lupus nephritis and joint symptoms. There was no correlation between OPN levels and the OPN rs1126616 polymorphism. The present data suggest that the CT and TT genotypes of the OPN rs1126616 polymorphism could be a risk factor for lupus nephritis. The OPN level is associated with SLE and certain SLE manifestations. However, there was no association between the OPN rs1126616 C/T polymorphism and SLE susceptibility. PMID:26998275
Zhao, Qian; Jin, Mei; Zhang, Da-Wei; Zhao, Wen; Wang, Xi-Si; Yue, Zhi-Xia; Duan, Chao; Huang, Cheng; Ma, Xiao-Li
2018-05-05
The pro-inflammatory cytokine, interleukin-6 (IL-6), stimulates the metastasis of several neoplasms. An association of its serum level and the single nucleotide polymorphism (SNP) rs1800795 with neuroblastoma (NB) has been reported in American and Italian cohorts. This study was to clarify whether the same association exists in Chinese children. A total of 130 NB patients, with 77 boys (59%), 53 girls (41%), mean age 41 ± 5 months, were assigned to two groups: high risk (HR) versus intermediate-low risk (non-HR), and 50 healthy children were randomly selected as the age- and gender-matched controls. Peripheral blood samples were analyzed to determine serum IL-6 level using enzyme linked immunosorbent assay and rs1800795 SNPs phenotype using polymerase chain reaction and gene sequencing. There were 87 NB patients in the HR group and 43 NB patients in the non-HR group. A comparison of allele and genotype frequencies of the rs1800795 polymorphism between patients and controls found no association with NB risk (P > 0.05). The frequency of GG+GC genotype was higher in HR-NB patients than in non-HR-NB patients (64.4% vs. 48.8%, P = 0.02), and serum IL-6 level was much higher in HR-NB patients with GG+GC genotype than in HR-NB patients with CC genotype (4.36 ± 1.1 pg/ml vs. 1.83 ± 0.5 pg/ml; P = 0.02), but not in Non-HR-NB patients. The polymorphism rs1800795 is associated with serum IL-6 level and level of NB risk. GG genotype might indicate that the tumor is highly malignant (prone to metastasis) and associated with poor prognosis.
Tepper, Clifford G; Dang, Julie H T; Stewart, Susan L; Fang, Dao M; Wong, Kimberly A; Liu, Stephenie Y; Davis, Ryan R; Dao, Doan Y; Gregg, Jeffrey P; Török, Natalie J; Chen, Moon S
2018-04-01
An exploratory study was performed to determine the prevalence of the patatin-like phospholipase domain-containing protein 3 (PNPLA3) rs78409 [G] allele among the Hmong as a risk factor for nonalcoholic fatty liver disease (NAFLD). NAFLD/nonalcoholic steatohepatitis is the world's most common chronic liver disease and is expected to replace viral hepatitis as the leading cause of cirrhosis and potential precursor to hepatocellular carcinoma (HCC). Of all populations in California, the Hmong experience the highest risk of death from HCC and the highest prevalence of metabolic syndrome risk factors among Asians that predispose them to NAFLD. Here a genetic explanation was sought for the high rates of chronic liver disease among the Hmong. The literature pointed to the PNPLA3 rs738409 [G] allele as a potential genetic culprit. Cell-free DNA was isolated from 26 serum samples previously collected in community settings. Quantitative polymerase chain reaction-based single-nucleotide polymorphism (SNP) genotyping was performed with a validated TaqMan SNP genotyping assay, and results were analyzed with TaqMan Genotyper software. The PNPLA3 rs738409 [C>G] variant occurred at a frequency of 0.46 (12 of 26; 95% confidence interval, 0.27-0.67). This carrier rate would rank the Hmong as the third highest population in the 1000 Genomes Project. Although this small sample size limits the generalizability, the high frequency rates of this allele along with the presence of metabolic syndrome risk factors warrant further studies into the etiology of NAFLD among the Hmong. Cancer 2018;124:1583-9. © 2018 American Cancer Society. © 2018 American Cancer Society.
Derbala, Moutaz; Rizk, Nasser M; Al-Kaabi, Saad; John, Anil; Sharma, Manik; El-dweik, Nazeeh; Yakoob, Rafie; Pasic, Fuad; Almohanadi, Muneera; Alejji, Khalid; Abdelmola, Abdulatif; Butt, Mohamed
2013-09-01
Interleukin-28B (IL28B) polymorphisms have previously been reported to be strongly associated with spontaneous and treatment-induced HCV viral clearance. To assess the impact of four different IL28B polymorphisms and their haplotype combination and interferon-c inducible protein 10 (IP-10) in response to treatment in Egyptian genotype 4 patients. 159 HCV-genotype 4 patients were included. All patients were treated with Peginterferon alph2a/Ribavirin for 48 wk. The following polymorphisms rs12979860, rs11881222, rs8103142 and rs8099917 and rs80803142 of Il-28 were known to be associated with the sustained virological response. They were genotyped using the TaqMan assay. IP-10 was assessed by Eliza. The data indicated that all SNPs are within the Hardy-Weinberg Equilibrium (HWE) except for rs8103142 (p=6.255(-9)), therefore it was excluded from the study since it deviates from HWE-P. The CC, AA and TT genotypes of rs12979860, rs11881222 and rs8099917 were the more frequent genotypes among the responders at RVR, EVR, ETR and SVR, respectively. The frequency of CC, CT, and TT genotype was 46.4%, 38.1% and 15.5% among responders of RVR, and was 46.9%, 45.9% and 7.2 among responders of SVR for rs12979860, respectively. The relapse rate was 18.0% and 16.0 % during EVR and ETR, while the response rate was 52.8%, 58.5%, 59.7% and 61.6% after 4, 12, 48 and 72 weeks of treatment. The transient virological response (TVR) was 6.9% among HCV patients. The results showed that the odds ratio and 95% CI of HCV genotype 4 patients to have a better sustained response to treatment (SVR) was 2.92, (1.83-4.68, p=2.01(-5)), 2.89 (1.79-4.70, p=2.53(-5)), and 2.73 (0.21-0.65, p=0.0007) for those with the major allele "C" of rs12979860, the "A" allele of rs11881222, and the "T" allele of rs8099917, respectively. Furthermore, the positive predictive value (PPV) of the major homozygous alleles for SVR with better response to therapy was in the following order: 78.69%, 68.42%, and 32.14% with
Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B
2017-08-31
This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.
Lipphardt, Mark F; Deryal, Mustafa; Ong, Mei Fang; Schmidt, Werner; Mahlknecht, Ulrich
2013-01-01
Estrogen and progesterone hormones are key regulators of a wide variety of biological processes. In addition to their influence on reproduction, cell differentiation and apoptosis, they affect inflammatory response, cell metabolism and most importantly, they regulate physiological breast tissue proliferation and differentiation as well as the development and progression of breast cancer. In order to assess whether genetic variants in the steroid hormone receptor gene ESR1 (estrogen receptor alpha) had an effect on sporadic breast cancer susceptibility, we assessed 7 ESR1 single nucleotide polymorphisms (SNPs) for associations with breast cancer susceptibility and clinical parameters in 221 breast cancer patients and 221 controls, respectively. We identified ESR1 intron SNP +2464 C/T (rs3020314) and ESR1 intron SNP -4576 A/C (rs1514348) to correlate with breast cancer susceptibility and progesterone receptor expression status. Patients genotyped CT for ESR1 intron SNP +2464 (rs3020314) (p ≤ 0.045) or genotyped AC for ESR1 intron SNP -4576 (rs1514348) (p ≤ 0.000026) were identified to carry a significant risk as to the development of breast cancer in the Central European Caucasian population (both together: p ≤ 0.000488). Our study could confirm previous associations and revealed new associations of SNP rs1514348 with susceptibility to breast cancer and clinical outcome, which might be used as new additional SNP markers.
Rotter, Iwona; Skonieczna-Żydecka, Karolina; Kosik-Bogacka, Danuta; Adler, Grażyna; Rył, Aleksandra; Laszczyńska, Maria
2016-01-01
Metabolic disorders, including MetS, obesity, and lipid disorders, may be related to genetic factors. Metabolic disorders are associated with decreased TS levels in aging men. The aim of this study was to evaluate the relationship between FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms and the presence of MetS and its components, the concurrent lipid disorders, as well as sex hormone concentrations. This study involved 272 men of Caucasian descent aged 50-75 years. Lipid profile, including TCh, LDL, HDL, and TG, was evaluated by spectrophotometric method. Anthropometric measurements concerned WC and blood pressure. MetS was diagnosed according to the criteria of the IDF. Sex hormone profile, including TST, FTS, E 2 , DHEAS, and SHBG, was examined using enzyme-linked immunosorbent assay. Polymorphisms within FTO , MC4R , and PPARγ genes were identified using polymerase chain reaction-restriction fragments length polymorphism. This study did not show links between the analyzed genetic polymorphisms and the presence of MetS, T2DM, HT, and obesity. However, higher concentrations of TCh and LDL were found in men with the FTO rs9939609 polymorphism in the recessive mode of inheritance ( P =0.03 and P =0.05, respectively). Lower WC was found to be associated with MC4R rs17782313 gene inherited in the same model ( P =0.005). FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms seem to have little effect on the incidence of metabolic malfunctions and no effect on androgen-related disorders in the examined middle-aged and elderly men.
Zhong, Binlong; Huang, Donghua; Ma, Kaige; Deng, Xiangyu; Shi, Deyao; Wu, Fashuai; Shao, Zengwu
2017-01-01
It has been reported that the single nucleotide polymorphism (SNP) rs1800012 in COL1A1 gene might be linked to the susceptibility of musculoskeletal degenerative diseases, such as osteoarthritis (OA) and intervertebral disc degeneration (IVDD). However, the data from different studies is contradictory. Here we aimed to comprehensively summarize and clarify the relationship between the SNP and musculoskeletal degenerative diseases. Seven eligible studies including 1339 cases and 5406 controls were screened out from PubMed, Web Of Science and Cochrane library databases. Significant association was identified in sub group analysis of IVDD in homozygote model (GG versus TT: OR = 0.33, 95% CI 0.14–0.78, P = 0.012), heterozygote model (GT versus TT: OR = 0.29, 95% CI 0.11–0.72, P = 0.008) and dominant model (GG/GT versus TT: OR = 0.31, 95% CI 0.13–0.74, P = 0.008). Additionally, significant relationship was also found in sub group analysis of severe degree of IVDD in homozygote model (GG versus TT: OR = 0.37, 95% CI 0.15–0.91, P = 0.031), heterozygote model (GT versus TT: OR = 0.33, 95% CI 0.13–0.87,P = 0.024) and dominant model (GG/GT versus TT: OR = 0.36, 95% CI 0.14–0.88, P = 0.025). Although no significance was observed, there is a trend that the more G allele at COL1A1 rs1800012 site, the less possibility of IVDD and severe IVDD would happen. Our results indicate that COL1A1 rs1800012 polymorphism associates with the susceptibility of IVDD. However, this polymorphism may not be associated with OA risk. PMID:29088884
CARD8 rs2043211 polymorphism is associated with gout in a Chinese male population.
Chen, Ying; Ren, Xianfeng; Li, Changgui; Xing, Shichao; Fu, Zhengju; Yuan, Ying; Wang, Robin; Wang, Yangang; Lv, Wenshan
2015-01-01
BACKGROUND &AIM: Previous studies have suggested genetic factors are involved in the development of gout. We performed a case-control study to investigate the genetic association between CARD8 rs2043211 polymorphism and gout. A total of 396 male patients with gout and 403 age- and sex- matched healthy controls were included in this study. Genotyping was performed using TaqMan SNP Genotyping Assays. An association analysis was carried out using the χ² test. The genotype-phenotype analysis was also conducted. The genotype distribution of CARD8 rs2043211 polymorphism confirmed to HWE in the controls (P = 0.27). There was an obvious difference in the genotype distribution of CARD8 rs2043211 polymorphism between cases and controls (P = 0.017). In addition, there was an obvious association between CARD8 rs2043211 polymorphism and gout under the recessive comparison model (AA vs. OR = 0.65, 95%CI 0.47-0.88, P = 0.006). Patients carrying genotype TT of CARD8 rs2043211 polymorphism had higher triglycerides levels compared to those carrying the AA genotype (2.77±2.08 mmol/L vs. 2.07±1.15 mmol/L, P = 0.01). Patients with the TT genotype also had significantly higher systolic blood pressure compared with those with the AA genotype (142.11±21.10 mmHg vs. 135.38±14.66 mmHg, P = 0.03). Patients carrying TT genotype also had an increased risk of renal calculus compared with those carrying the AA genotype. CARD8 rs2043211 polymorphism is significantly associated with susceptibility to gout in Chinese Han males. © 2015 S. Karger AG, Basel.
Foroughmand, Ali Mohammad; Nikkhah, Emad; Galehdari, Hamid; Jadbabaee, Mohammad Hossin
2015-01-01
Objective Coronary artery disease (CAD) is a multi-factorial and heterogenic disease with atherosclerosis plaques formation in internal wall of coronary artery. Plaque formation results to limitation of the blood reaching to myocardium leading to appearance of some problems, such as ischemia, sudden thrombosis veins and myocardial infarction (MI). Several environmental and genetic factors are involved in prevalence and incident of CAD as follows: hypertension, high low density lipoprotein-cholesterol (LDL-C), age, diabetes mellitus, family history of early-onset heart disease and smoking. According to genome wide association studies (GWAS), five polymorphisms in the 9p21 locus seem to be associated with the CAD. We aimed to evaluate the remarkable association of two polymorphisms at 9p21 locus, rs1333049 and rs10757274, with CAD. Materials and Methods This experimental study was conducted in Golestan, Aria Hospitals and Genetics Lab of Shahid Chamran University in the city of Ahvaz, Iran, in 2010- 2011. The collected blood samples belonging to 170 CAD patients (case group) and 100 healthy individuals (control group) were analyzed by tetra-primer amplification refractory mutation system (ARMS)-polymerase chain reaction (PCR) technique. The results were analyzed using software package used for statistical analysis (SPSS; SPSS Inc., USA) version 16. A value of p<0.05 and an odd ratio (OR) with 95% confidence intervals (CI) were considered significant. Results The frequencies of CC, CG and GG genotypes for rs1333049 polymorphism in patients were 18.2, 65.3 and 16.5%, while in controls, the related values were 25, 67 and 8%, respectively. GG genotypes of rs1333049 polymorphism in CAD patients were more than control cases (OR: 0.354, 95%CI: 0.138-0.912, p=0.032). The frequencies of AA, AG and GG genotypes for rs10757274 in CAD patients were 8.2, 58.3 and 33.5%, while in controls, the related values were 35, 63 and 2%, respectively. GG Genotype in rs10757274 polymorphism
Polymorphism of the renalase gene in gestational diabetes mellitus.
Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna
2017-01-01
Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.
Andersen, Vibeke; Ernst, Anja; Christensen, Jane; Østergaard, Mette; Jacobsen, Bent A; Tjønneland, Anne; Krarup, Henrik B; Vogel, Ulla
2010-05-28
Crohn's disease (CD) and ulcerative colitis (UC) are characterized by a dysregulated inflammatory response to normal constituents of the intestinal flora in the genetically predisposed host. Heme oxygenase-1 (HO-1/HMOX1) is a powerful anti-inflammatory and anti-oxidant enzyme, whereas the pro-inflammatory interleukin 1 beta (IL-1 beta/IL1B) and anti-inflammatory interleukin 10 (IL-10/IL10) are key modulators for the initiation and maintenance of inflammation. We investigated whether single nucleotide polymorphisms (SNPs) in the IL-1 beta, IL-10, and HO-1 genes, together with smoking, were associated with risk of CD and UC. Allele frequencies of the IL-1 beta T-31C (rs1143627), and IL-10 rs3024505, G-1082A (rs1800896), C-819T (rs1800871), and C-592A (rs1800872) and HO-1 A-413T (rs2071746) SNPs were assessed using a case-control design in a Danish cohort of 336 CD and 498 UC patients and 779 healthy controls. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated by logistic regression models. Carriers of rs3024505, a marker polymorphism flanking the IL-10 gene, were at increased risk of CD (OR = 1.40, 95% CI: 1.06-1.85, P = 0.02) and UC (OR = 1.43, 95% CI: 1.12-1.82, P = 0.004) and, furthermore, with risk of a diagnosis of CD and UC at young age (OR = 1.47, 95% CI: 1.10-1.96) and OR = 1.35, 95% CI: 1.04-1.76), respectively). No association was found between the IL-1 beta, IL-10 G-1082A, C-819T, C-592A, and HO-1 gene polymorphisms and CD or UC. No consistent interactions between smoking status and CD or UC genotypes were demonstrated. The rs3024505 marker polymorphism flanking the IL-10 gene was significantly associated with risk of UC and CD, whereas no association was found between IL-1 beta or HO-1 gene polymorphisms and risk of CD and UC in this Danish study, suggesting that IL-10, but not IL-1 beta or HO-1, has a role in IBD etiology in this population.
2010-01-01
Background Crohns disease (CD) and ulcerative colitis (UC) are characterized by a dysregulated inflammatory response to normal constituents of the intestinal flora in the genetically predisposed host. Heme oxygenase-1 (HO-1/HMOX1) is a powerful anti-inflammatory and anti-oxidant enzyme, whereas the pro-inflammatory interleukin 1β (IL-1β/IL1B) and anti-inflammatory interleukin 10 (IL-10/IL10) are key modulators for the initiation and maintenance of inflammation. We investigated whether single nucleotide polymorphisms (SNPs) in the IL-1β, IL-10, and HO-1 genes, together with smoking, were associated with risk of CD and UC. Methods Allele frequencies of the IL-1β T-31C (rs1143627), and IL-10 rs3024505, G-1082A (rs1800896), C-819T (rs1800871), and C-592A (rs1800872) and HO-1 A-413T (rs2071746) SNPs were assessed using a case-control design in a Danish cohort of 336 CD and 498 UC patients and 779 healthy controls. Odds ratio (OR) and 95% confidence interval (95% CI) were estimated by logistic regression models. Results Carriers of rs3024505, a marker polymorphism flanking the IL-10 gene, were at increased risk of CD (OR = 1.40, 95% CI: 1.06-1.85, P = 0.02) and UC (OR = 1.43, 95% CI: 1.12-1.82, P = 0.004) and, furthermore, with risk of a diagnosis of CD and UC at young age (OR = 1.47, 95% CI: 1.10-1.96) and OR = 1.35, 95% CI: 1.04-1.76), respectively). No association was found between the IL-1β, IL-10 G-1082A, C-819T, C-592A, and HO-1 gene polymorphisms and CD or UC. No consistent interactions between smoking status and CD or UC genotypes were demonstrated. Conclusions The rs3024505 marker polymorphism flanking the IL-10 gene was significantly associated with risk of UC and CD, whereas no association was found between IL-1β or HO-1 gene polymorphisms and risk of CD and UC in this Danish study, suggesting that IL-10, but not IL-1β or HO-1, has a role in IBD etiology in this population. PMID:20509889
Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F
2015-04-01
Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.
Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh
2017-01-01
Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.
Issac, Marianne Samir M; Ashur, Wafaa; Mousa, Heba
2014-06-01
Chronic obstructive pulmonary disease (COPD) is a complex chronic inflammatory disease that involves the activity of various inflammatory cells and mediators. It has been suggested that susceptibility to COPD is, at least in part, genetically determined. The primary aim of this study was to investigate the association between surfactant protein D (SFTPD) rs2243639, interleukin (IL)-1β rs16944 and IL-1 receptor antagonist (IL-1RN) rs2234663 gene polymorphisms and COPD susceptibility, as well as examining the association between the various IL-1RN/IL-1β haplotypes and pulmonary function tests (PFT). Secondly, we aimed to examine the influence of SFTPD rs2243639 polymorphism on serum surfactant protein D (SP-D) level. A total of 114 subjects were recruited in this study and divided into three groups: 63 COPD patients, 25 asymptomatic smokers, and 26 healthy controls. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed for the detection of SFTPD rs2243639 and IL-1β rs16944 polymorphisms. Detection of variable numbers of an 86-bp tandem repeat (VNTR) of IL-1RN was done using PCR. Serum SP-D level was measured using enzyme linked-immunosorbent assay. PFTs were measured by spirometry. Carriers of the SFTPD AG and AA polymorphic genotypes constituted 71.4 % of COPD patients versus 48 % in asymptomatic smokers, with a statistically significant difference between the two groups (p = 0.049). Smokers who were carriers of the polymorphic SFTPD rs2243639 A allele (AG and AA genotypes) have a 2.708 times risk of developing COPD when compared with wild-type GG genotype carriers [odds ratio (OR) 2.708 (95 % CI 1.041-7.047)]. Forced expiratory flow (FEF) 25-75 % predicted was higher in IL-1RN*1/*1 when compared with *1/*2 (p = 0.013). FEF25-75 % predicted in carriers of haplotype IL-1RN *1/IL-1β T (49.21 ± 10.26) was statistically significantly higher than in carriers of IL-1RN *2/IL-1β T (39.67 ± 12.64) [p = 0
Association between the BRCA2 rs144848 polymorphism and cancer susceptibility: a meta-analysis.
Li, Qiuyan; Guan, Rongwei; Qiao, Yuandong; Liu, Chang; He, Ning; Zhang, Xuelong; Jia, Xueyuan; Sun, Haiming; Yu, Jingcui; Xu, Lidan
2017-06-13
The BRCA2 gene plays an important role in cancer carcinogenesis, and polymorphisms in this gene have been associated with cancer risk. The BRCA2 rs144848 polymorphism has been associated with several cancers, but results have been inconsistent. In the present study, a meta-analysis was performed to assess the association between the rs144848 polymorphism and cancer risk. Literature was searched from the databases of PubMed, Embase and Google Scholar before April 2016. The fixed or random effects model was used to calculate pooled odd ratios on the basis of heterogeneity. Meta-regression, sensitivity analysis, subgroup analysis and publication bias assessment were also performed using STATA 11.0 software according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2009. A total of 40 relevant studies from 30 publications including 34,911 cases and 48,329 controls were included in the final meta-analysis. Among them, 22 studies focused on breast cancer, seven on ovarian cancer, five on non-Hodgkin lymphoma, and the remaining six studies examined various other cancers. The meta-analysis results showed that there were significant associations between the rs144848 polymorphism and cancer risk in all genetic models. Stratified by cancer type, the rs144848 polymorphism was associated with non-Hodgkin lymphoma. Stratified by study design, the allele model was associated with breast cancer risk in population-based studies. The meta-analysis suggests that the BRCA2 rs144848 polymorphism may play a role in cancer risk. Further well-designed studies are warranted to confirm these results.
Zhang, Rui-Nan; Zheng, Rui-Dan; Mi, Yu-Qiang; Zhou, Da; Shen, Feng; Chen, Guang-Yu; Zhu, Chan-Yan; Pan, Qin; Fan, Jian-Gao
2016-08-01
The association between nonalcoholic fatty liver disease (NAFLD) and apolipoprotein C3 gene (APOC3) promoter region single-nucleotide polymorphisms (SNPs) rs2854117 and rs2854116 is controversial. The aim of this study was to investigate the relationship between other polymorphisms of APOC3 and NAFLD in Chinese. Fifty-nine liver biopsy-proven NAFLD patients and 72 healthy control subjects were recruited to a cohort representing Chinese Han population. The polymorphisms in the exons and flanking regions of APOC3 and patatin-like phospholipase domain-containing protein 3 (PNPLA3) rs738409 polymorphisms were genotyped. Among the five SNPs (rs4225, rs4520, rs5128, rs2070666, and rs2070667) in APOC3, only rs2070666 (c.179 + 62 T/A) was significantly different in genotype and allele frequency (both p < 0.01) between groups of NAFLD and control. After adjusting for sex, age, serum triglycerides, total cholesterol, body mass index, and the PNPLA3 rs738409 polymorphism, the APOC3 rs2070666 A allele was an independent risk factor for NAFLD with an odds ratio (OR) of 3.683 and 95 % confidence interval (CI) of 1.037-13.084. The APOC3 rs2070666 A allele was linked to the fourth quartile of the controlled attenuation parameter values (OR 2.769, 95 % CI 1.002-7.651) in 131 subjects, and also linked to the significant histological steatosis (OR 4.986, 95 % CI 1.020-24.371), but neither to liver stiffness measurement values nor to hepatic histological activity and fibrosis in NAFLD patients. The APOC3 rs2070666 A allele is a risk factor for NAFLD independent of obesity, dyslipidemia, and PNPLA3 rs738409, and it might contribute to increased liver fat content in Chinese Han population.
Sng, Chelvin C A; Cackett, Peter D; Yeo, Ian Y; Thalamuthu, Anbupalam; Venkatraman, Anandalakshmi; Venkataraman, Divya; Koh, Adrian H; Tai, E-Shyong; Wong, Tien Y; Aung, Tin; Vithana, Eranga N
2011-01-01
Age-related macular degeneration (AMD) is a leading cause of visual impairment. A single-nucleotide polymorphism (SNP; rs3775291) in the Toll-like receptor 3 (TLR3) gene has recently been implicated in the pathogenesis of AMD in Caucasian populations. The aim of this study was to examine this association in Chinese persons with choroidal neovascularization (CNV) secondary to AMD and polypoidal choroidal vasculopathy (PCV). This was an observational cross-sectional study in Singapore. Study subjects were of Chinese ethnicity and included patients with exudative maculopathy and normal control subjects. The diagnoses of CNV and PCV were made based on fundus examination, fluorescein angiography and indocyanine green angiography findings. Genomic DNA was extracted, and genotypes were determined by bidirectional DNA sequencing. We compared the allele and genotype frequencies between subjects with CNV and PCV with controls using the software PLINK. A total of 246 subjects with exudative maculopathy (consisting of 126 with CNV and 120 with PCV) and 274 normal control subjects were recruited. The distribution of rs3775291 SNP genotypes for CNV and PCV was not significantly different from that for normal controls. This study indicates that the TLR3 rs3775291 gene polymorphism is not associated with CNV and PCV in Singaporean Chinese patients. Copyright © 2010 S. Karger AG, Basel.
Wang, Chunguang; Li, Hao; Chen, Kang; Wu, Bing; Liu, Haifeng
2017-01-01
It has been reported that the single nucleotide polymorphism (SNP) rs1800012 in COL1A1 might be associated with the susceptibility to sports-related tendon and ligament injuries such as ACL injuries, Achilles tendon injuries, shoulder dislocations and tennis elbow. But the data from different studies have been conflicting. Here we attempted to systematically summarize and clarify the association between the SNP and sports-related tendon and ligament injuries risk. Six eligible studies including 933 cases and 1,381 controls were acquired from PubMed, Web Of Science and Cochrane library databases. Significant association was identified in homozygote model (TT versus GG: OR=0.17, 95%CI 0.08-0.35, PH=0.00) and recessive model (TT versus GT/GG: OR=0.21, 95%CI 0.10-0.44, PH=0.00). Our results indicated that COL1A1 rs1800012 polymorphism may be associated with the reduced risk of sports-related tendon or ligament injuries, especially in ACL injuries, and that rare TT may played as a protective role. PMID:28206959
Hernández-Guerrero, César; Parra-Carriedo, Alicia; Ruiz-de-Santiago, Diana; Galicia-Castillo, Oscar; Buenrostro-Jáuregui, Mario; Díaz-Gutiérrez, Carmen
2018-01-01
Genetic polymorphisms of antioxidant enzymes CAT, GPX, and SOD are involved in the etiology of obesity and its principal comorbidities. The aim of the present study was to analyze the effect of aforementioned SNPs over the output of several variables in people with obesity after a nutritional intervention. The study included 92 Mexican women, which received a dietary intervention by 3 months. Participants were genotyped and stratified into two groups: (1) carriers; mutated homozygous plus heterozygous (CR) and (2) homozygous wild type (WT). A comparison between CR and WT was done in clinical (CV), biochemical (BV), and anthropometric variables (AV), at the beginning and at the end of the intervention. Participants ( n = 92) showed statistically significant differences ( p < 0.05) at the end of the nutritional intervention in several CV, BV, and AV. However, two kinds of responses were observed after genotyping participants: (A) CR and WT showed statistically significant differences ( p < 0.05) in several CV, BV, and AV for the SNPs 599C>T GPX1 (rs1050450), - 251A>G SOD1 (rs2070424), and - 262C>T CAT (rs1001179). (B) Only CR showed statistically changes ( p < 0.05) in several CV, BV, and AV for the SNPs - 21A>T CAT (rs7943316) and 47C>T SOD2 (rs4880). The dietary intervention effect was statistically significantly between the polymorphisms of 47C>T SOD2 and BMI, SBP, TBARS, total cholesterol, and C-LCL ( p < 0.05) and between the polymorphisms of - 21A>T CAT (rs7943316) and SBP, DBP, total cholesterol, and atherogenic index ( p < 0.05). People with obesity display different response in several CV, BV, and AV after a nutritional intervention, depending on the antioxidant genetic background of SOD and CAT enzymes.
Tanaka, Keiko; Miyake, Yoshihiro; Hanioka, Takashi; Furukawa, Shinya; Miyatake, Nobuyuki; Arakawa, Masashi
2017-11-01
Interleukin-18 (IL-18) is a proinflammatory cytokine that plays an important role in periodontitis and its polymorphisms might modulate the individual susceptibility to periodontitis. Only a limited number of studies on the association between IL18 single-nucleotide polymorphisms (SNPs) and the risk of periodontitis have been realized, however. The aim of this case-control study among young post-partum Japanese women (18 to 45 years) was to determine the impact of SNPs, rs1946518 (-607 C/A) and rs187238 (-137G/C), on periodontitis. The two SNPs may be located within a transcription factor-binding element, thereby influencing transcription from the IL18 promoter. Subjects were 131 cases who had at least one tooth with a probing pocket depth of ≥ 4.0 mm and 1,017 periodontally healthy controls. Probing pocket depth measurements were performed between 1 and 12 months post-partum. In this population, the A allele of rs1946518 and the C allele of rs187238 are more common. After adjustment for age, education, smoking, and use of an interdental brush, compared with subjects with the AA or AC genotype of SNP rs1946518, those with the CC genotype had a significantly reduced risk of periodontitis (adjusted odds ratio = 0.54, 95% confidence interval = 0.29-0.97). No significant association was observed between rs187238 and the risk of periodontitis. Our study did not reveal any evidence of interaction between the IL18 polymorphisms and smoking. Our findings indicate that the IL18 promoter SNP, rs1946518, is a potential risk factor of periodontitis among young Japanese women.
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Huebner, Claudia; Ferguson, Lynnette R; Han, Dug Yeo; Philpott, Martin; Barclay, Murray L; Gearry, Richard B; McCulloch, Alan; Demmers, Pieter S; Browning, Brian L
2009-01-01
Background The nucleotide-binding oligomerization domain containing 1 (NOD1) gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs) on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD), 405 ulcerative colitis (UC), 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1) was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p < 0.002) but not UC. There was an increased frequency of the three SNP (rs2075818, rs2075822, rs2907748) haplotype, CTG (p = 0.004) and a decreased frequency of the GTG haplotype (p = 0.02).in CD. The rs2075822 CT or TT genotypes were at an increased frequency (genotype p value = 0.02), while the rs2907748 AA or AG genotypes showed decreased frequencies in UC (p = 0.04), but not in CD. Functional assays showed that Nod1 is produced 6 hours after bacterial invasion of the Caco2 cell line. Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population. PMID:19327158
Hamdy, Shaimaa; Osman, Ahmed M; Zakaria, Zainab A; Galal, Iman; Sobhy, Maha; Hashem, Mohamed; Allam, Walaa R; Abdel-Samiee, Mohamed; Rewisha, Eman; Waked, Imam; Abdelwahab, Sayed F
2018-06-02
Toll-like receptors (TLRs) give the innate immune system a considerable specificity for a large range of pathogens. TLR3 detects dsRNA of viruses while TLR9 recognizes bacterial and viral unmethylated CpG motifs. This study examined whether there is a potential association between single-nucleotide polymorphisms (SNPs) in the TLR3.rs3775290 (c.1377C/T), TLR9.rs5743836 (-1237T→C) and TLR9.rs352140 (G2848A) genes and HCV infection among Egyptian patients and healthcare workers (HCWs). We enrolled 546 subjects (409 HCWs and 137 patients) divided into four groups: group 1 included 265 seronegative, aviremic subjects; group 2 included 25 seronegative, viremic subjects; group 3 included 87 subjects with spontaneously resolved HCV infection; and group 4 included 169 chronic HCV patients. All subjects were genotyped for TLR3.rs3775290, TLR9.rs5743836 and TLR9.rs352140 SNPs by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis. TLR3.rs3775290 "CC" genotype was associated with chronic HCV infection, where there was a significantly greater frequency of this genotype among chronic patients when compared to subjects with spontaneously resolved infection (63.9% vs. 51.9%; p = 0.033; OR = 1.639 and 95% CI = 0.94-2.84). However, this SNP did not correlate with the HCV RNA load among the chronic subjects (p > 0.05). There was no significant difference in TLR9.rs5743836 and TLR9.rs352140 genotype distribution between groups (p > 0.05). Lack of association between the three SNPs was found, as the three SNPs are located on two different chromosomes. In conclusion, the TLR3.rs3775290 "CC" genotype was associated with HCV chronicity, while the TLR9 gene may not play a major role in HCV infection.
Zhang, Shuyan; Zhang, Donghui; Jiang, Yongshuai; Wu, Lina; Shang, Hong; Liu, Jiafeng; Feng, Rennan; Liao, Mingzhi; Zhang, Liangcai; Liu, Yong; Liu, Guiyou; Li, Keshen
2015-03-01
It is reported that CLU rs2279590 polymorphism is significantly associated with Alzheimer's disease (AD) in European ancestry. Recent studies investigated rs2279590 polymorphism in Asian population (Chinese, Japanese and Korean). Four studies showed negative association and two studies showed weak association between rs2279590 and AD. We believe that the weak association or no association may be caused by the relatively small sample size in Asian population. Here, we reinvestigated the association in Asian population. Meanwhile, to investigate the genetic heterogeneity of the rs2279590 polymorphism in Asian and Caucasian populations, we searched the PubMed and AlzGene databases and selected 11 independent studies (6 studies in Asian population and 5 studies in Caucasian population) including 20,655 individuals (8,605 cases and 12,050 controls) for meta-analysis. Our results showed significant association between rs2279590 polymorphism and AD in Asian population with P = 2.00E-04 and P = 2.00E-04 using additive and recessive models, respectively. We observed no significant heterogeneity between Asian and Caucasian populations. We believe that our results may be helpful to understand the mechanisms of CLU in AD pathogenesis and will be useful for future genetic studies in AD.
[Association of IL-1β-511T gene rs16944 polymorphism with febrile seizures].
Ren, Xiao-Tun; Sun, Su-Zhen; Liu, Fang; Wang, Xiao-Ming
2014-02-01
Despite substantial research efforts worldwide, the role of inflammatory cytokine IL-1β in the onset of febrile seizures (FS) remains controversial. The aim of this study was to assess the relationship between rs16944 polymorphism of the IL-1β-511T gene and occurrence of simple FS in a sample of Han children in northern China. The IL-1β-511T gene rs16944 was genotyped by SNaPshot SNP technique in 141 FS children and 130 healthy control subjects. The genotypic and allelic frequencies in the two groups were comparatively analyzed. There were no significant differences in genotypic and allelic frequencies of rs16944 polymorphism of the IL-1β-511T gene between FS patients and control subjects (P>0.05).When the clinical data on A/A, A/G and G/G genotypes of the rs16944 polymorphism in FS patients, there was statistically significant difference in age of first onset (χ(2)=19.491, P<0.01), temperature of first onset (χ(2)=9.317, P<0.05) and family history of FS (χ(2)=26.798, P<0.01). There is no association between rs16944 polymorphism of the IL-1β-511T gene and the incidence of FS in Han children in Northern China. However, the differences in genotypes of this polymorphism might be associated with pathogenesis and prognosis of simple FS in the population studied.
Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M
2015-05-01
Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2) > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2) = 0.859; rs765250, r (2) = 0.858; rs11064560, r (2) = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.
Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta
2017-07-01
The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon
2009-01-01
Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828
Polymorphism of MDM2 promoter 309 (rs 2279744) and the risk of PCOS.
Chan, Ying; Jiang, Hongguo; Yang, Xiaoling; Li, Dongya; Ma, Lan; Luo, Ying; Tang, Wenru
2016-01-01
This study aimed at evaluating possible association between MDM2 SNP309 polymorphism (rs 2279744) and polycystic ovary syndrome (PCOS). One hundred and twenty-five women with PCOS and two hundred and fifty women without PCOS were collected from the department of reproductive medicine of college hospital in this case-control study. Peripheral blood samples were collected from all participants and DNA was extracted, MDM2 SNP309 polymorphism (rs 2279744) was determined from the 125 cases and 250 controls. Women were grouped into PCOS (n = 125) group and control group (n = 250). Odds ratios (OR) and 95% confidence intervals (CI) were used to evaluate the association between MDM2 SNP309 polymorphism (rs 2279744) and PCOS. The distribution of T allele was significant higher in PCOS cases than controls. MDM2 SNP 309 T allele is associated with PCOS.
Wang, P; Dong, P; Yang, X
2016-10-31
Some studies investigated the association of antisense non-coding RNA in the INK4 locus (ANRIL) rs2383207 polymorphism with coronary artery disease (CAD) risk. However, the result was still inconsistent. The aim of this study was to investigate whether there is an association between the ANRIL rs2383207 polymorphism and CAD risk. We carried out a PubMed (Medline), EMBASE database search covering all published articles. The strength of association between ANRIL rs2383207 polymorphism and CAD risk was assessed by calculating OR with 95% CI. A total of 13 case-control studies involving 6796 cases and 9956 controls were included in this meta-analysis. ANRIL rs2383207polymorphism was associated with a significantly an increased risk of CAD (OR=1.47; 95%CI, 1.33-1.62). We also found that this polymorphism increased CAD risk in Caucasians (OR=1.51; 95%CI, 1.28-1.77) and Asians (OR=1.42; 95%CI, 1.26-1.61). In the subgroup analysis according to gender, both women and men were significantly associated with the increased risk of CAD (OR=1.36; 95%CI, 1.03-1.79 and OR=1.58; 95%CI, 1.20-2.09). In the subgroup analysis by age, ANRIL rs2383207 polymorphism showed significant results in old CAD patients and young CAD patients (OR=1.32; 95%CI, 1.20-1.44 and OR=1.53; 95%CI, 1.32-1.77). Furthermore, this polymorphism also influenced myocardial infarction risk (OR=1.75; 95%CI, 1.24-2.47). Even the studies with adjustment for age, gender, smoking were included, the significant association was also observed (OR=1.43; 95%CI, 1.26-1.62). In conclusion, this meta-analysis suggested that ANRIL rs2383207 polymorphism is associated with CAD risk.
Li, Su-Xia
2004-12-01
Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.
Rachakonda, Sivaramakrishna P; Penack, Olaf; Dietrich, Sascha; Blau, Olga; Blau, Igor Wolfgang; Radujkovic, Aleksandar; Isermann, Berend; Ho, Anthony D; Uharek, Lutz; Dreger, Peter; Kumar, Rajiv; Luft, Thomas
2014-10-20
Steroid-refractory graft-versus-host disease (GVHD) is a major and often fatal complication after allogeneic stem-cell transplantation (alloSCT). Although the pathophysiology of steroid refractoriness is not fully understood, evidence is accumulating that endothelial cell stress is involved, and endothelial thrombomodulin (THBD) plays a role in this process. Here we assess whether single-nucleotide polymorphisms (SNPs) within the THBD gene predict outcome after alloSCT. Seven SNPs within the THBD gene were studied (rs1962, rs1042579, rs1042580, rs3176123, rs3176124, rs3176126, and rs3176134) in a training cohort of 306 patients. The relevant genotypes were then validated in an independent cohort (n = 321). In the training cohort, an increased risk of nonrelapse mortality (NRM) was associated with three of seven SNPs tested: rs1962, rs1042579 (in linkage disequilibrium with rs3176123), and rs1042580. When patients were divided into risk groups (one v no high-risk SNP), a strong correlation with NRM was observed (hazard ratio [HR], 2.31; 95% CI, 1.36 to 3.95; P = .002). More specifically, NRM was predicted by THBD SNPs in patients who later developed GVHD (HR, 3.03; 95% CI, 1.61 to 5.68; P < .001) but not in patients without GVHD. In contrast, THBD SNPs did not predict incidence of acute GVHD. Multivariable analyses adjusting for clinical variables confirmed the independent effect of THBD SNPs on NRM. All findings could be reproduced in the validation cohort. THBD SNPs predict mortality of manifest GVHD but not the risk of acquiring GVHD, supporting the hypothesis that endothelial vulnerability contributes to GVHD refractoriness. © 2014 by American Society of Clinical Oncology.
High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling
Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven
2006-01-01
Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952
Piao, Wei; Wang, Li; Zhang, Ting; Wang, Zhen; Shangguan, Shaofang; Sun, Jing; Huo, Junsheng
2017-01-01
Associations between genetic variants in the hepcidin regulation pathway and iron status have been reported in previous studies. Most of these studies were conducted in populations of European descent and relatively few studies have been conducted in Chinese populations. In this study, we evaluated associations between single-nucleotide polymorphisms (SNPs) in the hepcidin regulation pathway, serum ferritin (SF) and soluble transferrin receptor (sTfR) in Chinese adolescents. In total, 692 students from rural boarding schools were selected from six cities in China. The participants were divided into case and control groups according to criteria for SF and sTfR. Furthermore, 33 SNPs in TMPRSS6, TF, TFR2, BMP2, BMP4, HJV, CYBRD1, HFE, IL6, PCSK7, HAMP, KIAA1468, and SRPRB were selected. Associations between the genetic variants and SF or sTfR were detected. For SF, rs4820268 in TMPRSS6 was associated with an SF <25 ng/mL status. Carriers of the G/G genotype of rs4820268 exhibited significantly lower SF levels than A allele carriers did (p=0.047). For sTfR, rs1880669 in TF, rs4901474 in BMP4, and rs7536827 in HJV were significantly associated with an sTfR >=4.4 mg/L status. However, in general linear model analysis, after adjustment for age, sex, and location, only rs1880669 exhibited a stable association with higher sTfR levels (p=0.032). We found rs4820268, in TMPRSS6 that was associated with a low SF level, as previously reported, and a new association between 1880669 in TF and sTfR.
Cancer protection elicited by a single nucleotide polymorphism close to the adrenomedullin gene.
Martínez-Herrero, Sonia; Martínez, Alfredo
2013-04-01
The risk of developing cancer is regulated by genetic variants, including polymorphisms. Characterizing such variants may help in developing protocols for personalized medicine. Adrenomedullin is a regulatory peptide involved in cancer promotion and progression. Carriers of a single nucleotide polymorphism (SNP) in the proximity of the adrenomedullin gene have lower levels of circulating peptide. The aim of the present work was to investigate whether carriers of this SNP (rs4910118) are protected against cancer. This was a retrospective study. DNA samples were obtained from the Carlos III DNA National Bank (University of Salamanca, Salamanca, Spain). Samples represent a variety of donors and patients from Spain. DNA from patients with breast cancer (n = 238), patients with lung cancer (n = 348), patients with cardiac insufficiency (n = 474), and healthy donors of advanced age (n = 500) was used. All samples were genotyped using double-mismatch PCR, and confirmation was achieved by direct sequencing. The minor allele frequency was calculated in all groups. The Pearson χ(2) was used to compare SNP frequencies. Of 1560 samples, 14 had the minor allele, with a minor allele frequency in healthy donors of 0.90%. Patients with cancer had a statistically significantly lower frequency than healthy donors (odds ratio = 0.216, 95% confidence interval = 0.048-0.967, P = .028). Carriers of the minor allele have a 4.6-fold lower risk of developing cancer than homozygotes for the major allele. Knowledge of the rs4910118 genotype may be useful for stratifying patients in clinical trials and for designing prevention strategies.
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.
Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E
2014-02-01
The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.
Huang, Qiong; Yin, Ji-Ye; Dai, Xing-Ping; Wu, Jing; Chen, Xiang; Deng, Cai-Shu; Yu, Min; Gong, Zhi-Cheng; Zhou, Hong-Hao; Liu, Zhao-Qian
2010-12-01
Genome-wide association studies (GWASs) identified that SLC30A8 genetic polymorphism was a risk of type 2 diabetes mellitus (T2DM) in several populations. This study aimed to investigate whether the SLC30A8 rs13266634 and rs16889462 polymorphisms were associated with T2DM susceptibility and repaglinide therapeutic efficacy in Chinese T2DM patients. We conducted a case-control study of 443 T2DM patients and 229 healthy volunteers to identify SLC30A8 rs13266634 and rs16889462 genotypes by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. Forty-eight patients were randomly selected and underwent an 8-week repaglinide treatment (3 mg/d). Fasting plasma glucose (FPG), postprandial plasma glucose (PPG), glycated hemoglobin (HbAlc), fasting serum insulin (FINS), postprandial serum insulin (PINS), homeostasis model assessment for insulin resistance (HOMA-IR), serum triglyceride, total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-c) and high-density lipoprotein-cholesterol (HDL-c) were determined before and after repaglinide treatment. SLC30A8 rs13266634 risk C allele frequency was higher in T2DM patients than in healthy controls (P < 0.05). There was a better repaglinide response on FINS (P < 0.05) and PINS (P < 0.01) in patients with rs13266634 CT+TT genotypes compared with CC genotype carriers. Patients with rs16889462 GA genotype showed an enhanced repaglinide efficacy on FPG (P < 0.01), PPG (P < 0.01) and HbAlc (P < 0.05) compared with GG genotype individuals. SLC30A8 rs13266634 and rs16889462 polymorphisms were associated with repaglinide therapeutic efficacy in Chinese T2DM patients.
Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda
2018-01-01
Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695
Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda
2018-01-01
Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.
Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; Rueda-Medina, Blanca
2017-11-01
The aim of the present study was to investigate the possible influence of low-density lipoprotein receptor-related protein 5 (LRP5) and sclerostin (SOST) genes as genetic factors contributing to calcaneal quantitative ultrasound (QUS) and body composition variables in a population of young Caucasian adults. The study population comprised a total of 575 individuals (mean age 20.41years; SD 2.36) whose bone mass was assessed through QUS to determine broadband ultrasound attenuation (BUA, dB/MHz). Body composition measurements were performed using a body composition analyser. Seven single-nucleotide polymorphisms (SNPs) of LRP5 (rs2306862, rs599083, rs556442 and rs3736228) and SOST (rs4792909, rs851054 and rs2023794) were selected as genetic markers and genotyped using TaqMan OpenArray ® technology. Linear regression analysis was used to test the possible association of the tested SNPs with QUS and body composition parameters. Linear regression analysis revealed that the rs3736228 SNP of LPR5 was significantly associated with BUA after adjustment for age, sex, weight, height, physical activity and calcium intake (P = 0.028, β (95% CI) = 0.089 (0.099-1.691). For the remaining SNPs, no significant association with the QUS measurement was observed. Regarding body composition, no significant association was found between LRP5 and SOST polymorphisms and body mass index, total fat mass and total lean mass after adjustment for age and sex as covariates. We concluded that the rs3736228 LRP5 genetic polymorphism influences calcaneal QUS parameter in a population of young Caucasian adults. This finding suggests that LRP5 might be an important genetic marker contributing to bone mass accrual early in life.
Ni, Jianfeng; Shen, Nan; Tang, Jilei; Ren, Kewei
2017-01-01
A single nucleotide polymorphism (SNP) of the protein kinase catalytic subunit alpha-1 gene (PRKAA1) that confers susceptibility to gastric cancer (GC) was identified by genome-wide association in several case-control studies. However, the results remained controversial and ambiguous. Therefore, we performed a larger meta-analysis to confirm this association. We searched the PubMed, Embase, WanFang, and CNKI databases, without any restriction on language, covering all papers published until Feb 22, 2017. Overall, 14 case-control studies with 14,485 cases and 14,792 controls were retrieved based on the search criteria. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to quantify the strength of the association. Publication bias was assessed by Egger’s and Begg’s tests. We found that the PRKAA1 rs13361707 C/T polymorphism had no association with GC risk in any of the pooled genetic models (for example, the T-allele vs. C-allele allelic contrast model yielded the following estimates: OR = 0.87, 95% CI = 0.73–1.05, Pheterogeneity = 0.000). Furthermore, in analyses stratified by either source of control or geographical origin of subjects, a statistically significant inverse relationship was detected between PRKAA1 rs13361707 C/T polymorphism and GC risk. No obvious evidence of publication bias was detected in the pooled meta-analysis. Furthermore, we observed that individuals carrying T-allele (TT or TC) genotypes had a lower expression of PRKAA1. Our present study indicated that PRKAA1 rs13361707 C/T was not significantly associated with GC risk, despite few positive results in the subgroups. PMID:28978122
Suarez-Kurtz, Guilherme; Fuchshuber-Moraes, Mateus; Struchiner, Claudio J; Parra, Esteban J
2016-08-01
Several algorithms have been proposed to reduce the genotyping effort and cost, while retaining the accuracy of N-acetyltransferase-2 (NAT2) phenotype prediction. Data from the 1000 Genomes (1KG) project and an admixed cohort of Black Brazilians were used to assess the accuracy of NAT2 phenotype prediction using algorithms based on paired single nucleotide polymorphisms (SNPs) (rs1041983 and rs1801280) or a tag SNP (rs1495741). NAT2 haplotypes comprising SNPs rs1801279, rs1041983, rs1801280, rs1799929, rs1799930, rs1208 and rs1799931 were assigned according to the arylamine N-acetyltransferases database. Contingency tables were used to visualize the agreement between the NAT2 acetylator phenotypes on the basis of these haplotypes versus phenotypes inferred by the prediction algorithms. The paired and tag SNP algorithms provided more than 96% agreement with the 7-SNP derived phenotypes in Europeans, East Asians, South Asians and Admixed Americans, but discordance of phenotype prediction occurred in 30.2 and 24.8% 1KG Africans and in 14.4 and 18.6% Black Brazilians, respectively. Paired SNP panel misclassification occurs in carriers of NATs haplotypes *13A (282T alone), *12B (282T and 803G), *6B (590A alone) and *14A (191A alone), whereas haplotype *14, defined by the 191A allele, is the major culprit of misclassification by the tag allele. Both the paired SNP and the tag SNP algorithms may be used, with economy of scale, to infer NAT2 acetylator phenotypes, including the ultra-slow phenotype, in European, East Asian, South Asian and American populations represented in the 1KG cohort. Both algorithms, however, perform poorly in populations of predominant African descent, including admixed African-Americans, African Caribbeans and Black Brazilians.
Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae
2014-04-01
Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.
Valdivieso, Paola; Toigo, Marco; Hoppeler, Hans; Flück, Martin
2017-01-01
Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise.
Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin
2011-05-01
Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.
Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre
2011-01-01
Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816
Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui
2018-01-01
Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352
He, Dengming; Tao, Shiqi; Guo, Shimin; Li, Maoshi; Wu, Junqiu; Huang, Hongfei; Guo, Xinwu; Yan, Guohua; Zhu, Peng; Wang, Yuming
2015-08-01
The toll-like receptor-interferon (TLR-IFN) signalling pathway plays a crucial role in HBV infection. Human leucocyte antigen (HLA) polymorphisms are associated with chronic HBV infection by genome wide association study (GWAS). We aimed to explore interaction between TLR-IFN and HLA gene polymorphisms in susceptibility of chronic HBV infection. In the Chinese Southwest Han population, 1191 chronic HBV infection patients and 273 HBV clearance were selected. A total of 39 single nucleotide polymorphism loci in 23 genes of the TLR-IFN pathway and four HLA polymorphism loci associated with chronic HBV infection identified by GWAS were selected for genotyping. SNPStats, QVALUE, and multifactor dimensionality reduction were used for statistical analysis. A significant association was seen in several of the TLR-IFN pathway genes, TLR9 rs352140 (OR = 0.70, P = 0.0088), IL1B rs16944 (OR = 0.67, P = 0.016), IL12B rs3212227 (OR = 1.38, P = 0.021), IFNGR1 rs3799488 (OR = 1.48, P = 0.0048), IFNGR2 rs1059293 (OR = 0.27, P = 0.011), MX1 rs467960 (OR = 0.68, P = 0.022), as well as four loci in HLA, rs3077 (OR = 0.55, P < 0.0001), rs2856718 (OR = 0.60, P = 4e-04), rs9277535 (OR = 0.54, P < 0.0001) and rs7453920 (OR = 0.43, P < 0.0001). A synergistic relationship was seen between rs9277535 and rs16944 (0.13%), rs1143623 and rs6613 (0.10%). The combination of rs9277535 in HLA and rs16944 in IL1B was the best model to predict chronic HBV infection (testing accuracy = 0.6040, P = 0.0010, cross-validation consistency = 10/10). TLR-IFN pathway gene polymorphisms are associated with chronic HBV infection. Interactions with polymorphisms in these genes may be one mechanism by which HLA polymorphisms influence susceptibility to chronic HBV infection, as specific single nucleotide polymorphism combinations are highly predictive of chronic HBV infection. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.
Tejedor, J. Ramón; Tilgner, Hagen; Iannone, Camilla; Guigó, Roderic; Valcárcel, Juan
2015-01-01
The OLR1 gene encodes the oxidized low-density lipoprotein receptor (LOX-1), which is responsible for the cellular uptake of oxidized LDL (Ox-LDL), foam cell formation in atheroma plaques and atherosclerotic plaque rupture. Alternative splicing (AS) of OLR1 exon 5 generates two protein isoforms with antagonistic functions in Ox-LDL uptake. Previous work identified six single nucleotide polymorphisms (SNPs) in linkage disequilibrium that influence the inclusion levels of OLR1 exon 5 and correlate with the risk of cardiovascular disease. Here we use minigenes to recapitulate the effects of two allelic series (Low- and High-Risk) on OLR1 AS and identify one SNP in intron 4 (rs3736234) as the main contributor to the differences in exon 5 inclusion, while the other SNPs in the allelic series attenuate the drastic effects of this key SNP. Bioinformatic, proteomic, mutational and functional high-throughput analyses allowed us to define regulatory sequence motifs and identify SR protein family members (SRSF1, SRSF2) and HMGA1 as factors involved in the regulation of OLR1 AS. Our results suggest that antagonism between SRSF1 and SRSF2/HMGA1, and differential recognition of their regulatory motifs depending on the identity of the rs3736234 polymorphism, influence OLR1 exon 5 inclusion and the efficiency of Ox-LDL uptake, with potential implications for atherosclerosis and coronary disease. PMID:25904137
Single nucleotide polymorphisms related to cystic fibrosis in chronic rhinositus-a pilot study.
Hull, Benjamin P; Jiramongkolchai, Pawina; Turner, Justin H; Olson, Lana; Chandra, Rakesh K
2017-05-01
The clinical association between cystic fibrosis (CF) and chronic rhinosinusitis (CRS) is well known. Studies have identified several non-CF transmembrane conductance regulator single nucleotide polymorphisms (SNPs) associated with disease severity in CF patients. We hypothesized that prevalence of these SNPs would be different between CRS patients and age/gender-matched non-CRS controls. This is a targeted SNP study of 1231 CRS patients identified through a large university hospital database who were compared with 8796 age- and gender-matched controls without a history of rhinitis, sinusitis, allergies, or asthma. Prevalence of 5 relevant SNPs was compared between groups, with p < 0.05 considered significant. Stratification by race and gender was performed among groups when statistically appropriate. CRS patients exhibited a statistically significant (p = 0.036) lower prevalence of rs12883884 (associated with an ion transporter) compared with controls. This association was lost when patients were stratified by race. CRS patients manifested a greater prevalence of rs1403543 (chromosome 23) in both Caucasian and African American subgroups (p = 0.036 and p = 0.026, respectively). Statistical significance disappeared among Caucasians when stratified by gender, but persisted among African American women (p = 0.047). rs12188164 and rs12793173 were both more prevalent in African Americans with CRS than controls (p = 0.042 and p = 0.020, respectively). A trend was also observed for decreased prevalence of rs12883884 in CRS patients compared with controls in the African American subgroup (p = 0.086). The identified SNPs were differentially prevalent in CRS compared with control groups, with some variability as a function of race and gender. Further research is required to confirm these findings and elucidate clinical significance. © 2017 ARS-AAOA, LLC.
Li, You; Liang, Guiyun; Shi, Liwei; Liang, Xue; Long, Bingshuang; Qin, Jian; Zhang, Zhiyong
2016-12-27
BACKGROUND The present study was performed to identify the association of PON1 rs662 polymorphism with serum lipid levels and human longevity in the Bama Zhuang population. MATERIAL AND METHODS PON1 genotypes were determined by Taqman SNP Genotyping Assays in 110 long-lived inhabitants (longevity group, aged 90-110 years), 110 healthy inhabitants in Bama County (control 1 group, aged 43-82 years) and 110 healthy inhabitants in Nandan County (control 2 group, aged 28-82 years) without family history of longevity. RESULTS BMI (body mass index) and TG (serum total triglyceride) level were lower in the longevity group than in the two control groups, while the contents of serum LDL-c (low-density lipoprotein cholesterol) and HDL-c (high-density lipoprotein cholesterol) and the levels of SBP (systolic blood pressure) and DBP (diastolic blood pressure) in the longevity group were higher than in the two control groups (p<0.01). Significant differences in the frequencies of three genotypes (GG, AG, and AA) were observed between the longevity group and control 2 group (χ²=15.190, p=0.001). The minor allele frequency (MAF) of rs662 was significantly higher in the longevity group than in the two control groups. The levels of HDL-c in the longevity group were different among the three genotypes (p<0.05). The levels of TG for GG and GG+AG genotypes were significantly different, while the levels of TC (total cholesterol) and HDL-c for AG and GG+AG genotypes were significantly different among the three groups (p<0.05). Serum lipid parameters were correlated with several environmental factors, including age, gender, DBP, SBP, and BMI. The association of PON1 rs662 polymorphism and serum lipid levels was different among the three groups. CONCLUSIONS PON1 polymorphism might be one of the genetic factors of longevity in the Bama Zhuang population. The PON1 rs662 SNP (single nucleotide polymorphism) was associated with serum HDL-c levels in the longevity group.
Sundqvist, J; Xu, H; Vodolazkaia, A; Fassbender, A; Kyama, C; Bokor, A; Gemzell-Danielsson, K; D'Hooghe, T M; Falconer, H
2013-03-01
Is it possible to replicate the previously identified genetic association of four single-nucleotide polymorphisms (SNPs), rs12700667, rs7798431, rs1250248 and rs7521902, with endometriosis in a Caucasian population? A borderline association was observed for rs1250248 and endometriosis (P = 0.049). However, we could not replicate the other previously identified endometriosis-associated SNPs (rs12700667, rs7798431 and rs7521902) in the same population. Endometriosis is considered a complex disease, influenced by several genetic and environmental factors, as well as interactions between them. Previous studies have found genetic associations with endometriosis for SNPs at the 7p15 and 2q35 loci in a Caucasian population. Allele frequencies of SNPs were investigated in patients with endometriosis and controls. Blood samples and peritoneal biopsies were taken from a Caucasian female population consisting of 1129 patients with endometriosis and 831 controls. DNA was extracted for genotyping. The study was performed at a University hospital and research laboratories. A weak association with endometriosis (all stages) was observed for rs1250248 (P = 0.049). No significant associations were observed for the SNPs rs12700667, rs7798431 and rs7521902. A non-significant trend towards the association of rs1250248 with moderate/severe endometriosis was observed (odds ratio 1.18, 95% confidence interval 0.97-1.44). The inability to confirm all previous findings may result from differences between populations and type II errors. Our result demonstrates the difficulty of identifying common genetic variants in complex diseases. This study was supported by grants from the Karolinska Institutet and Stockholm City County/Karolinska Institutet (ALF), Stockholm, Sweden, Swedish Medical Research Council (K2007-54X-14212-06-3, K2010-54X-14212-09-3), Stockholm, Sweden, Leuven University Research Council (Onderzoeksraad KU Leuven), the Leuven University Hospitals Clinical Research Foundation
Jenkins, Aaron; Apud, José A; Zhang, Fengyu; Decot, Heather; Weinberger, Daniel R; Law, Amanda J
2014-01-01
Neurexins are presynaptic neuronal adhesion molecules that interact with postsynaptic neuroligins to form an inter-synaptic complex required for synaptic specification and efficient neurotransmission. Deletions and point mutations in the neurexin 1 (NRXN1) gene are associated with a broad spectrum of neuropsychiatric and neurodevelopmental disorders, including autism, intellectual disability, epilepsy, developmental delay, and schizophrenia. Recently, small nucleotide polymorphisms in NRXN1 have been associated with antipsychotic drug response in patients with schizophrenia. Based on previous suggestive evidence of an impact on clozapine response in patients with schizophrenia, we conducted an association study of NRXN1 polymorphisms (rs12467557 and rs10490162) with antipsychotic treatment response in 54 patients with schizophrenia in a double blind, placebo-controlled NIMH inpatient crossover trial and examined for association with risk for schizophrenia in independent case-control and family-based clinical cohorts. Pharmacogenetic analysis in the placebo controlled trial revealed significant association of rs12467557and rs10490162 with drug response, whereby individuals homozygous for the A allele, at either SNP, showed significant improvement in positive symptoms, general psychopathology, thought disturbance, and negative symptoms, whereas patients carrying the G allele showed no overall response. Although we did not find evidence of the same NRXN1 SNPs being associated with results of the NIMH sponsored CATIE trial, other SNPs showed weakly positive signals. The family and case-control analyses for schizophrenia risk were negative. Our results provide confirmatory evidence of genetically determined differences in drug response in patients with schizophrenia related to NRXN1 variation. Furthermore, these findings potentially implicate NRXN1 in the therapeutic actions of antipsychotic drugs. PMID:24633560
Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.
Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei
2016-01-01
Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.
Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric
2008-01-01
Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p
D'Souza, Wendy; Pradhan, Sultan; Saranath, Dhananjaya
2017-08-01
Oral cancer has a high incidence primarily because of tobacco chewing habits. However, a small proportion of habitués develop oral cancer, implying a role for genomic variants in its susceptibility. Thirteen single nucleotide polymorphisms (SNPs) in an Indian cohort comprising patients with oral cancer (n = 500) and healthy controls (n = 500) were genotyped using allelic discrimination real-time polymerase chain reaction (PCR). Prevalence of SNPs rs11130760, rs1957358, rs2306058, rs4883543, rs12637722, rs1457115, rs2353292, rs709821, rs2194861, rs4789378, rs3827538, rs2667552, and rs2886093 was determined in the Indian cohort. A significant association of rs11130760 GG (odds ratio [OR] 1.41; 95% confidence interval [CI] 1.08-1.84) and rs1957358 TT (OR 1.44; 95% CI 1.10-1.90) indicated increased risk; whereas rs1957358 TC (OR 0.67; 95% CI 0.53-0.87) and rs2306058 CT (OR 0.72; 95% CI 0.56-0.93) reflected decreased risk. The SNP rs11130760 wild-type (WT) allele G indicated an increased risk for oral cancer (OR 1.38; 95% CI 1.09-1.73), whereas SNP allele T indicated a decreased risk (OR 0.73; 95% CI 0.58-0.92) for oral cancer. Our study identified SNPs with susceptibility to oral cancer in high-risk populations. © 2017 Wiley Periodicals, Inc.
Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R
2018-05-03
Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.
Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K
2017-09-01
OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui
2011-07-15
Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP
Valdez-Haro, A; Valle, Y; Valdes-Alvarado, E; Casillas-Muñoz, F; Muñoz-Valle, J F; Reynoso-Villalpando, G L; Flores-Salinas, H E; Padilla-Gutiérrez, J R
2017-09-27
Acute coronary syndrome (ACS) is considered one of the main causes of death worldwide. Contradictory findings concerning the impact of the angiotensin-converting enzyme (ACE) gene on cardiovascular diseases have been reported. Previous conclusions point out that the variability in results depends on ethnicity and genetic polymorphisms to determine the association of rs4340 polymorphisms of the ACE gene and ACE circulating levels in ACS. Genotyping of rs4340 polymorphisms was performed in a total of 600 individuals from Western Mexico divided into two groups: the ACS and the control group (CG). The polymorphisms were identified by polymerase chain reaction. Serum ACE concentration was determined by enzyme-linked immunosorbent assay. D/D carriers had higher ACE levels than I/I carriers (3.6 vs 2.8 ng/mL, P < 0.0021) in the CG. The D/D genotype of the rs4340 polymorphism is associated with higher ACE concentration levels; however, the polymorphism was not associated with ACS.
Face and emotion expression processing and the serotonin transporter polymorphism 5-HTTLPR/rs22531.
Hildebrandt, A; Kiy, A; Reuter, M; Sommer, W; Wilhelm, O
2016-06-01
Face cognition, including face identity and facial expression processing, is a crucial component of socio-emotional abilities, characterizing humans as highest developed social beings. However, for these trait domains molecular genetic studies investigating gene-behavior associations based on well-founded phenotype definitions are still rare. We examined the relationship between 5-HTTLPR/rs25531 polymorphisms - related to serotonin-reuptake - and the ability to perceive and recognize faces and emotional expressions in human faces. For this aim we conducted structural equation modeling on data from 230 young adults, obtained by using a comprehensive, multivariate task battery with maximal effort tasks. By additionally modeling fluid intelligence and immediate and delayed memory factors, we aimed to address the discriminant relationships of the 5-HTTLPR/rs25531 polymorphisms with socio-emotional abilities. We found a robust association between the 5-HTTLPR/rs25531 polymorphism and facial emotion perception. Carriers of two long (L) alleles outperformed carriers of one or two S alleles. Weaker associations were present for face identity perception and memory for emotional facial expressions. There was no association between the 5-HTTLPR/rs25531 polymorphism and non-social abilities, demonstrating discriminant validity of the relationships. We discuss the implications and possible neural mechanisms underlying these novel findings. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Wang, Yong; Ma, Teng; Zhu, Yin-Sheng; Chu, Xue-Feng; Yao, Shun; Wang, Hong-Fei; Cai, Jian; Wang, Xiao-Feng; Jiang, Xiao-Yan
2017-07-01
To examine the associations between genetic variants of KSR2 (kinase suppressor of RAS)-rs7973260, RAPGEF6 (guanine nucleotide exchange factor 6)-rs3756290, LOC105377703-rs4481363, and subjective well-being (SWB) and depressive symptoms (DSs) in Chinese elders, which were recently associated in a genome-wide association study conducted in Caucasians. The pleiotropic effects of KSR2-rs7973260 on metabolic phenotypes were also explored. We used data from 1788 older individuals aged 70-84 years from the aging arm of the Rugao Longevity and Aging Study, a population-based cohort study conducted in the Jiangsu province of China. No significant distributions of genotype frequencies were observed between life-satisfied and -unsatisfied groups across those with the three polymorphisms. The level of SWB components (positive affect, negative affect, and affect balance) and DSs did not differ among genotypes of the three variants. However, the presence of GA+AA of KSR2-rs7973260 was significantly higher in the metabolic syndrome (MetS), severe hypertriglyceridemia (HTG), and diabetes groups than in control groups (43.7% vs. 37.6%, 46.4% vs. 37.6%, 45.8% vs. 37.9%, respectively). The A allele of rs7973260 was associated with increased risk of MetS, severe HTG, and diabetes with an odds ratios (95% confidence intervals) of 1.289 (1.002-1.658), 1.438 (1.076-1.921), and 1.384 (1.022-1.875), which remained significant after multiple adjustments. Rs7973260, rs3756290, and rs4481363 were not associated with SWB and DSs in Chinese elders. However, the KSR2-rs7973260 A allele exhibited pleiotropic effects on some metabolic phenotypes in Chinese elders. These effects should be validated in future studies.
Tanaka, Keiko; Arakawa, Masashi
2014-01-01
Epidemiological evidence on the relationship between single-nucleotide polymorphisms (SNPs) rs7216389 and rs11650680 on chromosome 17q12-21 and asthma is inconsistent. We examined this issue in young adult Japanese women. Case subjects were 202 women who had been diagnosed with asthma by a doctor, while 1290 women without doctor-diagnosed asthma served as control subjects. Adjustments were made for age and the presence of older siblings. There were no significant associations between SNP rs7216389 and asthma. Compared with the CC genotype of SNP rs11650680, the CT genotype, but not the TT genotype, was significantly inversely associated with asthma: the adjusted odds ratio for the CT genotype was 0.67 (95% confidence interval: 0.46–0.96). This inverse relationship was significant in women with late-onset asthma, but not in those with early-onset asthma. Under the dominant model, a significant inverse association was found between rs11650680 and asthma in women without older siblings, but not in those with older siblings; the interaction, however, was not significant. This is the first study to show that the CT genotype of SNP rs11650680 was significantly inversely associated with asthma, especially adult-onset asthma. We could not find evidence for interactions between rs11650680 and older siblings affecting asthma. PMID:24735179
Interleukin-1β rs1143627 polymorphism with susceptibility to periodontal disease
Huang, Wei; He, Bing-Yang; Shao, Jun; Jia, Xiao-Wei; Yuan, Ya-Di
2017-01-01
Association between interleukin-1 beta (IL-1β) rs1143627 polymorphism and periodontal disease susceptibility was inconsistent; hence we performed this meta-analysis to explore the precise correlation between them. The degree of association was appraised through calculating pooled odds ratio (OR) and its 95% confidence interval (CI). The databases known as PubMed, Embase, and Chinese National Knowledge Infrastructure were searched up to October 26, 2016. A total of 8 eligible case-control studies were finally included, which involved 229 aggressive periodontitis patients, 382 chronic periodontitis patients, and 555 healthy controls. All the five genetic models revealed a non-significant association between IL-1β rs1143627 polymorphism and periodontal disease susceptibility (TT vs. CC: OR = 1.22, 95% CI = 0.80-1.87; CT+TT vs. CC: OR = 0.66, 95% CI = 0.44-1.01; TT vs. CT + CC: OR = 1.19, 95% CI = 0.81-1.74; T vs. C: OR = 0.92, 95% CI = 0.81-1.12; CT vs. CC: OR = 0.92, 95% CI = 0.69-1.23). Sensitivity analyses indicated that the results were robust and the subgroup analyses reached similar conclusions. IL-1β rs1143627 polymorphism is not related to periodontal disease susceptibility in the overall population based on the current evidence, but further studies are required in more large scale sample size with risk factor adjusted. PMID:28404906
Ramus, Sara Mankoc; Cilensek, Ines; Petrovic, Mojca Globocnik; Soucek, Miroslav; Kruzliak, Peter; Petrovic, Daniel
2016-03-01
Oxidative stress plays an important role in the pathogenesis of diabetes and its complications. The aim of this study was to examine the possible association between seven single nucleotide polymorphisms (SNPs) of the Trx2/TXNIP and TrxR2 genes encoding proteins involved in the thioredoxin antioxidant defence system and the risk of diabetic retinopthy (DR). Cross-sectional case-control study. A total of 802 Slovenian patients with Type 2 diabetes mellitus; 277 patients with DR and 525 with no DR were enrolled. Patients genotypes of the SNPs; including rs8140110, rs7211, rs7212, rs4755, rs1548357, rs4485648 and rs5748469 were determined by the competitive allele specific PCR method. Each genotype of examined SNPs was regressed in a logistic model, assuming the co-dominant, dominant and the recessive models of inheritance with covariates of duration of diabetes, HbA1c, insulin therapy, total cholesterol and LDL cholesterol levels. In the present study, for the first time we identified an association between the rs4485648 polymorphism of the TrxR2 gene and DR in Caucasians with Type 2 DM. The estimated ORs of adjusted logistic regression models were found to be as follows: 4.4 for CT heterozygotes, 4.3 for TT homozygotes (co-dominant genetic model) and 4.4 for CT+TT genotypes (dominant genetic model). In our case-control study we were not able to demonstrate any association between rs8140110, rs7211, rs7212, rs4755, rs1548357, and rs5748469 and DR, however, our findings provide evidence that the rs4485648 polymorphism of the TrxR2 gene might exert an independent effect on the development of DR. Copyright © 2016 Elsevier Inc. All rights reserved.
Toigo, Marco; Hoppeler, Hans
2017-01-01
Background Mechanical stress, including blood pressure related factors, up-regulate expression of the pro-angiogenic extracellular matrix protein tenascin-C in skeletal muscle. We hypothesized that increased capillarization of skeletal muscle with the repeated augmentation in perfusion during endurance training is associated with blood vessel-related expression of tenascin-C and would be affected by the single-nucleotide polymorphism (SNP) rs2104772, which characterizes the non-synonymous exchange of thymidine (T)-to-adenosine (A) in the amino acid codon 1677 of tenascin-C. Methods Sixty-one healthy, untrained, male white participants of Swiss descent performed thirty 30-min bouts of endurance exercise on consecutive weekdays using a cycling ergometer. Genotype and training interactions were called significant at Bonferroni-corrected p-value of 5% (repeated measures ANOVA). Results Endurance training increased capillary-to-fiber-ratio (+11%), capillary density (+7%), and mitochondrial volume density (+30%) in m. vastus lateralis. Tenascin-C protein expression in this muscle was confined to arterioles and venules (80% of cases) and increased after training in A-allele carriers. Prior to training, volume densities of subsarcolemmal and myofibrillar mitochondria in m. vastus lateralis muscle were 49% and 18%, respectively, higher in A/A homozygotes relative to T-nucleotide carriers (A/T and T/T). Training specifically increased capillary-to-fiber ratio in A-nucleotide carriers but not in T/T homozygotes. Genotype specific regulation of angiogenesis was reflected by the expression response of 8 angiogenesis-associated transcripts after exercise, and confirmed by training-induced alterations of the shear stress related factors, vimentin and VEGF A. Conclusion Our findings provide evidence for a negative influence of T/T homozygosity in rs2104772 on capillary remodeling with endurance exercise. PMID:28384286
HOTAIR gene polymorphisms contribute to increased neuroblastoma susceptibility in Chinese children.
Yang, Xu; He, Jing; Chang, Yitian; Luo, Annie; Luo, Ailing; Zhang, Jiao; Zhang, Ruizhong; Xia, Huimin; Xu, Ling
2018-06-15
Neuroblastoma is the most frequently diagnosed extracranial solid tumor in children. Previous studies have shown that single-nucleotide polymorphisms in some genes are associated with the risk of multiple cancers, including neuroblastoma. Although Hox transcript antisense intergenic RNA (HOTAIR) gene polymorphisms have been investigated in a variety of cancers, to the authors' knowledge the relationships between HOTAIR gene polymorphisms and neuroblastoma susceptibility have not been reported to date. The objective of the current study was to evaluate the correlation between HOTAIR gene polymorphisms and neuroblastoma risk in Chinese children. The authors genotyped 6 polymorphisms (rs920778 A>G, rs12826786 C>T, rs4759314 A>G, rs7958904 G>C, rs874945 C>T, and rs1899663 C>A) of the HOTAIR gene in 2 Chinese populations including 393 neuroblastoma cases and 812 healthy controls. The strength of the associations was evaluated using odds ratios and 95% confidence intervals. Further stratification analyses were conducted to explore the association between the HOTAIR gene polymorphisms rs12826786 C>T, rs874945 C>T, and rs1899663 C>A with neuroblastoma susceptibility in terms of age, sex, clinical stage of disease, and sites of origin. The authors found that the rs12826786 C>T (P =.013), rs874945 C>T (P =.020), and rs1899663 C>A (P =.029) polymorphisms were significantly associated with increased neuroblastoma risk. In stratification analyses, these associations were more predominant in females and among patients with tumor in the retroperitoneal region or mediastinum. The remaining 3 polymorphisms were not found to be related to neuroblastoma susceptibility. The results of the current study verified that HOTAIR gene polymorphisms are associated with increased neuroblastoma risk and suggest that HOTAIR gene polymorphisms might be a potential biomarker for neuroblastoma susceptibility. Cancer 2018;124:2599-606. © 2018 American Cancer Society. © 2018 American Cancer Society.
Peng, Qiliu; Yang, Shi; Lao, Xianjun; Li, Ruolin; Chen, Zhiping; Wang, Jian; Qin, Xue; Li, Shan
2014-01-01
Polymorphisms of genes encoding components of the vitamin D pathway including vitamin D receptor (VDR) and vitamin D binding protein (DBP) have been widely investigated because of the complex role played by vitamin D in cancer tumorogenesis. In this study, we investigated the association between VDR and DBP gene polymorphisms and HBV-related HCC risk in a Chinese population. Study subjects were divided into three groups: 184 HBV patients with HCC, 296 HBV patients without HCC, and 180 healthy controls. The VDR rs2228570, and rs3782905 and the DBP rs7041 polymorphisms were genotyped using PCR-RFLP and the VDR rs11568820 polymorphism was genotyped by PCR-SSP, respectively. DNA sequencing was performed to validate the genotype results. We found that there were significant differences in the genotype and allele frequencies of the VDR rs2228570 and DBP rs7041 polymorphisms between HBV patients with HCC and healthy controls. The rs2228570 T allele was associated with a significant increased HBV-related HCC risk as compared with the C allele. The rs2228570 TT and TT/TC genotypes were correlated with a significant increased HBV-related HCC risk when compared with the wild-type CC homozygote. Similarly, the rs7041 G allele was associated with a significant increased HBV-related HCC risk as compared with the T allele. The rs7041 GG and GG/TG genotypes were correlated with a significant increased HBV-related HCC risk when compared with the wild-type TT homozygote. However, we did not observe any significant effect of VDR rs11568820, and rs3782905 polymorphisms on HBV-related HCC risk in this population. In haplotype analysis, we also did not find any significant differences in haplotype frequencies of the VDR gene between HBV patients with HCC and the healthy controls. We conclude that the VDR rs2228570 and DBP rs7041 polymorphisms may contribute to increased susceptibility to HBV-related HCC in the Chinese population. Due to the marginal significance, further large and well
Fateh, Abolfazl; Aghasadeghi, Mohammad Reza; Keyvani, Hossein; Mollaie, Hamid Reza; Yari, Shamsi; Hadizade Tasbiti, Ali Reza; Ghazanfari, Morteza; Monavari, Seyed Hamid Reza
2015-01-01
A recent genome-wide association study (GWAS) on patients with chronic hepatitis C (CHC) treated with peginterferon and ribavirin (pegIFN-α/RBV) identified a single nucleotide polymorphism (SNP) on chromosome 19 (rs12979860) which was strongly associated with a sustained virological response (SVR). The aim of this study was twofold: to study the relationship between IL28B rs12979860 and sustained virological response (SVR) to pegIFN-α/RVB therapy among CHC patients and to detect the rs12979860 polymorphism by high resolution melting curve (HRM) assay as a simple, fast, sensitive, and inexpensive method. The study examined outcomes in 100 patients with chronic hepatitis C in 2 provinces of Iran from December 2011 to June 2013. Two methods were applied to detect IL28B polymorphisms: PCR-sequencing as a gold standard method and HRM as a simple, fast, sensitive, and inexpensive method. The frequencies of IL28B rs12979860 CC, CT, and TT alleles in chronic hepatitis C genotype 1a patients were 10% (10/100), 35% (35/100), and 6% (6/100) and in genotype 3a were 13% (13/100), 31% (31/100), and 5% (5/100), respectively. In genotype 3a infected patients, rs12979860 (CC and CT alleles) and in genotype 1a infected patients (CC allele) were significantly associated with a sustained virological response (SVR). The SVR rates for CC, CT and TT (IL28B rs12979860) were 18%, 34% and 4%, respectively. Multiple logistic regression analysis identified two independent factors that were significantly associated with SVR: IL-28B genotype (rs 12979860 CC vs TT and CT; odds ratio [ORs], 7.86 and 4.084, respectively), and HCV subtype 1a (OR, 7.46). In the present study, an association between SVR rates and IL28B polymorphisms was observed. The HRM assay described herein is rapid, inexpensive, sensitive and accurate for detecting rs12979860 alleles in CHC patients. This method can be readily adopted by any molecular diagnostic laboratory with HRM capability and will be clinically beneficial
Trang, Nguyen Thi; Huyen, Vu Thi; Tuan, Nguyen Thanh; Phan, Tran Duc
2018-04-25
N-acetyltransferase-2 (NAT2) and Glutathione S-transferases (GSTs) are phase-II xenobiotic metabolizing enzymes participating in detoxification of toxic arylamines, aromatic amines, hydrazines and reactive oxygen species (ROS), which are produced under oxidative and electrophile stresses. The purpose of this research was to investigate whether two common single-nucleotide polymorphisms (SNP) of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) associated with susceptibility to idiopathic male infertility. A total 300 DNA samples (150 infertile patients and 150 healthy control) were genotyped for the polymorphisms by ARMS - PCR. We revealed a significant association between the NAT2 variant genotypes (CT + TT (rs1799929), (OR: 3.74; p < 0.001)) and (GA + AA (rs1799930), (OR: 3.75; p < 0.001)) or GSTP1 variant genotypes (GA + AA (rs1695), (OR: 5.11; p < 0,001)) and (CT + TT (rs1138272), (OR: 7.42; p < 0,001) with idiopathic infertility risk. Our findings rate the effect of single-nucleotide polymorphisms of GSTP1 and/or NAT2 in modulation of the risk of male infertility in subjects from Vietnam. This pilot study is the first (as far as we know) to reveal that polymorphisms of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) are some novel genetic markers for susceptibility to idiopathic male infertility. Copyright © 2018 Elsevier B.V. All rights reserved.
Arruda, Mônica Barcellos; Campagnari, Francine; de Almeida, Tailah Bernardo; Couto-Fernandez, José Carlos; Tanuri, Amilcar; Cardoso, Cynthia Chester
2016-01-01
Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME) influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs) in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs), and 8 to protease inhibitors (PIs) containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001), while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009). Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.
Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu
2016-04-01
Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.
Urschitz, Johann; Sultan, Omar; Ward, Kenneth
2011-01-01
Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308
2013-01-01
Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216
Zaharan, Nur Lisa; Muhamad, Nor Hanisah; Jalaludin, Muhammad Yazid; Su, Tin Tin; Mohamed, Zahurin; Mohamed, M N A; A Majid, Hazreen
2018-01-01
Several non-synonymous single-nucleotide polymorphisms (nsSNPs) have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA) in relation to adiposity parameters among adolescents in Malaysia. We examined whether (a) PA and (b) selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study ( n = 1,151). Body mass indices, waist-hip ratio, and percentage body fat (% BF) were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C). Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3) rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS). Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model. PAQ-C scores were associated with % BF (β = -0.44 [95% confidence interval -0.72, -0.16], p = 0.002). The CC genotype of ADRB3 rs4994 (β = -0.16 [-0.28, -0.05], corrected p = 0.01) and AA genotype of MC3R rs3827103 (β = -0.06 [-0.12, -0.00], p = 0.02) were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = -0.05 [-0.10, -0.01], p = 0.02) and combined GRS (β = -0.03 [-0.04, -0.01], p = 0.01) for % BF. Higher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention in this population.
Wu, Yao; Tong, Xiang; Tang, Ling-Li; Zhou, Kai; Zhong, Chuan-Hong; Jiang, Shu
2014-01-01
Associations between the rs6010620 polymorphism in the regulator of telomere elongation helicase1 (RTEL1) gene and glioma have been widely reported but the results were not inconclusive. The aim of the current study was to investigate the association between the rs6010620 polymorphism in RTEL1 gene and risk of glioma by meta-analysis. We searched PubMed, Embase, Wanfang Weipu and CNKI (China National Knowledge Infrastructure) databases, which included all research published 05 May 2014. A total of 8,292 cases and 12,419 controls from 14 case-control studies involving the rs6010620 polymorphism in the RTEL1 gene were included. Statistical analysis was performed using STATA 12.0 software. The results indicated that the rs6010620 polymorphism in RTEL1 gene was indeed associated with risk of glioma (OR=1.474, 95%CI=1.282-1.694, p<0.001). On subgroup analysis by ethnicity, we found associations between the rs6010620 polymorphism in the RTEL1 gene and risk of glioma in both Caucasians and Asians. The current meta-analysis suggested that the rs6010620 polymorphism in the RTEL1 gene might increase risk of glioma. In future, larger case-control studies are needed to confirm our results.
Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjuan; Li, Shanqu
2015-01-01
Background Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. Material/Methods In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Results Using the χ2 test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes “CC” of rs2297440 and “GG” of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Conclusions Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population. PMID:26156397
Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjun; Li, Shanqu
2015-07-09
Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Using the χ(2) test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes "CC" of rs2297440 and "GG" of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population.
Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein
2015-01-01
Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783
Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen
2017-04-01
In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.
Huang, Xiao-Lei; Wu, Guo-Cui; Wang, Yu-Jie; Yang, Xiao-Ke; Yang, Guo-Jun; Tao, Jin-Hui; Duan, Yu; Yan, Jun-Wei; Li, Xiang-Pei; Ye, Dong-Qing; Wang, Jing
2016-08-01
The aim of our study was to investigate the association of five single nucleotide polymorphisms in interleukin-1 (IL-1) gene with susceptibility to systemic sclerosis (SSc) in a Chinese population. A total of 58 SSc patients and 113 healthy controls were enrolled. TaqMan allele discrimination assay was performed to detect the genotyping of IL-1A -889C/T (rs1800587), IL-1B -511C/T (rs16944), IL-18 -607C/A (rs1946518), IL-18 -137G/C (rs187238) and IL-33 rs7044343. The association between these SNPs and SSc risk was analyzed. Furthermore, a meta-analysis of relevant studies on the association of IL-1A -889C/T (rs1800587) and IL-1B -511C/T (rs16944) with the susceptibility to SSc was performed. Through the genotyping, significant associations for SSc were found for: IL-1A -889C/T genotype frequencies (P = 0.000), dominant model (P = 0.000), recessive model (P = 0.001) and allele T frequency (P = 0.000). Among SSc patients, dyspnea was significantly associated with IL-18 -607C/A genotype frequency and IL-33 rs7044343 allele frequency (P = 0.037, P = 0.042, respectively). In addition, elevated erythrocyte sedimentation rate was significantly associated with IL-18 -137G/C (rs187238) genotype and allele frequency (P = 0.019, P = 0.006, respectively). While meta-analysis showed there was no significant association between IL-1A -889C/T polymorphism and SSc, for IL-1B -511C/T (rs16944), significant associations were found in the comparison of allele C versus T (OR 1.267, 95 % CI 1.016-1.580) by combined different outcomes. Results showed that IL-1A -889C/T (rs1800587) was associated with SSc susceptibility in the Chinese population. However, this association was not supported by a meta-analysis of all relevant studies. Further investigations are required to verify our findings.
Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat
2009-01-01
The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375
Angulo, Jenniffer; Pino, Karla; Echeverría-Chagas, Natalia; Marco, Claudia; Martínez-Valdebenito, Constanza; Galeno, Héctor; Villagra, Eliecer; Vera, Lilian; Lagos, Natalia; Becerra, Natalia; Mora, Judith; Bermúdez, Andrea; Cárcamo, Marcela; Díaz, Janepsy; Miquel, Juan Francisco; Ferrés, Marcela; López-Lastra, Marcelo
2015-01-01
Background. Andes virus (ANDV) is the sole etiologic agent of hantavirus cardiopulmonary syndrome (HCPS) in Chile, with a fatality rate of about 35%. Individual host factors affecting ANDV infection outcome are poorly understood. In this case-control genetic association analysis, we explored the link between single-nucleotide polymorphisms (SNPs) rs12979860, rs8099917 and rs1800629 and the clinical outcome of ANDV-induced disease. The SNPs rs12979860 and rs8099917 are known to play a role in the differential expression of the interleukin 28B gene (IL28B), whereas SNP rs1800629 is implicated in the expression of tumor necrosis factor α gene (TNF-α). Methods. A total of 238 samples from confirmed ANDV-infected patients collected between 2006 and 2014, and categorized according to the severity of the disease, were genotyped for SNPs rs12979860, rs8099917, and rs1800629. Results. Analysis of IL28B SNPs rs12979860 and rs8099917 revealed a link between homozygosity of the minor alleles (TT and GG, respectively), displaying a mild disease progression, whereas heterozygosity or homozygosity for the major alleles (CT/CC and TG/TT, respectively) in both IL28B SNPs is associated with severe disease. No association with the clinical outcome of HCPS was observed for TNF-α SNP rs1800629 (TNF −308G>A). Conclusions. The IL28B SNPs rs12979860 and rs8099917, but not TNF-α SNP rs1800629, are associated with the clinical outcome of ANDV-induced disease, suggesting a possible link between IL28B expression and ANDV pathogenesis. PMID:26394672
Rs1914663 of SFTPA 1 gene is associated with pediatric tuberculosis in Han Chinese population.
Li, Jieqiong; Qi, Hui; Sun, Lin; Shen, Chen; Jiao, Weiwei; Xu, Fang; Xiao, Jing; Shen, Adong
2016-07-01
Surfactant protein A (SP-A), a part of the innate immune system of the lung, performs a vital role in the host defense against Mycobacterium tuberculosis (MTB) infection. In order to investigate the relationship between SFTPA polymorphism variations and Tuberculosis (TB) in a Chinese pediatric group, we conducted a case-control study using single-nucleotide polymorphism (SNP) analysis. Significant difference of the allelic distribution of rs1914663 in SFTPA gene was observed between TB group and control group and, T allele of rs1914663 was associated with increased risk for TB (control vs. 1.42, 95% CI: 1.10-1.81, P=0.005). In addition, the TC+TT genotype of rs1914663 was higher in PTB and non-severe TB than that in controls. The haplotype comprising rs17881720-A and rs17879335-G was a resistance factor while the haplotype comprising rs1914663-T and rs1059225-G was found to be a susceptibility factor to TB. Using a case-control study, we identified a genetic polymorphism in the SFTPA that regulates host susceptibility to pediatric TB in the Han Chinese population. Copyright © 2016 Elsevier B.V. All rights reserved.
CCDC26 rs4295627 polymorphisms associated with an increased risk of glioma: A meta-analysis.
Zeng, Jie; Luo, Yueji; Yu, Min; Li, Jianming; Liu, Zhenghai
2017-11-01
Gliomas are the most common primary brain tumor in adults. Many studies have revealed associations between the rs4295627 polymorphism in the coiled-coil domain containing 26 (CCDC26) gene and the risk of glioma. However, the conclusions are still unclear because some studies have reported inconsistent results. The aim of the present meta-analysis was to determine the relationship and quantitatively evaluate the effect of the rs4295627 polymorphism on the risk of glioma. Data was extracted from PubMed, EMBASE and Google Scholar, with the most recent search up to December, 2015. Odds ratios (OR) and their 95% CIs were used to evaluate the effect of CCDC26 rs4295627 polymorphisms on glioma. A test of heterogeneity and an assessment of publication bias were also performed. A total of 11 studies (8292 cases and 12,419 controls) were selected for this meta-analysis. Significant associations were observed in all genetic analysis models (G vs T: OR = 1.26, 95% CI = 1.12-1.43; GG vs TT: OR = 1.72, 95% CI = 1.24-2.39; GT vs TT: OR = 1.33, 95% CI = 1.24-1.42; GG + GT vs TT: OR = 1.36, 95% CI = 1.20-1.53; GG vs GT + TT: OR = 1.65, 95% CI = 1.18-2.29, respectively). The results of the present study clearly show that the G allele of the rs4295627 polymorphism significantly increases the risk of glioma. Nevertheless, well-designed large-scale studies are needed to further evaluate the effect of the rs4295627 polymorphism on different types or degrees of glioma in different ethnic groups as well as to measure the combined effects on glioma risk.
AGXT2 rs37369 polymorphism predicts the renal function in patients with chronic heart failure.
Hu, Xiao-Lei; Zeng, Wen-Jing; Li, Mu-Peng; Yang, Yong-Long; Kuang, Da-Bin; Li, He; Zhang, Yan-Jiao; Jiang, Chun; Peng, Li-Ming; Qi, Hong; Zhang, Ke; Chen, Xiao-Ping
2017-12-30
Patients with chronic heart failure (CHF) are often accompanied with varying degrees of renal diseases. The purpose of this study was to identify rs37369 polymorphism of AGXT2 specific to the renal function of CHF patients. A total of 1012 southern Chinese participants, including 487 CHF patients without history of renal diseases and 525 healthy volunteers, were recruited for this study. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to determine the genotypes of AGXT2 rs37369 polymorphism. Levels of blood urea nitrogen (BUN) and serum creatinine (SCr) were detected to indicate the renal function of the participants. BUN level was significantly higher in CHF patients without history of renal diseases compared with healthy volunteers (p=0.000). And the similar result was also obtained for SCr (p=0.000). Besides, our results indicated that the level of BUN correlated significantly with SCr in both the CHF patients without renal diseases (r=0.4533, p<0.0001) and volunteers (r=0.2489, p<0.0001). Furthermore, we found that the AGXT2 rs37369 polymorphism could significantly affect the level of BUN in CHF patients without history of renal diseases (p=0.036, AA+AG vs GG). Patients with rs37369 GG genotype showed a significantly reduced level of BUN compared to those with the AA genotype (p=0.024), and the significant difference was still observed in the smokers of CHF patients without renal diseases (p=0.023). In conclusion, we found that CHF might induce the impairment of kidney and cause deterioration of renal function. AGXT2 rs37369 polymorphism might affect the renal function of CHF patients free from renal diseases, especially in patients with cigarette smoking. Copyright © 2017. Published by Elsevier B.V.
Kamada, Anselmo J; Bianco, Anna M; Zupin, Luisa; Girardelli, Martina; Matte, Maria C C; Medeiros, Rúbia Marília de; Almeida, Sabrina Esteves de Matos; Rocha, Marineide M; Segat, Ludovica; Chies, José A B; Kuhn, Louise; Crovella, Sergio
2016-07-01
Bone marrow stromal cell antigen-2 (BST-2)/Tetherin is a restriction factor that prevents Human immunodeficiency virus type 1 (HIV-1) release from infected cells and mediates pro-inflammatory cytokine production. This study investigated the risk conferred by single nucleotide polymorphisms (rs919266, rs9192677, and rs9576) at BST-2 coding gene (BST2) in HIV-1 mother-to-child transmission and in disease progression. Initially, 101 HIV-1+ pregnant women and 331 neonates exposed to HIV-1 from Zambia were enrolled. Additional BST2 single nucleotide polymorphism analyses were performed in 2 cohorts with acquired immunodeficiency syndrome (AIDS) progression: an adult Brazilian cohort (37 rapid, 30 chronic and 21 long-term non-progressors) and an Italian pediatric cohort (21 rapid and 67 slow progressors). The rs9576A allele was nominally associated with protection during breastfeeding (P = 0.019) and individuals carrying rs919266 GA showed slower progression to AIDS (P = 0.033). Despite the influence of rs919266 and rs9576 on BST2 expression being still undetermined, a preventive role by BST2 polymorphisms was found during HIV-1 infection.
Quantitative Assessment the Relationship between p21 rs1059234 Polymorphism and Cancer Risk.
Huang, Yong-Sheng; Fan, Qian-Qian; Li, Chuang; Nie, Meng; Quan, Hong-Yang; Wang, Lin
2015-01-01
p21 is a cyclin-dependent kinase inhibitor, which can arrest cell proliferation and serve as a tumor suppressor. Though many studies were published to assess the relationship between p21 rs1059234 polymorphism and various cancer risks, there was no definite conclusion on this association. To derive a more precise quantitative assessment of the relationship, a large scale meta-analysis of 5,963 cases and 8,405 controls from 16 eligible published case-control studies was performed. Our analysis suggested that rs1059234 was not associated with the integral cancer risk for both dominant model [(T/T+C/T) vs C/C, OR=1.00, 95% CI: 0.84-1.18] and recessive model [T/T vs (C/C+C/T), OR=1.03, 95% CI: 0.93-1.15)]. However, further stratified analysis showed rs1059234 was greatly associated with the risk of squamous cell carcinoma of head and neck (SCCHN). Thus, larger scale primary studies are still required to further evaluate the interaction of p21 rs1059234 polymorphism and cancer risk in specific cancer subtypes.
MSH3 rs26279 polymorphism increases cancer risk: a meta-analysis
Miao, Hui-Kai; Chen, Li-Ping; Cai, Dong-Ping; Kong, Wei-Ju; Xiao, Li; Lin, Jie
2015-01-01
Previous studies have investigated the association of mutS homolog 3 (MSH3) rs26279 G > A polymorphism with the risk of different types of cancers including colorectal cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, ovarian cancer and oesophageal cancer. However, its association with cancer remains conflicting. We performed a comprehensive meta-analysis to derive a more precise estimation of the relationship between MSH3 rs26279 G > A polymorphism and cancer susceptibility. Systematically searching the PubMed and EMBASE databases yielded 11 publications with 12 studies of 3282 cases and 6476 controls. The strength of the association was determined by crude odds ratios (OR) and 95% confidence intervals (CI). Overall, pooled risk estimates demonstrated that MSH3 rs26279 G > A was significantly associated with an increased overall cancer risk under all the genetic models (GG vs. AA: OR = 1.27, 95% CI = 1.09-1.48, P = 0.002; AG vs. AA: OR = 1.10, 95% CI = 1.00-1.21, P = 0.045; GG vs. AG + AA: OR = 1.23, 95% CI = 1.06-1.42, P = 0.005; AG + GG vs. AA: OR = 1.13, 95% CI = 1.04-1.24, P = 0.006; G vs. A: OR = 1.13, 95% CI = 1.05-1.20, P = 0.001). The association was more evident for colorectal cancer and breast cancer. Moreover, the significant association was also observed in the following subgroups: Europeans, Asians, population-based studies, hospital-based studies, and studies comprising relatively large sample size (≥ 200). Our meta-analysis results demonstrated that MSH3 rs26279 G > A polymorphism is associated with an increased risk of overall cancer, especially for the colorectal cancer and breast cancer. PMID:26617824
MSH3 rs26279 polymorphism increases cancer risk: a meta-analysis.
Miao, Hui-Kai; Chen, Li-Ping; Cai, Dong-Ping; Kong, Wei-Ju; Xiao, Li; Lin, Jie
2015-01-01
Previous studies have investigated the association of mutS homolog 3 (MSH3) rs26279 G > A polymorphism with the risk of different types of cancers including colorectal cancer, breast cancer, prostate cancer, bladder cancer, thyroid cancer, ovarian cancer and oesophageal cancer. However, its association with cancer remains conflicting. We performed a comprehensive meta-analysis to derive a more precise estimation of the relationship between MSH3 rs26279 G > A polymorphism and cancer susceptibility. Systematically searching the PubMed and EMBASE databases yielded 11 publications with 12 studies of 3282 cases and 6476 controls. The strength of the association was determined by crude odds ratios (OR) and 95% confidence intervals (CI). Overall, pooled risk estimates demonstrated that MSH3 rs26279 G > A was significantly associated with an increased overall cancer risk under all the genetic models (GG vs. AA: OR = 1.27, 95% CI = 1.09-1.48, P = 0.002; AG vs. AA: OR = 1.10, 95% CI = 1.00-1.21, P = 0.045; GG vs. AG + AA: OR = 1.23, 95% CI = 1.06-1.42, P = 0.005; AG + GG vs. AA: OR = 1.13, 95% CI = 1.04-1.24, P = 0.006; G vs. A: OR = 1.13, 95% CI = 1.05-1.20, P = 0.001). The association was more evident for colorectal cancer and breast cancer. Moreover, the significant association was also observed in the following subgroups: Europeans, Asians, population-based studies, hospital-based studies, and studies comprising relatively large sample size (≥ 200). Our meta-analysis results demonstrated that MSH3 rs26279 G > A polymorphism is associated with an increased risk of overall cancer, especially for the colorectal cancer and breast cancer.
The association between MMP2 -1306 C > T (rs243865) polymorphism and risk of prostate cancer.
Shajarehpoor Salavati, L; Tafvizi, F; Manjili, H K
2017-02-01
Prostate cancer is the second most common cancer in men. Matrix metalloproteinase-2 (MMP2) is the most important member of the matrix metalloproteinase family. MMP2 digests the basement membrane and causes changes in the extracellular matrix which in turn facilitate cancer invasion. It, therefore, has a major role in tumor angiogenesis. Previous studies have identified a single-nucleotide polymorphism C/T at position -1306 of MMP2 gene promoter which is a key regulatory factor in cancer progression. The present study aimed to determine the association between MMP2 polymorphism and the risk of prostate cancer in Iranian men. This case-control study was performed on 50 paraffin-embedded prostate cancer tissue samples and 54 blood samples from healthy men. Genotyping of the samples was performed using high-resolution melting analysis (HRM). Finally, 20 % of the genotypes were confirmed by sequencing. No significant associations were found between CT and TT genotypes and the risk of prostate cancer. However, there were no significant relationships between the genotypes and the studied factors, e.g., age, pathological stage, and Gleason Score. MMP2 -1306 C > T (rs243865) polymorphism was not significantly related with prostate cancer susceptibility in Iranian men.
Kadkhodazadeh, Mahdi; Ebadian, Ahmad Reza; Gholami, Gholam Ali; Khosravi, Alireza; Tabari, Zahra Alizadeh
2013-05-01
RANK/OPG/RANKL pathway plays a significant role in osteoclastogenesis, osteoclast activation, and regulation of bone resorption. The aim of this study was to investigate the association of RANKL gene polymorphisms (rs9533156 and rs2277438) with chronic periodontitis and peri-implantitis in an Iranian population. 77 patients with chronic periodontitis, 40 patients with peri-implantitis and 89 periodontally healthy patients were enrolled in this study. 5cc of blood was obtained from the cephalic vein of subjects arms and transferred into tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP) technique. Differences in the frequencies of genotypes and alleles in the disease and control groups were analyzed using Chi-square and Fisher's exact statistical tests. Comparison of frequency of alleles in SNP rs9533156 of RANKL gene between the chronic periodontitis group with the control and peri-implantitis groups revealed statistically significant differences (P=0.024 and P=0.027, respectively). Comparison of genotype expression of SNP rs9533156 on RANKL gene between the peri-implantitis group with chronic periodontitis and control groups revealed statistically significant differences (P=0.001); the prevalence of CT genotype was significantly higher amongst the chronic periodontitis group. Regarding SNP rs2277438 of RANKL gene, comparison of prevalence of genotypes and frequency of alleles did not reveal any significant differences (P=0.641/P=0.537, respectively). The results of this study indicate that CT genotype of rs9533156 RANKL gene polymorphism was significantly associated with peri-implantitis, and may be considered as a genetic determinant for peri-implantitis. Copyright © 2012 Elsevier Ltd. All rights reserved.
Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent
2012-05-01
Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.
Schulz, S; Seitter, L; Werdan, K; Hofmann, B; Schaller, H-G; Schlitt, A; Reichert, S
2018-05-06
Biological plausibility of an association between severe periodontitis and cardiovascular disease (CVD) has been proven. Genetic characteristics play an important role in both complex inflammatory diseases. Polymorphisms (single nucleotide polymorphisms [SNPs]) in the long noncoding RNA, antisense noncoding RNA in the INK4 locus (ANRIL), were shown to play a leading role in both diseases. The primary objectives of the study were to assess, among cardiovascular (CV angiographically proven ≥50% stenosis of a main coronary artery) patients, the impact of ANRIL SNPs rs133049 and rs3217992 on the severity of periodontitis and the previous history of coronary events, as well as on the occurrence of further adverse CV events. The prevalence of severe periodontitis was analyzed in 1002 CV patients. ANRIL SNPs rs133049 and rs3217992 were genotyped. The prognostic value of both ANRIL SNPs for combined CV endpoint (stroke/transient ischemic attack [TIA], myocardial infarction, death from a CV-related event, death from stroke) was evaluated after a 3-year follow-up period. Hazard ratios (HRs) were adjusted for established CV risk factors applying Cox regression. ANRIL SNPs rs133049 and rs3217992 were not associated with severe periodontitis or history of CVD in CV patients. In the Kaplan-Meier survival curve including the log rank-test (P = .036) and Cox regression (hazard ratio = 1.684, P = .009) the AA genotype of rs3217992 was shown to be an independent predictor for adverse CV events after 3 years of follow-up. SNPs in ANRIL are not risk modulators for severe periodontitis and history of CVD in CV patients. The AA genotype of ANRIL SNPs rs3217992 possesses prognostic power for further CV events within 3 years of follow-up. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
USDA-ARS?s Scientific Manuscript database
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...
Guerra, Jose Luis Lopez; Gomez, Daniel; Wei, Qingyi; Liu, Zhengshen; Wang, Li-E; Yuan, Xianglin; Zhuang, Yan; Komaki, Ritusko; Liao, Zhongxing
2012-12-01
We investigated the association between single nucleotide polymorphisms (SNPs) in the transforming growth factor β1 (TGFβ1) gene and the risk of radiation-induced esophageal toxicity (RE) in patients with non-small-cell lung cancer (NSCLC). Ninety-seven NSCLC patients with available genomic DNA samples and mostly treated with intensity modulated radio(chemo)therapy from 2003 to 2006 were used as a test dataset and 101 NSCLC patients treated with 3-dimensional conformal radio(chemo)therapy from 1998 to 2002 were used as a validation set. We genotyped three SNPs of the TGFβ1 gene (rs1800469:C-509T, rs1800471:G915C, and rs1982073:T869C) by the polymerase chain reaction restriction fragment length polymorphism method. In the test dataset, the CT/TT genotypes of TGFβ1 rs1800469:C-509T were associated with a statistically significant higher risk of RE grade⩾3 in univariate (P=0.026) and multivariate analysis (P=0.045) when compared with the CC genotype. These results were again observed in both univariate (P=0.045) and multivariate (P=0.023) analysis in the validation dataset. We found and validated that the TGFβ1 rs1800469:C-509T genotype is associated with severe RE. This response marker may be used for guiding therapy intensity in an individual patient, which would further the goal of individualized therapy. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy
2016-08-01
Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Abbasi, Zahra; Kazemi Nezhad, Seyed Reza; Pourmahdi-Broojeni, Mahdi; Rajaei, Elham
2017-01-01
Single-nucleotide polymorphism (SNP) rs2476601 within protein tyrosine phosphatase non-receptor type 22 gene (PTPN22) has been shown to be a risk factor for different autoimmune diseases. This study explored the association of 1858 C/T SNP with rheumatoid arthritis (RA) and celiac disease (CD) in a region covering south-west of Iran. Totally, 52 patients with CD, 120 patients with RA, and 120 healthy subjects were selected. The samples were genotyped for the rs2476601 in PTPN22 gene using the tetra-amplification refractory mutation system polymerase chain reaction. The frequency of +1858T risk allele was significantly increased in both RA (P=0.021, OR=2.56, 95%CI=1.19-5.47) and CD (P=0.002, OR=3.87, 95%CI=1.68-8.95) patients, as compared to the control group. However, no association was found between the +1858C/T PTPN22 gene SNP and the anti-cyclic citrullinated peptide and rheumatoid factor positivity in RA patients. PTPN22 gene could play a crucial role in people's susceptibility to certain autoimmune diseases.
A Meta-Analysis of the Association between DNMT1 Polymorphisms and Cancer Risk.
Li, Hao; Liu, Jing-Wei; Sun, Li-Ping; Yuan, Yuan
2017-01-01
Previous studies have examined the associations of DNA methyltransferase 1 ( DNMT1 ) polymorphisms, including single nucleotide polymorphisms rs16999593 (T/C), rs2228611 (G/A), and rs2228612 (A/G), with cancer risk. However, the results are inconclusive. The aim of this meta-analysis is to elucidate the associations between DNMT1 polymorphisms and cancer susceptibility. The PubMed, Embase, Web of Science, and Chinese National Knowledge Infrastructure databases were searched systematically to identify potentially eligible reports. Odd ratios and 95% confidence intervals were used to evaluate the strength of association between three DNMT1 polymorphisms and cancer risk. A total of 16 studies were finally included in the meta-analysis, namely, nine studies of 3378 cases and 4244 controls for rs16999593, 11 studies of 3643 cases and 3866 controls for rs2228611, and three studies of 1343 cases and 1309 controls for rs2228612. The DNMT1 rs2228612 (A/G) polymorphism was significantly related to cancer risk in the recessive model. The meta-analysis also suggested that DNMT1 rs16999593 (T/C) may be associated with gastric cancer, while rs2228611 (G/A) may be associated with breast cancer. In future research, large-scale and well-designed studies are required to verify these findings.
Genetic Polymorphisms in Cytokine Genes in Colombian Patients with Ocular Toxoplasmosis.
Naranjo-Galvis, C A; de-la-Torre, A; Mantilla-Muriel, L E; Beltrán-Angarita, L; Elcoroaristizabal-Martín, X; McLeod, R; Alliey-Rodriguez, N; Begeman, I J; López de Mesa, C; Gómez-Marín, J E; Sepúlveda-Arias, J C
2018-04-01
Toxoplasmosis is caused by infection with the protozoan parasite Toxoplasma gondii , which has the capacity to infect all warm-blooded animals worldwide. Toxoplasmosis is a major cause of visual defects in the Colombian population; however, the association between genetic polymorphisms in cytokine genes and susceptibility to ocular toxoplasmosis has not been studied in this population. This work evaluates the associations between polymorphisms in genes coding for the cytokines tumor necrosis factor alpha (TNF-α) (rs1799964, rs1800629, rs1799724, rs1800630, and rs361525), interleukin 1β (IL-1β) (rs16944, rs1143634, and rs1143627), IL-1α (rs1800587), gamma interferon (IFN-γ) (rs2430561), and IL-10 (rs1800896 and rs1800871) and the presence of ocular toxoplasmosis (OT) in a sample of a Colombian population (61 patients with OT and 116 healthy controls). Genotyping was performed with the "dideoxynucleotide (ddNTP) primer extension" technique. Functional-effect predictions of single nucleotide polymorphisms (SNPs) were done by using FuncPred. A polymorphism in the IL-10 gene promoter (-1082G/A) was significantly more prevalent in OT patients than in controls ( P = 1.93e-08; odds ratio [OR] = 5.27e+03; 95% confidence interval [CI] = 3.18 to 8.739; Bonferroni correction [BONF] = 3.48e-07). In contrast, haplotype "AG" of the IL-10 gene promoter polymorphisms (rs1800896 and rs1800871) was present at a lower frequency in OT patients ( P = 7e-04; OR = 0.10; 95% CI = 0.03 to 0.35). The +874A/T polymorphism of IFN-γ was associated with OT ( P = 3.37e-05; OR = 4.2; 95% CI = 2.478 to 7.12; BONF = 6.07e-04). Haplotype "GAG" of the IL-1β gene promoter polymorphisms (rs1143634, rs1143627, and rs16944) appeared to be significantly associated with OT ( P = 0.0494). The IL-10, IFN-γ, and IL-1β polymorphisms influence the development of OT in the Colombian population. Copyright © 2018 American Society for Microbiology.
Bufalo, N E; Dos Santos, R B; Marcello, M A; Piai, R P; Secolin, R; Romaldini, J H; Ward, L S
2015-05-01
Intronic thyroid-stimulating hormone receptor polymorphisms have been associated with the risk for both Graves' disease and Graves' ophthalmopathy, but results have been inconsistent among different populations. We aimed to investigate the influence of thyroid-stimulating hormone receptor intronic polymorphisms in a large well-characterized population of GD patients. We studied 279 Graves' disease patients (231 females and 48 males, 39.80 ± 11.69 years old), including 144 with Graves' ophthalmopathy, matched to 296 healthy control individuals. Thyroid-stimulating hormone receptor genotypes of rs179247 and rs12885526 were determined by Real Time PCR TaqMan(®) SNP Genotyping. A multivariate analysis showed that the inheritance of the thyroid-stimulating hormone receptor AA genotype for rs179247 increased the risk for Graves' disease (OR = 2.821; 95 % CI 1.595-4.990; p = 0.0004), whereas the thyroid-stimulating hormone receptor GG genotype for rs12885526 increased the risk for Graves' ophthalmopathy (OR = 2.940; 95 % CI 1.320-6.548; p = 0.0083). Individuals with Graves' ophthalmopathy also presented lower mean thyrotropin receptor antibodies levels (96.3 ± 143.9 U/L) than individuals without Graves' ophthalmopathy (98.3 ± 201.9 U/L). We did not find any association between the investigated polymorphisms and patients clinical features or outcome. We demonstrate that thyroid-stimulating hormone receptor intronic polymorphisms are associated with the susceptibility to Graves' disease and Graves' ophthalmopathy in the Brazilian population, but do not appear to influence the disease course.
Prandini, Paola; Pasquali, Alessandra; Malerba, Giovanni; Marostica, Andrea; Zusi, Chiara; Xumerle, Luciano; Muglia, Pierandrea; Da Ros, Lucio; Ratti, Emiliangelo; Trabetti, Elisabetta; Pignatti, Pier Franco
2012-08-01
The objective of this study was to replicate an association study on a newly collected Italian autism spectrum disorder (ASD) cohort by studying the genetic markers associated with ASDs from recent genome-wide and candidate gene association studies. We have genotyped 746 individuals from 227 families of the Italian Autism Network using allelic discrimination TaqMan assays for seven common single-nucleotide polymorphisms: rs2292813 (SLC25A12 gene), rs35678 (ATP2B2 gene), rs4307059 (between CDH9 and CDH10 genes), rs10513025 (between SEMA5A and TAS2R1 genes), rs6872664 (PITX1 gene), rs1861972 (EN2 gene), and rs4141463 (MACROD2 gene). A family-based association study was conducted. A significant association was found for two of seven markers: rs4307059 T allele (odds ratio: 1.758, SE=0.236; P-value=0.017) and rs35678 TC genotype (odds ratio: 0.528, SE=0.199; P-value=0.0013). A preferential allele transmission of two markers located at loci previously associated with social and verbal communication skill has been confirmed in patients of a new ASD family sample.
Johnson, Amy R; Lao, Sai; Wang, Tongwen; Galanko, Joseph A; Zeisel, Steven H
2012-01-01
Approximately 15% of couples are affected by infertility and up to half of these cases arise from male factor infertility. Unidentified genetic aberrations such as chromosomal deletions, translocations and single nucleotide polymorphisms (SNPs) may be the underlying cause of many cases of idiopathic male infertility. Deletion of the choline dehydrogenase (Chdh) gene in mice results in decreased male fertility due to diminished sperm motility; sperm from Chdh(-/-) males have decreased ATP concentrations likely stemming from abnormal sperm mitochondrial morphology and function in these cells. Several SNPs have been identified in the human CHDH gene that may result in altered CHDH enzymatic activity. rs12676 (G233T), a non-synonymous SNP located in the CHDH coding region, is associated with increased susceptibility to dietary choline deficiency and risk of breast cancer. We now report evidence that this SNP is also associated with altered sperm motility patterns and dysmorphic mitochondrial structure in sperm. Sperm produced by men who are GT or TT for rs12676 have 40% and 73% lower ATP concentrations, respectively, in their sperm. rs12676 is associated with decreased CHDH protein in sperm and hepatocytes. A second SNP located in the coding region of IL17BR, rs1025689, is linked to altered sperm motility characteristics and changes in choline metabolite concentrations in sperm.
Johnson, Amy R.; Lao, Sai; Wang, Tongwen; Galanko, Joseph A.; Zeisel, Steven H.
2012-01-01
Approximately 15% of couples are affected by infertility and up to half of these cases arise from male factor infertility. Unidentified genetic aberrations such as chromosomal deletions, translocations and single nucleotide polymorphisms (SNPs) may be the underlying cause of many cases of idiopathic male infertility. Deletion of the choline dehydrogenase (Chdh) gene in mice results in decreased male fertility due to diminished sperm motility; sperm from Chdh−/− males have decreased ATP concentrations likely stemming from abnormal sperm mitochondrial morphology and function in these cells. Several SNPs have been identified in the human CHDH gene that may result in altered CHDH enzymatic activity. rs12676 (G233T), a non-synonymous SNP located in the CHDH coding region, is associated with increased susceptibility to dietary choline deficiency and risk of breast cancer. We now report evidence that this SNP is also associated with altered sperm motility patterns and dysmorphic mitochondrial structure in sperm. Sperm produced by men who are GT or TT for rs12676 have 40% and 73% lower ATP concentrations, respectively, in their sperm. rs12676 is associated with decreased CHDH protein in sperm and hepatocytes. A second SNP located in the coding region of IL17BR, rs1025689, is linked to altered sperm motility characteristics and changes in choline metabolite concentrations in sperm. PMID:22558321
He, Jinshui; Fang, Yanling; Lin, Xinfu; Zhou, Huowang; Zhu, Shaobo; Zhang, Yugui; Yang, Huicong; Ye, Xiaoling
2016-02-26
BACKGROUND Growth hormone deficiency (GHD) is a major cause of congenital short stature. GHD patients have significantly decreased serum leptin levels, which are regulated by gene polymorphism of leptin and leptin receptor. This study thus investigated the relationship between gene polymorphism and susceptibility to GHD. MATERIAL AND METHODS A case-control study was performed using 180 GHD children in addition to 160 healthy controls. After the extraction of whole genomic DNA, the genotypes of leptin and leptin receptor gene loci were analyzed by sequencing for single-nucleotide polymorphism. RESULTS The frequency distribution of all alleles identified in leptin gene (loci rs7799039) and leptin receptor gene (loci rs1137100 and rs1137101) fit Hardy-Weinberg equilibrium. There was a significant difference in allele frequency at loci rs7799039 or rs1137101, as individuals with heterozygous GA allele had lower (rs7799039) or higher (rs1137101) GHD risk. No significant difference in allele frequency was discovered at loci rs1137100 (p>0.05), which was unrelated to GHD susceptibility. CONCLUSIONS Gene polymorphism of leptin (loci rs7799039) and leptin receptor (loci rs1137101) are correlated with GHD susceptibility.
de Luis, Daniel Antonio; Izaola, Olatz; Primo, David; de la Fuente, Beatriz; Aller, Rocio
2017-10-01
Few studies assessing the relationship between single nucleotide polymorphisms in CNR2 and obesity or its related metabolic parameters are available. To investigate the influence of polymorphism rs3123554 in the CNR2 receptor gene on obesity anthropometric parameters, insulin resistance, and adipokines in subjects with obesity. The study population consisted of 1027 obese subjects, who were performed bioelectrical impedance analyses, blood pressure measurements, serial assessments of dietary intake during three days, and biochemical tests. Genotypes GG, GA, and AA were found in 339 (33.0%), 467 (45.5%), and 221 (21.5%) respectively. Body mass index, weight, fat mass, waist circumference, insulin, HOMA-IR, and triglyceride and leptin levels were higher in A-allele carriers as compared to non A-allele carriers. No differences were seen in these parameters between the GA and AA genotypes. There were no statistical differences in dietary intake. The main study finding was the association of the minor allele of the SNP rs3123554 in the CNR2 gene with body weight and triglyceride, HOMA-IR, insulin, and leptin levels. Copyright © 2017 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.
Jiménez-Jiménez, Félix Javier; Alonso-Navarro, Hortensia; García-Martín, Elena; Agúndez, José A.G.
2016-01-01
Abstract Background/aims: Several neuropathological, biochemical, and pharmacological data suggested a possible role of histamine in the etiopathogenesis of Parkinson disease (PD). The single nucleotide polymorphism (SNP) rs11558538 in the histamine N-methyltransferase (HNMT) gene has been associated with the risk of developing PD by several studies but not by some others. We carried out a systematic review that included all the studies published on PD risk related to the rs11558538 SNP, and we conducted a meta-analysis following Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Methods: We used several databases to perform the systematic review, the software Meta-DiSc 1.1.1 to perform the meta-analysis of the eligible studies, and the Q-statistic to test heterogeneity between studies. Results: The meta-analysis included 4 eligible case–control association studies for the HNMT rs11558538 SNP and the risk for PD (2108 patients, 2158 controls). The frequency of the minor allele positivity showed a statistically significant association with a decreased risk for PD, both in the total series and in Caucasians. Although homozygosity for the minor allele did not reach statistical significance, the test for trend indicates the occurrence of a gene–dose effect. Global diagnostic odds ratios (95% confidence intervals) for rs11558538T were 0.61 (0.46–0.81) for the total group, and 0.63 (0.45–0.88) for Caucasian patients. Conclusion: The present meta-analysis confirms published evidence suggesting that the HNMT rs11558538 minor allele is related to a reduced risk of developing PD. PMID:27399132
Angulo, Jenniffer; Pino, Karla; Echeverría-Chagas, Natalia; Marco, Claudia; Martínez-Valdebenito, Constanza; Galeno, Héctor; Villagra, Eliecer; Vera, Lilian; Lagos, Natalia; Becerra, Natalia; Mora, Judith; Bermúdez, Andrea; Cárcamo, Marcela; Díaz, Janepsy; Miquel, Juan Francisco; Ferrés, Marcela; López-Lastra, Marcelo
2015-12-15
Andes virus (ANDV) is the sole etiologic agent of hantavirus cardiopulmonary syndrome (HCPS) in Chile, with a fatality rate of about 35%. Individual host factors affecting ANDV infection outcome are poorly understood. In this case-control genetic association analysis, we explored the link between single-nucleotide polymorphisms (SNPs) rs12979860, rs8099917 and rs1800629 and the clinical outcome of ANDV-induced disease. The SNPs rs12979860 and rs8099917 are known to play a role in the differential expression of the interleukin 28B gene (IL28B), whereas SNP rs1800629 is implicated in the expression of tumor necrosis factor α gene (TNF-α). A total of 238 samples from confirmed ANDV-infected patients collected between 2006 and 2014, and categorized according to the severity of the disease, were genotyped for SNPs rs12979860, rs8099917, and rs1800629. Analysis of IL28B SNPs rs12979860 and rs8099917 revealed a link between homozygosity of the minor alleles (TT and GG, respectively), displaying a mild disease progression, whereas heterozygosity or homozygosity for the major alleles (CT/CC and TG/TT, respectively) in both IL28B SNPs is associated with severe disease. No association with the clinical outcome of HCPS was observed for TNF-α SNP rs1800629 (TNF -308G>A). The IL28B SNPs rs12979860 and rs8099917, but not TNF-α SNP rs1800629, are associated with the clinical outcome of ANDV-induced disease, suggesting a possible link between IL28B expression and ANDV pathogenesis. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Association between Tryptophan Hydroxylase 2 Gene Polymorphism and Completed Suicide
ERIC Educational Resources Information Center
Fudalej, Sylwia; Ilgen, Mark; Fudalej, Marcin; Kostrzewa, Grazyna; Barry, Kristen; Wojnar, Marcin; Krajewski, Pawel; Blow, Frederic; Ploski, Rafal
2010-01-01
The association between suicide and a single nucleotide polymorphism (rs1386483) was examined in the recently identified tryptophan hydroxylase 2 (TPH2) gene. Blood samples of 143 suicide victims and 162 age- and sex-matched controls were examined. The frequency of the TT genotype in the TPH2 polymorphism was higher in suicide victims than in…
MYO9B gene polymorphisms are associated with the risk of inflammatory bowel diseases
Yu, Qiang; Zhu, Chun-Fu; Kong, Zhi-Jun; Zhao, Hui; Tang, Li-Ming; Qin, Xi-Hu
2016-01-01
Myosin IXB (MYO9B) gene polymorphisms have been extensively investigated in terms of their associations with inflammatory bowel disease (IBD), with contradictory results. The aim of this meta-analysis was to evaluate associations between MY09B gene polymorphisms and the risk of IBD, Crohn's disease (CD) and ulcerative colitis (UC). Eligible studies from PubMed, Embase, and CNKI databases were identified. Pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated. Ten studies published in eight papers reporting 8,975 cases and 9,482 controls were included in this meta-analysis. Five MY09B gene polymorphisms were evaluated: rs1545620, rs962917, rs1457092, rs2305764, and rs2305767. Our data suggested that the rs1545620 polymorphism was associated with a decreased risk of IBD. A similar result was found for rs2305767 and UC. The rs962917 single nucleotide polymorphism (SNP) increased the risk of IBD, CD and UC. Moreover, rs1457092 increased the risk of IBD and UC. Rs2305764 was also associated with an increased risk of IBD. Furthermore, stratification analyses indicated that rs1545620 decreased the risk of IBD, while rs962917 increased the risk of IBD, CD and UC in Caucasian populations. To sum up, our data indicate that these five SNPs in MY09B are significantly associated with the risk of IBD. PMID:27556856
Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil
2010-01-01
Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505
Association between AMELX polymorphisms and dental caries in Koreans.
Kang, S W; Yoon, I; Lee, H W; Cho, J
2011-05-01
Dental caries is greatly influenced disease by environmental factors, but recently there are increasing evidences for a genetic component in caries susceptibility. AMELX is the gene coding amelogenin, which is the most important factor for normal enamel development. The aim of this study was to examine the relationship between dental caries and single nucleotide polymorphisms (SNPs) in AMELX. For this study, we used DNA samples collected from 120 unrelated individuals older than 12 years of age. All of them were examined for their oral and dental status under the WHO recommended criteria, and clinical information such as DMFT and DMFS were evaluated. Individuals whose DMFT and DMFS index lower than 2 were designated 'very low caries experience' and higher than 3 were designated 'higher caries experience'. Genomic DNA was extracted from hair samples, and single nucleotide polymorphisms of AMELX were genotyped. Genotyping of three SNPs (rs17878486, rs5933871, rs5934997, intron) in AMELX gene was determined by direct sequencing and analyzed with SNPStats. There were significant associations between rs5933871 and rs5934997 SNP and caries susceptibility in the water fluoridation group. These results suggest that SNPs of AMELX might be associated with dental caries susceptibility in Korean population. © 2010 John Wiley & Sons A/S.
Chen, Fa; He, Baochang; Yan, Lingjun; Qiu, Yu; Lin, Lisong; Cai, Lin
2017-01-01
The fatty acid desaturase 1 (FADS1) gene variant is a novel susceptibility marker for laryngeal squamous cell carcinoma identified by a recent genome-wide association study, but it is still unclear whether this genetic variant continues to influence oral cancer recurrence or death. The purpose of this study was to evaluate the role of FADS1 rs174549 polymorphism and its interaction with postoperative chemoradiotherapy in the prognosis of oral cancer. A prospective cohort study involving 304 oral cancer patients with surgical resection was conducted in Fujian, China. Demographic and clinical data (adjuvant therapy types, histologic types, clinical stage, etc.) were extracted from medical records, and follow-up data were obtained by telephone interviews. We collected 5 to 8 mL of venous blood from all patients for DNA extraction, and rs174549 genotypes were determined by TaqMan assays (Life Technologies, Carlsbad, CA). A Cox proportional hazards model and Kaplan-Meier curve were used to assess the association between FADS1 rs174549 polymorphism and progression-free survival (PFS), as well as overall survival, in oral cancer. Carrying the AA genotype was significantly associated with a decreased risk of PFS: The hazard ratio was 0.52 (95% confidence interval, 0.29 to 0.93) for the codominant model and 0.54 (95% confidence interval, 0.31 to 0.94) for the recessive model. Moreover, better PFS was particularly obvious in patients who had received chemoradiotherapy. A positive multiplicative interaction between FADS1 rs174549 polymorphism and chemoradiotherapy was observed for PFS (P = .036). No significant association was found between FADS1 rs174549 polymorphism and overall survival. Our study suggests, for the first time, that FADS1 rs174549 polymorphism is a potentially independent and favorable factor in predicting oral cancer PFS especially for patients who undergo chemoradiotherapy, and it may serve as a potential target for individualized treatment in the future
Zhang, Ji-Xiang; Song, Jia; Wang, Jun; Dong, Wei-Guo
2014-06-01
In this meta-analysis, we aimed to clarify the impact of Janus kinase 2 (JAK2) rs10758669 polymorphisms on ulcerative colitis (UC) and Crohn's disease (CD) risk. Data were extracted, and pooled odd ratios (ORs) as well as 95% confidence intervals (95%CIs) were calculated. Eleven studies with 7009 CD patients, 7929 UC patients, and 19235 controls were included. The results showed that JAK2 rs10758669 polymorphism was associated with CD (AC vs. AA, OR = 1.16, 95%CI, 1.08-1.24; CC vs. AA, OR = 1.29, 95%CI, 1.17-1.43; AC + CC vs. AA, OR = 1.19, 95%CI, 1.11-1.27; CC vs. AA + AC, OR = 1.19, 95%CI, 1.09-1.31; C vs. A, OR = 1.14, 95%CI, 1.09-1.20) and UC susceptibility (AC vs. AA, OR = 1.14, 95%CI, 1.06-1.22; CC vs. AA, OR = 1.33, 95%CI, 1.20-1.47; AC + CC vs. AA, OR = 1.18, 95%CI, 1.10-1.27; CC vs. AA + AC, OR = 1.24, 95%CI, 1.12-1.36; C vs. A, OR = 1.15, 95%CI, 1.10-1.21). But no significant association was found between JAK2 rs10758669 polymorphism with CD in Asian. Either in adult-onset group or multi-age group, hospital-based group or population-based group, JAK2 rs10758669 polymorphism was associated with CD and UC susceptibility. This meta-analysis indicated that JAK2 rs10758669 polymorphism was a risk factor both for CD and UC, especially in Caucasian. The differences in age of onset and study design did not influence the associations obviously. Gene-gene and gene-environment interactions should be investigated in the future.
El-Sabrout, Karim; Aggag, Sarah A.
2017-01-01
Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458
Colic, Lejla; Li, Meng; Demenescu, Liliana Ramona; Li, Shija; Müller, Iris; Richter, Anni; Behnisch, Gusalija; Seidenbecher, Constanze I; Speck, Oliver; Schott, Björn H; Stork, Oliver; Walter, Martin
2018-05-30
Anxiety disorders are common and debilitating conditions with higher prevalence in women. However, factors that predispose women to anxiety phenotypes are not clarified. Here we investigated potential contribution of the single nucleotide polymorphism rs2236418 in GAD2 gene to changes in regional inhibition/excitation balance, anxiety-like traits, and related neural activity in both sexes. One hundred and five healthy individuals were examined with high-field (7T) multimodal magnetic resonance imaging (MRI); including resting-state functional MRI in combination with assessment of GABA and glutamate (Glu) levels via MR spectroscopy. Regional GABA/Glu levels in anterior cingulate cortex (ACC) subregions were assessed as mediators of gene-personality interaction for the trait harm avoidance and moderation by sex was tested. In AA homozygotes, with putatively lower GAD2 promoter activity, we observed increased intrinsic neuronal activity and higher inhibition/excitation balance in pregenual ACC (pgACC) compared with G carriers. The pgACC drove a significant interaction of genotype, region, and sex, where inhibition/excitation balance was significantly reduced only in female AA carriers. This finding was specific for rs2236418 as other investigated single nucleotide polymorphisms of the GABA synthesis related enzymes ( GAD1 , GAD2 , and GLS ) were not significant. Furthermore, only in women there was a negative association of pgACC GABA/Glu ratios with harm avoidance. A moderated-mediation model revealed that pgACC GABA/Glu also mediated the association between the genotype variant and level of harm avoidance, dependent on sex. Our data thus provide new insights into the neurochemical mechanisms that control emotional endophenotypes in humans and constitute predisposing factors for the development of anxiety disorders in women. SIGNIFICANCE STATEMENT Anxiety disorders are among the most common and burdensome psychiatric disorders, with higher prevalence rates in women
Ponce de León-Suárez, Valeria; Valdés-Flores, Margarita; Miranda-Duarte, Antonio; Ramírez-Pérez, Esperanza; Pérez-Ríos, Alin; Barredo-Prieto, Blanca; Hidalgo-Bravo, Alberto; Casas-Avila, Leonora
2018-04-01
Polymorphisms in Interleukin-6 (IL6) and its receptor (IL6R) have been associated with bone mineral density. In this work, the G-174C and G-572C polymorphisms in IL6, G-208A, and Asp358Ala in IL6R were analyzed in Mexican women with hip fracture. Postmenopausal Mexican women (60 years or over) with hip fragility fracture (77.97 ± 8 years) and without hip fracture (70.5 ± 7.02 years) were genotyped by real-time PCR. The rs1800796 GG genotype was associated with low risk of fracture (p = 0.05), while GC genotype was associated with high risk of fracture [p = 0.047, OR 2.3 (95% CI 1.013-5.2)]. The AA genotype of the rs2228145 SNP (IL6R) was significantly different [p = 0.033, OR 1.94 (95% CI 1.01-3.75)], but when data were adjusted by age and body mass index, there were no differences (p = 0.9). Our results suggest that the IL6 rs1800796 SNP is a good marker for hip fracture risk in Mexican women.
Prospects for inferring pairwise relationships with single nucleotide polymorphisms
Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody
2003-01-01
An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...
Hou, Huixian; Ma, Rulin; Guo, Heng; He, Jia; Hu, Yunhua; Mu, Lati; Yan, Yizhong; Ma, Jiaolong; Li, Shugang; Zhang, Jingyu; Ding, Yusong; Zhang, Mei; Niu, Qiang; Liu, Jiaming; Guo, Shuxia
2017-01-01
Objective: To explore the association between CETP gene polymorphisms and metabolic syndrome (MS), as well as the relationship between the CETP gene polymorphisms and each component of MS. Methods: A total of 571 individuals which were randomly selected from 5692 Uyghur adults were subdivided into two groups, including 280 patients with MS and 291 control subjects, using the group-matching method after matching for gender. We detected CETP polymorphisms (rs5882, rs1800775, rs3764261, rs12149545, rs711752, and rs708272) by using the Snapshot method. Results: (1) Significant differences were found involving the frequency distribution of genotypes and alleles of rs1800775, rs3764261, rs12149545, rs711752, and rs708272 between the control and MS groups (all p < 0.05). (2) rs1800775, rs3764261, rs12149545, rs711752, and rs708272 polymorphisms were significantly related to the risk of MS (all p < 0.05). (3) The rs1800775 polymorphism was associated with high fasting blood glucose levels and low high density lipoprotein cholesterol (HDL-C); rs3764261 and rs12149545 polymorphisms were associated with all components of MS except high blood pressure; rs711752 and rs708272 polymorphisms were associated with low HDL-C (all p < 0.05). (4) Complete linkage disequilibrium (LD) was identified for two pairs of single nucleotide polymorphisms (SNPs) (rs3764261 and rs12149545 (D’ = 1.000, r2 = 0.931), rs711752 and rs708272 (D’ = 1.000, r2 = 0.996)). (5) The A-G-G-G-C (p = 0.013, odds ratio [OR] = 0.622, 95% confidence interval [95% CI] = 0.427–0.906) and A-T-A-A-T (p < 0.001, OR = 0.519, 95% CI = 0.386–0.697) haplotypes were more frequent in the control group than in the case group. Conclusions: The rs1800775, rs3764261, rs12149545, rs711752, and rs708272 polymorphisms of CETP were associated with MS and its components among the Uyghur ethnic group. Complete LD was found between two pairs of SNPs (rs3764261 and rs12149545, rs711752, and rs708272). The A-G-G-G-C and A
Safranow, Krzysztof; Żekanowski, Cezary
2015-01-01
Background Gilles de la Tourette syndrome (GTS) is a neurodevelopmental disorder characterized by motor and vocal tics. Hyperactivity of dopaminergic transmission is considered a prime abnormality in the pathophysiology of tics. There are reciprocal antagonistic interactions between adenosine and dopamine transmission. The aim of the study was to analyze the association of two polymorphisms, rs2228079 in ADORA1 and rs5751876 in ADORA2A, with the risk of GTS and co-morbid disorders. Material and Methods A total of 162 Polish GTS patients and 270 healthy persons were enrolled in the study. Two polymorphisms were selected on the basis of knowledge of SNPs frequencies in ADORA1 and ADORA2A. Chi-square test was used for allelic and genotypic association studies. Association of genotypes with age of tic onset was analyzed with Mann-Whitney test. Multivariate logistic regression was used to find independent predictors of GTS risk. Results We found that the risk of GTS was associated with rs2228079 and rs5751876 polymorphisms. The GG+GT genotypes of rs2228079 in ADORA1 were underrepresented in GTS patients (p = 0.011), whereas T allele of rs5751876 in ADORA2A was overrepresented (p = 0.017). The GG genotype of rs2228079 was associated with earlier age of tic onset (p = 0.046). We found also that the minor allele G of rs2228079 was more frequent in GTS patients with depression as compared to the patients without depression (p = 0.015). Also the genotype GG was significantly more frequent in patients with obsessive compulsive disorder/behavior (OCD/OCB, p = 0.021) and depression (p = 0.032), as compared to the patients without these co-morbidities. The minor allele T frequency of rs5751876 was lower in GTS patients with co-morbid attention deficit hyperactivity disorder (p = 0.022), and TT+TC genotypes were less frequent in the non-OCD anxiety disorder group (p = 0.045). Conclusion ADORA1 and ADORA2A variants are associated with the risk of GTS, co-morbid disorders, and may
SLC11A1 polymorphisms and host susceptibility to cutaneous leishmaniasis in Pakistan.
Sophie, Mariam; Hameed, Abdul; Muneer, Akhtar; Samdani, Azam J; Saleem, Saima; Azhar, Abid
2017-01-07
The vector-borne cutaneous leishmaniasis (CL) is endemic in several regions of Pakistan mainly affecting poor populations. Host genetic factors, particularly SLC11A1 (solute carrier transmembrane protein) within macrophages, play a crucial role in disease pathology and susceptibility. Association of SLC11A1 with cutaneous leishmaniasis, a neglected tropical disease, is not well established. Inconsistencies have been observed within different populations worldwide with respect to genetic susceptibility. This study was designed to investigate genetic variation(s) in SLC11A1 and to assess possible association with cutaneous leishmaniasis in Pakistan. Eight polymorphisms (rs2276631, rs3731864, rs2290708, rs2695342, rs201565523, rs17215556, rs17235409, rs17235416) were genotyped across SLC11A1 in 274 patients and 119 healthy controls. Six polymorphisms were studied by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing. Two single nucleotide polymorphisms were analyzed with newly designed semi-nested PCR assays. Case-control analysis showed no association between selected polymorphisms in SLC11A1 and cutaneous leishmaniasis. No significant difference was observed in the distribution of alleles between leishmaniasis patients and healthy individuals. Strong pairwise linkage disequilibrium was observed between rs2276631 and rs2290708 (r 2 = 64); and rs17235409 and rs17235416 (r 2 = 78). This study shows that genetic variations in the candidate gene SLC11A1 do not affect susceptibility to cutaneous leishmaniasis in the sample population from Pakistan.
Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S
2016-06-01
Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.
Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).
Studer, Jacqueline; Bartsch, Christine; Haas, Cordula
2014-07-01
Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.
Yete, Subuhi; Pradhan, Sultan; Saranath, Dhananjaya
2017-08-01
Oral cancer is a high incidence cancer in India primarily due to the prevalent tobacco/areca nut chewing habits and hence a major health concern. India constitutes 26% of the global oral cancer burden. Besides the well-established risk factors, the genomic constitution of an individual plays a role in oral cancer. The aim of the current study was to analyse genomic variants represented as single nucleotide polymorphisms (SNPs), analyse their prevalence and investigate risk association of allelotypes/genotypes to oral cancers. Eleven SNPs in genes associated with biological functions were analysed in an Indian cohort (n = 1000) comprising 500 oral cancer patients and 500 long term tobacco habitués as controls, using Allelic discrimination Real-Time PCR assay with SYBR Green dye. Fisher's exact test and Odds Ratio were used for statistical analysis. Increased risk was observed for rs9849237 CC [P = 0.008; OR 1.412 (1.09-1.82)] and rs243865 CT [P = 0.004; OR 1.469 (1.13-1.90)] genotypes, whereas rs9849237 CT [P = 0.034; OR 0.755 (0.58-0.97)], rs243865 CC [P = 0.002; OR 0.669 (0.51-0.86)] and rs10090787 CC [P = 0.049; OR 0.774 (0.60-0.99)] genotypes indicated decreased risk to oral cancer. The other SNPs showed equidistribution in both groups. Our data indicated genotypes and alleles in specific SNPs rs9849237, rs243865 and rs10090787 with increased/decreased risk to oral cancer. Copyright © 2017 Elsevier Inc. All rights reserved.
Salehi, Mohaddeseh; Amin-Beidokhti, Mona; Safarpour Lima, Behnam; Gholami, Milad; Javadi, Gholam-Reza; Mirfakhraie, Reza
2018-01-01
Migraine is a painful complex neurovascular disease characterized by recurrent moderate-to-severe headaches. Increased level of homocysteine is related to dilation of cerebral vessels and endothelial injury that could trigger migraine attacks. Functional polymorphisms in the MTHFR gene affect homocysteine metabolism and, therefore, play an important role in the etiology of the disease. We aimed to investigate the possible association between MTHFR gene rs4846049, C677T, and A1298C polymorphisms and the risk of migraine in Iranian population. In this genetic association study, 498 individuals were enrolled, including 223 migraine patients and 275 healthy controls. Genotyping was performed using tetra-primer ARMS-PCR for rs4846049 and PCR-restriction fragment length polymorphism for C677T and A1298C polymorphisms. The association between rs4846049 and C677T polymorphisms and migraine was observed. For the rs4846049 polymorphism, the association was detected under a dominant model ( P =0.007; odds ratio [OR] =0.60; 95% confidence interval [CI], 0.41-0.87), and for the C677T polymorphism, the TT genotype frequency was significantly different in the studied groups ( P =0.009; OR =2.48; 95% CI, 1.25-4.92). No significant differences in the genotype or allele frequencies were found for the A1298C polymorphism between the migraineurs and controls. Present data provide evidence for the association of rs4846049 and C677T polymorphisms in the MTHFR gene and migraine. Further studies are required to validate the significance of the studied genetic variations in diverse ethnic populations.
Li, Yaping; Zhai, Song; Li, Mei; Wang, Yuan; Lu, Tong; Deng, Huiling; Zhang, Xin; Dang, Shuangsuo
2017-07-01
Objective To investigate whether the polymorphisms of TLR7/MyD88 signaling pathway is associated with the susceptibility to and severity of hand, foot and mouth disease (HFMD) caused by enterovirus 71 (EV71) in children. Methods We collected 180 EV71 HFMD cases and 201 healthy controls from both the Second Affiliated Hospital of Xi'an Jiaotong University and Xi'an Children's Hospital. The genotypes including rs3853839, rs179010 of TLR7, and rs7744 of MyD88 were detected in the 381 samples by SNPscan kit. Results The susceptibility risk (OR=2.343, 95%CI:1.516-3.621) and severity risk (OR=1.939, 95%CI: 1.064-3.521) of TLR7 rs3853839 allele C significantly increased in the male children with EV71 HFMD. Also, the susceptibility risk (OR=1.701, 95%CI: 1.142-2.535) and severity risk (OR=1.852, 95%CI: 1.038-3.305) of TLR7 rs179010 allele T significantly increased in the male children with EV71 HFMD. But there was no significant difference in the distribution of TLR7 rs179010 and rs3853839 genes between female children with EV71 HFMD and female controls. There was no correlation between the genetic polymorphisms of MyD88 rs7744 and the susceptibility to and severity of EV71 HFMD in the children. Conclusion Polymorphisms of TLR7 rs3853839 and rs179010 are correlated to the susceptibility to and severity of EV71 HFMD in male children.
A family study of DRD3 rs6280, SLC1A2 rs3794087 and MAPT rs1052553 variants in essential tremor.
Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Lorenzo-Betancor, Oswaldo; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Agúndez, José A G
2016-10-01
Despite many data suggesting a role of genetic factors in the risk for essential tremor (ET), the responsible genes have not been identified. We analyzed in ET Spanish families three single nucleotide polymorphisms (SNPs): DRD3 rs6280, SLC1A2 rs3794087, and MAPT rs1052553) previously related to an increased risk for developing the disease. We recruited 45 subjects with ET and 13 subjects without tremor belonging to 11 families who were evaluated because of familial tremor. Diagnosis of probable or definite ET was done according to TRIG criteria. Genotyping of the 3 SNPs was done using TaqMan-based qPCR assays. Data were compared with those of healthy controls of our laboratory. Family-based association testing for disease traits was performed as well. rs6280 and rs3794087 genotype and allelic frequencies did not differ significantly between subjects with ET and healthy controls. However, rs1052553AA genotype and the allele rs1052553A allele were significantly more frequent among ET patients. rs1052553A allele was non-significantly overrepresented in ET patients compared with controls when considering only the more severely affected member of each ET family. Family-based association test for disease traits showed lack of association between ET and the three SNPs studied. Our results showed a lack of association between rs6280 and rs3794087 with the risk for ET, though a marginal increased risk for ET was observed among the rs1052553A allele carriers, which was not confirmed with a family-based association study.
Lozić, Bernarda; Krželj, Vjekoslav; Kuzmić-Prusac, Ivana; Kuzmanić-Šamija, Radenka; Čapkun, Vesna; Lasan, Ružica; Zemunik, Tatijana
2014-08-28
Involvement of development-related gene polymorphisms in multifactorial/polygenic etiology of stillborn/neonatal deaths due to malformations has been insufficiently tested. Since these genes showed evolutional stability and their mutations are very rare, we can assume that their polymorphic variants may be a risk factor associated with the occurrence of developmental disorders of unknown etiology or can enhance the phenotypic variability of known genetic disorders. To determine the association of 3 polymorphisms involved in the regulation of the early embryonic development of different organs, we conducted an association study of their relation to the particular malformation. We selected 140 samples of archived paraffin tissue samples from deceased patients in which fetal/neonatal autopsy examination had shown congenital abnormalities as the most likely cause of death. The polymorphisms of OSR1 rs12329305, rs9936833 near FOXF1, and HOXA1 rs10951154 were genotyped using the TaqMan allelic discrimination assay. After Bonferroni correction for multiple testing, significant allelic association with stillborn/neonatal deaths was observed for rs12329305 (p=7×10-4). In addition, association analysis for the same polymorphism was shown in the subgroup with isolated anomalies (1.25×10^-5), particularly in the subgroup of cases with kidney and heart anomalies (p=4.18×10^-5, p=5.12×10^-8, respectively). The findings of the present study showed, for the first time, the role of the OSR1 rs12329305 polymorphism in the development of congenital malformations in cases of stillborn/neonatal death, particularly in those with congenital kidney and heart developmental defects.
Deng, Zhen-Han; Sun, Ming-Hua; Li, Yu-Sheng; Luo, Wei; Zhang, Fang-Jie; Tian, Jian; Wu, Ping; Xiao, Wen-Feng
2017-03-21
This study explored the association between single nucleotide polymorphisms (SNPs) in the CD40 gene, rs4810485 G > T and rs1883832 C > T, as well as disease susceptibility and severity in knee osteoarthritis (KOA) in the Chinese Han population. Peripheral venous blood was collected from 133 KOA patients (KOA group) and 143 healthy people (control group) from December 2012 to November 2013. The patients in the KOA group were classified into mild, moderate and severe groups according to disease severity. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to test the genotypes of all subjects. Binary logistic regression analyses were performed to analyze the risk factors for KOA. The KOA group was significantly different from the control group in living environment (P < 0.05). The KOA group had a lower frequency of TT genotype and T allele distribution of rs4810485 G > T compared with the control group, and rs4810485 G > T TT genotype and T allele may associate with low incidence of KOA (all P < 0.05). Besides, T allele and mutant homozygous TT genotype of rs1883832 C > T increased the susceptibility to KOA. Genotype and allele distribution of rs4810485 G > T and rs1883832 C > T were significantly different among the mild, moderate and severe groups (P < 0.05). There were more patients with rs4810485 G > T GG genotype and rs1883832 C > T TT genotype in the severe group than other genotypes of these two SNPs. According to binary logistic regression analysis, rs4810485 G > T TT genotype could alleviate disease severity in KOA, rs1883832 C > T TT genotype increase the severity of KOA and living environment is an important external factor that affects KOA severity. These data provide evidences that rs4810485 G > T and rs1883832 C > T in the CD40 gene may be associated with disease susceptibility and severity in KOA.
Mao, Jinyuan; Vanderlelie, Jessica J; Perkins, Anthony V; Redman, Christopher WG; Ahmadi, Kourosh R; Rayman, Margaret P
2016-01-01
Background: Low selenium status in pregnancy has been associated with a number of adverse conditions. In nonpregnant populations, the selenium status or response to supplementation has been associated with polymorphisms in dimethylglycine dehydrogenase (DMGDH), selenoprotein P (SEPP1) and the glutathione peroxidases [cytosolic glutathione peroxidase (GPx1) and phospholipid glutathione peroxidase (GPx4)]. Objective: We hypothesized that, in pregnant women, these candidate polymorphisms would be associated with selenium status in early pregnancy, its longitudinal change, and the interindividual response to selenium supplementation at 60 μg/d. Design: With the use of stored samples and data from the United Kingdom Selenium in Pregnancy Intervention (SPRINT) study in 227 pregnant women, we carried out genetic-association studies, testing for associations between selenium status, its longitudinal change, and response to supplementation and common genetic variation in DMGDH (rs921943), SEPP1 (rs3877899 and rs7579), GPx1 (rs1050450) and GPx4 (rs713041). Selenium status was represented by the concentration of whole-blood selenium at 12 and 35 wk of gestation, the concentration of toenail selenium at 16 wk of gestation, and plasma glutathione peroxidase (GPx3) activity at 12 and 35 wk of gestation. Results: Our results showed that DMGDH rs921943 was significantly associated with the whole-blood selenium concentration at 12 wk of gestation (P = 0.032), which explained ≤2.0% of the variance. This association was replicated with the use of toenail selenium (P = 0.043). In unsupplemented women, SEPP1 rs3877899 was significantly associated with the percentage change in whole-blood selenium from 12 to 35 wk of gestation (P = 0.005), which explained 8% of the variance. In supplemented women, SEPP1 rs3877899 was significantly associated with the percentage change in GPx3 activity from 12 to 35 wk of gestation (P = 0.01), which explained 5.3% of the variance. Selenium status was
Li, Xiao-Mu; Ling, Yan; Lu, Da-Ru; Lu, Zhi-Qiang; Liu, Ying; Chen, Hong-Yan; Gao, Xin
2012-10-01
Proprotein convertase subtilisin/kexin-type 1 (PCSK1) is a prohormone convertase that has an important role in prohormone maturation including the process of prorenin to renin. We studied the association of the PCSK1 single-nucleotide polymorphism (SNP) rs6235 (encoding an S690T substitution) with essential hypertension (EH), obesity and related traits in the Han Chinese population. The rs6235 SNP in the PCSK1 gene was investigated using a case-control study design, with 1034 hypertension cases and 1112 normotensive controls. In this study, the rs6235 SNP was significantly associated with hypertension (OR=1.26, 95% CI (1.10-1.46), P=0.001); the odds ratios of GC vs GG and CC vs GG were 1.30 (95% CI (1.06-1.58), P=0.010) and 1.55 (95% CI (1.12-2.13), P=0.007), respectively. In the controls, the C-allele was associated with increased systolic (P=0.010) and diastolic (P=0.010) blood pressure levels. In all of the EH patients and EH patients without a history of renin-angiotensin-aldosterone (RAA) system-related antagonists, the C-allele was associated with increased plasma renin activity (P=0.00004 and 0.002, respectively) and aldosterone levels (P=0.018 and 0.005, respectively). The C-allele was also associated with increased body mass index (BMI) (P=0.010) in the normotensive controls. In conclusion, the PCSK1 SNP rs6235 was associated with EH and blood pressure in the Han Chinese population, and this association may be mediated by the SNP's effect on RAA levels. rs6235 was also associated with BMI in this population.
Chen, Yun; Yang, Xiqiang; Huang, Ying; Liu, Enmei; Wang, Lijia
2011-01-01
The single-nucleotide polymorphisms (SNPs) of the Mina gene in animals are associated with the development of Th2-mediated diseases. However, there is no information whether the association occurs in humans. This case-control study aimed at examining the potential association of the SNP of the Mina gene with the development of asthma in Chinese Han children. The DNA genotypes and serum immunoglobulin E and interleukin-4 levels of 202 asthmatic patients and 191 nonasthmatic subjects were determined by matrix-assisted laser desorption ionization-time of flight mass spectrometry method and enzyme-linked immunosorbent assay, respectively. We found that the frequency of the T allele of rs4857304, but not rs832081, rs832078, rs9879532, and rs17374916, in the Mina gene in asthmatic patients was significantly higher than that of controls (p = 0.0199). Using a recessive model, we found that the percentage of patients with TT homozygous rs4857304 was significantly higher than that of controls (p = 0.0282, odds ratio=1.568, 95% confidence interval=1.048-2.346). Further, the mean levels of serum immunoglobulin E and interleukin-4 in the patients with TT genotype of rs4857304 were significantly higher than that of patients with the G allele (p = 0.000 and p = 0.03, respectively). Apparently, the T allele of rs4857304 of the Mina gene may be associated with increased risk for the development of asthma in Chinese Han children.
Association between BMP4 rs17563 polymorphism and NSCL/P risk: a meta-analysis.
Hu, Yuan-Yuan; Qin, Chuan-Qi; Deng, Mo-Hong; Niu, Yu-Ming; Long, Xing
2015-01-01
To investigate the association between bone morphogenetic protein 4 (BMP4) rs17563 polymorphism and nonsyndromic cleft lip with or without palate (NSCL/P) risk. Four online databases were researched and the related publications were collected. Odds ratio (OR) with 95% confidence interval (CI) was applied to assess the relationship; publication bias, metaregression, and sensitivity analysis were conducted to guarantee the strength of results. Six published case-control studies were collected. Overall, no significant association between BMP4 rs17563 polymorphism and NSCL/P risk was found. It was notable that significant susceptibility on different ethnicity was observed in the stratified analysis. For Chinese population, the BMP4 rs17563 polymorphism was a significantly increased risk for NSCL/P (C versus T: OR = 1.52, 95% CI = 1.28-1.82, P < 0.01, I (2) = 0%; CC versus TT: OR = 2.58, 95% CI = 1.74-3.82, P < 0.01, I (2) = 0%; TC + CC versus TT: OR = 1.45, 95% CI = 1.14-1.84, P < 0.01, I (2) = 0%; CC versus TT + TC: OR=2.46, 95% CI = 1.46-4.14, P < 0.01, I(2) = 47.0%). On the contrary, significantly protective effects were found in Brazilian population (C versus T: OR = 0.69, 95% CI = 0.50-0.96, P = 0.03, I(2) = 68.5%; TC versus TT: OR = 0.52, 95% CI = 0.40-0.68, P < 0.01, I(2) = 0%; TC + CC versus TT: OR = 0.52, 95% CI = 0.35-0.78, P < 0.010, I(2) = 54.4%). This meta-analysis indicated that BMP4 rs17563 polymorphism could play a different role during the development of NSCL/P based on ethnicity diversity.
Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms
USDA-ARS?s Scientific Manuscript database
We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...
Wang, Yafeng; Chen, Yu; Jiang, Heping; Tang, Weifeng; Kang, Mingqiang; Liu, Tianyun; Guo, Zengqing; Ma, Zhiqiang
2015-01-01
Peroxisome proliferator-activated receptor gamma (PPARG) is related to inflammation and plays an important role in the development of cancer. PPARG rs1801282 C>G polymorphism might influence the risk of cancer by regulating production of PPARG gene. Hence, a comprehensive meta-analysis was conducted to explore the association of PPARG rs1801282 C>G polymorphism with cancer susceptibility. An extensive search of PubMed and Embase databases for all relevant publications was carried out. A total of 38 publications with 16,844 cancer cases and 23,736 controls for PPARG rs1801282 C>G polymorphism were recruited in our study. Our results indicated that PPARG rs1801282 C>G variants were associated with an increased cancer risk in Asian populations and gastric cancer. In summary, the findings suggest that PPARG rs1801282 C>G polymorphism may play a crucial role in malignant transformation and the development of cancer. PMID:26550180
Wang, Yafeng; Chen, Yu; Jiang, Heping; Tang, Weifeng; Kang, Mingqiang; Liu, Tianyun; Guo, Zengqing; Ma, Zhiqiang
2015-01-01
Peroxisome proliferator-activated receptor gamma (PPARG) is related to inflammation and plays an important role in the development of cancer. PPARG rs1801282 C>G polymorphism might influence the risk of cancer by regulating production of PPARG gene. Hence, a comprehensive meta-analysis was conducted to explore the association of PPARG rs1801282 C>G polymorphism with cancer susceptibility. An extensive search of PubMed and Embase databases for all relevant publications was carried out. A total of 38 publications with 16,844 cancer cases and 23,736 controls for PPARG rs1801282 C>G polymorphism were recruited in our study. Our results indicated that PPARG rs1801282 C>G variants were associated with an increased cancer risk in Asian populations and gastric cancer. In summary, the findings suggest that PPARG rs1801282 C>G polymorphism may play a crucial role in malignant transformation and the development of cancer.
Divella, Rosa; Daniele, Antonella; Mazzocca, Antonio; Abbate, Ines; Casamassima, Porzia; Caliandro, Cosimo; Ruggeri, Eustachio; Naglieri, Emanuele; Sabbà, Carlo; De Luca, Raffaele
2017-01-01
Background: ADIPOQ gene, which encode for Adiponectin (APN), is sited on chromosome 3q27 and linked to a susceptibility locus for metabolic syndrome (MetS). The ADIPOQ rs266729 G/C gene polymorphism is significantly associated with low APN levels and linked to susceptibility to develop cancer. In addition, decreased APN serum levels are linked with tumor development and progression and inversely associated with markers of inflammation. Here, we investigate the influence of APN rs266729 G/C polymorphism on adipocytokine circulating levels and their association with MetS in colorectal cancer patients (CRC). Methods: Blood samples from 105 CRC patients (50 women and 55 men) with and without MetS were genotyped for APN rs266729 G/C polymorphism by TETRA ARMS PCR. ELISA assay was used to measure plasma levels of APN and inflammatory TNF-α cytokine. Biochemical and anthropometric parameters of MetS were also analyzed. Results: We found that CRC patients (N=75) with genotype rs266729G/C or carriers of G allele were associated with a significantly increased risk of MetS development (OR =2.9) compared to those with CC genotype (N=30). Also, CG/GG genotypes were associated with significantly lower plasma APN levels and higher TNF-α levels in comparison to CC genotype (P=0.034) and APN levels were decreased in relation to BMI increases (P=0.001). Conclusions: Our findings show that APN rs266729 G/C polymorphism is associated with lower APN levels in CRC patients, indicating that decreased circulating levels of APN may be a determinant risk factor for CRC in MetS patients. PMID:28529612
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
Skuratovskaia, D A; Vulf, M A; Kirienkova, E V; Mironyuk, N I; Zatolokin, P A; Litvinova, L S
2018-03-01
The relationship between the rs2302382, rs8111428 and Glu354Gln (rs1800437) polymorphisms in GIPR (glucosedependent insulinotropic polypeptide receptor) gene and plasma levels of mediators involved in the regulation of carbohydrate metabolism in obese patients with type 2 diabetes (before and after a test breakfast) was investigated. The contribution of polymorphic variants of rs2302382, rs8111428 in GIPR gene in the predisposition to type 2 diabetes in individuals belonging to the Slavic population of Russia was found. Polymorphisms rs2302382 and rs8111428 in the GIPR gene were characterized by the nonequilibrium cohesion. The decrease in the level of expression of the GIPR gene in adipose tissue of the small intestine mesentery in the carriers of the CC genotype rs2302382 and AA rs8111428 was associated with the increase in the plasma leptin level, whereas during normal expression, the plasma content of insulin, and GIP (in persons with the genotype of the polymorphism rs2302382 and AG polymorphism rs8111428), resistin and ghrelin (in individuals with the genotype of the polymorphism rs2302382) increased. We propose the stimulating effect of GIP on the secretion of resistin, leptin and ghrelin, with an increase in insulin production in obese patients with type 2 diabetes.
Zhu, Xiaonian; Liu, Wei; Qiu, Xiaoqiang; Wang, Zhigang; Tan, Chao; Bei, Chunhua; Qin, Linyuan; Ren, Yuan; Tan, Shengkui
2017-10-03
Hepatocellular carcinoma (HCC) is a malignant cancer causing deleterious health effect worldwide, especially in China. So far clinical cure rate and long-term survival rate of HCC remains low. Most HCC patients after cancer resection have recurrence or metastasis within 5 years. This study aims to explore the genetic association of mutL homolog 1 ( MLH1 ) polymorphisms with HCC risk and prognosis. Four candidate MLH1 polymorphisms, rs1800734, rs10849, rs3774343 and rs1540354 were studied from a hospital-based case-control study including 1,036 cases (HCC patients) and 1,036 controls (non-HCC patients) in Guangxi, China. All these SNPs interacted with environmental risk factors, such as HBV infection, alcohol intake and smoking in the pathogenesis of HCC. However, only rs1800734 had significant difference between cases and controls. Compared to the AA genotype, patients with AG, GG and AG/GG genotype of rs1800734 had an increased risk of HCC [ORs (95% CI) = 1.217 (1.074∼1.536), 1.745 (1.301∼2.591) and 1.291 (1.126∼1.687)] and a decreased survival time [co-dominant, HR (95% CI) = 1.553 (1.257∼1.920); dominant, HR (95% CI) = 2.207 (1.572∼3.100)]. Furthermore, we found that tumor number, tumor staging, metastasis and rs1800734 were associated with the overall survival of HCC patients by multivariate COX regression analysis. No significant difference was found between the other three MLH1 polymorphisms with HCC risk and prognosis. Our study suggests MLH1 SNP, rs1800734 as a new predictor for poor prognosis of HCC patients.
The gender-specific association of rs334558 in GSK3β with major depressive disorder.
Liu, Sha; Wang, Le; Sun, Ning; Yang, Chunxia; Liu, Zhifen; Li, Xinrong; Cao, Xiaohua; Xu, Yong; Zhang, Kerang
2017-01-01
Major depressive disorder (MDD) is one of the most prevalent psychiatric illnesses with a heritability ranging from 40% to 50%. The single nucleotide polymorphism (SNP) rs334558 on the glycogen synthase kinase-3β (GSK3β) gene has been identified as a genetic risk loci associated with schizophrenia and bipolar disorder. However, results from replication studies examining the association between rs334558 and MDD remain inconsistent.In the present study, first, we conducted a meta-analysis of the association between rs334558 and MDD by combining 5 available case-control samples totaling 2311 cases and 2535 controls. Second, genotyping data from patients with MDD at our institution, after further stratification by gender, were analyzed to determine the association between rs334558 and MDD.All studies retrieved and included in the meta-analysis were from Korea and China. The meta-analysis suggested that the functional polymorphism rs334558 within the GSK3β promoter region was associated with MDD risk (P < 0.05). The associations were observed both in the allelic and genetic models. Analysis of the genotyping data extracted from our hospital database revealed that rs334558 exhibited exclusive association with MDD in female patients (P=0.015).Our findings suggest that GSK3β rs334558 polymorphisms might be a potential risk for MDD, and females with GSK3β rs334558 polymorphisms might have higher penetrance of MDD. If validated in larger scale samples and in different ethnic populations, these findings might be of value as diagnostic references for MDD.
Lee, Sung Won; Lee, Shin Seok; Oh, Dong Ho; Park, Dong Jin; Kim, Hyun Sook; Choi, Jung Ran; Chae, Soo Cheon; Yun, Ki Jung; Chung, Won Tae; Choe, Jung Yoon; Kim, Seong Kyu
2016-10-01
The aim of this study was to determine the association between P2X7R rs3751142 and CARD8 rs2043211 polymorphisms and gout susceptibility in male Korean subjects. This study enrolled a total of 242 male patients with gout and 280 healthy controls. The polymorphisms of two individual genes including rs3751142(C>A) in the P2X7R gene and rs2043211(A>T) in the CARD8 gene were assessed using Taq-Man analysis. Statistical analyses were performed using the Chi-square test, Kruskal-Wallis test, and logistic regression analyses. A difference in genotypic frequency of the P2X7R rs3751142 and CARD8 rs2043211 genes was not detected between gout and control patients. Clinical parameters including age, onset age, disease duration, body mass index, and serum uric acid levels were not different among the three genotypes for either P2X7R or CARD8 (P > 0.05 for all). A pair-wise comparison of P2X7R rs3751142 and CARD8 rs2043211 genotype combinations revealed that subjects with the CA P2X7R rs3751142 genotype and the TT CARD8 rs2043211 genotype had a trend toward a higher risk of gout compared to the CC/AA combination (P = 0.056, OR = 2.618, 95% CI 0.975 - 7.031). In conclusion, this study revealed that genetic variability of the P2X7R rs3751142 and CARD8 rs2043211 genes might, in part, be associated with susceptibility for gout.
LINGO1 rs9652490 and rs11856808 polymorphisms are not associated with risk for multiple sclerosis
2013-01-01
Background Some recent experimental data suggest a possible role of LINGO-1 in the pathogenesis of multiple sclerosis (MS). In an attempt to identify genetic biomarkers related to MS susceptibility, we genotyped two common SNPs in the LINGO1 gene which have been associated to other neurological conditions, in patients with MS and in healthy subjects. These SNPs are linked to several SNPs within the LINGO1 gene, especially in individuals of Oriental or Caucasian descent. Methods We analyzed the allelic and genotype frequency of two LINGO1 variants (rs9652490 and rs11856808) in 293 patients with MS and 318 healthy controls, using KASPar assays. Results LINGO1 rs9652490 and rs11856808 allelic and genotype frequencies did not differ significantly between MS patients and controls. The minor allele frequencies for rs9652490 were 0.171 (95% CI = 0.140-0.201) and 0.167 (95% CI = 0.138-0.196 for cases and controls respectively (p = 0.853). For rs11856808 the minor allele frequencies were 0.317 (95% CI = 0.280-0.355) and 0.310 (95% CI = 0.274-0.346) for cases and controls, respectively (p = 0.773). Allele and genotype frequencies were unrelated with the age of onset of MS, gender, and clinical course of MS. In addition, haplotype analyses did not reveal any putative risk related to haplotypes. Conclusions These results suggest that LINGO1 rs9652490 and rs11856808 polymorphisms are not related with risk for MS. This study adds to other published evidence indicating that, to date, the LINGO1 SNPs studied here could be useful risk biomarkers of developing essential tremor, but not other movement disorders. PMID:23574883
Sirois, Francine; Kaefer, Nadine; Currie, Krista A; Chrétien, Michel; Nkongolo, Kabwe K; Mbikay, Majambu
2012-10-01
The PCSK1 (proprotein convertase subtilisin/kexin type 1) locus encodes proprotein convertase 1/3, an endoprotease that converts prohormones and proneuropeptides to their active forms. Spontaneous loss-of-function mutations in the coding sequence of its gene have been linked to obesity in humans. Minor alleles of two common non-synonymous single-nucleotide polymorphisms (SNPs), rs6232 (T > C, N221D) and rs6235 (C > G, S690T), have been associated with increased risk of obesity in European populations. In this study, we compared the frequencies of the rs6232 and rs6234 (G > C, Q665E) SNPs in Aboriginal and Caucasian populations of Northern Ontario. The two SNPs were all relatively less frequent in Aboriginals: The minor allele frequency of the rs6232 SNP was 0.01 in Aboriginals and 0.08 in Caucasians (P < 4.10(-6)); for the rs6234 SNP, it was 0.20 and 0.32, respectively (P < 0.001). Resequencing revealed that the rs6234 SNP variation was tightly linked to that of the rs6235 SNP, as previously reported. Most interestingly, all carriers of the rs6232 SNP variation also carried the rs6234/rs6235 SNP clustered variations, but not the reverse, suggesting the former occurred later on an allele already carrying the latter. These data indicate that, in Northern Ontario Aboriginals, the triple-variant PCSK1 allele is relatively rare and might be of lesser significance for obesity risk in this population.
Jin, Tianbo; Wang, Jihong; Fan, Dongsheng; Hao, Zengtao; Jing, Shangfei; Han, ChaoQian; Du, Jieli; Jiang, Dong; Wen, Shuzheng; Wang, Jianzhong
2017-01-01
This study aimed to investigate whether functional polymorphisms in the tissue inhibitors of metalloproteinase-2 (TIMP-2) gene are associated with susceptibility to knee osteoarthritis (OA) in the Chinese Han population. Six TIMP-2 single nucleotide polymorphisms (SNPs) were assayed using MassARRAY in 300 patients clinically and radiographically diagnosed with knee OA and in 428 controls. Allelic and genotypic frequencies were compared between groups. Logistic regression adjusting for age and gender was used to estimate risk associations between specific genotypes and knee OA by computing odds ratios (ORs) and 95% confidence intervals (95% CIs). We found that allele “A” in rs7342880 was significantly associated with increased risk of knee OA (OR = 1.44, 95%CI = 1.09-1.91, p = 0.035). In addition, in the over-dominant model, rs4789936 correlated with reduced risk of knee OA, adjusting for age and gender (OR = 0.69, 95%CI = 0.49-0.98, p = 0.036). Finally, rs7342880 correlated with increased risk of knee OA in females. This study provides evidence that TIMP-2 is a knee OA susceptibility gene in the Chinese population and a potential diagnostic and preventive marker for the disease. PMID:27901480
Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.
López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés
2017-12-01
This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.
Bukowski, Karol; Woźniak, Katarzyna
2018-03-09
Genetic polymorphism is associated with the occurrence of at least 2 different alleles in the locus with a frequency higher than 1% in the population. Among polymorphisms we can find single nucleotide polymorphism (SNP) and polymorphism of variable number of tandem repeats. The presence of certain polymorphisms in genes encoding DNA repair enzymes is associated with the speed and efficiency of DNA repair and can protect or expose humans to the effects provoked by xenobiotics. Chemicals, such as lead, arsenic pesticides are considered to exhibit strong toxicity. There are many different polymorphisms in genes encoding DNA repair enzymes, which determine the speed and efficiency of DNA damage repair induced by these xenobiotics. In the case of lead, the influence of various polymorphisms, such as APE1 (apurinic/apyrimidinic endonuclease 1) (rs1130409), hOGG1 (human 8-oxoguanine glycosylase) (rs1052133), XRCC1 (X-ray repair cross-complementing protein group 1) (rs25487), XRCC1 (rs1799782) and XRCC3 (X-ray repair cross-complementing protein group 3) (rs861539) were described. For arsenic polymorphisms, such as ERCC2 (excision repair cross-complementing) (rs13181), XRCC3 (rs861539), APE1 (rs1130409) and hOGG1 (rs1052133) were examined. As to pesticides, separate and combined effects of polymorphisms in genes encoding DNA repair enzymes, such as XRCC1 (rs1799782), hOGG1 (rs1052133), XRCC4 (X-ray repair cross-complementing protein group 4) (rs28360135) and the gene encoding the detoxification enzyme PON1 paraoxonase (rs662) were reported. Med Pr 2018;69(2):225-235. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Zhou, Dong; Wang, Xinhong; Chen, Tao; Wen, Wen; Liu, Yang; Wu, Yue; Yuan, Zuyi
2016-01-01
The objective of this study is to investigate the potential association of the NLRP3 rs10754558 and CARD8 rs2043211 polymorphisms with the occurrence and prognosis of CAD. Gene polymorphisms were analyzed using the ABI PRISM-Snapshot multiplex method in 515 CAD patients and 401 control subjects. The serum level of IL-1β was investigated by ELISA assays. The clinical endpoints were evaluated during a median follow-up period of 32 months. The NLRP3 rs10754558 gene polymorphism was significantly associated with the occurrence of CAD, while the CARD8 rs2043211 gene polymorphism was not involved. Patients carrying G allele of NLRP3 rs10754558 had more severe coronary artery stenosis. Multivariable analysis revealed a significant association of the G allele with major adverse cardiac event. The serum IL-1β concentrations in patients with GG genotype were significantly increased compared with those in the patients with CC genotype. Our findings for the first time show that the NLRP3 rs10754558 polymorphism is involved in the occurrence of CAD in the Chinese Han population; and G allele can effectively predict clinical outcome of CAD. The G allele susceptibility to CAD is maybe associated with the increased level of serum IL-1β.
Lozić, Bernarda; Krželj, Vjekoslav; Kuzmić-Prusac, Ivana; Kuzmanić-Šamija, Radenka; Čapkun, Vesna; Lasan, Ružica; Zemunik, Tatijana
2014-01-01
Background Involvement of development-related gene polymorphisms in multifactorial/polygenic etiology of stillborn/neonatal deaths due to malformations has been insufficiently tested. Since these genes showed evolutional stability and their mutations are very rare, we can assume that their polymorphic variants may be a risk factor associated with the occurrence of developmental disorders of unknown etiology or can enhance the phenotypic variability of known genetic disorders. Material/Methods To determine the association of 3 polymorphisms involved in the regulation of the early embryonic development of different organs, we conducted an association study of their relation to the particular malformation. We selected 140 samples of archived paraffin tissue samples from deceased patients in which fetal/neonatal autopsy examination had shown congenital abnormalities as the most likely cause of death. The polymorphisms of OSR1 rs12329305, rs9936833 near FOXF1, and HOXA1 rs10951154 were genotyped using the TaqMan allelic discrimination assay. Results After Bonferroni correction for multiple testing, significant allelic association with stillborn/neonatal deaths was observed for rs12329305 (p=7×10−4). In addition, association analysis for the same polymorphism was shown in the subgroup with isolated anomalies (1.25×10−5), particularly in the subgroup of cases with kidney and heart anomalies (p=4.18×10−5, p=5.12×10−8, respectively). Conclusions The findings of the present study showed, for the first time, the role of the OSR1 rs12329305 polymorphism in the development of congenital malformations in cases of stillborn/neonatal death, particularly in those with congenital kidney and heart developmental defects. PMID:25164089
Mohammadi, Seyed Mahdi; Shirvani Farsani, Zeinab; Dosti, Rozita; Sahraian, Mohammad Ali; Behmanesh, Mehrdad
2016-12-01
Multiple sclerosis (MS) is an autoimmune disease of the central nervous system characterized by brain inflammation, demyelination and axonal loss. Neuropeptide Y (NPY) has a critical role in the maintenance of homeostasis in the immune system and coping of stress condition. In the current study we analyzed 188 patients suffering from MS and 204 unrelated healthy controls for two functional single nucleotide polymorphisms (SNPs), NPY 20T>C (rs16139) and NPY -485T>C (rs16147) using PCR-RFLP and Mismatch PCR-RFLP methods. Our results demonstrated that homozygocity in the minor allele for NPY -485T>C polymorphism is associated with the MS risk in patients in compare with healthy controls (CC vs. TT, P=0.033; CC vs. TT+TC, P=0.02). In addition, by comparison with allele T, the frequency of NPY -485C allele was higher in cases than in control subjects and present increased risk of MS, but statistically significant was borderline (P=0.053). The stratification for disease progression revealed a significant difference in the allelic and genotypic distribution between subgroups of MS and controls. The frequency of the CC genotype and C allele was higher in the primary progressive MS patients when compared with control group (CC vs. TT, P=0.019; CC vs. TT+TC, P=0.008; C vs. T, P=0.022). In addition, the frequency of CC genotype was higher in the relapsing remitting MS patients when compared with control group (CC vs. TT, P=0.034; CC vs. TT+TC, P=0.016). Haplotype analysis demonstrated that the haplotype 3 (CT) is more common in RR MS (P=0.041), and PP MS (P=0.031) than control group. In conclusion, the obtained results demonstrate the probable role of NPY SNPs in susceptibility to MS within the Iranian population. Copyright © 2016 Elsevier Ltd. All rights reserved.
Martin, Nicolas W; Benyamin, Beben; Hansell, Narelle K; Montgomery, Grant W; Martin, Nicholas G; Wright, Margaret J; Bates, Timothy C
2011-01-01
Breast-fed C-allele carriers of the rs174575 single nucleotide polymorphism in the fatty acyl desaturase 2 (FADS2) gene have been reported to show a 6.4 to 7 IQ point advantage over formula-fed C-allele carriers, with no effect of breast-feeding in GG carriers. An Australian sample was examined to determine if an interaction between breast-feeding and the rs174575 single nucleotide polymorphism had any effect on IQ. This hypothesis was tested in more than 700 families of adolescent twins assessed for IQ and breast-feeding, birth weight, and FADS2 polymorphisms, and parental socioeconomic status and education, and maternal FADS2 status. No significant evidence for a moderating effect on IQ of rs174575 C-carrier status and breast-feeding was found, and there no effects of maternal FADS2 status on offspring IQ. In addition, no main effects of any FADS2 polymorphisms on IQ were found when the genotype was kept as two-homozygote and one-heterozygote categories and indeed no evidence for effects of breast-feeding on IQ scores after controlling for parental socioeconomic status and education. The investigation was extended to two additional FADS2 polymorphisms (rs1535 and rs174583), but again, although these polymorphisms code alleles affecting fatty acid metabolism, no main or interaction effects were found on IQ. These results support the view that apparent effects of breast-feeding on IQ reflect differential likelihood of breast-feeding as a function of parental education and did not support the predicted interaction effect of FADS2 and breast-feeding on IQ. Copyright © 2011 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi
2017-06-13
We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.
Zhang, Chang'e; Wang, Wenju; Zhang, Hong'e; Wei, Lulu; Guo, Shuping
2016-06-28
The aim of this meta-analysis was to estimate the association between the FCGR2A rs1801274 polymorphism and the susceptibility to autoimmune diseases more precisely. A meta-analysis was conducted on the association between the FCGR2A gene variants and ADs by allelic contrast, homozygote contrast, the recessive model, and the dominant model. A total of 17 studies with 30 comparisons in different populations and genotype-methods were available for this meta-analysis, including 10 Kawasaki disease (KD), 7 Ulcerative colitis (UC), 6 Crohn's disease (CD), 3 Rheumatoid arthritis (RA), 2 Systemic lupus erythematosus (SLE), 1 Autoimmune thyroid disease (ATD) and 1 diabetes mellitus type 1 (T1D). A significant association between FCGR2A rs1801274 polymorphism were found in KD (OR = 1.409, P < 0.001) and UC (OR = 1.237, P < 0.001). A overall meta-analysis increased risk of AD significant association between FCGR2A rs1801274 gene polymorphism and ADs under allelic (OR = 1.378, P=0.000), homozygous (OR: 1.866, P=0.001), dominant (OR = 1.667, P = 0.000) and recessive (OR = 1.434, P=0.000) in Asian population. Meanwhile, a decreased risk of AD was detected in the allelic (OR= 0.882, P = 0.011), homozygous (OR = 0.777, P = 0.013), dominant (OR = 0.850, P = 0.032) and recessive (OR = 0.840, P = 0.048) in African-American population. This meta-analysis demonstrates that the FCGR2A rs1801274 G-allele confers susceptibility to KD and UC. Data also suggests that the FCGR2A rs1801274 polymorphism may be associated with the susceptibility of multiple ADs in Asian and African-American populations.
Wei, Lulu; Guo, Shuping
2016-01-01
Objectives The aim of this meta-analysis was to estimate the association between the FCGR2A rs1801274 polymorphism and the susceptibility to autoimmune diseases more precisely. Methods A meta-analysis was conducted on the association between the FCGR2A gene variants and ADs by allelic contrast, homozygote contrast, the recessive model, and the dominant model. Results A total of 17 studies with 30 comparisons in different populations and genotype-methods were available for this meta-analysis, including 10 Kawasaki disease (KD), 7 Ulcerative colitis (UC), 6 Crohn's disease (CD), 3 Rheumatoid arthritis (RA), 2 Systemic lupus erythematosus (SLE), 1 Autoimmune thyroid disease (ATD) and 1 diabetes mellitus type 1 (T1D). A significant association between FCGR2A rs1801274 polymorphism were found in KD (OR = 1.409, P < 0.001) and UC (OR = 1.237, P < 0.001). A overall meta-analysis increased risk of AD significant association between FCGR2A rs1801274 gene polymorphism and ADs under allelic (OR = 1.378, P=0.000), homozygous (OR: 1.866, P=0.001), dominant (OR = 1.667, P = 0.000) and recessive (OR = 1.434, P=0.000) in Asian population. Meanwhile, a decreased risk of AD was detected in the allelic (OR= 0.882, P = 0.011), homozygous (OR = 0.777, P = 0.013), dominant (OR = 0.850, P = 0.032) and recessive (OR = 0.840, P = 0.048) in African-American population. Conclusions This meta-analysis demonstrates that the FCGR2A rs1801274 G-allele confers susceptibility to KD and UC. Data also suggests that the FCGR2A rs1801274 polymorphism may be associated with the susceptibility of multiple ADs in Asian and African-American populations. PMID:27270653
Song, Jin-Fang; Wang, Tao; Zhu, Jing; Zhou, Xue-Yan; Lu, Qian; Guo, Hao; Zhang, Fan; Wang, Yan; Li, Wei; Wang, Dan-Dan; Cui, Ya-Wen; Lv, Dong-Mei; Yin, Xiao-Xing
2015-01-01
Repaglinide is a short-acting insulin secretagogue, which often results in considerable interindividual variability in therapeutic efficacy when widely used in a clinical setting. Among various reasons under discussion is genetic polymorphism, especially the genes related to insulin secretion and resistance. Recent studies have described the importance of PPARD in regulating the secretion and resistance of insulin. However, little is known about the impacts of PPARD genetic polymorphism on the efficacy of repaglinide. Therefore, the current study was designed to investigate the associations of PPARD rs2016520 polymorphism with type 2 diabetes mellitus (T2DM) susceptibility and repaglinide therapeutic efficacy in Chinese Han T2DM patients. A total of 338 T2DM patients and 200 healthy subjects were genotyped for PPARD rs2016520 polymorphism by polymerase chain reaction-restriction fragment length polymorphism assay. A total of 84 patients with the same genotypes of CYP2C8*3 139Arg and OATP1B1 521TT were randomized to orally take repaglinide for 8 weeks. Then the pharmacodynamic parameters of repaglinide and biochemical indicators were determined before and after repaglinide treatment. No significant difference was found in either allelic frequency (P = 0.298) or genotype distribution (P = 0.151) of PPARD rs2016520 between T2DM patients and healthy subjects. However, T2DM patients carrying genotype TC showed a significantly lower increase in postprandial serum insulin (mU/L) than those with wild-type TT (P < 0.05). These findings suggest that PPARD rs2016520 polymorphism might influence the therapeutic effect of repaglinide rather than T2DM susceptibility in Chinese Han T2DM patients. © 2014 Wiley Publishing Asia Pty Ltd.
Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.
Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M
2015-01-01
Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.
Zhang, Tao; Liu, Yuan; Hu, Yibo; Zhang, Xiaoqing; Zhong, Lin; Fan, Junwei; Peng, Zhihai
2017-09-05
New-onset diabetes mellitus (NODM) is a common complication after liver transplantation (LT). The small ubiquitin-like modifier 4 (SUMO4) rs237025 polymorphism has been reported to be associated with type 2 diabetes mellitus (T2DM). In this study, we aimed to evaluate the association of donor and recipient SUMO4 rs237025 polymorphisms with NODM and the long-term consequences of NODM after LT. A total of 126 liver transplant patients were enrolled in the study. One single nucleotide polymorphism, SUMO4 rs237025, was genotyped in both donors and recipients. Both donor and recipient SUMO4 rs237025 polymorphisms were found to be significantly associated with NODM after LT. In multivariate analysis, recipient age>50 years, tacrolimus trough concentrations>10ng/mL at 1month after LT, donor and recipient rs237025 genetic variant, and the combined donor and recipient rs237025 genetic variant were independent predictive factors of NODM. Area under the receiver operating characteristic curve (AUROC) analysis indicated the higher predictive ability of the model containing combined donor and recipient rs237025 polymorphisms than the clinical model (p=0.046). Furthermore, Kaplan-Meier survival analysis demonstrated that NODM was related to significantly poorer patient survival in comparison with non-NODM patients (p=0.041). Both donor and recipient SUMO4 rs237025 polymorphisms contribute to the development of NODM after LT and NODM is a frequent complication that negatively affects patient survival. Copyright © 2017. Published by Elsevier B.V.
Meta-Analysis of the Relation Between IL10 Promoter Polymorphisms and Autoimmune Liver Disease Risk.
Qian, Bao-Xin; Ye, Qing; Zhao, Xin-Yu; Han, Tao; Wang, Feng-Mei; Yang, Jie
2018-05-01
Single nucleotide polymorphisms of the IL10 gene have been linked to the occurrence of autoimmune liver disease. We performed a meta-analysis to assess the association between three IL10 promoter polymorphisms (rs1800896, rs1800871, and rs1800872) and the risk of autoimmune hepatitis, primary biliary cholangitis, and primary sclerosing cholangitis. In total, 1420 articles were initially identified through database retrieval. After screening, seven eligible articles were ultimately included in the meta-analysis. A fixed-effect model was used for all Mantel-Haenszel statistics due to the absence of large between-study heterogeneity (all I 2 < 50%, p > 0.1). No association between any of the studied polymorphisms and risk of autoimmune liver disease was detected in the allele, homozygote, heterozygote, dominant, recessive, or carrier genetic models (p association > 0.05). Potential publication bias was excluded using Begg's and Egger's tests. Similar negative results were observed in subgroup analyses and in an analysis of the three haplotypes of rs1800896/rs1800871/rs1800872 (G/C/C, A/C/C, and A/T/A). Our meta-analysis strongly suggests that the IL10 rs1800896, rs1800871, and rs1800872 polymorphisms are not associated with the risk of autoimmune liver disease.
Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder
ERIC Educational Resources Information Center
Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.
2012-01-01
Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…
Zhang, B Q; Fang, W G; Zhang, Y; Liu, S F; Zeng, X J
2017-11-01
Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P <0.001), with an OR for hyperuricemia of 2.89 (95% CI 1.91-4.37, P <0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95% CI 1.94 - 4.62, P <0.001). Subgroup analysis showed that the ORs were 3.83 (95% CI 2.03-7.24, P <0.001) in male and 2.30 (95% CI 1.32-4.00, P =0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95% CI 1.02-10.29, P =0.047) in male and 3.06 (95% CI 1.37-6.84, P =0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95% CI 1
Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F
2016-04-01
Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.
Single nucleotide polymorphisms associated with nonsyndromic cryptorchidism in Mexican patients.
Chávez-Saldaña, M; Vigueras-Villaseñor, R M; Yokoyama-Rebollar, E; Landero-Huerta, D A; Rojas-Castañeda, J C; Taja-Chayeb, L; Cuevas-Alpuche, J O; Zambrano, E
2018-02-01
Cryptorchidism is a frequent genitourinary malformation considered as an important risk factor for infertility and testicular malignancy. The aetiology of cryptorchidism is multifactorial in which certain SNPs, capable of inhibiting the development of the gubernaculum, are implicated. We analysed 16 SNPs by allelic discrimination and automated sequencing in 85 patients and 99 healthy people, with the objective to identify the association between these variants and isolated cryptorchidism. In two different patients with unilateral cryptorchidism, we found the variants rs121912556 and p.R105R of INSL3 gene in a heterozygous form associated with cryptorchidism, so we could considered them as risk factors for cryptorchidism. On the other hand, SNPs rs10421916 of INSL3 gene, as well as the variants rs1555633 and rs7325513 in the RXFP2 gene, and rs3779456 variant of the HOXA10 gene were statistically significant, when the patients and controls were compared and could be considered as protective factors since are predominantly present in controls. The genotype-phenotype correlation did not show statistical significance. With these results, we could conclude that these polymorphisms can be considered as important variants in our population and would contribute in the future knowledge of the aetiology and physiopathology of cryptorchidism. © 2017 Blackwell Verlag GmbH.
Wang, Li; Widatalla, Sarrah E; Whalen, Diva S; Ochieng, Josiah; Sakwe, Amos M
2017-08-02
Breast cancer (BC) patients with late-stage and/or rapidly growing tumors are prone to develop high serum calcium levels which have been shown to be associated with larger and aggressive breast tumors in post and premenopausal women respectively. Given the pivotal role of the calcium sensing receptor (CaSR) in calcium homeostasis, we evaluated whether polymorphisms of the CASR gene at rs1801725 and rs1801726 SNPs in exon 7, are associated with circulating calcium levels in African American and Caucasian control subjects and BC cases. In this retrospective case-control study, we assessed the mean circulating calcium levels, the distribution of two inactivating CaSR SNPs at rs1801725 and rs1801726 in 199 cases and 384 age-matched controls, and used multivariable regression analysis to determine whether these SNPs are associated with circulating calcium in control subjects and BC cases. We found that the mean circulating calcium levels in African American subjects were higher than those in Caucasian subjects (p < 0.001). As expected, the mean calcium levels were higher in BC cases compared to control subjects (p < 0.001), but the calcium levels in BC patients were independent of race. We also show that in BC cases and control subjects, the major alleles at rs1801725 (G/T, A986S) and at rs1801726 (C/G, Q1011E) were common among Caucasians and African Americans respectively. Compared to the wild type alleles, polymorphisms at the rs1801725 SNP were associated with higher calcium levels (p = 0.006) while those at rs1801726 were not. Using multivariable linear mixed-effects models and adjusting for age and race, we show that circulating calcium levels in BC cases were associated with tumor grade (p = 0.009), clinical stage (p = 0.003) and more importantly, with inactivating mutations of the CASR at the rs1801725 SNP (p = 0.038). These data suggest that decreased sensitivity of the CaSR to calcium due to inactivating polymorphisms at rs1801725, may predispose
Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.
2009-01-01
With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267
A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms
ERIC Educational Resources Information Center
Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.
2016-01-01
The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…
Steck, Andrea K; Xu, Ping; Geyer, Susan; Redondo, Maria J; Antinozzi, Peter; Wentworth, John M; Sosenko, Jay; Onengut-Gumuscu, Suna; Chen, Wei-Min; Rich, Stephen S; Pugliese, Alberto
2017-08-01
Genome-wide association studies identified >50 type 1 diabetes (T1D) associated non-human leukocyte antigens (non-HLA) loci. The purpose of this study was to assess the contribution of non-HLA single nucleotide polymorphisms (SNPs) to risk of disease progression. The TrialNet Pathway to Prevention Study follows relatives of T1D patients for development of autoantibodies (Abs) and T1D. Using the Immunochip, we analyzed 53 diabetes-associated, non-HLA SNPs in 1016 Ab-positive, at-risk non-Hispanic white relatives. Effect of SNPs on the development of multiple Abs and T1D. Cox proportional analyses included all substantial non-HLA SNPs, HLA genotypes, relationship to proband, sex, age at initial screening, initial Ab type, and number. Factors involved in progression from single to multiple Abs included age at screening, relationship to proband, HLA genotypes, and rs3087243 (cytotoxic T lymphocyte antigen-4). Significant factors for diabetes progression included age at screening, Ab number, HLA genotypes, rs6476839 [GLIS family zinc finger 3 (GLIS3)], and rs3184504 [SH2B adaptor protein 3 (SH2B3)]. When glucose area under the curve (AUC) was included, factors involved in disease progression included glucose AUC, age at screening, Ab number, relationship to proband, HLA genotypes, rs6476839 (GLIS3), and rs7221109 (CCR7). In stratified analyses by age, glucose AUC, age at screening, sibling, HLA genotypes, rs6476839 (GLIS3), and rs4900384 (C14orf64) were significantly associated with progression to diabetes in participants <12 years old, whereas glucose AUC, sibling, rs3184504 (SH2B3), and rs4900384 (C14orf64) were significant in those ≥12. In conclusion, we identified five non-HLA SNPs associated with increased risk of progression from Ab positivity to disease that may improve risk stratification for prevention trials. Copyright © 2017 by the Endocrine Society
Park, Jongkeun; Song, Kijun; Jang, Yangsoo
2015-01-01
Purpose The aim of the present study was to investigate associations between the renin gene (REN) and the risk of essential hypertension and blood pressure (BP) levels in Koreans. Materials and Methods To outline the functional role of a single nucleotide polymorphism in the transcription of the REN gene, we conducted a case-control study of 1975 individuals: 646 hypertension (HT) patients and 1329 ethnically and age-matched normotensive subjects. Results Logistic regression analysis indicated that the genotypes AA/AG were strongly associated with risk of HT (odds ratio, 1.493; 95% confidence interval, 1.069-2.086, p=0.018) in female subjects. The genotypes AA/AG also showed significant association with higher blood pressure levels, both systolic and diastolic, in postmenopausal HT women (p=0.003 and p=0.017, respectively). Analysis of the promoter containing rs6682082 revealed a 2.4±0.01-fold higher activity in the A variant promoter than the G variant promoter, suggesting that rs6682082 is itself a functional variant. Conclusion We suggest that the A allele of rs6682082 is a positive genetic marker for predisposition to essential hypertension and high BP in Korean women and may be mediated through the transcriptional activation of REN. PMID:25510769
Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.
2017-01-01
Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065
Chatzikyriakidou, Anthoula; Aidinidou, Louiza; Giannopoulos, Andreas; Papadopoulou-Legbelou, Kyriaki; Kalinderi, Kallirhoe; Fidani, Liana
2015-04-01
Kawasaki disease is an acute, febrile syndrome in infancy, characterised by vasculitis of medium-sized arteries, and affects predominantly young children. Family-based studies on Kawasaki disease supports the contribution of genetic factors in disorder manifestation. In a recent genome-wide association study, the polymorphism rs1801274 of FCGR2A [Fc fragment of immunoglobulin G, low-affinity IIa, receptor] gene has been implicated in disease pathogenesis. The aim of the present study was to explore the association of this variant, for the first time, in a group of Kawasaki-diseased patients of Greek origin. A total of 47 Kawasaki-diseased children and 50 control subjects were enrolled in the study. Polymerase chain reaction-restriction fragment length polymorphism assay was performed in rs1801274 genotyping. No association was observed between this polymorphism genotypes' or alleles' distribution between Kawasaki-diseased patients and controls. Furthermore, no association was revealed between this polymorphism and cardiovascular complications in Kawasaki-diseased patients. In the literature, the reported data over this polymorphism association with Kawasaki disease in Caucasian patients are contradictory. In addition, the disease shows low prevalence in the Caucasian populations. Therefore, the independent genetic association studies on rs1801274 with Kawasaki disease in various Caucasian groups increase the amount of genetic data, which could be used in a future meta-analysis, increasing the statistical power of the resultant conclusions.
Association of vdr, cyp27b1, cyp24a1 and mthfr gene polymorphisms with oral lichen planus risk.
Kujundzic, Bojan; Zeljic, Katarina; Supic, Gordana; Magic, Marko; Stanimirovic, Dragan; Ilic, Vesna; Jovanovic, Barbara; Magic, Zvonko
2016-05-01
The current study investigated the association between VDR EcoRV (rs4516035), FokI (rs2228570), ApaI (rs7975232) and TaqI (rs731236), CYP27B1 (rs4646536), CYP24A1 (rs2296241), and MTHFR (rs1801133) gene polymorphisms and risk of oral lichen planus (OLP) occurrence. The study group consisted of 65 oral lichen planus patients and 100 healthy blood donors in the control group. Single nucleotide polymorphisms were genotyped by real time PCR or PCR-restriction fragment length polymorphism (RFLP) method. Heterozygous as well as mutated genotype of vitamin D receptor (VDR) FokI (rs2228570) polymorphism was associated with increased oral lichen planus risk in comparison with wild type genotype (odds ratio (OR) = 3.877, p = 0.017, OR = 38.153, p = 0.001, respectively). A significantly decreased OLP risk was observed for heterozygous genotype of rs2296241 polymorphism in CYP24A1 gene compared with the wild type form (OR = 0.314, p = 0.012). VDR gene polymorphisms ApaI and TaqI were in linkage disequilibrium (D' = 0.71, r(2) = 0.22). Identified haplotype AT was associated with decreased OLP risk (OR = 0.592, p = 0.047). Our results highlight the possible important role of VDR FokI (rs2228570) and CYP24A1 rs2296241 gene polymorphisms for oral lichen planus susceptibility. Identification of new molecular biomarkers could potentially contribute to determination of individuals with OLP predisposition.
Association between MC4R rs17782313 polymorphism and overeating behaviors.
Yilmaz, Z; Davis, C; Loxton, N J; Kaplan, A S; Levitan, R D; Carter, J C; Kennedy, J L
2015-01-01
Melanocortins have a crucial role in appetite and weight regulation. Although the melanocortin 4 receptor (MC4R) gene has been repeatedly linked to obesity and antipsychotic-induced weight gain, the mechanism behind how it leads to this effect in still undetermined. The goal of this study was to conduct an in-depth and sophisticated analysis of MC4R polymorphisms, body mass index (BMI), eating behavior and depressed mood. We genotyped 328 individuals of European ancestry on the following MC4R markers based on the relevant literature on obesity and antipsychotic-induced weight gain: rs571312, rs17782313, rs489693, rs11872992, and rs8087522. Height and weight were measured, and information on depressed mood and overeating behaviors was obtained during the in-person assessment. BMI was associated with rs17782313 C allele; however, this finding did not survive correction for multiple testing (P = 0.018). Although rs17782313 was significantly associated with depressed mood and overeating behaviors, tests of indirect effects indicated that emotional eating and food cravings, rather than depressed mood, uniquely accounted for the effect of this marker and BMI (n = 152). To our knowledge, this is the first study to investigate the link between MC4R rs17782313, mood and overeating behavior, as well as to demonstrate possible mechanisms behind MC4R's influence on body weight. If replicated in a larger sample, these results may have important clinical implications, including potential for the use of MC4R agonists in the treatment of obesity and disordered eating.
Burfeind, Kevin G; Murchison, Charles F; Westaway, Shawn K; Simon, Matthew J; Erten-Lyons, Deniz; Kaye, Jeffrey A; Quinn, Joseph F; Iliff, Jeffrey J
2017-09-01
The glymphatic system is a brain-wide perivascular network that facilitates clearance of proteins, including amyloid β, from the brain interstitium through the perivascular exchange of cerebrospinal fluid and interstitial fluid. The astrocytic water channel aquaporin-4 (AQP4) is required for glymphatic system function, and impairment of glymphatic function in the aging brain is associated with altered AQP4 expression and localization. In human cortical tissue, alterations in AQP4 expression and localization are associated with Alzheimer's disease (AD) status and pathology. Although this suggests a potential role for AQP4 in the development or progression of AD, the relationship between of naturally occurring variants in the human AQP4 gene and cognitive function has not yet been evaluated. Using data from several longitudinal aging cohorts, we investigated the association between five AQP4 single-nucleotide polymorphisms (SNPs) and the rate of cognitive decline in participants with a diagnosis of AD. None of the five SNPs were associated with different rates of AD diagnosis, age of dementia onset in trial subjects. No association between AQP4 SNPs with histological measures of AD pathology, including Braak stage or neuritic plaque density was observed. However, AQP4 SNPs were associated with altered rates of cognitive decline after AD diagnosis, with two SNPS (rs9951307 and rs3875089) associated with slower cognitive decline and two (rs3763040 and rs3763043) associated with more rapid cognitive decline after AD diagnosis. These results provide the first evidence that variations in the AQP4 gene, whose gene product AQP4 is vital for glymphatic pathway function, may modulate the progression of cognitive decline in AD.
García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A
2013-12-01
Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Lin, Liming; Liu, Honglong
2017-01-01
Previous studies have found that the polymorphisms of tumor necrosis factor-α induced protein 3 (TNFAIP3) were associated with several autoimmune diseases. However, the role of TNFAIP3 polymorphisms in type-1 autoimmune hepatitis (AIH-1) remained unclear. The present study aimed to clarify the association of TNFAIP3 polymorphisms with AIH-1 risk in a Chinese Han population. The TaqMan SNP genotyping assay was used to determine the distribution of TNFAIP3 polymorphisms in 432 AIH-1 patients and 500 healthy controls. The association of TNFAIP3 polymorphisms and clinical characteristic was further evaluated. Five TNFAIP3 polymorphisms (rs2230926, rs5029939, rs10499194, rs6920220, rs582757) were analyzed in the present study. No significant association could be observed between rs2230926, rs5029939, rs6920220, rs582757 and the susceptibility to AIH-1 in Chinese Han population. Compared with wild-type genotype CC at rs10499194, individuals carrying CT genotype had a significantly increased risk for developing AIH-1 (OR = 2.32, 95%CI 1.44–3.74). Under a dominant model, CT/TT carriers have a 140% increased risk of AIH-1 than CC carriers (OR = 2.40, 95%CI 1.50–3.87). The rs10499194 T allele was also found to be significantly associated with AIH-1 risk (OR = 2.41, 95%CI 1.51–3.82). In addition, higher serum ALT, AST levels and more common cirrhosis were observed in AIH-1 patients with T allele (CT/TT) than those with CC genotype. In conclusion, TNFAIP3 rs10499194 T allele and CT genotype were associated with an increased risk for AIH-1, suggesting rs10499194 polymorphism as a candidate of susceptibility locus to AIH-1. PMID:28448618
Association of the Risk of Dental Caries and Polymorphism of MBL2 rs11003125 Gene in Iranian Adults.
Mokhtari, Mohammad Javad; Koohpeima, Fatemeh; Hashemi-Gorji, Feyzollah
2018-06-14
This case-control study aimed to investigate the effect of rs11003125 in dental caries. For this purpose, a total number of 404 individuals - from Fars Province in Iran - were studied. The technique of this research was the tetra-primer amplification-refractory mutation system (ARMS)-PCR. Dental caries prevalence among the 404 individuals was assessed by counting the number of decayed, missing, and filled teeth. In this research, individuals were divided into two groups: cases (n = 238) and controls (n = 166), and the peripheral blood samples were used to extract the genomic DNA. For genotyping of DNA, the tetra-primer ARMS-PCR method was conducted using specific primer pairs. While examining MBL2 rs11003125 polymorphism, we found significant differences in the genotype frequencies between the case and the control group. The pooled estimates indicated that the GG and GC genotypes of MBL2 rs11003125 polymorphism significantly increased, and therefore caries risk (OR = 2.40, 95% CI = 1.31-4.40, p = 0.004) under the dominant model. These findings suggested that polymorphism in MBL2 gene was associated with dental caries in Iranian adults. Further verification is needed with more ethnic groups and larger sample sizes to determine whether rs11003125 polymorphism is related to dental caries in other regions or not. © 2018 S. Karger AG, Basel.
VDR polymorphisms are associated with bone mineral density in post-menopausal Mayan-Mestizo women.
Canto-Cetina, Thelma; Cetina Manzanilla, José Antonio; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia
2015-01-01
Osteoporosis is characterized by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic and environmental factors. To analyse the association between two polymorphisms of VDR as well as their haplotypes with BMD in post-menopausal Maya-Mestizo women. This study comprised 600 post-menopausal Maya-Mestizo women. A structured questionnaire for risk factors was applied and BMD was assessed at the lumbar spine (LS) and total hip (TH) by dual-energy X-ray absorptiometry. DNA was extracted from blood leukocytes. Two single-nucleotide polymorphisms of VDR (rs731236 and rs2228570) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analysed with covariance. Haplotype analysis was conducted. TT genotype of rs731236 of VDR had higher BMD at total hip and femoral neck (FN), and one haplotype formed by the two polymorphisms was associated with only TH-BMD variations. This difference was statistically significant after adjustment for confounders. The genotype of rs2228570 of VDR analysis showed no significant differences with BMD variations. The results showed that the TT genotype of rs731236 of VDR and one haplotype formed by rs731236 and rs2228570 polymorphisms were associated with higher BMD at TH and FN.
The role of the RTEL1 rs2297440 polymorphism in the risk of glioma development: a meta-analysis.
Zhang, Cuiping; Lu, Yu; Zhang, Xiaolian; Yang, Dongmei; Shang, Shuxin; Liu, Denghe; Jiang, Kongmei; Huang, Weiqiang
2016-07-01
The regulator of the telomere elongation helicase1 (RTEL1) gene plays a crucial role in the DNA double-stand break-repair pathway by maintaining genomic stability. Recent epidemiological studies showed that the rs2297440 polymorphism in the RTEL1 gene was a potential risk locus for glioma development, but the results were inconclusive. To clarify the association between this polymorphism and the risk of glioma, we performed a comprehensive meta-analysis. The PubMed, EMBASE, Web of Science, and China National Knowledge Infrastructure databases were systematically searched to identify all relevant published studies up to 30 August 2015. Four eligible studies were finally included. The pooled results indicated that the RTEL1 rs2297440 polymorphism moderately increased the risk of glioma in all genetic models. A comparison of the dominant model CT + CC versus TT (OR 1.40; 95 % CI 1.24-1.60; p < 0.001) indicated that having the C allele conferred a 40 % increased risk of developing glioma. In a subgroup analysis based on geographic location (Europe, Asia, and America), there was an association between the rs2297440 polymorphism and the risk of glioma in all three areas. The results of the subgroup analysis based on source of control indicated an elevated risk of glioma in population-based control studies. This meta-analysis demonstrates that the RTEL1 rs2297440 polymorphism plays a moderate, but significant role in the risk of glioma. Further studies with larger sample sizes are necessary to confirm this finding.
Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene.
Matveeva, Marina Yu; Kashina, Elena V; Reshetnikov, Vasily V; Bryzgalov, Leonid O; Antontseva, Elena V; Bondar, Natalia P; Merkulova, Tatiana I
2016-12-22
Germline mutations in the coding sequence of the tumour suppressor APC gene give rise to familial adenomatous polyposis (which leads to colorectal cancer) and are associated with many other oncopathologies. The loss of APC function because of deletion of putative promoter 1A or 1B also results in the development of colorectal cancer. Since the regions of promoters 1A and 1B contain many single nucleotide polymorphisms (SNPs), the aim of this study was to perform functional analysis of some of these SNPs by means of an electrophoretic mobility shift assay (EMSA) and a luciferase reporter assay. First, it was shown that both putative promoters of APC (1A and 1B) drive transcription in an in vitro reporter experiment. From eleven randomly selected SNPs of promoter 1A and four SNPs of promoter 1B, nine and two respectively showed differential patterns of binding of nuclear proteins to oligonucleotide probes corresponding to alternative alleles. The luciferase reporter assay showed that among the six SNPs tested, the rs75612255 C allele and rs113017087 C allele in promoter 1A as well as the rs138386816 T allele and rs115658307 T allele in promoter 1B significantly increased luciferase activity in the human erythromyeloblastoid leukaemia cell line K562. In human colorectal cancer HCT-116 cells, none of the substitutions under study had any effect, with the exception of minor allele G of rs79896135 in promoter 1B. This allele significantly decreased the luciferase reporter's activity CONCLUSION: Our results indicate that many SNPs in APC promoters 1A and 1B are functionally relevant and that allele G of rs79896135 may be associated with the predisposition to colorectal cancer.
Yu, B; Ding, Q; Zheng, T; Jiang, L; Li, Q; Sun, X; Bai, C; Huang, Z
2015-11-01
Defective spermatogenesis is prevalent in infertile men, but the molecular mechanisms underlying its aetiology are largely unknown. In this study, a proposed association between IκBα SNPs, smoking-related ROS and sperm quality was investigated. Two polymorphisms in the IκBα gene, rs2233406 and rs696 were genotyped in 342 controls and 338 patients with defective spermatogenesis from a southern Chinese population. The results showed the rs696 AA genotype to be significantly more common (21.60% versus 14.33%, P = 0.013) and the rs696 GG genotype to be significantly rarer (28.99% versus 37.13%, P = 0.024) in the cases than in the controls. After subjects were stratified into smokers and nonsmokers, these differences were only observed in nonsmokers. Further analysis showed the rs696 AA genotype to be significantly closely associated with defective spermatogenesis in all subjects (P = 0.014, OR = 1.647) and in nonsmokers (P = 0.036, OR = 1.889). In a TM3 cell model, exposure to cigarette smoke condensate was found to activate NF-κB luciferase activity and altered transcriptional level of NF-κB pathway genes. In conclusion, this study demonstrates an association between functional polymorphisms of the IκBα rs696 and cigarette smoking with the risk of defective spermatogenesis, suggesting some interaction between the NF-κB signalling pathway and smoking-related ROS in human spermatogenesis. © 2014 Blackwell Verlag GmbH.
Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong
2017-08-01
MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.
Doğan, Gülnihal Emrem; Demir, Turgut; Aksoy, Hülya; Sağlam, Ebru; Laloğlu, Esra; Yildirim, Abdulkadir
2016-10-01
Matrix-Gla Protein (MGP) is one of the major Gla-containing protein associated with calcification process. It also has a high affinity for Ca 2+ and hydroxyapatite. In this study we aimed to evaluate the MGP rs4236 [A/G] gene polymorphism in association with subgingival dental calculus. Also a possible relationship between MGP gene polymorphism and serum and GCF levels of MGP were examined. MGP rs4236 [A/G] gene polymorphism was investigated in 110 patients with or without subgingival dental calculus, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) techniques. Additionally, serum and GCF levels of MGP of the patients were compared according to subgingival dental calculus. Comparison of patients with and without subgingival dental calculus showed no statistically significant difference in MGP rs4236 [A/G] gene polymorphism (p=0.368). MGP concentrations in GCF of patients with subgingival dental calculus were statistically higher than those without subgingival dental calculus (p=0.032). However, a significant association was not observed between the genotypes of AA, AG and GG of the MGP rs4236 gene and the serum and GCF concentrations of MGP in subjects. In this study, it was found that MGP rs4236 [A/G] gene polymorphism was not to be associated with subgingival dental calculus. Also, that GCF MGP levels were detected higher in patients with subgingival dental calculus than those without subgingival dental calculus independently of polymorphism, may be the effect of adaptive mechanism to inhibit calculus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.
IL-1B rs16944 polymorphism is related to septic shock and death.
Jiménez-Sousa, María Ángeles; Medrano, Luz M; Liu, Pilar; Almansa, Raquel; Fernández-Rodríguez, Amanda; Gómez-Sánchez, Esther; Rico, Lucía; Heredia-Rodríguez, María; Gómez-Pesquera, Estefanía; Tamayo, Eduardo; Resino, Salvador
2017-01-01
IL-1β is a primary mediator of systemic inflammatory response syndrome (SIRS) and it may lead to shock septic. Our aim was to analyse whether IL-1B rs16944 polymorphism is associated with the onset of septic shock and death after major surgery. We performed a case-control study on 467 patients who underwent major cardiac or abdominal surgery. Of them, 205 patients developed septic shock (cases, SS group) and 262 patients developed SIRS (controls, SIRS group). The primary outcome variables were the development of septic shock and death within 90 days after diagnosis of septic shock. The IL-1B rs16944 polymorphism was genotyped by Sequenom's MassARRAY platform. The association analysis was performed under a recessive genetic model (AA vs. GG/GC). The frequency of septic shock was higher in patients with IL-1B rs16944 AA genotype than in patients with IL-1B rs16944 GG/AG genotype when all patients were taken into account (63·6% vs. 41·8%; P = 0·006), cardiac surgery (52·2% vs. 33·3%; P = 0·072) and abdominal surgery (76·2% vs. 50·2%; P = 0·023). However, the IL-1B rs16944 AA genotype was only associated with higher likelihood of septic shock in the analysis of all population [adjusted odds ratio (aOR) = 2·26 (95%CI = 1·03; 4·97; P = 0·042], but not when it was stratified by cardiac surgery (P = 0·175) or abdominal surgery (P = 0·467). Similarly, IL-1B rs16944 AA genotype was also associated with higher likelihood of septic shock-related death in all population [aOR = 2·67 (95%CI = 1·07; 4·97); P = 0·035]. IL-1B rs16944 AA genotype seems to be related to the onset of septic shock and death in patients who underwent major surgery. © 2016 Stichting European Society for Clinical Investigation Journal Foundation.
Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.
Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung
2017-01-01
Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.
Zhang, Li; Wang, Jinxin; Che, Di; Wang, Yanfei; Rong, Xing; Pi, Lei; Xu, Yufen; Li, Wei; Huang, Ping; Chu, Maoping; Gu, Xiaoqiong
2018-06-14
miRNA-146a plays a critical role in innate immune and inflammatory responses. Kawasaki disease involves immune-mediated inflammatory responses, which lead to vascular endothelial injury. However, there has been no study on the association between the miRNA-146a rs2910164 C>G polymorphism and Kawasaki disease risk. We enrolled 532 Kawasaki disease patients and 623 healthy controls from a southern Chinese population, and the miRNA-146a rs2910164 C>G polymorphism was genotyped by the TaqMan method. There was no evidence that this polymorphism was associated with Kawasaki disease. Stratified analysis also showed no significant association. This study indicates that the miRNA-146a rs2910164 C>G polymorphism may not be associated with Kawasaki disease in a southern Chinese population. Larger, multicenter studies are needed to confirm our conclusions. ©2018 The Author(s).
Feng, Yanguo; Cheng, Dejun; Zhang, Chaofeng; Li, Yuchun; Zhang, Zhiying; Wang, Juan; Feng, Xiao
2017-02-01
Accumulating studies have reported inconsistent association between ErbB4 single nucleotide polymorphisms (SNPs) and predisposition to schizophrenia. To better interpret this issue, here we conducted a meta-analysis using published case-control studies. We conducted a systematic search of MEDLINE (Pubmed), Embase (Ovid), Web of Science (Thomson-Reuters) to identify relevant references. The association between ErbB4 SNPs and schizophrenia was assessed by odds ratios (ORs) and 95% confidence intervals (CIs). Between-study heterogeneity was evaluated by I squared (I) statistics and Cochran's Q test. To appraise the stability of results, we employed sensitivity analysis by omitting 1 single study each time. To assess the potential publication bias, we conducted trim and fill analysis. Seven studies published in English comprising 3162 cases and 4264 controls were included in this meta-analysis. Meta-analyses showed that rs707284 is statistically significantly associated with schizophrenia susceptibility among Asian and Caucasian populations under the allelic model (OR = 0.91, 95% CI: 0.83-0.99, P = 0.035). Additionally, a marginal association (P < 0.1) was observed between rs707284 and schizophrenia risk among Asian and Caucasian populations under the recessive (OR = 0.85, 95% CI: 0.72-1.01, P = 0.065) and homozygous (OR = 0.84, 95% CI: 0.68-1.03, P = 0.094) models. In the Asian subgroup, rs707284 was also noted to be marginally associated with schizophrenia under the recessive model (OR = 0.84, 95% CI: 0.70-1.00, P = 0.053). However, no statistically significant association was found between rs839523, rs7598440, rs3748962, and rs2371276 and schizophrenia risk. This meta-analysis suggested that rs707284 may be a potential ErbB4 SNP associated with susceptibility to schizophrenia. Nevertheless, due to the limited sample size in this meta-analysis, more large-scale association studies are still needed to confirm the results.
Watanabe, Eizo; Zehnbauer, Barbara A.; Oda, Shigeto; Sato, Yasunori; Hirasawa, Hiroyuki; Buchman, Timothy G.
2012-01-01
Purpose Management of sepsis in critically ill patients remains difficult and requires prolonged intensive care. Genetic testing has been proposed as a strategy to identify patients at risk for adverse outcome of critical illnesses. Therefore, we wished to determine the influence of heredity on predisposition to poor outcome and on duration of ventilator support of intensive care unit (ICU) patients. Methods A study was conducted from July 2001 to December 2005 in heterogeneous population of patients from 12 US ICUs represented by the Genetic Predisposition to Severe Sepsis (GenPSS) archive. In 1057 Caucasian critically ill patients with SAPS II probability of survival of >0.2 in the US, six functional single nucleotide polymorphisms in relation to inflammatory cytokines and innate immunity (rs1800629, rs16944, rs1800795, rs1800871, rs2569190, and rs909253) were evaluated in terms of mortality and ventilator free days. Results The AA homozygote of TNF(−308) (rs1800629) was most over-represented in the deceased patient group (P = 0.015 with recessive model). The carriage of the TNF(−308)* AA genotype showed significantly higher odds ratio of 2.67(1.29–5.55) (P = 0.008) after adjustment with the covariates. However, the presence of 1, 2, or 3 acute organ dysfunctions was larger prognostic factors for the adverse outcome (OR(95%CI) = 2.98(2.00–4.45), 4.01(2.07–7.77), or 19.95(4.99–79.72), P < 0.001 for all). Kaplan–Mayer plot on ventilator duration of TNF(−308)* AA patient significantly diverged from that of TNF(−308)* (GG + GA) ((AA v GG + GA), Adjusted HR(95%CI) = 2.53(1.11–5.79) with Cox regression, P = 0.028). Conclusions TNF(−308)* AA is significantly associated with susceptibility to adverse outcome and to longer ventilator duration. Therefore, heredity likely affects both predisposition to ICU prognosis as well as the resource utilization. PMID:22749237
USDA-ARS?s Scientific Manuscript database
Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...
Boer, Hink; Westerink, Nico-Derk L; Altena, Renske; Nuver, Janine; Dijck-Brouwer, D A Janneke; van Faassen, Martijn; Klont, Frank; Kema, Ido P; Lefrandt, Joop D; Zwart, Nynke; Boezen, H Marike; Smit, Andries J; Meijer, Coby; Gietema, Jourik A
2016-02-01
Chemotherapy-treated testicular cancer survivors are at risk for development of the metabolic syndrome, especially in case of decreased androgen levels. Polymorphisms in the gene encoding steroid 5-α-reductase type II (SRD5A2) are involved in altered androgen metabolism. We investigated whether single-nucleotide polymorphisms (SNPs) rs523349 (V89L) and rs9282858 (A49T) in SRD5A2 are associated with cardiometabolic status in testicular cancer survivors. In 173 chemotherapy-treated testicular cancer survivors, hormone levels and cardiometabolic status were evaluated cross-sectionally (median 5 years [range 3-20] after chemotherapy) and correlated with SNPs in SRD5A2. The metabolic syndrome was more prevalent in survivors who were homozygous or heterozygous variant for SRD5A2 rs523349 compared to wild type (33% versus 19%, P = 0.032). In particular, patients with lower testosterone levels (<15 nmol/l) and a variant genotype showed a high prevalence of the metabolic syndrome (66.7%). Mean intima-media thickness of the carotid artery and urinary albumin excretion, both markers of vascular damage, were higher in the group of survivors homozygous or heterozygous variant for rs523349 (0.62 versus 0.57 mm, P = 0.026; 5.6 versus 3.1 mg/24 h, P = 0.017, respectively). No association was found between cardiometabolic status and SNP rs9282858 in SRD5A2. Metabolic syndrome develops more frequently in testicular cancer survivors homozygous or heterozygous variant for SNP rs523349 in SRD5A2. Altered androgen sensitivity appears to be involved in the development of adverse metabolic and vascular changes in testicular cancer survivors and is a target for intervention. Copyright © 2015 Elsevier Ltd. All rights reserved.
Functional Polymorphisms of FAS and FASL Gene and Risk of Breast Cancer – Pilot Study of 134 Cases
Fazaeli, Aliakbar; Eskandari-Nasab, Ebrahim; Arbabi, Farshid; Mashhadi, Mohammad Ali; Taheri, Mohsen; Chaabane, Wiem; Jain, Mayur V.; Łos, Marek J.
2013-01-01
Fas/Fas ligand (FasL) system is one of the key apoptotic signaling entities in the extrinsic apoptotic pathway. De-regulation of this pathway, i.e. by mutations may prevent the immune system from the removal of newly-formed tumor cells, and thus lead to tumor formation. The present study investigated the association between −1377 G/A (rs2234767) and −670 A/G (rs1800682) polymorphisms in Fas as well as single nucleotide polymorphisms INV2nt −124 A/G (rs5030772) and −844 C/T (rs763110) in FasL in a sample of Iranian patients with breast cancer. This case-control study was done on 134 breast cancer patients and 152 normal women. Genomic DNA was extracted from whole blood samples. The polymorphisms were determined by using tetra-ARMS-PCR method. There was no significant difference in the genotype distribution of FAS rs2234767 polymorphism between cases and controls. FAS rs1800682, FASL rs5030772, and FASL rs763110 genotypes showed significant associations with an increasing risk of breast cancer (odds ratio OR = 3.18, P = 0.019; OR = 5.08, P = 0.012; OR = 2.40, P = 0.024, respectively). In conclusion, FAS rs2234767 was not associated with breast cancer risk. Though, FAS rs1800682, FASL rs5030772, and FASL rs763110 polymorphisms were associated with the risk of breast cancer in the examined population. PMID:23326385
Association between MC4R rs17782313 Polymorphism and Overeating Behaviours
Yilmaz, Zeynep; Davis, Caroline; Loxton, Natalie J.; Kaplan, Allan S.; Levitan, Robert D.; Carter, Jacqueline C.; Kennedy, James L.
2014-01-01
Background/Objectives Melanocortins play a crucial role in appetite and weight regulation. Although the melanocortin 4 receptor (MC4R) gene has been repeatedly linked to obesity and antipsychotic-induced weight gain, the mechanism behind how it leads to this effect in still undetermined. The goal of this study was to conduct an in-depth and sophisticated analysis of MC4R polymorphisms, body mass index (BMI), eating behaviour, and depressed mood. Subjects/Methods We genotyped 328 individuals of European ancestry on the following MC4R markers based on the relevant literature on obesity and antipsychotic-induced weight gain: rs571312, rs17782313, rs489693, rs11872992, and rs8087522. Height and weight were measured, and information on depressed mood and overeating behaviours was obtained during the in-person assessment. Results BMI was associated with rs17782313 C allele; however this finding did not survive correction for multiple testing (p=0.018). Although rs17782313 was significantly associated with depressed mood and overeating behaviours, tests of indirect effects indicated that emotional eating and food cravings, rather than depressed mood, uniquely accounted for the effect of this marker and BMI (n=152). Conclusions To our knowledge, this is the first study to investigate the link between MC4R rs17782313, mood and overeating behaviour, as well as to demonstrate possible mechanisms behind MC4R’s influence on body weight. If replicated in a larger sample, these results may have important clinical implications, including potential for the use of MC4R agonists in the treatment of obesity and disordered eating. PMID:24827639
Wang, Shitao; He, Feiyan; Wang, Ying
2015-06-01
The insulin-degrading enzyme (IDE) gene is a strong positional and biological candidate for late-onset Alzheimer disease (LOAD) susceptibility, with recent studies independently demonstrating an association between IDE gene variants and LOAD. However, previous data have been controversial. To investigate the relationship between IDE gene polymorphisms and LOAD risk, a case-control association study of 406 Han Chinese participants in Xinjiang, China, was undertaken. The LOAD and control groups consisted of 202 and 204 participants, respectively. The single-nucleotide polymorphisms rs1887922 and rs1999764 of the IDE gene were linked to LOAD incidence. The presence of the CT+CC genotype of rs1999764 had a protective effect compared to the TT genotype (adjusted P=.0001; odds ratio [OR]=0.226; 95% confidence interval [CI]=0.116-0.441), while the CT+CC genotype of rs1887922 was associated with increased LOAD risk (adjusted P=.0001; OR=3.640; 95% CI=1.889-7.016). Moreover, the effects of rs1887922 and rs1999764 were associated with LOAD risk independent of the apolipoprotein E ∊4 polymorphism and were more significant in men and women, respectively. These results demonstrate that the polymorphisms rs1887922 and rs1999764 of the IDE gene are associated with LOAD susceptibility in the Xinjiang Han population. © The Author(s) 2014.
Kupfer, Sonia S.; Torres, Jada Benn; Hooker, Stanley; Anderson, Jeffrey R.; Skol, Andrew D.; Ellis, Nathan A.; Kittles, Rick A.
2009-01-01
Regions on chromosome 8q24 harbor susceptibility alleles for multiple cancers including colorectal (region 3) and prostate cancer (regions 1–4). The objectives of the present study were (i) to test whether single-nucleotide polymorphisms (SNPs) in region 4 are associated with colorectal cancer (CRC) in European or African Americans; (ii) to test whether 8q24 SNPs previously shown to be associated with colorectal and prostate cancer also show association in our multiethnic series and (iii) to test for association between 100 ancestry informative markers (AIMs) and CRC in both the African American and European American cohorts. In total, we genotyped nine markers on 8q24 and 100 unlinked AIMs in 569 CRC cases and 439 controls (490 European Americans and 518 African Americans) obtained retrospectively from a hospital-based sample. We found rs7008482 in 8q24 region 4 to be significantly associated with CRC in European Americans (P = 0.03). Also in region 4, we found that a second SNP, rs16900305, trended toward association with CRC in African Americans. The rs6983267 in region 3, previously implicated in CRC risk, trended toward association with disease in European Americans but not in African Americans. Finally, none of the 100 AIMs tested for association reached statistical significance after correction for multiple hypothesis testing. In summary, these results are evidence that 8q24 region 4 contains novel CRC-associated alleles in European and African Americans. PMID:19520795
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia
2017-12-01
Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.
Ambreen, Fareeha; Ismail, Muhammad; Qureshi, Irfan Zia
2015-01-01
To study the association of serum levels of inflammatory mediators and angiogenic factors with genetic polymorphism in Pakistani age-related macular degeneration (AMD) patients. This was a cross-sectional and case-control study that included 90 AMD patients diagnosed through slit-lamp examination, fundoscopy, and ocular coherence tomography. For reference and comparison purposes, 100 healthy age-matched subjects (controls) were also recruited. IL-6, IL-8, VEGF, and CRP levels were estimated in the serum samples of patients and control subjects. Using restriction fragment length polymorphism, single nucleotide polymorphisms were studied in IL-6 (rs1800795, rs1800796, rs1800797), IL-8 (rs4073, rs2227306, rs2227543), VEGF (rs3025039, rs699947), and CRP genes (rs1205, rs1130864). Since the data were obtained from a sample population, the Box-Cox transformation algorithm was applied to reduce heterogeneity of error. Multivariate analyses of variance (M-ANOVA) were applied on the transformed data to investigate the association of serum levels of IL-6, IL-8, VEGF, and CRP with AMD. Genotype and allele frequencies were compared through χ(2) tests applying Hardy-Weinberg equilibrium. The serum concentrations of IL-6 and IL-8, VEGF, and CRP between homozygotes and heterozygotes were compared through one-way ANOVA. Significance level was p<0.05. Compared to control subjects, serum IL-6 (p<0.0001), IL-8 (p<0.0001), VEGF (p<0.0001), and CRP (p<0.0001) levels were significantly elevated in the AMD patients. For rs1800795, patients with the GG genotype showed significantly raised levels of IL-6 compared to those with GC and CC genotypes (p<0.0001). Serum IL-8 levels were significantly higher in patients with the GG genotype compared to the GC and CC genotypes for the single nucleotide polymorphism (SNP) rs2227543 (p<0.002). Similarly, significantly higher VEGF levels were detected for genotype TT for rs3025039 SNP (p<0.038). However, no significant alteration in serum CRP levels
Wang, Geng-Fu; Ye, Sheng; Gao, Lei; Han, Yu; Guo, Xuan; Dong, Xiao-Peng; Su, Yuan-Yuan; Zhang, Xin
2018-05-10
Increasing evidence has revealed that genetic variants in Reelin (RELN) gene, especially single-nucleotide polymorphisms (SNPs), correlate with autistic spectrum disorders (ASD) risk; however, no consensus have been reached. This study aimed to provide additional evidence for the association between two SNPs of RELN (i.e., rs736707, rs2229864) and ASD risk, as well as the relationship between RELN gene and symptom-based and developmental deficits of ASD patients in Chinese Han children and adolescents. 157 ASD subjects and 256 typical development (TD) controls were genotyped by TaqMan® genotyping assay. ASD patients were assessed by Childhood Autism Rating Scale (CARS), Autism Behavior Checklist (ABC), and Early Childhood Development Questionnaire (ECDQ). We found that SNP rs2229864 was associated with the genetic predisposition of ASD, whereas a negative association between SNP rs2229864 and symptom-based and developmental features was detected. In contrast, RELN rs736707 correlated with the sensory subscale of the ABC, the relating subscale of the ABC and the total score of ABC, although we did not detect a significant association between SNP rs736707 and ASD risk. Furthermore, a significant rs736707-rs2229864 haplotype was detected. Individuals with a CC haplotype were more likely to have ASD, but individuals with a CT haplotype had more chance be TD controls. Further studies using more samples and including more gene variants in RELN are warranted to confirm our results. Copyright © 2018 Elsevier B.V. All rights reserved.
Han, Lin; Xin, Ruosai; Sun, Jian; Hou, Feng; Li, Changgui; Hu, Xinlin; Liu, Zhen; Wang, Yao; Li, Xinde; Ren, Wei; Wang, Xuefeng; Jia, Zhaotong
2015-10-01
OBJECTIVE To assess the association of single nucleotide polymorphisms (SNPs) of susceptibility genes of type 2 diabetes mellitus (T2DM) with liability to gout among ethnic Han Chinese males from coastal region of Shandong province. METHODS Seven SNPs within the susceptibility genes of T2DM, including rs10773971(G/C) and rs4766398(G/C) of WNT5B gene, rs10225163(G/C) of JAZF1 gene, rs2069590(T/A) of BDKRB2 gene, rs5745709(G/A) of HGF gene, rs1991914(C/A) of OTOP1 gene and rs2236479(G/A) of COL18A1 gene, were typed with a custom-made Illumina GoldenGate Genotyping assay in 480 male patients with gout and 480 male controls. Potential association was assessed with the chi-square test. RESULTS No significant difference was detected for the 7 selected SNPs in terms of genotypic and allelic frequencies (P > 0.05). When age and body mass index (BMI) were adjusted, the 7 genetic variants still showed no significant association with gout. CONCLUSION The genotypes of the 7 selected SNPs are not associated with gout in ethnic Han Chinese male patients from the coastal region of Shandong province. However, the results need to be replicated in larger sets of patients collected from other regions and populations.
Mortazavi, Elnaz; Eslami, Behnaz; Aghahosseini, Parisa; Ahron, Fatemeh; Amininejad, Armagan; Mahmoodi, Sepideh; Satarpour, Hadis; Radmanesh, Nilofar; Rassi, Hossein
2017-10-01
Type II diabetes mellitus (T2DM) is the prevalent type of diabetes, including 90% of the cases world-wide. Helicobacter pylori plays a pathogenic role in the development of T2DM. The host genetic factors have a significant impact on the clinical outcome and anatomical distribution of H. pylori infection and polymorphisms in several genes such as tumor necrotic factor (TNF)-α and mannose-binding lectin (MBL) and are considered to increase the risk for the development of T2DM. In this study, we investigate the prevalence rate of H. pylori infection and its relationship to MBL rs1800450 and TNF-α rs1800620 polymorphism in T2DM. In this case-control study, 174 patients with type II diabetes and 185 healthy controls were studied. Also, demographics, physical, and biochemical parameters were performed in all patients. The DNA extracted from blood specimens was amplified by H. pylori cagA-specific primers. The MBL rs1800450 and TNF-α rs1800620 genotyping were detected by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR). The results show that H. pylori cagA positivity was detected in 42.82% of the diabetic patients and in 22.16% of the control group, and H. pylori infection was closely correlated with MBL rs1800450 AA genotype and TNF-α rs1800620 GG genotype when compared with healthy controls. Furthermore, these two genotypes were strongly associated with H. pylori cagA(+) samples when compared with cagA(-) samples. In addition, the presence of H. pylori cagA(+) infection was significantly associated with the elevated serum levels of total cholesterol and low-density lipoprotein cholesterol. In general, it can be concluded that molecular analysis of MBL rs1800450 AA genotype and TNF-α rs1800620 AA genotype is important in the early detection and treatment of T2DM with H. pylori cagA(+) infection.
da Silva Calixto, Poliane; Lopes, Otávio Sérgio; Dos Santos Maia, Mayara; Herrero, Sylvia Satomi Takeno; Longui, Carlos Alberto; Melo, Cynthia Germoglio Farias; de Carvalho Filho, Ivan Rodrigues; Soares, Leonardo Ferreira; de Medeiros, Arnaldo Correia; Delatorre, Plínio; Khayat, André Salim; Burbano, Rommel Rodriguez; Lima, Eleonidas Moura
2018-07-01
Basal cell carcinoma - BCC is considered a multifactorial neoplasm involving genetic, epigenetic and environmental factors. Where UVB radiation is considered the main physical agent involved in BCC carcinogenesis. The Brazil and state of Paraíba are exposed to high levels of UVB rays. The mismatch repair - MMR is important DNA repair mechanisms to maintain replication fidelity. Therefore, single nucleotide polymorphisms (SNPs) in genes encoding proteins involved in MMR may be potential molecular markers of susceptibility to BCC. The objective of this study was to evaluate and describe for the first time the SNPs rs560246973, rs2303425 and rs565410865 and risk of developing BCC. The present study analyzed 100 samples of paraffin-embedded tissue from patients with histopathological diagnosis of BCC and 100 control samples. The results were obtained by genotyping method, Dideoxy Unique Allele Specific - PCR (DSASP). The SNPs rs2303425 were not associated with Basal Cell Carcinoma. However, the SNPs rs560246973 and rs565410865 was shown to be associated with the development of BCC when compared to control samples (P < 0.0001). The SNPs rs565410865 was also statistical significance between the genotypes of and the age group (p = 0.0027) and tumor location (p = 0,0191). The result suggests that SNPs rs2303425 and rs565410865 are associated with susceptibility to the development of BCC in the Brazilian population and may be considered as potential molecular markers for BCC.
Relationship between IL1 gene polymorphisms and periodontal disease in Japanese women.
Tanaka, Keiko; Miyake, Yoshihiro; Hanioka, Takashi; Arakawa, Masashi
2014-04-01
Epidemiological evidence on the relationship between IL1A and/or IL1B polymorphisms and periodontal disease is inconsistent. We investigated associations between three IL1 single-nucleotide polymorphisms (SNPs) in genes encoding interleukin (IL) -1α (rs1800587) and IL-1β (rs1143634 and rs16944) and the risk of periodontal disease among young Japanese women. A case-control study was performed with a total of 1150 women, including 131 subjects who had at least one tooth with a probing pocket depth of 4 mm or deeper and 1019 periodontally healthy controls. Compared with a reference group of women with the GG genotype of SNP rs16944, those with the GA genotype had a significantly reduced risk of periodontal disease, while there was no significant relationship between the AA genotype and periodontal disease. No evident relationships were observed between SNP rs1800587 or rs1143634 and periodontal disease. Our study did not reveal any evidence of interaction between the IL1 polymorphisms and smoking. The results of this study showed that the heterozygous variant genotype of the IL1 rs16944 was significantly associated with a reduced risk of periodontal disease in young Japanese women. Smoking did not significantly modify the gene-disease associations under study.
Relationship Between IL1 Gene Polymorphisms and Periodontal Disease in Japanese Women
Miyake, Yoshihiro; Hanioka, Takashi; Arakawa, Masashi
2014-01-01
Epidemiological evidence on the relationship between IL1A and/or IL1B polymorphisms and periodontal disease is inconsistent. We investigated associations between three IL1 single-nucleotide polymorphisms (SNPs) in genes encoding interleukin (IL) -1α (rs1800587) and IL-1β (rs1143634 and rs16944) and the risk of periodontal disease among young Japanese women. A case–control study was performed with a total of 1150 women, including 131 subjects who had at least one tooth with a probing pocket depth of 4 mm or deeper and 1019 periodontally healthy controls. Compared with a reference group of women with the GG genotype of SNP rs16944, those with the GA genotype had a significantly reduced risk of periodontal disease, while there was no significant relationship between the AA genotype and periodontal disease. No evident relationships were observed between SNP rs1800587 or rs1143634 and periodontal disease. Our study did not reveal any evidence of interaction between the IL1 polymorphisms and smoking. The results of this study showed that the heterozygous variant genotype of the IL1 rs16944 was significantly associated with a reduced risk of periodontal disease in young Japanese women. Smoking did not significantly modify the gene–disease associations under study. PMID:24460370
Kim, Johanna I; Kim, Jae-Won; Park, Jong-Eun; Park, Subin; Hong, Soon-Beom; Han, Doug Hyun; Cheong, Jae Hoon; Choi, Jae-Won; Lee, Sumin; Kim, Bung-Nyun
2017-08-01
We investigated the possible association between two NMDA subunit gene polymorphisms (GRIN2B rs2284411 and GRIN2A rs2229193) and treatment response to methylphenidate (MPH) in attention-deficit/hyperactivity disorder (ADHD). A total of 75 ADHD patients aged 6-17 years underwent 6 months of MPH administration. Treatment response was defined by changes in scores of the ADHD-IV Rating Scale (ADHD-RS), clinician-rated Clinical Global Impression-Improvement (CGI-I), and Continuous Performance Test (CPT). The association of the GRIN2B and GRIN2A polymorphisms with treatment response was analyzed using logistic regression analyses. The GRIN2B rs2284411 C/C genotype showed significantly better treatment response as assessed by ADHD-RS inattention ( p=0.009) and CGI-I scores ( p=0.009), and there was a nominally significant association in regard to ADHD-RS hyperactivity-impulsivity ( p=0.028) and total ( p=0.023) scores, after adjusting for age, sex, IQ, baseline Clinical Global Impression-Severity (CGI-S) score, baseline ADHD-RS total score, and final MPH dose. The GRIN2B C/C genotype also showed greater improvement at the CPT response time variability ( p<0.001). The GRIN2A G/G genotype was associated with a greater improvement in commission errors of the CPT compared to the G/A genotype ( p=0.001). The results suggest that the GRIN2B rs2284411 genotype may be an important predictor of MPH response in ADHD.
Akinyemi, Rufus; Arnett, Donna K; Tiwari, Hemant K; Ovbiagele, Bruce; Sarfo, Fred; Srinivasasainagendra, Vinodh; Irvin, Marguerite Ryan; Adeoye, Abiodun; Perry, Rodney T; Akpalu, Albert; Jenkins, Carolyn; Owolabi, Lukman; Obiako, Reginald; Wahab, Kolawole; Sanya, Emmanuel; Komolafe, Morenikeji; Fawale, Michael; Adebayo, Philip; Osaigbovo, Godwin; Sunmonu, Taofiki; Olowoyo, Paul; Chukwuonye, Innocent; Obiabo, Yahaya; Akpa, Onoja; Melikam, Sylvia; Saulson, Raelle; Kalaria, Raj; Ogunniyi, Adesola; Owolabi, Mayowa
2017-08-15
Inherited genetic variations offer a possible explanation for the observed peculiarities of stroke in sub - Saharan African populations. Interleukin-6 polymorphisms have been previously associated with ischemic stroke in some non-African populations. Herein we investigated, for the first time, the association of genetic polymorphisms of IL-6, CDKN2A- CDKN2B and other genes with ischemic stroke among indigenous West African participants in the Stroke Investigative Research and Education Network (SIREN) Study. Twenty-three previously identified single nucleotide polymorphisms (SNPs) in 14 genes of relevance to the neurobiology of ischemic stroke were investigated. Logistic regression models adjusting for known cardiovascular disease risk factors were constructed to assess the associations of the 23 SNPs in rigorously phenotyped cases (N=429) of ischemic stroke (Men=198; Women=231) and stroke- free (N=483) controls (Men=236; Women=247). Interleukin-6 (IL6) rs1800796 (C minor allele; frequency: West Africans=8.6%) was significantly associated with ischemic stroke in men (OR=2.006, 95% CI=[1.065, 3.777], p=0.031) with hypertension in the model but not in women. In addition, rs2383207 in CDKN2A/CDKN2B (minor allele A with frequency: West Africans=1.7%) was also associated with ischemic stroke in men (OR=2.550, 95% CI=[1.027, 6.331], p=0.044) with primary covariates in the model, but not in women. Polymorphisms in other genes did not show significant association with ischemic stroke. Polymorphisms rs1800796 in IL6 gene and rs2383207 in CDKN2A/CDKN2B gene have significant associations with ischemic stroke in indigenous West African men. CDKN2A/CDKN2B SNP rs2383207 is independently associated with ischemic stroke in indigenous West African men. Further research should focus on the contributions of inflammatory genes and other genetic polymorphisms, as well as the influence of sex on the neurobiology of stroke in people of African ancestry. Copyright © 2017 Elsevier B
2011-01-01
Background Preeclampsia (PE) is the first worldwide cause of death in pregnant women, intra-uterine growth retardation, and fetal prematurity. Some vascular endothelial grown factor gene (VEGF) polymorphisms have been associated to PE and other pregnancy disturbances. We evaluated the associations between VEGF genotypes/haplotypes and PE in Mexican women. Methods 164 pregnant women were enrolled in a case-control study (78 cases and 86 normotensive pregnant controls). The rs699947 (-2578C/A), rs1570360 (-1154G/A), rs2010963 (+405G/C), and rs25648 (-7C/T), VEGF variants were discriminated using Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) methods or Taqman single nucleotide polymorphism (SNP) assays. Results The proportions of the minor allele for rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs were 0.33, 0.2, 0.39, and 0.17 in controls, and 0.39, 0.23, 0.41, and 0.15 in cases, respectively (P values > 0.05). The most frequent haplotypes of rs699947, rs1570360, rs2010963, and rs25648 VEGF SNPs, were C-G-C-C and C-G-G-C with frequencies of 0.39, 0.21 in cases and 0.37, 0.25 in controls, respectively (P values > 0.05) Conclusion There was no evidence of an association between VEGF alleles, genotypes, or haplotypes frequencies and PE in our study. PMID:21575227
Yu, Yung-Luen; Su, Kuo-Jung; Hsieh, Ming-Ju; Wang, Shian-Shiang; Wang, Po-Hui; Weng, Wei-Chun; Yang, Shun-Fa
2014-01-01
The gene EZH2, the polycomb group protein enhancer of zeste 2, encodes a transcriptional repressor that also serves as a histone methyltransferase that is associated with progression to more advanced disease in a variety of malignancies. EZH2 expression level in urothelial cell carcinoma (UCC) is highly correlated with tumor aggressiveness, but it has not been determined if specific EZH2 genetic variants are associated with UCC risk. This study investigated the potential associations of EZH2 single-nucleotide polymorphisms with UCC susceptibility and its clinicopathologic characteristics. A total of 233 UCC patients and 552 cancer-free controls, all of whom were from Taiwan, were analyzed for four EZH2 single-nucleotide polymorphisms (rs6950683, rs2302427, rs3757441, and rs41277434) using real-time PCR genotyping. After adjusting for other co-variants, we found that individuals carrying at least one C allele at EZH2 rs6950683 had a lower risk of developing UCC than did major allele carriers. The CCCA or TGTA haplotype among the four EZH2 sites was also associated with a reduced risk of UCC. Furthermore, UCC patients who carried at least one G allele at rs2302427 had a lower invasive tumor stage than did patients carrying the major allele. The rs6950683 SNPs of EZH2 might contribute to the prediction of UCC susceptibility. This is the first study to provide insight into risk factors associated with EZH2 variants in carcinogenesis of UCC in Taiwan.
Kasap, Burcu; Öztürk Turhan, Nilgün; Edgünlü, Tuba; Duran, Müzeyyen; Akbaba, Eren; Öner, Gökalp
2016-01-06
The G-protein-coupled estrogen receptor (GPR30, GPER-1) is a member of the G-protein-coupled receptor 1 family and is expressed significantly in uterine leiomyomas. To understand the relationship between GPR30 single nucleotide polymorphisms and the risk of leiomyoma, we measured the follicle-stimulating hormone (FSH) and estradiol (E2) levels of 78 perimenopausal healthy women and 111 perimenopausal women with leiomyomas. The participants' leiomyoma number and volume were recorded. DNA was extracted from whole blood with a GeneJET Genomic DNA Purification Kit. An amplification-refractory mutation system polymerase chain reaction approach was used for genotyping of the GPR30 gene (rs3808350, rs3808351, and rs11544331). The differences in genotype and allele frequencies between the leiomyoma and control groups were calculated using the chi-square (χ2) and Fischer's exact test. The median FSH level was higher in controls (63 vs. 10 IU/L, p=0.000), whereas the median E2 level was higher in the leiomyoma group (84 vs. 9.1 pg/mL, p=0.000). The G allele of rs3808351 and the GG genotype of both the rs3808350 and rs3808351 polymorphisms and the GGC haplotype increased the risk of developing leiomyoma. There was no significant difference in genotype frequencies or leiomyoma volume. However, the GG genotype of the GPR30 rs3808351 polymorphism and G allele of the GPR30 rs3808351 polymorphism were associated with the risk of having a single leiomyoma. Our results suggest that the presence of the GG genotype of the GPR30 rs3808351 polymorphism and the G allele of the GPR30 rs3808351 polymorphism affect the characteristics and development of leiomyomas in the Turkish population.
G-protein-coupled estrogen receptor-30 gene polymorphisms are associated with uterine leiomyoma risk
Kasap, Burcu; Turhan, Nilgün Öztürk; Edgünlü, Tuba; Duran, Müzeyyen; Akbaba, Eren; Öner, Gökalp
2016-01-01
The G-protein-coupled estrogen receptor, GPER-1) is a member of the G-protein-coupled receptor 1 family and is expressed significantly in uterine leiomyomas. To understand the relationship between GPR30 single nucleotide polymorphisms and the risk of leiomyoma, we measured the follicle-stimulating hormone (FSH) and estradiol (E2) levels of 78 perimenopausal healthy women and 111 perimenopausal women with leiomyomas. The participants’ leiomyoma number and volume were recorded. DNA was extracted from whole blood with a GeneJET Genomic DNA Purification Kit. An amplification-refractory mutation system polymerase chain reaction approach was used for genotyping of the GPR30 gene (rs3808350, rs3808351, and rs11544331). The differences in genotype and allele frequencies between the leiomyoma and control groups were calculated using the chi-square (χ2) and Fischer’s exact test. The median FSH level was higher in controls (63 vs. 10 IU/L, p=0.000), whereas the median E2 level was higher in the leiomyoma group (84 vs. 9.1 pg/mL, p=0.000). The G allele of rs3808351 and the GG genotype of both the rs3808350 and rs3808351 polymorphisms and the GGC haplotype increased the risk of developing leiomyoma. There was no significant difference in genotype frequencies or leiomyoma volume. However, the GG genotype of the GPR30 rs3808351 polymorphism and G allele of the GPR30 rs3808351 polymorphism were associated with the risk of having a single leiomyoma. Our results suggest that the presence of the GG genotype of the GPR30 rs3808351 polymorphism and the G allele of the GPR30 rs3808351 polymorphism affect the characteristics and development of leiomyomas in the Turkish population. PMID:26773178
Correlation between facial morphology and gene polymorphisms in the Uygur youth population.
He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao
2017-04-25
Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.
Zhou, Futao; Haina, Dong
2017-06-01
Genetic variants of the bridging integrator 1 (BIN1) at the rs7561528 single nucleotide polymorphism were implicated in increased risk of Alzheimer's disease in several case-control association studies. However, the studies have reported apparently conflicting results. Here, we searched the PubMed and Google Scholar databases. In total, 17,179 AD patients and 17,448 healthy controls (HCs) from 18 studies are included in the current study to examine the association between this polymorphism and AD risk. Significant associations of the SNP rs242557 with AD are found under allelic [A vs. G: odds ratio (OR)=0.86, 95% confidence interval (CI)=0.78, 0.96, P=0.006], dominant (AA+AG vs. GG: OR=0.87, 95% CI=0.77, 0.97, P=0.01), recessive (AA vs. AG+GG: OR=0.86, 95% CI=0.76, 0.98, P=0.21), homozygous (AA vs. GG: OR=0.86, 95% CI=0.76, 0.99, P=0.03) and heterozygous (AG vs. GG: OR=0.87, 95% CI=0.83, 0.92, P<0.00001) models in the pooled populations, under allelic (OR=0.77, 95% CI=0.65, 0.91, P=0.002), dominant (OR=0.75, 95% CI=0.63, 0.90, P=0.001) and heterozygous (OR =0.79, 95% CI=0.70, 0.88, P<0.0001) models in East Asian population, under heterozygous (OR=0.89, 95% CI=0.84, 0.94, P<0.0001) model in Caucasian population. The results of the current meta-analysis suggest that the rs7561528 A allele carriers may be a protective factor against susceptibility to AD under all the genetic models in the pooled populations and under allelic and dominant model in East Asian population, and individuals with A/G heterozygous genotype are not prone to suffer from AD in both Asians and Caucasians. Copyright © 2017 Elsevier B.V. All rights reserved.
Ahmed, Tayyaba; Nawaz, Saira; Noreen, Rabia; Bangash, Kashif Sardar; Rauf, Abdur; Younis, Muhammad; Anwar, Khursheed; Khawaja, Muhammad Athar; Azam, Maleeha; Qureshi, Abid Ali; Akhter, Saeed; Kiemeney, Lambertus A; Qamar, Raheel; Ali, Syeda Hafiza Benish
2018-03-01
Altered DNA repair capacity may affect an individual's susceptibility to cancers due to compromised genomic integrity. This study was designed to elucidate the association of selected polymorphisms in DNA repair genes with urothelial bladder carcinoma (UBC). OGG1 rs1052133 and rs2304277, XRCC1 rs1799782 and rs25487, XRCC3 rs861539, XPC rs2228001, and XPD rs13181 were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) in 200 UBC cases and 200 controls. We found association of OGG1 rs2304277 [odds ratio (OR) GG = 3.55, 95% confidence interval (CI) = 1.79-7.06] and XPC rs2228001 (OR AC = 2.38, 95% CI = 1.43-3.94) with UBC. In stratified analysis with respect to smoking status, OGG1 rs2304277 and XPC rs2228001 exhibited increased risk in smokers [(rs2304277 OR GG = 4.96, 95% CI = 1.51-16.30) (rs2228001 OR AC = 2.19, 95% CI = 1.02-4.72)] as well as nonsmokers [(rs2304277 OR GG = 2.95, 95% CI = 1.26-6.90) (rs2228001 OR AC = 2.57, 95% CI = 1.31-5.04)]. These polymorphisms were also associated with both low-grade [(rs2304277 OR GG = 3.73, 95% CI = 1.72-8.09) (rs2228001 OR AC = 2.18, 95% CI = 1.21-3.92)] and high-grade tumors [(rs2304277 OR GG = 3.45, 95% CI = 1.52-7.80) (rs2228001 OR AC = 2.81, 95% CI = 1.48-5.33)] as well as with non-muscle-invasive bladder cancer [(rs2304277 OR GG = 4.03, 95% CI = 1.87-8.67) (rs2228001 OR AC = 2.14, 95% CI = 1.20-3.81)] and muscle-invasive bladder cancer [(rs2304277 OR GG = 3.06, 95%CI = 1.31-7.13) (rs2228001 OR AC = 2.95, 95%CI = 1.51-5.75)]. This is the first study on DNA repair gene polymorphisms and UBC in the Pakistani population. It identifies OGG1 rs2304277 and replicates XPC rs2228001 as significant modulators of UBC susceptibility. © 2017 John Wiley & Sons Ltd/University College London.
Jin, Jia-Li; Sun, Jing; Ge, Hui-Juan; Cao, Yun-Xia; Wu, Xiao-Ke; Liang, Feng-Jing; Sun, Hai-Xiang; Ke, Lu; Yi, Long; Wu, Zhi-Wei; Wang, Yong
2009-12-16
Several studies have reported the association of the SNP rs2414096 in the CYP19 gene with hyperandrogenism, which is one of the clinical manifestations of polycystic ovary syndrome (PCOS). These studies suggest that SNP rs2414096 may be involved in the etiopathogenisis of PCOS. To investigate whetherthe CYP19 gene SNP rs2414096 polymorphism is associated with the susceptibility to PCOS, we designed a case-controlled association study including 684 individuals. A case-controlled association study including 684 individuals (386 PCOS patients and 298 controls) was performed to assess the association of SNP rs2414096 with PCOS. Genotyping of SNP rs2414096 was conducted by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method that was performed on genomic DNA isolated from blood leucocytes. Results were analyzed in respect to clinical test results. The genotypic distributions of rs2414096 (GG, AG, AA) in the CYP19 gene (GG, AG, AA) in women with PCOS (0.363, 0.474, 0.163, respectively) were significantly different from that in controls (0.242, 0.500, 0.258, respectively) (P = 0.001). E2/T was different between the AA and GG genotypes. Age at menarche (AAM) and FSH were also significantly different among the GG, AG, and AA genotypes in women with PCOS (P = 0.0391 and 0.0118, respectively). No differences were observed in body mass index (BMI) and other serum hormone concentrations among the three genotypes, either in the PCOS patients or controls. Our data suggest that SNP rs2414096 in the CYP19 gene is associated with susceptibility to PCOS.
Genetic polymorphisms in the vitamin D pathway in relation to lung cancer risk and survival
Kong, Jinyu; Xu, Fangxiu; Qu, Jinli; Wang, Yu; Gao, Ming; Yu, Herbert; Qian, Biyun
2015-01-01
Studies have suggested that vitamin D may have protective effects against cancer development or tumor progression. To search for additional evidence, we investigated the role of genetic polymorphisms involved in the vitamin D pathway in non-small cell lung cancer (NSCLC). We evaluated common genetic polymorphisms associated with the vitamin D pathway in relation to NSCLC in a case-control study of 603 newly diagnosed NSCLC patients and 661 matched healthy controls. Seven single nucleotide polymorphisms (SNPs) were genotyped, the expression of CYP27B1 and CYP24A1 were measured in 153 tumor samples and their associations with genotypes and patient survival were also analyzed. In the case-control comparison, we found SNP rs3782130 (CYP27B1), rs7041 (GC), rs6068816 and rs4809957 (CYP24A1) associated with NSCLC risk. The risk of NSCLC was increased with the number of risk alleles. CYP27B1 and CYP24A1 expression were significantly different between tumor and normal tissues in NSCLC. High CYP27B1 expression was associated with better overall survival, and the expression was different by the rs3782130 genotype. The study suggests that some genetic polymorphisms involved in the vitamin D pathway may associate with NSCLC risk, and one of the polymorphisms (rs3782130) may affect gene expression and patient survival. PMID:25544771
Soejima, Mikiko; Teye, Kwesi; Koda, Yoshiro
2018-08-01
The serum haptoglobin (HP) level varies in various clinical conditions and among individuals. Recently, the common HP alleles, rs5472, and rs2000999 have been reported to associate with serum HP level, but no studies have been done on Africans. Here, we explored the relationship of not only these polymorphisms but also rs5470 and rs5471 to the serum HP level in 121 Ghanaians. Genotyping of rs2000999 was performed by PCR using hydrolysis probes, while the other polymorphisms have been already genotyped. Serum HP level was measured by a sandwich ELISA. We observed a significant association between rs5471 and the serum HP level (p = 0.026). It was also observed within the subgroups of HP 2 /HP 2 and HP 2 /HP 1 . In addition, we detected a trend toward lower HP levels for individuals with the A allele of rs2000999 than those without A, but it was not statistically significant (p = 0.156). However, we did not observe the clear associations between other polymorphisms and serum HP level that were observed for Europeans and Asians because of the small sample size and the complexity of SNPs affecting the HP level. We suggest that rs5471 is a strong genetic determinant of HP levels in Ghanaians, and this seems to be characteristic of Africans. Further investigation using large scale samples will help in understanding the genetic background of individual variability of the serum HP level. Copyright © 2018 Elsevier B.V. All rights reserved.
Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun
2010-02-05
Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.
Gao, L W; Zhang, M X; Wu, L J; Fu, L W; Zhao, X Y; Mi, J
2018-01-10
Objective: To examine the association between rs10938397 polymorphism in glucosamine-6-phosphate deaminase 2 ( GNPDA2 ) and risk of obesity in children at different stages of development and analyze the differences in the association. Methods: A total of 3 503 school-aged children were selected from the Beijing Child and Adolescent Metabolic Syndrome (BCAMS) study in Beijing and their complete anthropometry weight, height, fat mass percentage (FMP), fat mass index (FMI) and free fat mass index (FFMI) and sexual maturation (SM) data were used. The developmental stages were evaluated using male testicular volume and female breast Tanner staging. FMP, FM and FFM were measured by bioelectrical impedance analysis. General obesity and adiposity were respectively defined according to Chinese sex-age-specific body mass index (BMI) cutoffs and sex-age-specific FMP cutoffs. The SNP rs10938397 were genotyped by the TaqMan Allelic Discrimination Assay with the GeneAmp 7900 sequence detection system (Applied Biosystems, Foster city, CA, USA). Relationships between rs10938397 polymorphism and BMI, FMP, FMI and FFMI and different types of obesity were tested using multivariate linear regression and logistic regression models. Results: After age adjustment and correction for multiple testing, the rs10938397-G was associated with BMI and risk of general obesity in boys in early puberty ( β =0.328, P =0.001; OR =1.420, 95% CI : 1.126-1.790), and the rs10938397-G was associated with BMI in girls in late puberty ( β =0.266, P =0.001). The associations of GNPDA2 rs10938397-G with FFMI and FMI were observed in boys in early puberty ( β =0.137, P =0.016; β =0.202, P =0.007) and the associations of rs10938397-G with FMP and FMI were observed in girls in late puberty ( β =0.153, P =0.002; β =0.168, P =0.001). The rs10938397-G was also associated with adiposity in girls in late puberty ( OR =1.339, 95% CI : 1.093-1.637). Conclusion: The rs10938397 polymorphism in GNPDA2 is associated
Association between adiponectin polymorphisms and the risk of colorectal cancer.
Guo, Xin; Liu, Jiaqi; You, Liuping; Li, Gang; Huang, Yuenan; Li, Yunlong
2015-01-01
To discuss the association between adiponectin (ADIPOQ) gene rs2241766 and rs1501299 polymorphisms and the risk of colorectal cancer, and to analyze the role of the interaction between these two loci and environmental factors in colorectal cancer pathogenesis. The case-control study was performed with a 1:1 match. A self-designed questionnaire was used to perform a face-to-face survey with 600 new primary colorectal cancer cases confirmed by histopathology as well as 600 cases of people receiving a physical examination at the same time. The general information, lifestyle, and diet habits, etc. were collected from two groups of study subjects. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to identify ADIPOQ rs2241766 and rs1501299 genotypes. After adjusting for factors such as colorectal cancer family history, body-mass index (BMI), daily sedentary time, weekly red meat intake frequency, as well regular tea drinking, conditional logistic regression analysis indicated that rs2241766 TG+GG carriers had a higher risk of colorectal cancer than TT carriers (OR=1.433, 95% CI: 1.014-1.985); rs1501299 GT+TT carriers had a lower risk of colorectal cancer than GG carriers (OR=0.723, 95% CI: 0.531-0.902). Generalized multifactor dimensionality reduction analysis showed that ADIPOQ rs2241766 and rs1501299 could have interaction with red meat intake (p=0.001). ADIPOQ rs2241766 and rs1501299 single nucleotide polymorphisms (SNPs) could be associated with colorectal pathogenesis and could have interactions with red meat intake. Both factors impact colorectal cancer occurrence.
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population.
Zhao, Nan; Liu, Xin; Wang, Yongqin; Liu, Xiaoqiu; Li, Jiana; Yu, Litian; Ma, Liyuan; Wang, Shuyu; Zhang, Hongye; Liu, Lisheng; Zhao, Jingbo; Wang, Xingyu
2012-07-06
Inflammatory mechanisms are important in stroke risk, and genetic variations in components of the inflammatory response have been implicated as risk factors for stroke. We tested the inflammatory gene polymorphisms and their association with ischemic stroke in a Chinese Han population. A total of 1,124 ischemic stroke cases and 1,163 controls were genotyped with inflammatory panel strips containing 51 selected inflammatory gene polymorphisms from 35 candidate genes. We tested the genotype-stroke association with logistic regression model. We found two single nucleotide polymorphisms (SNPs) in CCL11 were associated with ischemic stroke. After adjusting for multiple testing using false discovery rate (FDR) with a 0.20 cut-off point, CCL11 rs4795895 remained statistically significant. We further stratified the study population by their hypertension status. In the hypertensive group, CCR2 rs1799864, CCR5 rs1799987 and CCL11 rs4795895 were nominally associated with increased risk of stroke. In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke. After correction for multiple testing, CCR2 rs1799864 and CCR5 rs1799987 remained significant in the hypertensive group, and CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 remained significant in the non-hypertensive group. Our results indicate that inflammatory genetic variants are associated with increased risk of ischemic stroke in a Chinese Han population, particularly in non-hypertensive individuals.
Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R
2017-05-01
To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.
TERT Polymorphism rs2736100-C Is Associated with EGFR Mutation-Positive Non-Small Cell Lung Cancer
Zheng, Yonglan; Niu, Xiaomin; Weng, Xiaoling; Zhang, Hong; Favus, Murray; Zhang, Lanjun; Jia, Weihua; Zeng, Yixin; Amos, Christopher I; Lu, Shun; Wang, Hui-Yun; Liu, Yun; Liu, Wanqing
2015-01-01
Purpose Epidermal growth factor receptor (EGFR) mutation-positive (EGFRmut+) non-small cell lung cancer (NSCLC) may be a unique orphan disease. Previous studies suggested that the telomerase reverse transcriptase (TERT) gene polymorphism is associated with demographic and clinical features strongly associated with EGFR mutations, e.g. adenocarcinoma histology, never-smoking history and female gender. We aim to test the association between TERT polymorphism and EGFRmut+ NSCLC. Experimental Design We conducted a genetic association study in Chinese NSCLC patients (n=714) and healthy controls (n=2,520), between the rs2736100 polymorphism and EGFRmut+ NSCLC. We further tested the association between the EGFR mutation status and mean leukocyte telomere length (LTL). The potential function of rs2736100 in lung epithelial cells was also explored. Results The rs2736100-C allele was significantly associated with EGFRmut+ NSCLC (OR=1.52, 95%CI=1.28–1.80, p=1.6×10−6) but not EGFRmut− NSCLC (OR=1.07, 95%CI=0.92–1.24, p=0.4). While NSCLC patients as a whole have significantly longer LTL compared to healthy controls (p≤10−13), the EGFRmut+ patients have even longer LTL compared to EGFRmut-patients (p=0.008). Meanwhile, rs2736100 was significantly associated with TERT mRNA expression in both normal and tumor lung tissues. All results remained significant after controlling for age, gender, smoking status and histology (p<0.05 for all tests). Moreover, the rs2736100 DNA sequence has an allele-specific affinity to nuclear proteins extracted from lung epithelial cells, which led to an altered enhancer activity of the sequence in vitro. Conclusion Our study suggests that telomerase and telomere function may be essential for carcinogenesis of EGFRmut+ NSCLC. Further investigation for the underlying mechanism is warranted. PMID:26149460
Polymorphisms of the TLR4 gene and risk of gastric cancer.
Huang, Lina; Yuan, Kexin; Liu, Jingjing; Ren, Xiyun; Dong, Xiaoqun; Tian, Wenjing; Jia, Yunhe
2014-03-01
Toll-like receptor 4 (TLR4) is an important lipo-polysaccharide (LPS) receptor in gastric epithelial cell signaling transduction and plays critical roles in the development and progression of gastric cancer (GC). We investigated the effects of TLR4 gene polymorphisms and gene-environmental interactions on the risk of GC in Northeastern China. We genotyped two single-nucleotide polymorphisms (SNPs) in TLR4 (rs10116253 and rs1927911) in 217 GC patients and 294 cancer-free controls using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Odds ratio (OR) and 95% confidence intervals (CIs) were estimated by unconditional logistic-regression models. Individuals carrying CC genotype of rs10116253 and TT genotype of rs1927911 had a significantly decreased risk of GC (adjusted OR=0.33, 95% CI 0.18-0.60, P<0.001 and adjusted OR=0.37, 95% CI 0.21-0.67, P=0.001 respectively), compared with TT genotype of rs10116253 and CC genotype of rs1927911. In addition, the SNP effects were additive to the effects of some known environmental factors without any interaction between them in the susceptibility to GC. Our data suggested that TLR4 gene polymorphisms may be associated with a decreased risk of GC in Chinese population. And these SNPs and their combined effects with environmental factors may be associated with the risk of GC. Copyright © 2013 Elsevier B.V. All rights reserved.
2011-01-01
Introduction The Toll-like receptor 7 (TLR7) gene, encoded on human chromosome Xp22.3, is crucial for type I interferon production. A recent multicenter study in East Asian populations, comprising Chinese, Korean and Japanese participants, identified an association of a TLR7 single-nucleotide polymorphism (SNP) located in the 3' untranslated region (3' UTR), rs3853839, with systemic lupus erythematosus (SLE), especially in males, although some difference was observed among the tested populations. To test whether additional polymorphisms contribute to SLE in Japanese, we systematically analyzed the association of TLR7 with SLE in a Japanese female population. Methods A case-control association study was conducted on eight tag SNPs in the TLR7 region, including rs3853839, in 344 Japanese females with SLE and 274 healthy female controls. Results In addition to rs3853839, two SNPs in intron 2, rs179019 and rs179010, which were in moderate linkage disequilibrium with each other (r2 = 0.53), showed an association with SLE (rs179019: P = 0.016, odds ratio (OR) 2.02, 95% confidence interval (95% CI) 1.15 to 3.54; rs179010: P = 0.018, OR 1.75, 95% CI 1.10 to 2.80 (both under the recessive model)). Conditional logistic regression analysis revealed that the association of the intronic SNPs and the 3' UTR SNP remained significant after we adjusted them for each other. When only the patients and controls carrying the risk genotypes at the 3' UTR SNPpositionwere analyzed, the risk of SLE was significantly increased when the individuals also carried the risk genotypes at both of the intronic SNPs (P = 0.0043, OR 2.45, 95% CI 1.31 to 4.60). Furthermore, the haplotype containing the intronic risk alleles in addition to the 3' UTR risk allele was associated with SLE under the recessive model (P = 0.016, OR 2.37, 95% CI 1.17 to 4.80), but other haplotypes were not associated with SLE. Conclusions The TLR7 intronic SNPs rs179019 and rs179010 are associated with SLE independently of
ADAM33 polymorphisms are associated with asthma and a distinctive palm dermatoglyphic pattern
XUE, WEILIN; HAN, WEI; ZHOU, ZHAO-SHAN
2013-01-01
A close correlation between asthma and palm dermatoglyphic patterns has been observed in previous studies, but the underlying genetic mechanisms have not been investigated. A disintegrin and metalloprotein-33 (ADAM33) polymorphisms are important in the development of asthma and other atopic diseases. To investigate the underlying mechanisms of the association between asthma and distinctive palm dermatoglyphic patterns, thirteen ADAM33 single-nucleotide polymorphisms (SNPs) were analyzed for the association between asthma and palm dermatoglyphic patterns in a population of 400 asthmatic patients and 200 healthy controls. Based on the results, five SNPs, rs44707 (codominant model, P=0.031; log-additive model, P=0.0084), rs2787094 (overdominant model, P=0.049), rs678881 (codominant model, P=0.028; overdominant model, P=0.0083), rs677044 (codominant model, P=0.013; log-additive model, P=0.0033) and rs512625 (dominant model, P=0.033), were associated with asthma in this population. Two SNPs, rs44707 (dominant model, P=0.042) and rs2787094 (codominant model, P=0.014; recessive model, P=0.0038), were observed in the asthma patients with the distinctive palm pattern. As rs44707 and rs2787094 are associated with asthma and a distinctive palm pattern, the data suggest that ADAM33 polymorphisms are correlated with asthma and may be the underlying genetic basis of the association between asthma and palm dermatoglyphic patterns. PMID:24141861
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-01-01
Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of
Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi
2017-05-05
Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were
Vitamin D receptor polymorphisms in patients with cutaneous melanoma.
Orlow, Irene; Roy, Pampa; Reiner, Anne S; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Millikan, Robert C; Thomas, Nancy E; Gruber, Stephen B; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P; Dwyer, Terence; Kanetsky, Peter A; Busam, Klaus; From, Lynn; Begg, Colin B; Berwick, Marianne
2012-01-15
The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene single nucleotide polymorphisms (SNPs) in a large international multicenter population-based case-control study of melanoma. Buccal DNAs were obtained from 1,207 people with incident multiple primary melanoma and 2,469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, haplotype tagging SNPs with ≥ 10% minor allele frequency in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3' gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25 to 33% for six polymorphisms: rs10875712 (odds ratios [OR] 1.28; 95% confidence interval (CI), 1.01-1.62), rs4760674 (OR 1.33; 95% CI, 1.06-1.67), rs7139166 (OR 1.26; 95%CI, 1.02-1.56), rs4516035 (OR 1.25; 95%CI, 1.01-1.55), rs11168287 (OR 1.27; 95%CI, 1.03-1.57) and rs1544410 (OR 1.30; 95%CI, 1.04-1.63); for two polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65-1.02) and rs7965281 (OR, 0.78; 95%CI, 0.62-0.99). We recognize the potential false positive findings because of multiple comparisons; however, the eight significant SNPs in our study outnumbered the two significant tests expected to occur by chance. The VDR may play a role in melanomagenesis. Copyright © 2011 UICC.
Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria
Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung
2017-01-01
Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221
Sung, L; Dix, D; Cellot, S; Gillmeister, B; Ethier, M C; Roslin, N M; Johnston, D L; Feusner, J; Mitchell, D; Lewis, V; Aplenc, R; Yanofsky, R; Portwine, C; Price, V; Zelcer, S; Silva, M; Bowes, L; Michon, B; Stobart, K; Traubici, J; Allen, U; Beyene, J; den Hollander, N; Paterson, A D
2016-06-01
We evaluated single nucleotide polymorphisms (SNPs) associated with infection risk in children with newly diagnosed acute myeloid leukaemia (AML). We conducted a multicentre, prospective cohort study that included children aged ≤18 years with de novo AML. DNA was isolated from blood lymphocytes or buccal swabs, and candidate gene SNP analysis was conducted. Primary outcome was the occurrence of microbiologically documented sterile site infection during chemotherapy. Secondary outcomes were Gram-positive and -negative infections, viridans group streptococcal infection and proven/probable invasive fungal infection. Interpretation was guided by consistency in risk alleles and microbiologic agent with previous literature. Over the study period 254 children and adolescents with AML were enrolled. Overall, 190 (74.8%) had at least one sterile site microbiologically documented infection. Among the 172 with inferred European ancestry and DNA available, nine significant associations were observed; two were consistent with previous literature. Allele A at IL1B (rs16944) was associated with decreased microbiologically documented infection, and allele G at IL10 (rs1800896) was associated with increased risk of Gram-positive infection. We identified SNPs associated with infection risk in paediatric AML. Genotype may provide insight into mechanisms of infection risk that could be used for supportive-care novel treatments. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
rs3806268 of NLRP3 gene polymorphism is associated with the development of primary gout.
Deng, Jianping; Lin, Wen; Chen, Yunpeng; Wang, Xin; Yin, Zhong; Yao, Chunhong; Liu, Tangbing; Lv, Yonghong
2015-01-01
The aim of the present study was to investigate the association between seven functional SNPs in NALP3 gene and the susceptibility to primary gout. A total of 247 patients with primary gout and 247 controls were selected in this study. Genotyping of NALP3 rs4612666, rs3806268, rs12239046, rs10754558, rs7512998, rs12137901 and rs12565738 was performed using the Sequenom MassARRAY platform. Comparison analysis showed that primary gout patients were more likely to have a higher body mass index, DBP, SBP, TG, urea nitrogen and uric acid (P < 0.05). According to logistic regression analysis, individuals carrying with the GG genotype of rs3806268 were associated with increased risk of primary gout when compared with the AA genotype (OR=1.83, 95% CI=1.03-3.26). However, no significant associations were identified for the remaining SNPs. In conclusion, we found a significant association between rs3806268 in NLRP3 gene and the risk of primary gout in a Chinese population. Further clinical and genetic studies are required to investigate the mechanisms underlying the association between NALP3 polymorphisms and the development of primary gout.
Chai, H C; Phipps, M E; Othman, I; Tan, L P; Chua, K H
2013-02-01
Human leukocyte antigen (HLA) antigens and genes have long been reported associated with systemic lupus erythematosus (SLE) susceptibility in many populations. With the advance in technologies such as genome-wide association studies, many newly discovered SLE-associated single-nucleotide polymorphisms (SNPs) have been reported in recent years. These include HLA-DRB1/HLA-DQA1 rs9271366 and HLA-DQB1/HLA-DQA2 rs9275328. Our aim was to investigate these SNPs in a Malaysian SLE cohort. SNPs rs9271366 and rs9275328 were screened across 790 Malaysian citizens from three ethnic groups (360 patients and 430 healthy volunteers) by Taqman SNP genotyping assays. Allele and genotyping frequencies, Hardy-Weinberg equilibrium, Fisher's exact test and odds ratio were calculated for each SNP and ethnic group. Linkage disequilibrium and interaction between the two SNPs were also evaluated. The minor allele G and its homozygous genotype GG of HLA-DRB1/HLA-DQA1 rs9271366 significantly increased the SLE susceptibility in Malaysian patients, including those of Malay and Chinese ethnicity (odds ratio (OR) > 1, p < 0.05). As for HLA-DQB1/HLA-DQA2 rs9275328, the minor allele T and the heterozygous genotype CT conferred protective effect to SLE in Malaysians, as well as in Malays and Chinese, by having OR < 1 and p value <0.05. Both SNPs did not show associations to SLE in Indians. D' and r (2) values for the two SNPs in LD analysis were 0.941 and 0.065, respectively, with haplotype GC and AT being significantly associated with SLE (p < 5.0 × 10(-4)) after 10,000 permutations were performed. The MDR test clustered the genotype combinations of GG and CC, and AG and CC of rs9271366 and rs9275328, accordingly, as high-risk group, and the two SNPs interacted redundantly by removing 1.96% of the entropy. Our findings suggest that in addition to some classical HLA variants, rs9271366 and rs9275328 are additional polymorphisms worth considering in the Malaysian and possibly in
Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo
2016-01-01
Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941
Liu, Min; Zhu, Wenqian; Wang, Jun; Zhang, Jixiang; Guo, Xufeng; Wang, Jing; Song, Jia; Dong, Weiguo
2015-09-01
The interleukin-23 receptor (IL-23R) polymorphism has been implicated in susceptibility to ulcerative colitis (UC), but the results remain inconclusive. This study was designed to evaluate whether IL-23R polymorphisms were associated with UC susceptibility. CNKI, WanFang Data, PubMed, MEDLINE, Web of Science, Google Scholar, EBSCO, CBM database and EMBASE were searched until 31 June 2014 for eligible studies on eight IL-23R polymorphisms: rs11209026, rs7517847, rs1209032, rs2201841, rs1343151, rs1088967, rs1495965 and rs1004819. Meta-analysis from all eligible case-control studies was performed to assess the purported associations. Meta-analysis was performed by using the RevMan 5.2 software and STATA package version 12.0. Sixteen studies with 5438 cases and 7380 controls were included. Overall, our analysis found that variant minor alleles for single nucleotide polymorphisms (SNPs) rs11209026 (Arg381Gln) (dominant model: GG+TG vs. TT, P=0.02, OR=0.71, 95%CI: 0.53-0.94); rs7517847 (recessive model: GG vs. TT, P=0.04, OR=0.80, 95%CI: 0.65-0.99) and rs11209032 [dominant model: GA+AA vs. GG (P=0.04, OR=1.31, 95% CI: 1.01-1.26); AA vs. GG: (P=0.04, OR=1.21, 95% CI: 1.01-1.45)] of IL-23R were associated with UC risk. In stratification analysis by ethnicity, we observed that the rs11209026 and rs7517847 polymorphism of IL-23R could protect against development of UC among Caucasian populations [rs11209026: dominant model (P=0.01, OR=0.69, 95%CI: 0.52-0.92); rs7517847: GG vs. TT (P=0.002, OR=0.69, 95%CI: 0.54-0.87); recessive model (P=0.004, OR=0.73, 95% CI: 0.59-0.90)]; the rs11209032 were associated with a greater risk for UC in Caucasian populations [dominant model (P=0.04, OR=1.13, 95%CI: 1.00-1.26)]; the rs1088967 were associated with a lower risk for UC among Asian populations [dominant model (P=0.04, OR=0.73, 95%CI: 0.54-0.99)]. Moreover, meta-analysis revealed no association between the four alleles of the rs2201841, rs1004819, rs1495965 and rs1343151 polymorphisms
Cytokine Polymorphisms are Associated with Daytime Napping in Adults Living with HIV
Byun, Eeeseung; Gay, Caryl L.; Portillo, Carmen J.; Pullinger, Clive R.; Aouizerat, Bradley E.; Lee, Kathryn A.
2017-01-01
Objective/Background Daytime napping longer than one hour has been associated with an increased risk for all-cause mortality. Associations between cytokine polymorphisms and daytime napping in chronic illnesses such as HIV, however, have not been well described. The purpose of this study was to examine cytokine polymorphisms associated with long daytime napping in adults living with HIV. Methods A cross-sectional analysis was conducted using a convenience sample of 257 adults living with HIV. Daytime napping was assessed with wrist actigraphy data collected over three days. Participants categorized as long nappers (≥ 60 min) were compared to short nappers and non-nappers (< 60 min). Single nucleotide polymorphisms (SNPs) for 15 candidate genes involved in cytokine signaling were analyzed. Genes included: interferon-gamma (IFNG), IFNG receptor 1 (IFNGR1), interleukins (IL1B, IL1R, IL1R2, IL2, IL4, IL6, IL8, IL10, IL13, IL17A), nuclear factors of kappa light polypeptide gene enhancer in B cells (NFKB1 and NFKB2), and tumor necrosis factor alpha (TNFA). Results After adjusting for relevant demographic and clinical characteristics, long daytime napping was associated with 12 SNPs from seven genes: 1) IFNG rs2069728; 2) IL1B rs1143642, rs1143627, and rs16944; 3) IL2 rs2069763; 4) IL6 rs4719714, rs1554606, and rs2069845; 5) IL17A rs3819024 and rs8193036; 6) NFKB1 rs4648110; and 7) NFKB2 rs1056890. Conclusions Cytokine genetic variations may have a role in physiological regulation of daytime napping as well as nocturnal sleep. Cytokine polymorphisms associated with long daytime napping could help identify adults with HIV who may benefit from targeted therapeutic interventions. PMID:28366330
Cytokine polymorphisms are associated with daytime napping in adults living with HIV.
Byun, Eeeseung; Gay, Caryl L; Portillo, Carmen J; Pullinger, Clive R; Aouizerat, Bradley E; Lee, Kathryn A
2017-04-01
Daytime napping longer than one hour has been associated with an increased risk for all-cause mortality. Associations between cytokine polymorphisms and daytime napping in chronic illnesses such as HIV, however, have not been well described. The purpose of this study was to examine cytokine polymorphisms associated with long daytime napping in adults living with HIV. A cross-sectional analysis was conducted using a convenience sample of 257 adults living with HIV. Daytime napping was assessed with wrist actigraphy data collected over three days. Participants categorized as long nappers (≥60 min) were compared to short nappers and non-nappers (<60 min). Single nucleotide polymorphisms (SNPs) for 15 candidate genes involved in cytokine signaling were analyzed. Genes included: interferon-gamma (IFNG), IFNG receptor 1 (IFNGR1), interleukins (IL1B, IL1R, IL1R2, IL2, IL4, IL6, IL8, IL10, IL13, IL17A), nuclear factors of kappa light polypeptide gene enhancer in B cells (NFKB1 and NFKB2), and tumor necrosis factor alpha (TNFA). After adjusting for relevant demographic and clinical characteristics, long daytime napping was associated with 12 SNPs from seven genes: 1) IFNG rs2069728; 2) IL1B rs1143642, rs1143627, and rs16944; 3) IL2 rs2069763; 4) IL6 rs4719714, rs1554606, and rs2069845; 5) IL17A rs3819024 and rs8193036; 6) NFKB1 rs4648110; and 7) NFKB2 rs1056890. Cytokine genetic variations may have a role in physiological regulation of daytime napping as well as nocturnal sleep. Cytokine polymorphisms associated with long daytime napping could help identify adults with HIV who may benefit from targeted therapeutic interventions. Copyright © 2017 Elsevier B.V. All rights reserved.
Association of TUSC1 and DPF3 gene polymorphisms with male infertility.
Sato, Youichi; Hasegawa, Chise; Tajima, Atsushi; Nozawa, Shiari; Yoshiike, Miki; Koh, Eitetsue; Kanaya, Jiro; Namiki, Mikio; Matsumiya, Kiyomi; Tsujimura, Akira; Komatsu, Kiyoshi; Itoh, Naoki; Eguchi, Jiro; Yamauchi, Aiko; Iwamoto, Teruaki
2018-02-01
Recently, genome-wide association studies of a Hutterite population in the USA revealed that five single nucleotide polymorphisms (SNPs) with a significant association with sperm quality and/or function in ethnically diverse men from Chicago were significantly correlated with family size. Of these, three SNPs (rs7867029, rs7174015, and rs12870438) were found to be significantly associated with the risk of azoospermia and/or oligozoospermia in a Japanese population. In this study, we investigated whether the rs10966811 (located in an intergenic region between the TUSC1 and IZUMO3 genes) and rs10129954 (located in the DPF3 gene) SNPs, previously related to family size, are associated with male infertility. In addition, we performed association analysis between rs12348 in TUSC1 and rs2772579 in IZUMO3 and male infertility. We genotyped 145 patients with infertility (including 83 patients with azoospermia and 62 with oligozoospermia) and 713 fertile controls by PCR-RFLP technique for polymorphism. Because rs10966811 has no restriction sites, the SNP rs12376894 with strong linkage disequilibrium was selected as an alternative to rs10966811. There was a statistically significant association between rs12376894 proxy SNP of rs10966811 and oligozoospermia. Also, a statistically significant association between rs10129954 and azoospermia, and oligozoospermia was observed. When we assessed the relationship between rs12348 in TUSC1 and rs2772579 in IZUMO3 and male infertility traits, we found that rs12348 in TUSC1 was significantly associated with azoospermia and oligozoospermia, but rs2772579 in IZUMO3 was not associated with male infertility. We found that the polymorphisms in TUSC1 and DPF3 displayed strong associations with male infertility.
Venugopal, Priyanka; Lavu, Vamsi; Rao, Suresh Ranga; Venkatesan, Vettriselvi
2017-10-05
Periodontitis is a chronic inflammatory disease, caused by interaction between periodontopathic bacteria and the host immune response. MicroRNAs are small, single-stranded molecules, which play a key role in the regulation of diverse biological processes. Dysregulation of microRNAs function can lead to several diseases such as autoimmune and chronic inflammatory diseases. The objective of the study was to determine the association between selected single nucleotide polymorphisms in miR-125a, miR-499 and LIN28 homology A with chronic periodontitis susceptibility in a sample population from south India. Genotyping of the single nucleotide polymorphisms in miR-125a (rs41275794, rs12976445, rs10404453 and rs12975333), miR-499 (rs3746444) and LIN28 homolog A (rs3811463) was performed in DNA from288 controls (individuals with healthy gingiva) and 262 cases (chronic periodontitis patients) by direct dye-terminator sequencing. Disease association analysis revealed a significant association of the variant alleles of the miR-499a polymorphism (rs3746444) in chronic periodontitis [OR=2.07; 95%CI (1.35-3.17)]. The risk associated C-allele frequency was found to be higher in chronic periodontitis subjects as compared to that of healthy individuals. Similar results were also observed in the dominant model [OR=2.42; 95% CI (1.67-3.51)]. The recessive model for miR-125a polymorphism (rs12976445) was also found to be statistically significant with OR=1.54 and 95% CI (1.03-2.30). The haplotype "GCGGCA" was found to be higher in chronic periodontitis subjects than in healthy individuals. Pairwise linkage disequilibrium analysis exhibited that the polymorphisms, rs41275794 and rs12976445 in miR-125a, were in strong linkage equilibrium (D'=0.97). Epistatic interaction by multifactorial dimensionality reduction analysis revealed that the genotypes of the polymorphisms of miR-125a (rs41275794, rs12976445, rs10404453), miR-499a (rs3746444) and LIN28 (rs3811463) were interacting
Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun
2007-10-15
Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.
Balta, Burhan; Gumus, Hakan; Bayramov, Ruslan; Korkmaz Bayramov, Keziban; Erdogan, Murat; Oztop, Didem Behice; Dogan, Muhammet Ensar; Taheri, Serpil; Dundar, Munis
2018-05-18
Although there are a large number of sequence variants of different genes and copy number variations at various loci identified in autistic disorder (AD) patients, the pathogenesis of AD has not been elucidated completely. Recently, in AD patients, a large number of expression array and transcriptome studies have shown an increase in the expression of genes especially related to innate immune response. Antimicrobial effects of vitamin D and VDR are exerted through Toll-Like-Receptors (TLR) which have an important role in the innate immune response, are expressed by antigen presenting cells and recognize foreign microorganisms. In this study, age and gender matched 30 patients diagnosed with AD and 30 healthy controls were included in the study. Comparatively whole blood VDR gene expression and rs11568820 and rs4516035 SNP profile of the promoter region of the VDR gene were investigated by real time PCR. Whole blood VDR gene expression was significantly higher in the AD group compared to control subjects (p < 0.0001). There were no significant differences among allele and genotype distribution of rs11568820 and rs4516035 polymorphisms between AD patients and controls. The increase of VDR gene expression in patients with AD may be in accordance with an increase in the innate immune response in patients with AD. Furthermore, this study will stimulate new studies in order to clarify the relationship among AD, vitamin D, VDR, and innate immunity.
Choi, Damee; Minote, Natsumi; Watanuki, Shigeki
2017-01-26
Oxytocin receptor (OXTR) gene polymorphisms are related to individual differences in emotional processing of social cues. However, whether OXTR polymorphisms affect emotional processing of nonsocial cues remains unclear. The present study investigated the relationship between the OXTR rs53576 polymorphism and emotional processing of social cues and nonsocial cues. Event-related potentials were recorded from 88 male participants while images of humans and images of objects were presented as social cues and nonsocial cues, respectively. First, the results showed that GG carriers of OXTR rs53576 showed more negative N1 (50-200 ms) than AA carriers in response to images of both humans and objects. Second, GG carriers showed more negative N2 (200-320 ms) than AA carriers in response to images of humans but not in response to images of objects. Third, GG carriers showed more negative N2 in response to images of humans than images of objects, whereas AA carriers showed the opposite pattern. Fourth, we observed no difference in late positive potential (600-1000 ms) to images of humans or objects that depended on the OXTR rs53576 polymorphism. These results suggest that the OXTR rs53576 polymorphism affects emotional processing of not only social cues but also nonsocial cues in the very early stage (reflected in N1); however, the data also suggest that the OXTR rs53576 polymorphism is related specifically to increased emotional processing of social cues in the middle stage (reflected in N2).
The miR-449b polymorphism, rs10061133 A>G, is associated with premature ovarian insufficiency.
Pan, Hong; Chen, Beili; Wang, Jing; Wang, Xi; Hu, Ping; Wu, Shinan; Liu, Yunyun; Xu, Zuying; Zhang, Wei; Wang, Binbin; Cao, Yunxia
2016-09-01
To determine if the miR-449b polymorphism, rs10061133 A>G, is associated with premature ovarian insufficiency (POI) pathogenesis. From January 2011 to December 2014, a total of 148 individuals with POI and 225 age-matched controls were collected from the Center for Reproductive Medicine, 1st Affiliated Hospital of Anhui Medical University (Hefei, China). Genotyping of miR-449b rs1006113 was performed using matrix-assisted laser desorption ionization time-of-flight-based mass spectrometry. Rs10061133 A>G is a highly conserved SNP locus in the mature area of miR-449b. Association analysis shows that the rs10061133 AA genotype is a risk factor for POI. Our study provides the first evidence that the miR-449b rs10061133 AA genotype is associated with POI risk.
Onuma, Hiroshi; Tabara, Yasuharu; Kawamoto, Ryuichi; Shimizu, Ikki; Kawamura, Ryoichi; Takata, Yasunori; Nishida, Wataru; Ohashi, Jun; Miki, Tetsuro; Kohara, Katsuhiko; Makino, Hideichi; Osawa, Haruhiko
2010-09-01
It was recently reported that GCKR rs780094 was associated with fasting plasma glucose (FPG) and triglyceride (TG) levels in various ethnic populations (A allele for low FPG and high TG). An association between GCKR rs780094 and type 2 diabetes mellitus (T2DM) (A allele for low risk) has also been reported. We examined the association between GCKR rs780094 and T2DM in Japanese subjects by analyzing 488 cases and 398 controls. A meta-analysis was performed involving two previous association studies. We also analyzed the association between the single-nucleotide polymorphism and clinical parameters in the general Japanese population (n=1854). In the case-control study, the A allele of GCKR rs780094 was associated with a reduced risk of T2DM (odds ratio=0.711 (95% confidence interval=0.589-0.859), P=4.2 × 10(-4)). A meta-analysis confirmed the association of GCKR rs780094 with T2DM susceptibility. In the general Japanese population, subjects with the A/A genotype had lower levels of FPG, fasting plasma insulin and homeostasis model assessment of insulin resistance than those with the G/G genotype. Conversely, subjects with the A/A genotype had higher levels of TG than those with the G/G genotype. We replicated GCKR rs780094 as a marker of T2DM susceptibility in Japanese subjects. This suggests that GCKR rs780094 is a common variant for T2DM susceptibility in various ethnic groups.
Mizoo, Taeko; Taira, Naruto; Nishiyama, Keiko; Nogami, Tomohiro; Iwamoto, Takayuki; Motoki, Takayuki; Shien, Tadahiko; Matsuoka, Junji; Doihara, Hiroyoshi; Ishihara, Setsuko; Kawai, Hiroshi; Kawasaki, Kensuke; Ishibe, Youichi; Ogasawara, Yutaka; Komoike, Yoshifumi; Miyoshi, Shinichiro
2013-12-01
Lifestyle factors, including food and nutrition, physical activity, body composition and reproductive factors, and single nucleotide polymorphisms (SNPs) are associated with breast cancer risk, but few studies of these factors have been performed in the Japanese population. Thus, the goals of this study were to validate the association between reported SNPs and breast cancer risk in the Japanese population and to evaluate the effects of SNP genotypes and lifestyle factors on breast cancer risk. A case-control study in 472 patients and 464 controls was conducted from December 2010 to November 2011. Lifestyle was examined using a self-administered questionnaire. We analyzed 16 breast cancer-associated SNPs based on previous GWAS or candidate-gene association studies. Age or multivariate-adjusted odds ratios (OR) and 95% confidence intervals (95% CI) were estimated from logistic regression analyses. High BMI and current or former smoking were significantly associated with an increased breast cancer risk, while intake of meat, mushrooms, yellow and green vegetables, coffee, and green tea, current leisure-time exercise, and education were significantly associated with a decreased risk. Three SNPs were significantly associated with a breast cancer risk in multivariate analysis: rs2046210 (per allele OR=1.37 [95% CI: 1.11-1.70]), rs3757318 (OR=1.33[1.05-1.69]), and rs3803662 (OR=1.28 [1.07-1.55]). In 2046210 risk allele carriers, leisure-time exercise was associated with a significantly decreased risk for breast cancer, whereas current smoking and high BMI were associated with a significantly decreased risk in non-risk allele carriers. In Japanese women, rs2046210 and 3757318 located near the ESR1 gene are associated with a risk of breast cancer, as in other Asian women. However, our findings suggest that exercise can decrease this risk in allele carriers.
Fuku, Noriyuki; Alis, Rafael; Yvert, Thomas; Zempo, Hirofumi; Naito, Hisashi; Abe, Yukiko; Arai, Yasumichi; Murakami, Haruka; Miyachi, Motohiko; Pareja-Galeano, Helios; Emanuele, Enzo; Hirose, Nobuyoshi; Lucia, Alejandro
2016-01-01
Myostatin (MSTN) and α-actinin-3 (ACTN3) genes are potentially associated with preservation of muscle mass and oxidative capacity, respectively. To explore the possible role of these genes in exceptional longevity (EL), the allele/genotype frequency distribution of two polymorphisms in MSTN (rs1805086, K153R) and ACTN3 (rs1815739, R577X) was studied in Japanese centenarians of both sexes (n = 742) and healthy controls (n = 814). The rs1805086 R-allele (theoretically associated with muscle mass preservation at the expense of oxidative capacity) was virtually absent in the two groups, where genotype distributions were virtually identical. Likewise, no differences in allele (p = 0.838 (women); p = 0.193 (men); p = 0.587 (both sexes)) or genotype distribution were found between groups for ACTN3 rs1815739 (p = 0.975 (women), p = 0.136 (men), p = 0.752 (both sexes)). Of note, however, the frequency of the rs1805086 R-allele observed here is the lowest been reported to date whereas that of the 'highly oxidative/efficient' rs1815739 XX genotype in Japanese male centenarians (33.3%) or supercentenarians of both sexes (≥110 years) are the highest (32.6%), for a non-American population. No definite conclusions can be inferred in relation to EL owing to its lack of association with both rs1815739 and rs1805086. However, it cannot be excluded that these gene variants could eventually be related to a "healthy" metabolic phenotype in the Japanese population. Further research might determine if such metabolic profile is among the factors that can potentially predispose these individuals to live longer than Caucasians and what genetic variants might be actually involved.
Yvert, Thomas; Zempo, Hirofumi; Naito, Hisashi; Abe, Yukiko; Arai, Yasumichi; Murakami, Haruka; Miyachi, Motohiko; Pareja-Galeano, Helios; Emanuele, Enzo; Hirose, Nobuyoshi; Lucia, Alejandro
2016-01-01
Myostatin (MSTN) and α-actinin-3 (ACTN3) genes are potentially associated with preservation of muscle mass and oxidative capacity, respectively. To explore the possible role of these genes in exceptional longevity (EL), the allele/genotype frequency distribution of two polymorphisms in MSTN (rs1805086, K153R) and ACTN3 (rs1815739, R577X) was studied in Japanese centenarians of both sexes (n = 742) and healthy controls (n = 814). The rs1805086 R-allele (theoretically associated with muscle mass preservation at the expense of oxidative capacity) was virtually absent in the two groups, where genotype distributions were virtually identical. Likewise, no differences in allele (p = 0.838 (women); p = 0.193 (men); p = 0.587 (both sexes)) or genotype distribution were found between groups for ACTN3 rs1815739 (p = 0.975 (women), p = 0.136 (men), p = 0.752 (both sexes)). Of note, however, the frequency of the rs1805086 R-allele observed here is the lowest been reported to date whereas that of the ‘highly oxidative/efficient’ rs1815739 XX genotype in Japanese male centenarians (33.3%) or supercentenarians of both sexes (≥110 years) are the highest (32.6%), for a non-American population. No definite conclusions can be inferred in relation to EL owing to its lack of association with both rs1815739 and rs1805086. However, it cannot be excluded that these gene variants could eventually be related to a “healthy” metabolic phenotype in the Japanese population. Further research might determine if such metabolic profile is among the factors that can potentially predispose these individuals to live longer than Caucasians and what genetic variants might be actually involved. PMID:27861536
Single nucleotide polymorphism analysis using different colored dye dimer probes
NASA Astrophysics Data System (ADS)
Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter
2006-09-01
Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.
Robustillo-Villarino, Montserrat; García-Bermúdez, Mercedes; Llorca, Javier; Corrales, Alfonso; González-Juanatey, Carlos; Ubilla, Begoña; Miranda-Filloy, José A.; Mijares, Verónica; Pina, Trinitario; Blanco, Ricardo; Alegre-Sancho, Juan J.; Ramírez Huaranga, Marco A.; Mínguez Sánchez, María D.; Tejera Segura, Beatriz; Ferraz-Amaro, Iván; Vicente, Esther; Carmona, F. David; Castañeda, Santos; Martín, Javier; González-Gay, Miguel A.
2015-01-01
Objectives To determine whether the interleukin-33 (IL-33)-interleukin-1 receptor like 1 (IL-1RL1) signaling pathway is implicated in the risk of subclinical atherosclerosis in patients with rheumatoid arthritis (RA). Methods A total of 576 Spanish RA patients from Northern Spain were genotyped for 6 well-known IL33-IL1RL1 polymorphisms (IL33 rs3939286, IL33 rs7025417, IL33 rs7044343, IL1RL1 rs2058660, IL1RL1 rs2310173 and IL1RL1 rs13015714) by TaqMan genotyping assay. The presence of subclinical atherosclerosis was determined by the assessment of carotid intima-media thickness (cIMT) by carotid ultrasound (US). Results RA patients carrying the TT genotype of the IL33 rs3939286 polymorphism had lower cIMT values than those homozygous for the CC genotype (mean ± standard deviation (SD): 0.71 ± 0.14 mm versus 0.76 ± 0.16 mm, respectively) while patients carrying the CT genotype had intermediate cIMT values (mean ± SD: 0.73 ± 0.17 mm). Moreover, RA patients carrying the mutant allele T of the IL33 rs3939286 polymorphism exhibited significantly lower cIMT values than those carrying the wild allele C (mean ± SD: 0.72 ± 0.16 mm versus 0.75 ± 0.18 mm respectively; p = 0.04). The association of both genotype and allele frequencies of IL33 rs3939286 and cIMT levels remained statistically significant after adjustment for sex, age at the time of US study, follow-up and center (p = 0.006 and p = 0.0023, respectively), evidencing that the potential effect conferred by IL33 rs3939286 may be independent of confounder factors. No association with other IL33-IL1RL1 genetic variants was observed. Conclusions In conclusion, our results may suggest a potential protective effect of the IL33 rs3939286 allele T in the risk of subclinical atherosclerosis in patients with RA. PMID:26571131
López-Mejías, Raquel; Genre, Fernanda; Remuzgo-Martínez, Sara; Robustillo-Villarino, Montserrat; García-Bermúdez, Mercedes; Llorca, Javier; Corrales, Alfonso; González-Juanatey, Carlos; Ubilla, Begoña; Miranda-Filloy, José A; Mijares, Verónica; Pina, Trinitario; Blanco, Ricardo; Alegre-Sancho, Juan J; Ramírez Huaranga, Marco A; Mínguez Sánchez, María D; Tejera Segura, Beatriz; Ferraz-Amaro, Iván; Vicente, Esther; Carmona, F David; Castañeda, Santos; Martín, Javier; González-Gay, Miguel A
2015-01-01
To determine whether the interleukin-33 (IL-33)-interleukin-1 receptor like 1 (IL-1RL1) signaling pathway is implicated in the risk of subclinical atherosclerosis in patients with rheumatoid arthritis (RA). A total of 576 Spanish RA patients from Northern Spain were genotyped for 6 well-known IL33-IL1RL1 polymorphisms (IL33 rs3939286, IL33 rs7025417, IL33 rs7044343, IL1RL1 rs2058660, IL1RL1 rs2310173 and IL1RL1 rs13015714) by TaqMan genotyping assay. The presence of subclinical atherosclerosis was determined by the assessment of carotid intima-media thickness (cIMT) by carotid ultrasound (US). RA patients carrying the TT genotype of the IL33 rs3939286 polymorphism had lower cIMT values than those homozygous for the CC genotype (mean ± standard deviation (SD): 0.71 ± 0.14 mm versus 0.76 ± 0.16 mm, respectively) while patients carrying the CT genotype had intermediate cIMT values (mean ± SD: 0.73 ± 0.17 mm). Moreover, RA patients carrying the mutant allele T of the IL33 rs3939286 polymorphism exhibited significantly lower cIMT values than those carrying the wild allele C (mean ± SD: 0.72 ± 0.16 mm versus 0.75 ± 0.18 mm respectively; p = 0.04). The association of both genotype and allele frequencies of IL33 rs3939286 and cIMT levels remained statistically significant after adjustment for sex, age at the time of US study, follow-up and center (p = 0.006 and p = 0.0023, respectively), evidencing that the potential effect conferred by IL33 rs3939286 may be independent of confounder factors. No association with other IL33-IL1RL1 genetic variants was observed. In conclusion, our results may suggest a potential protective effect of the IL33 rs3939286 allele T in the risk of subclinical atherosclerosis in patients with RA.
Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura
2015-01-01
Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342
Thathapudi, Sujatha; Kodati, Vijayalakshmi; Erukkambattu, Jayashankar; Addepally, Uma; Qurratulain, Hasan
2015-03-01
Polycystic ovaries and irregular menstruation/anovulation are important diagnostic criteria along with hyperandrogenism as per the Androgen Excess Society-2006 criteria for polycystic ovarian syndrome (PCOS). In the etiopathogenesis of PCOS, one of the candidate genes causing ovarian failure is the luteinizing hormone (LH) chorionic gonadotropin hormone receptor (LHCGR). Our aim was to study the association of LHCGR polymorphism (rs2293275) with PCOS in our study population. Genetic case-control study from multiple gynecological centers from Hyderabad, a cosmopolitan city in South India. The study involved 204 women with PCOS and 204 healthy, sex-, and age-matched controls. Anthropometric and biochemical profiles were taken in a well-designed pro forma. Isolation of deoxyribonucleic acid (DNA) and genotype analysis were done for the entire study population using the polymerase chain reaction-restriction fragment length polymorphism method followed by 12% polyacrylamide gel electrophoresis. In this study, we have demonstrated an association between LHCGR (rs2293275) polymorphism and PCOS. The frequency of the G allele was 0.60 in PCOS and 0.49 in controls (odds ratio [OR] 1.531, confidence interval [CI] 1.16-2.01, and p-value=0.0026), which indicates that the G allele is associated with PCOS in our population. The GG genotype conferred a significant risk of developing PCOS (OR 3.36, CI 1.96-5.75, and p-value<0.0001). We found a significant association of the GG allele with body-mass index, waist to hip ratio, insulin resistance, LH, and LH/follicle-stimulating hormone (FSH) ratio in PCOS when compared with controls. The AA allele showed high basal FSH levels. This study suggests that LHCGR (rs2293275) polymorphism is associated with PCOS and could be used as a relevant molecular marker to identify women with the risk of developing PCOS in our population and may provide an understanding about the etiology of PCOS.
Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing
2016-05-01
Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,P< .001). Our findings provide further support for the hypothesis that a susceptibility gene for autism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.
Association of VAV2 and VAV3 polymorphisms with cardiovascular risk factors
Perretta-Tejedor, Nuria; Fernández-Mateos, Javier; García-Ortiz, Luis; Gómez-Marcos, Manuel A.; Recio-Rodríguez, José I.; Agudo-Conde, Cristina; Rodriguez-Sánchez, Emiliano; Morales, Ana I.; López-Hernández, Francisco J.; López-Novoa, José M.; González-Sarmiento, Rogelio; Martínez-Salgado, Carlos
2017-01-01
Hypertension, diabetes and obesity are cardiovascular risk factors closely associated to the development of renal and cardiovascular target organ damage. VAV2 and VAV3, members of the VAV family proto-oncogenes, are guanosine nucleotide exchange factors for the Rho and Rac GTPase family, which is related with cardiovascular homeostasis. We have analyzed the relationship between the presence of VAV2 rs602990 and VAV3 rs7528153 polymorphisms with cardiovascular risk factors and target organ damage (heart, vessels and kidney) in 411 subjects. Our results show that being carrier of the T allele in VAV2 rs602990 polymorphism is associated with an increased risk of obesity, reduced levels of ankle-brachial index and diastolic blood pressure and reduced retinal artery caliber. In addition, being carrier of T allele is associated with increased risk of target organ damage in males. On the other hand, being carrier of the T allele in VAV3 rs7528153 polymorphism is associated with a decreased susceptibility of developing a pathologic state composed by the presence of hypertension, diabetes, obesity or cardiovascular damage, and with an increased risk of developing altered basal glycaemia. This is the first report showing an association between VAV2 and VAV3 polymorphisms with cardiovascular risk factors and target organ damage. PMID:28157227
Association of HTRA1 polymorphism and bilaterality in advanced age-related macular degeneration.
Chen, Haoyu; Yang, Zhenglin; Gibbs, Daniel; Yang, Xian; Hau, Vincent; Zhao, Peiquan; Ma, Xiang; Zeng, Jiexi; Luo, Ling; Pearson, Erik; Constantine, Ryan; Kaminoh, Yuuki; Harmon, Jennifer; Tong, Zongzhong; Stratton, Charity A; Cameron, D Joshua; Tang, Shibo; Zhang, Kang
2008-02-01
Single nucleotide polymorphism (SNP), rs11200638, in the promoter of HTRA1 has recently been shown to increase the risk for AMD. In order to investigate the association of this HTRA1 polymorphism and the bilaterality of AMD, we genotyped rs11200638 in control, unilateral, and bilateral advanced AMD patients. The A allele for SNP rs11200638 in HTRA1, was significantly more prevalent in bilateral wet AMD and GA patients than in unilateral groups (p=.02 and p=.03, respectively). The homozygote odds ratios of bilateral wet AMD and GA are significantly greater than those seen in unilateral groups (twofold and threefold increase, respectively). This finding is consistent with the role of HTRA1 in AMD pathogenesis and will help aid in the clinical management and prognosis of AMD patients.
Sikora, Klaudia M; Magee, David A; Berkowicz, Erik W; Berry, Donagh P; Howard, Dawn J; Mullen, Michael P; Evans, Ross D; Machugh, David E; Spillane, Charles
2011-01-07
Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following adjustment for
2011-01-01
Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following
BDNF Polymorphism Predicts General Intelligence after Penetrating Traumatic Brain Injury
Rostami, Elham; Krueger, Frank; Zoubak, Serguei; Dal Monte, Olga; Raymont, Vanessa; Pardini, Matteo; Hodgkinson, Colin A.; Goldman, David; Risling, Mårten; Grafman, Jordan
2011-01-01
Neuronal plasticity is a fundamental factor in cognitive outcome following traumatic brain injury. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, plays an important role in this process. While there are many ways to measure cognitive outcome, general cognitive intelligence is a strong predictor of everyday decision-making, occupational attainment, social mobility and job performance. Thus it is an excellent measure of cognitive outcome following traumatic brain injury (TBI). Although the importance of the single-nucleotide polymorphisms polymorphism on cognitive function has been previously addressed, its role in recovery of general intelligence following TBI is unknown. We genotyped male Caucasian Vietnam combat veterans with focal penetrating TBI (pTBI) (n = 109) and non-head injured controls (n = 38) for 7 BDNF single-nucleotide polymorphisms. Subjects were administrated the Armed Forces Qualification Test (AFQT) at three different time periods: pre-injury on induction into the military, Phase II (10–15 years post-injury, and Phase III (30–35 years post-injury). Two single-nucleotide polymorphisms, rs7124442 and rs1519480, were significantly associated with post-injury recovery of general cognitive intelligence with the most pronounced effect at the Phase II time point, indicating lesion-induced plasticity. The genotypes accounted for 5% of the variance of the AFQT scores, independently of other significant predictors such as pre-injury intelligence and percentage of brain volume loss. These data indicate that genetic variations in BDNF play a significant role in lesion-induced recovery following pTBI. Identifying the underlying mechanism of this brain-derived neurotrophic factor effect could provide insight into an important aspect of post-traumatic cognitive recovery. PMID:22087305
Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.
2012-01-01
Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097
Wu, Pengbo; Shu, Yongxiang; Guo, Fang; Luo, Hesheng; Zhang, Guo; Tan, Shiyun
2015-01-01
To explore the association between patatin-like phospholipase domain-containing protein 3(PNPLA3) gene rs738409 polymorphism and the susceptibility of non-alcoholic fatty liver disease(NAFLD). Data bases were comprehensively searched to retrace all the related studies on the association between PNPLA3 gene rs738409 polymorphism and susceptibility. Of NAFLD, the pooled OR with 95% CI of the association between PNPLA3 gene rs738409 polymorphism and NAFLD susceptibility were performed using different genetic models. Subgroup analysis based on the source of population and sensitivity analysis was performed to detect the stability of results. 28 original studies with 6 216 patients and 8 218 controls were involved in the final combination of data. Findings from the meta-analyses showed that there were strong associations between PNPLA3 gene rs738409 polymorphism and the susceptibility of NAFLD, under different genetic model comparisons[GG vs. CC:OR = 2.42, 95%CI:1.83-3.21, P < 0.001;CG vs. CC:OR = 1.28, 95%CI:1.15-1.43, P < 0.001;CG+GG vs. CC:OR = 1.31, 95%CI:1.17-1.46, P < 0.001; GG vs. CC+GC:OR = 2.26, 95%CI:1.76-2.90, P < 0.001]. Similar results were found in both Asian and Caucasian populations. Results from the Meta-analysis strongly suggested that there appeared significant association between PNPLA3 gene rs738409 polymorphism and the susceptibility of NAFLD.
Associations of the APOC3 rs5128 polymorphism with plasma APOC3 and lipid levels: a meta-analysis.
Song, Yongyan; Zhu, Liren; Richa, Mudwari; Li, Ping; Yang, Yang; Li, Suping
2015-04-18
Studies of the association between the apolipoprotein C3 gene (APOC3) rs5128 polymorphism and plasma levels of apolipoprotein C3 (APOC3) and lipids have reported apparently conflicting findings. This meta-analysis aimed to investigate the associations of the rs5128 polymorphism with fasting APOC3 and lipid levels. The following information was abstracted for each study: ethnicity, age, sex, health condition, sample size, genotyping and lipid assay methods, mean and standard deviation or standard error by genotypes for APOC3 and lipid variables. There were 42 eligible studies with 23846 subjects included in this meta-analysis. A dominant model was used for this meta-analysis. The results showed that the carriers of the variant allele G had higher levels of APOC3 [standardized mean difference (SMD): 0.22, 95% confidence interval (CI): 0.12-0.31, P<0.00001], triglycerides (TG) (SMD: 0.33, 95% CI: 0.23-0.44, P<0.00001), total cholesterol (TC) (SMD: 0.15, 95% CI: 0.09-0.22, P<0.00001), and low-density lipoprotein cholesterol (LDL-C) (SMD: 0.11, 95% CI: 0.04-0.17, P=0.001) than the non-carriers. No significant association between the APOC3 rs5128 polymorphism and lower levels of high-density lipoprotein cholesterol (HDL-C) was detected under the dominant model (SMD: -0.03, 95% CI: -0.06-0.01, P=0.156). The results from the present meta-analysis demonstrate a significant association between the APOC3 rs5128 polymorphism and higher levels of APOC3, TG, TC and LDL-C, but further studies are needed to elucidate the underlying mechanisms.
Brozaitiene, Julija; Skiriute, Daina; Burkauskas, Julius; Podlipskyte, Aurelija; Jankauskiene, Edita; Serretti, Alessandro; Mickuviene, Narseta
2018-04-01
To investigate the association among deiodinases (DIO), organic anion-transporting polypeptide 1C1 (OATP1C1) gene polymorphisms, and thyroid hormones (THs) in patients with acute myocardial infarction (AMI). In summary, 290 patients with AMI were evaluated for sociodemographic and clinical characteristics, coronary artery disease (CAD) risk factors, and comorbidities, as well as circulating thyroid-stimulating hormone and TH (triiodothyronine [T3], thyroxine [T4], free T3, free T4, and reverse T3) levels. Ten single nucleotide polymorphisms for thyroid axis related genes: DIO1 (rs11206244-C/T, rs12095080-A/G, rs2235544-A/C), DIO2 (rs225014-T/C, rs225015-G/A), DIO3 (rs945006-T/G), and OATP1C1 (rs10444412-T/C, rs10770704-C/T, rs1515777-A/G, rs974453-G/A) were genotyped. Marginal associations were observed between the DIO1, DIO2, and OATP1C1 gene polymorphisms and almost all analyzed THs (p's < 0.05). After controlling for potential confounders, the OATP1C1 rs1515777-A/G minor allele homozygous genotype (G/G) was associated with a decrease in circulating free T3 and free T3/free T4. In the AMI cohort, associations between: DIO1 rs12095080 and hypertension; DIO2 rs225015 and diabetes mellitus; and the OATP1C1 rs974453 genotype, and AMI type were established. DIO1 and DIO2 gene polymorphisms are mainly associated with T3, free T4, free T3/free T4, and [natural-log transformed (ln)] reverse T3 levels, while the OATP1C1 minor allele homozygous genotype is associated with free T3 and free T3/free T4 in CAD patients after AMI.
Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei
2012-01-01
Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508
Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population
2012-01-01
Background Inflammatory mechanisms are important in stroke risk, and genetic variations in components of the inflammatory response have been implicated as risk factors for stroke. We tested the inflammatory gene polymorphisms and their association with ischemic stroke in a Chinese Han population. Methods A total of 1,124 ischemic stroke cases and 1,163 controls were genotyped with inflammatory panel strips containing 51 selected inflammatory gene polymorphisms from 35 candidate genes. We tested the genotype-stroke association with logistic regression model. Results We found two single nucleotide polymorphisms (SNPs) in CCL11 were associated with ischemic stroke. After adjusting for multiple testing using false discovery rate (FDR) with a 0.20 cut-off point, CCL11 rs4795895 remained statistically significant. We further stratified the study population by their hypertension status. In the hypertensive group, CCR2 rs1799864, CCR5 rs1799987 and CCL11 rs4795895 were nominally associated with increased risk of stroke. In the non-hypertensive group, CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 and CCL11 rs4795895 were associated with ischemic stroke. After correction for multiple testing, CCR2 rs1799864 and CCR5 rs1799987 remained significant in the hypertensive group, and CCL11 rs3744508, LTC4S rs730012, FCER1B rs569108, TGFB1 rs1800469, LTA rs909253 remained significant in the non-hypertensive group. Conclusions Our results indicate that inflammatory genetic variants are associated with increased risk of ischemic stroke in a Chinese Han population, particularly in non-hypertensive individuals. PMID:22769019
Yang, Yanmei; Zhao, Qiaoshi; Liu, Yang; Liu, Xiaona; Chu, Yanru; Yan, Huazhu; Fan, Yumei; Huo, Simeng; Wang, Limei; Lou, Qun; Guo, Ning; Sun, Dianjun; Gao, Yanhui
2018-05-21
Skeletal fluorosis is a metabolic bone and joint disease caused by excessive accumulation of fluoride in the bones. Compared with Kazakhs, Tibetans are more likely to develop moderate and severe brick tea type skeletal fluorosis, although they have similar fluoride exposure. Single nucleotide polymorphisms (SNPs) in frizzled-related protein (FRZB) have been associated with osteoarthritis, but their association with the risk of skeletal fluorosis has not been reported. In this paper, we investigated the association of three SNPs (rs7775, rs2242070 and rs9288087) in FRZB1with brick tea type skeletal fluorosis risk in a cross-sectional case-control study conducted in Sinkiang and Qinghai, China. A total of 598 individuals, including 308 Tibetans and 290 Kazakhs, were enrolled in this study, in which cases and controls were 221 and 377, respectively. The skeletal fluorosis was diagnosed according to the Chinese diagnostic criteria of endemic skeletal fluorosis (WS192-2008). The fluoride content in tea water or urine was detected using the fluoride ion electrode. SNPs were assessed using the Sequenom MassARRAY system. Binary logistic regressions found evidence of association with rs2242070 AA genotype in only Kazakh participants [odds ratio (OR) 0.417, 95% CI 0.216-0.807, p = 0.009], but not in Tibetans. When stratified by age, this protective effect of AA genotype in rs2242070 was pronounced in Kazakh participants aged 46-65 (OR 0.321, 95% CI 0.135-0.764, p = 0.010). This protective association with AA genotype in rs2242070 in Kazakhs also appeared to be stronger with tea fluoride intake > 3.5 mg/day (OR 0.396, 95% CI 0.182-0.864, p = 0.020). Our data suggest there might be differential genetic influence on skeletal fluorosis risk in Kazakh and Tibetan participants and that this difference might be modified by tea fluoride intake.
Zhou, Tian-Biao; Jiang, Zong-Pei; Huang, Miao-Fang
2015-02-01
Association of vitamin D receptor (VDR) BsmI (rs1544410) gene polymorphism with the chronic kidney disease (CKD) susceptibility from the published reports are still conflicting. This meta-analysis was performed to evaluate the relationship between VDR BsmI (rs1544410) gene polymorphism and the risk of CKD. The association studies were identified from PubMed, Cochrane Library and China Biological Medicine Database on 1 March 2014, and eligible investigations were included and synthesized using meta-analysis method. Nine reports were recruited into this meta-analysis for the association of VDR BsmI gene polymorphism with CKD susceptibility. In this meta-analysis for overall populations, the BsmI B allele BB genotype and bb genotype were not associated with the risk of CKD (B allele: OR = 1.12, 95% CI: 0.88-1.44, p = 0.36; BB genotype: OR = 1.15, 95% CI: 0.81-1.62, p = 0.43; bb genotype: OR = 0.86, 95% CI: 0.61-1.20, p = 0.36). Furthermore, VDR BsmI gene polymorphism was not associated with CKD susceptibility in Asians and in Caucasians. In conclusion, the BsmI gene polymorphism was not associated with CKD susceptibility in overall populations, in Asians and in Caucasians. However, more studies should be conducted to confirm it.
Costa, Claudia D; Teleginski, Adriana; Al-Lahham, Yusra; Souza, Emanuel M; Valdameri, Glaucio; Alberton, Dayane; Rego, Fabiane G M; Picheth, Geraldo
2018-04-01
Metalloproteinase 9 (MMP9) is involved in the degradation of extracellular matrix molecules, and its polymorphism rs17576 (Gln279Arg) has been associated with diabetes. We investigated the association of rs17576 in a case-control study with Euro-Brazilian women with gestational diabetes. The study group consisted of a total of 262 Euro-Brazilian pregnant women classified as either healthy (n = 131, control) or with GDM (n = 131). Fluorescent probes with real time PCR (TaqMan system) were applied for genotyping. All groups were in Hardy-Weinberg equilibrium. The minor allele frequencies (G-allele) for rs17567 in healthy and GDM women were 27.1% [95% CI, 22 - 32] and 37.4% [95% CI, 32 - 43], p = 0.011, respectively. Genotypic comparison showed a significant difference (p < 0.05) between the groups. Polymorphism rs17567 was associated with GDM in the studied population and carriers of the G-allele showed an increased risk for gestational diabetes (Odds ratio 1.61; 95% CI, 1.1 - 2.3).
Tarnowski, M; Malinowski, D; Safranow, K; Dziedziejko, V; Czerewaty, M; Pawlik, A
2017-06-01
Gestational diabetes mellitus (GDM) is a metabolic disorder that occurs during pregnancy. HHEX and PROX1 are genetic loci associated with diabetes mellitus type 2. HHEX and PROX1 play significant roles in carbohydrate intolerance and diabetes because these transcription factors may be involved in the regulation of insulin secretion and in glucose and lipid metabolism. The aim of this study was to examine the association between HHEX (rs5015480) and PROX1 (rs340874) gene polymorphisms and GDM. This study included 204 pregnant women with GDM and 207 pregnant women with the normal glucose tolerance (NGT). The diagnosis of GDM was based on a 75-g oral glucose tolerance test at 24-28 weeks' gestation. There was a statistically significant prevalence of the HHEX rs5015480 CC genotype and C allele among women with GDM (C vs T allele, p = 0.021, odds ratio OR = 1.40, 95% CI: 1.05-1.87). Statistically significant higher increase of body mass and BMI during pregnancy was found in women with the HHEX rs5015480 CC genotype. The results of our study suggest an association between the HHEX gene rs5015480 polymorphism and risk of GDM. The HHEX gene rs5015480 C allele may be a risk allele of GDM that is associated with increased BMI during pregnancy. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.
Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao
2017-02-07
Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.
Serotonin-1A Receptor Polymorphism (rs6295) Associated with Thermal Pain Perception
Lindstedt, Fredrik; Karshikoff, Bianka; Schalling, Martin; Olgart Höglund, Caroline; Ingvar, Martin; Lekander, Mats; Kosek, Eva
2012-01-01
Background Serotonin (5-HT) is highly involved in pain regulation and serotonin-1A (5-HT1A) receptors are important in determining central 5-HT tone. Accordingly, variation in the 5-HT1A receptor gene (HTR1A) may contribute to inter-individual differences in human pain sensitivity. The minor G-allele of the HTR1A single nucleotide polymorphism (SNP) rs6295 attenuates firing of serotonergic neurons and reduces postsynaptic expression of the receptor. Experiments in rodents suggest that 5-HT1A-agonism modulates pain in opposite directions at mild compared to high noxious intensities. Based upon this and several other similar observations, we hypothesized that G-carriers would exhibit a relative hypoalgesia at mild thermal stimuli but tend towards hyperalgesia at higher noxious intensities. Methods Fourty-nine healthy individuals were selectively genotyped for rs6295. Heat- and cold-pain thresholds were assessed along with VAS-ratings of a range of suprathreshold noxious heat intensities (45°C–49°C). Nociceptive-flexion reflex (NFR) thresholds were also assessed. Results Volunteers did not deviate significantly from Hardy-Weinberg equilibrium. G-carriers were less sensitive to threshold-level thermal pain. This relative hypoalgesia was abolished at suprathreshold noxious intensities where G-carriers instead increased their ratings of heat-pain significantly more than C-homozygotes. No differences with regard to NFR-thresholds emerged. Conclusion/Significance To the best of our knowledge this is the first study of human pain perception on the basis of variation in HTR1A. The results illustrate the importance of including a range of stimulus intensities in assessments of pain sensitivity. In speculation, we propose that an attenuated serotonergic tone may be related to a ‘hypo- to hyperalgesic’ response-pattern. The involved mechanisms could be of clinical interest as variation in pain regulation is known to influence the risk of developing pain pathologies
Harms, Katharina C; Kapitza, Karl P; Pahl, Lisa; Tran, Anh-Thu; Volkmann, Lilly; Buers, Dennis; Karst, Matthias; Stuhrmann, Manfred; Bernateck, Michael
2013-02-01
The etiology of multisomatoform disorder (MSD) is still largely unknown, but genetic factors seem to have an influence on pathogenesis. Pain is a major symptom of MSD and polymorphisms of different proinflammatory cytokines have been found associated with pain in former studies. Therefore, we presumed that cytokine polymorphisms could also be associated with MSD. Groups of 148 MSD patients with pain as the leading clinical symptom and 149 age and gender matched healthy controls participated in this study. Nine cytokine polymorphisms were genotyped and statistically analyzed for associations with MSD. Allelic and genotypic associations were found for rs16944 (interleukin 1β), rs1800629 (tumor necrosis factor) and rs909253 (lymphotoxin α). After correcting for multiple testing, the association of rs1800629 with MSD remained significant. The rare A-allele was correlated with MSD (p=0.007). Since the common G-allele of rs1800629 (TNFα) occurs much more often in the control group than in the MSD group it is assumed to be protective. Being carrier of the A-allele seems to be a risk factor for MSD. Copyright © 2012 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...
Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...
Association between long non-coding RNA polymorphisms and cancer risk: a meta-analysis.
Huang, Xin; Zhang, Weiyue; Shao, Zengwu
2018-05-25
Several studies have suggested that long non-coding RNA (lncRNA) gene polymorphisms are associated with cancer risk. In the present study, we conducted a meta-analysis related to studies on the association between lncRNA single-nucleotide polymorphisms (SNPs) and the overall risk of cancer. A total 12 SNPs in five common lncRNA genes were finally included in the meta-analysis. In the lncRNA antisense noncoding RNA in the INK4 locus (ANRIL), the rs1333048 A/C, rs4977574 A/G, and rs10757278 A/G polymorphisms, but not rs1333045 C/T, were correlated with overall cancer risk. Our study also demonstrated that other SNPs were correlated with overall cancer risk, namely, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1, rs619586 A/G), HOXA distal transcript antisense RNA (HOTTIP, rs1859168 A/C) and highly up-regulated in liver cancer (HULC, rs7763881 A/C). Moreover, four prostate cancer‑associated non‑coding RNA 1 (PRNCR1, rs16901946 G/A, rs13252298 G/A, rs1016343 T/C, and rs1456315 G/A) SNPs were in association with cancer risk. No association was found between the PRNCR1 (rs7007694 C/T) SNP and the risk of cancer. In conclusion, our results suggest that several studied lncRNA SNPs are associated with overall cancer risk. Therefore, they might be potential predictive biomarkers for the risk of cancer. More studies based on larger sample sizes and more lncRNA SNPs are warranted to confirm these findings. ©2018 The Author(s).
Obregón Rivas, Ana Maria; Santos, Jose L; Valladares, Macarena A; Cameron, Jameson; Goldfield, Gary
2018-03-27
The aim of this study was to assess the association between the single-nucleotide polymorphism rs9939609 in the FTO gene and homeostatic/non-homeostatic eating behavior patterns in Chilean children. A cross-sectional study was conducted in 258 children (44% female; 8-14 y of age). Anthropometric measurements (weight, height, Z-score of height, body mass index, and waist circumference) were performed. Eating behavior was assessed using the Eating in Absence of Hunger Questionnaire; the Child Eating Behavior Questionnaire; the Three Factor Eating Questionnaire, and the Food Reinforcement Value Questionnaire. Genotype of rs9939609 was determined by a Taqman assay. Association of rs9939609 with eating behavior was assessed using non-parametric tests. Allelic frequencies of rs9939609 were estimated as 77% for the A allele and 23% for the T allele. We found that normal-weight girl A carriers had higher scores of Satiety Responsiveness and Slowness on the Eating subscale. Normal-weight boy A carriers showed significantly higher scores on the Negative Affect and lower scores of the Desire to Drink subscale. In overweight children, A carriers showed higher scores on the Food Responsiveness, Emotional Overeating, Enjoyment of Food, and Food Choice subscales and lower scores on the Satiety- Responsiveness and Slowness in Eating subscales. In obese children, we found higher scores on the Cognitive Restrained subscale and lower Food Choice. The rs9939609 A allele of the FTO gene is associated with eating behavior traits and may predispose to obesity. Copyright © 2018 Elsevier Inc. All rights reserved.
Xu, X-L; Yao, Y-L; Xu, W-Z; Feng, J-G; Mao, W-M
2015-04-15
Mismatch repair (MMR) genes, as well as the nucleotide excision repair genes, play an important role in removing cisplatin-DNA adducts, and the mutation of MMR genes in tumors can lead to a decreased response to platinum-based therapies. We examined MutS homolog 3 (MSH3), a mismatch repair gene, and whether polymorphisms of MSH3 were associated with response and survival in advanced non-small cell lung cancer (NCSLC) patients who were treated with platinum-based chemotherapy. The peripheral blood of 180 advanced NCSLC patients who were treated with first-line platinum-based chemotherapy was collected to determine the patients' genotypes of MSH3. The three genotypes of the MSH3 polymorphisms rs26279, rs1650697 and rs1105524 were investigated. A statistically significant association was observed between the polymorphism rs26279 (Ala1054Thr) and sensitivity to platinum-based chemotherapy (P = 0.014). A significant correlation was found between rs1105524 and progression-free survival (PFS), with the G/A and A/A genotypes (median survival time: 14.27 months; 95%CI = 9.80-18.75) suffering shorter survival than patients with the G/G genotype (median survival time: 26.37 months; 95%CI = 15.03-37.71) (P = 0.04). Our results showed that single nucleotide polymorphisms in MSH3 had an impact on the chemotherapy response and prognosis of advanced NCSLC patients who were treated with platinum-based chemotherapy.
Zhang, Jixiang; Wu, Jianhong; Peng, Xiulan; Song, Jia; Wang, Jun; Dong, Weiguo
2014-01-01
Many studies have investigated the associations between the signal transducer and activator of transcription 3 (STAT3) in the susceptibility to ulcerative colitis (UC) and Crohn's disease (CD). However, the results remain inconsistent. This meta-analysis determined the risk of STAT3 rs744166 polymorphism-conferred UC and CD susceptibility. Electronic databases, including PubMed, EMBASE and the Cochrane Library, were searched for all eligible studies that evaluated the association between STAT3 rs744166 polymorphisms with UC and CD risk up to August 21, 2014. The pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using fixed- or random-effects models. Twelve studies containing 10298 patients with CD, 4244 patients with UC and 11191 controls were included in this meta-analysis. The results indicated that the STAT3 rs744166 polymorphism was associated with CD and UC susceptibility (CD: GA+AA vs. GG, OR = 1.20, 95%CI, 1.11-1.30, I2 = 0%, Punadjusted<0.00001, PBonferroni<0.00005, PFDR<0.00001; UC: GA+AA vs. GG, OR = 1.21, 95%CI, 1.08-1.36, I2 = 1%, Punadjusted = 0.001, PBonferroni = 0.005, PFDR = 0.00125). In subgroup analyses by ethnicity, the significant association was found only among Caucasians. However, when grouped by age of onset, positive associations were found both among adults and children. In addition, when stratified by study design and genotyping methods, the risk of CD was significantly associated with the STAT3 rs744166 polymorphism in hospital-based and population-based groups and in SNP Array and SNPlex groups. For UC, significant associations were also found in population-based, PCR-RFLP and SNPlex groups. Moreover, these findings were sufficiently robust to withstand the Bonferroni correction and false discovery rate (FDR). This meta-analysis indicates that carriers of the STAT3 rs744166 'A' allele have a significantly greater risk of CD and UC, especially among Caucasians.
Significance of neurexin and neuroligin polymorphisms in regulating risk of Hirschsprung's disease.
Li, Yanhong; Liu, Hui; Dong, Yubin
2018-06-01
By performing a basic case-control study among a Chinese population, the aims of this study were to explore if single nucleotide polymorphisms (SNPs) within neurexin and neuroligin were associated with susceptibility to Hirschsprung's disease (HD). Eleven SNPs within neurexin and neuroligin were selected in this basic case-control study, and this study recruited 210 children with HD and 187 healthy children. The t-test and Χ 2 test were used to find the difference between case and control in their clinical variables. OR and 95% CI were used to assess the association between HD susceptibility and neurexin/neuroligin polymorphisms/haplotypes. Several SNPs were significantly associated with altered risk of HD in the Chinese Han population, including rs1421589 within NRXN1 , rs11795613 and rs4844285 within NLGN3, as well as rs5961397, rs7157669 and rs724373 within NLGX4X (all P<0.05). Further studies presented that the effects of rs1421589 within NRXN1 , rs4844285 and rs11795613 within NLGN3 , as well as rs5961397 within NLGX4X on HD phenotypes were also statistically significant (all P<0.05). Conclusively, the polymorphisms and haplotypes situated within neurexin and neuroligin were markedly associated with the onset of HD, implying that mutations of neurexin and neuroligin might serve as the treatment target for HD for the Chinese children. © American Federation for Medical Research (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Babanejad, Mojgan; Moein, Hamidreza; Akbari, Mohammad R; Badiei, Azadeh; Yaseri, Mehdi; Soheilian, Masoud; Najmabadi, Hossein
2016-06-01
Age-related macular degeneration (AMD) is a complex disorder which results in irreversible vision loss and progressive impairment of central vision. Disease susceptibility is influenced by multiple genetic and environmental factors. Single nucleotide polymorphisms (SNP) in the complement factor H gene are the most important genetic risk factors. We conducted a case-control study to investigate the association four SNPs (dbSNP ID: rs800292, rs1061170, rs2274700 and rs3753395) of CFH gene with AMD in the Iranian population. We recruited 100 AMD patients and 100 age- and sex-matched normal controls. Direct sequencing for three SNPs (rs800292, rs2274700 and rs3753395) and restriction fragment length polymorphism utilized for rs1061170. Allele and genotype frequencies of SNPs were calculated and tested for departure from Hardy-Weinberg equilibrium using the Chi-square test. An allelic and genotypic association was compared by logistic regression analysis using the SNPassoc. According to our results, the frequencies of risk allele for all SNPs (G, G, A, and C alleles of rs800292, rs2274700, rs3753395 and rs1061170, respectively) were significantly higher in AMD patients (p value < 0.001). AMD individuals who had at least one copy of the C allele of rs1061170 had an increased risk of disease compared with cases with the T allele. Other studied polymorphisms showed the same association. Our results suggest the contribution of all four predicted CFH polymorphisms in AMD susceptibility among the Iranian population. This association with CFH may lead to early detection and new strategies for prevention and treatment of AMD.
Ashouri, Elham; Meimandi, Elham Mahmoodi; Saki, Forough; Dabbaghmanesh, Mohammad Hossein; Omrani, Gholamhossein Ranjbar; Bakhshayeshkaram, Marzieh
2015-11-01
Failure to achieve optimal bone mass in childhood is the primary cause of decreased adult bone mineral density (BMD) and increased bone fragility in later life. Activating and inactivating LRP5 gene mutations has been associated with extreme bone-related phenotypes. Our aim was to investigate the role of LRP5 polymorphism on BMD, mineral biochemical parameters, and body composition in Iranian children. This cross-sectional study was performed on 9-18 years old children (125 boys, 137 girls). The serum level of calcium, phosphorous, alkaline phosphatase, and vitamin D parameters were checked. The body composition and BMD variables were measured by the Hologic system DXA. The rs566442 (V1119V) coding polymorphism in exon 15 of LRP5 was performed using PCR-RFLP method. Linear regression analysis, with adjustment for age, gender, body size parameters, and pubertal status was used to determine the association between LRP5 polymorphism (rs556442) and bone and body composition parameters. The allele frequency of the rs566442 gene was 35.5 % A and 63.9 % G. Our study revealed that LRP5 (rs556442) has not any significant influence on serum calcium, phosphorus, 25OHvitD, and serum alkaline phosphatase (P > 0.05). Total lean mass was greater in GG genotype (P = 0.028). Total body less head area (P = 0.044), spine BMD (P = 0.04), and total femoral BMC (P = 0.049) were lower in AG heterozygote genotype. This study show LRP5 polymorphism may associate with body composition and BMD in Iranian children. However, further investigations should be done to evaluate the role of other polymorphism.
Díaz-Soto, G; Romero, E; Pérez-Castrillón, J L; Jauregui, O I; de Luis Román, D
2016-12-01
Although normocalcemic and asymptomatic hyperparathyroidism (HPT) are becoming more common, they remain only partially understood. Parathyroid hormone ( PTH ) polymorphisms have been associated with disease severity in classical HPT. The aim of the present study was to evaluate the clinical effect of PTH polymorphism (rs6254) in normocalcemic and asymptomatic HPT. A prospective study of 61 consecutive patients with normocalcemic or asymptomatic HPT was carried out. Secondary causes of HPT were ruled out. All patients were followed for≥1 year. Calcium and phosphorus metabolism parameters were assessed at least twice during the follow-up period to classify as normocalcemic or asymptomatic HPT. Bone mineral density (BMD) and the rs6254 polymorphism genotype were also assessed. Genotype rs6254GG was observed in 23 patients (37.7%) whereas GA and AA genotypes were presented in 29 (47.5%) and 9 (14.8%) patients, respectively. Age, sex and genotype distributions were comparable in both groups. In asymptomatic but not normocalcemic HPT patients, the GG genotype was associated with a significantly higher level of intact PTH [200.2 (SD 76.5) vs. 113.3 (SD 25.9) pg/ml; p<0.01], and significantly lower Z-score densitometry at the femoral neck, proximal femur, and lumbar spine. Both remained significant after adjusting for major confounding factors by multiple linear regression. The present study supports the independent pathogenic effect of rs6254GA polymorphism on the development and severity of BMD complications in patients with asymptomatic but not normocalcemic HPT. Further studies are needed to confirm this finding and to assess the effect of other polymorphisms in normocalcemic and asymptomatic HPT. © Georg Thieme Verlag KG Stuttgart · New York.
Khrustaleva, A M; Gritsenko, O F; Klovach, N V
2013-11-01
The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.
Association between RTEL1 gene polymorphisms and COPD susceptibility in a Chinese Han population.
Ding, Yipeng; Xu, Heping; Yao, Jinjian; Xu, Dongchuan; He, Ping; Yi, Shengyang; Li, Quanni; Liu, Yuanshui; Wu, Cibing; Tian, Zhongjie
2017-01-01
We investigated the association between single-nucleotide polymorphisms in regulation of telomere elongation helicase 1 ( RTEL1 ), which has been associated with telomere length in several brain cancers and age-related diseases, and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese Han population. In a case-control study that included 279 COPD cases and 290 healthy controls, five single-nucleotide polymorphisms in RTEL1 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. In the genotype model analysis, we determined that rs4809324 polymorphism had a decreased effect on the risk of COPD (CC versus TT: OR =0.28; 95% CI =0.10-0.82; P =0.02). In the genetic model analysis, we found that the "C/C" genotype of rs4809324 was associated with a decreased risk of COPD based on the codominant model (OR =0.33; 95% CI =0.13-0.86; P =0.022) and recessive model (OR =0.32; 95% CI =0.12-0.80; P =0.009). Our data shed new light on the association between genetic polymorphisms of RTEL1 and COPD susceptibility in the Chinese Han population.
Jiménez-Sousa, María Ángeles; Gómez-Moreno, Ana Zaida; Pineda-Tenor, Daniel; Medrano, Luz Maria; Sánchez-Ruano, Juan José; Fernández-Rodríguez, Amanda; Artaza-Varasa, Tomas; Saura-Montalbán, José; Vázquez-Morón, Sonia; Ryan, Pablo; Resino, Salvador
2018-01-01
The polymorphisms at the α-chain of the IL-7 receptor (IL7RA) have been related to T-cell homeostasis and development and may contribute to immune system deregulation. In the present study, we analyzed the association between IL7RA polymorphisms and the progression of liver fibrosis in patients infected with HCV. We carried out a retrospective study with a design consisting of repeated measurements in 187 HCV-infected patients, to study the risk prediction of liver fibrosis progression using genetic factors. We genotyped the rs6897932, rs987106 and rs3194051 IL7RA polymorphisms using the Agena Bioscience's MassARRAY. Transient elastography was used to measure liver stiffness. The used cut-offs were: <7.1 kPa (F0-F1), 7.1-9.4 kPa (F2; significant fibrosis), 9.5-12.4 kPa (F3; advanced fibrosis), and ≥12.5 kPa (F4; cirrhosis). All HCV genotypes were analyzed. The median of follow-up time was 47.9 months. Baseline liver stiffness measurement (LSM) values did not show significant statistical differences for IL7RA genotypes (p>0.05). In univariate analysis, the rs6897932 T allele had a positive relationship with an increase in LSM (arithmetic mean ratio (AMR) = 1.21 (95%CI = 1.08; 1.36); p = 0.001), progression to advanced fibrosis (F≥3) (odds ratio (OR) = 2.51 (95%CI = 1.29; 4.88); p = 0.006) and progression to cirrhosis (F4) (OR = 2.71 (95%CI = 0.94; 5.03); p = 0.069). In multivariable analysis, the rs6897932 T allele was related to a higher increase of LSM values during follow-up (adjusted AMR = 1.27 (95%CI = 1.13; 1.42); p<0.001) and higher odds of progression to advanced fibrosis [adjusted OR = 4.46 (95%CI = 1.87; 10.62); p = 0.001], and progression to cirrhosis [adjusted OR = 3.92 (95%CI = 1.30; 11.77); p = 0.015]. Regarding IL7RA rs987106 and rs3194051 polymorphisms, we did not find significant results except for the relationship between IL7RA rs987106 and the increase in LSM values [adjusted OR = 1.12 (95%CI = 1.02; 1.23); p = 0.015]. The IL7RA rs6897932
Wang, Yuemei; Wang, Xiaowei
2018-01-01
Background A number of studies have investigated the roles of excision repair cross-complementation group 1 (ERCC1) gene rs3212986 polymorphisms as potential biomarkers in gastric cancer (GC). However, the results were inconsistent. Here, we performed a meta-analysis to explore ERCC1 rs3212986 polymorphisms in the chemotherapy response and clinical outcome of GC. Methods PubMed, Embase, and Web of Science were searched up to July 28, 2017, for studies on the association between ERCC1 rs3212986 A/C polymorphisms and response to chemotherapy as well as overall survival time of GC. A fixed-effect or random-effect model was used to calculate the pooled odds ratios (ORs) based on the results from the heterogeneity tests. Results The result revealed that there was no significant association between the ERCC1 rs3212986 A/C polymorphism and response to chemotherapy in GC under comparison models (AA + CA versus CC, OR 0.95, P=0.80, AA versus CA, OR 0.85, P=0.55, AA versus CC, OR 0.74, P=0.47). Further identification suggested that ERCC1 rs3212986 A/C polymorphisms were not linked with the overall survival of GC (AA + CA versus CC, OR 1.09, P=0.52, AA versus CA, OR 1.05, P=0.85, AA versus CC, OR 1.43, P=0.23). Conclusion Our meta-analysis indicated that the ERCC1 rs3212986 A/C polymorphism was not associated with response to chemotherapy or overall survival time in GC. Well-designed studies with larger sample sizes and more ethnic groups should be performed to further validate our results. PMID:29302191
Petit, Anne-Cécile; El Asmar, Khalil; David, Denis J; Gardier, Alain M; Becquemont, Laurent; Fève, Bruno; Verstuyft, Céline; Corruble, Emmanuelle
2018-02-02
The study of genetic polymorphisms involved in antidepressants (AD) response is essential to provide a personalized medicine approach in the field of depression. β-arrestin 2 (ARRB2) is a candidate gene in the pharmacogenetics of AD as it is involved in the signaling cascade downstream of numerous neurotransmitter receptors. We investigated the association between five ARRB2 single nucleotide polymorphisms (SNPs): rs1045280, rs2036657, rs4790694, rs3786047 and rs452246, and response to AD treatment in a sample of 569 patients with a major depressive episode treated for 6months. We show that GG/GT patients for rs4522461 (n=534) and AA/AC patients for rs4790694 (n=244) have a lower response to AD than other genotype groups (HDRS score of 10.9 vs 8.0 after 6months, multivariate analysis: p=0.03; 12.2 vs 9.6, p=0.02, respectively). These data provide additional evidence that β-arrestin 2 is a regulator of intracellular signal transduction processes involved in AD treatment. Copyright © 2017 Elsevier Inc. All rights reserved.
Three polymorphisms in interleukin-1β gene and risk for breast cancer: a meta-analysis.
Liu, Xiaoan; Wang, Zhanwei; Yu, Jinhua; Lei, Gang; Wang, Shui
2010-12-01
Interleukin-1β (IL-1β), which is involved in inflammatory and immunological responses, plays an important role in the development and progression of breast cancer. Three functional single nucleotide polymorphisms (SNPs) identified in IL-1β gene are thought to influence breast cancer risk. The results of the association between IL-1β polymorphisms and breast cancer remain inconsistent. Therefore, we conducted a meta-analysis of eight case-control studies with rs1143627 (T > C), rs16944 (C > T), and rs1143634 (C > T). We found that the variant CC genotype of rs1143627 was associated with a significantly increased breast cancer risk (CC vs. TT: OR = 1.37, 95% CI = 1.10-1.70, P = 0.22 for heterogeneity; the recessive model CC vs. TT/TC: OR = 1.40, 95% CI = 1.17-1.67, P = 0.49 for heterogeneity). For rs16944 (C > T) and rs1143634 (C > T), no significant associations were found in all genetic models. In conclusion, the present meta-analysis suggests that rs1143627 is associated with breast cancer risk.
Association between FOXP3 polymorphisms and vitiligo in a Han Chinese population.
Song, P; Wang, X-W; Li, H-X; Li, K; Liu, L; Wei, C; Jian, Z; Yi, X-L; Li, Q; Wang, G; Li, C-Y; Gao, T-W
2013-09-01
Vitiligo is an autoimmune chronic depigmentation disorder caused by melanocyte loss. Previous studies found that CD4(+)CD25(+) regulatory T-cell (Treg) dysfunction was involved in the pathogenesis of vitiligo and that gene polymorphisms in forkhead box P3 (FOXP3) - a master regulator of Treg development and function - were associated with susceptibility to some autoimmune disorders. Therefore, we hypothesized that functional polymorphisms of the FOXP3 gene might be associated with vitiligo via dysregulation of Treg cells. To evaluate whether FOXP3 polymorphisms are associated with vitiligo risk. In this hospital-based case-control study of 682 patients with vitiligo and 682 vitiligo-free age- and sex-matched controls, we genotyped three single nucleotide polymorphisms (SNPs) of the FOXP3 gene - rs2232365, rs3761548 and rs5902434 - by performing polymerase chain reaction with sequence-specific primers (PCR-SSP). Significantly increased vitiligo risk was associated with the rs2232365 GG [odds ratio (OR) 1·68, 95% confidence interval (CI) 1·17-2·39, P = 0·004] and rs3761548 AA (OR 1·82, 95% CI 1·10-3·01, P = 0·033) genotypes compared with the rs2232365 AA and rs3761548 CC genotypes. On combined analysis of these three variant alleles, we found that individuals carrying 2-6 variant alleles had significantly increased vitiligo risk (OR 1·34, 95% CI 1·08-1·66). This risk was more pronounced in the following subgroups: age > 20 years, male sex, active vitiligo, nonsegmental vitiligo and other accompanying autoimmune diseases. FOXP3 gene polymorphisms contributed to vitiligo risk in a Han Chinese population. © 2013 The Authors BJD © 2013 British Association of Dermatologists.
Safarinejad, Mohammad Reza; Shafiei, Nayyer; Safarinejad, Saba
2013-12-01
We wanted to determine whether genetic polymorphisms of aryl hydrocarbon receptor (AhR) gene are associated with susceptibility to male infertility. This study comprised 176 men with idiopathic infertility and 352 healthy fertile men who served as controls. Seven single-nucleotide polymorphisms (SNPs) of the AhR gene (rs2066853, rs1476080, rs10250822, rs10247158, rs2282885, rs6960165, and rs7811989) were selected and genotyped by the polymerase chain reaction-restriction fragment length polymorphism analysis. The serum levels of reproductive and thyroid hormones and inhibin B were also measured. After multiple regression analysis, 2 of the 7 studied SNPs were significantly associated with the occurrence of male infertility. Men with rs2066853 AA genotype had 33% decreased risk of being infertile (odds ratio [OR] = 0.67, 95% confidence interval [CI]: 0.46-0.87; P = .003). The C allele of rs2282885 was significantly associated with infertility risk, with an OR of 2.14 (95% CI: 1.64-3.72) for heterozygotes and 3.54 (95% CI: 2.25-5.84) for homozygotes. When haplotypes were composed of 7 AhR SNP sites, patients with AACACAG haplotype harbored more than 75% decreased risk of being infertile (OR = 0.21, 95% CI: 0.11-0.32; P = .001). Conversely, carriers of the AACACGA haplotype had more than 12-fold increased risk of being infertile (OR = 12.62, 95% CI: 2.77-52.74; P = .00001). Homozygosity for the rs2066853 A allele and rs2282885 C allele decreases and increases the risk of developing male infertility, respectively.
Song, Jaewoo; Xue, Cheng; Preisser, John S; Cramer, Drake W; Houck, Katie L; Liu, Guo; Folsom, Aaron R; Couper, David; Yu, Fuli; Dong, Jing-Fei
2016-01-01
VWF is extensively glycosylated with biantennary core fucosylated glycans. Most N-linked and O-linked glycans on VWF are sialylated. FVIII is also glycosylated, with a glycan structure similar to that of VWF. ST3GAL sialyltransferases catalyze the transfer of sialic acids in the α2,3 linkage to termini of N- and O-glycans. This sialic acid modification is critical for VWF synthesis and activity. We analyzed genetic and phenotypic data from the Atherosclerosis Risk in Communities (ARIC) study for the association of single nucleotide polymorphisms (SNPs) in the ST3GAL4 gene with plasma VWF levels and FVIII activity in 12,117 subjects. We also analyzed ST3GAL4 SNPs found in 2,535 subjects of 26 ethnicities from the 1000 Genomes (1000G) project for ethnic diversity, SNP imputation, and ST3GAL4 haplotypes. We identified 14 and 1,714 ST3GAL4 variants in the ARIC GWAS and 1000G databases respectively, with 46% being ethnically diverse in their allele frequencies. Among the 14 ST3GAL4 SNPs found in ARIC GWAS, the intronic rs2186717, rs7928391, and rs11220465 were associated with VWF levels and with FVIII activity after adjustment for age, BMI, hypertension, diabetes, ever-smoking status, and ABO. This study illustrates the power of next-generation sequencing in the discovery of new genetic variants and a significant ethnic diversity in the ST3GAL4 gene. We discuss potential mechanisms through which these intronic SNPs regulate ST3GAL4 biosynthesis and the activity that affects VWF and FVIII.
Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin; Daneshpour, Maryam S; Mottaghi, Azadeh; Azizi, Fereidoun
2017-01-01
The aim of this study was to examine the interaction of dietary food groups and genetic variants of APOA1/APOC3, relative to Metabolic Syndrome (MetS) risk in adults. In this matched nested case-control study, 414 MetS subjects and 414 controls were selected from among participants of Tehran Lipid and Glucose Study. Dietary intake was assessed with the use of a valid and reliable semi-quantitative food frequency questionnaire. Single Nucleotide Polymorphisms (SNPs), APOA1 (rs670, -75G>A and rs5069, +83C>T/APOC3 rs5128 C3238>G) were genotyped by the conventional polymerase chain reaction and restriction fragment length polymorphism. The mean (SD) of age was 40.7 (13) and 41.2 (13) years in male cases and controls versus 44.0 (11) and 44.0 (12) years in female case and controls. A significant interaction between intake quartiles of the sugar group and APOA1 combined group (GA+AA/CT+TT) SNPs was found; The ORs for these genotype carriers were (1, 0.44, 0.36, 0.23; P trend<0.001) in quartiles of intake, relative to other combined genotypes (P interaction=0.02). MetS risk appeared to be increased significantly in higher quartiles of sweet beverages and fish intakes in the GA+AA/CT+TT/CC genotypes of APOA1/APOC3 SNPs, compared to other genotypes (P interaction=0.01). The combined effect of genotypes of APOC3/APOA1 showed further decrease in MetS risk in higher quartiles of sugar group intakes (OR: 1, 0.24, 0.26, 0.14, P trend=0.001) relative to other combinations (P interaction=0.008). Results obtained demonstrate that some dietary food groups (sugar, fish, and sweet beverages) modulate the effect of APOA1/APOC3 SNPs in relation to MetS risk.
Kim, Young Jong; Park, Jin Kyung; Kang, Won Sub; Kim, Su Kang; Han, Changsu; Na, Hae Ri; Park, Hae Jeong; Kim, Jong Woo; Kim, Young Youl; Park, Moon Ho
2017-01-01
Objective Mitochondrial dysfunction is a prominent and early feature of Alzheimer's disease (AD). The morphologic changes observed in the AD brain could be caused by a failure of mitochondrial fusion mechanisms. The aim of this study was to investigate whether genetic polymorphisms of two genes involved in mitochondrial fusion mechanisms, optic atrophy 1 (OPA1) and mitofusin 2 (MFN2), were associated with AD in the Korean population by analyzing genotypes and allele frequencies. Methods One coding single nucleotide polymorphism (SNP) in the MFN2, rs1042837, and two coding SNPs in the OPA1, rs7624750 and rs9851685, were compared between 165 patients with AD (83 men and 82 women, mean age 72.3±4.41) and 186 healthy control subjects (82 men and 104 women, mean age 76.5±5.98). Results Among these three SNPs, rs1042837 showed statistically significant differences in allele frequency, and genotype frequency in the co-dominant 1 model and in the dominant model. Conclusion These results suggest that the rs1042837 polymorphism in MFN2 may be involved in the pathogenesis of AD. PMID:28096879
Gutwerk, Alexander; Wex, Thomas; Stein, Kerstin; Langner, Cosima; Canbay, Ali; Malfertheiner, Peter
2018-01-01
The aim of the study was to evaluate the serological rate of Helicobacter pylori (H. pylori) infection in patients with chronic hepatitis C virus (HCV) infection and determine any correlations with liver damage and IL28B single-nucleotide polymorphism (SNP). One hundred eighty-nine patients with chronic HCV infection were included in the study, and H. pylori status was defined based on anti-H. pylori-IgG or anti-CagA-IgG antibodies using enzyme-linked immunosorbent assay (ELISA). Liver damage was assessed using histology or transient elastography. IL28B C/T polymorphism (rs12979860) was evaluated in circulating blood cells using a PCR-based restriction fragment length polymorphism assay. Overall H. pylori serology was positive in 38.1% of our HCV-infected subjects. Among those, the anti-CagA-IgG positivity rate was 43.1% and was within the range of previously described populations of the same region. Highest prevalence of H. pylori was found in patients between 31 and 40 years compared to other age subgroups. The seropositivity rate was higher in the non-cirrhotic group than the cirrhotic one (45.4% vs. 20.0%, p < 0.05). No difference was found in IL28B genotype between H. pylori-positive and -negative cohorts. However, we observed a trend for the lower anti-CagA-IgG expression level in relation to the IL28B T-allele. Our results do not support an association between HCV and H. pylori infection. Whether IL28B SNP has a functional role in modulation of serological response to H. pylori CagA needs further investigation. PMID:29510558
Ying, Ying; Chen, Yong; Li, Zhen; Huang, Haiyan; Gong, Qiongyao
2017-04-01
The purpose of this study was to investigate the relationship between P2RX7 gene single nucleotide polymorphisms and primary gout and hyperuricemia in a Chinese Han male population. The genetic distributions of the single nucleotide polymorphisms (SNPs) rs2230911, rs208294, rs435309, rs28360447, rs1718119, rs28360457, and rs3751143 in P2RX7 were detected in 293 primary gout patients, 187 hyperuricemia patients and 269 controls using SNaPshot technology. Statistical analyses were implemented using SPSS version 20.0. The genetic distributions of each group were tested for Hardy-Weinberg equilibrium (HWE). T test, analysis of variance, rank sum test and Chi-square test were measured to assess differences in clinical data and polymorphisms among groups. Logistic regression was used to assess susceptibility to disease with odds ratios (ORs) and 95% confidence intervals (95% CIs). SHEsis software was used to calculate linkage disequilibrium blocks and haplotype association risk. P < .05 was regarded as statistically significant. Three SNPs (rs2230911, rs208294 and rs435309) did not deviate significantly from HWE (P > .05). In the comparison between primary gout and control, the frequencies of rs2230911 genotypes were significantly different (P = .002), and allele G was associated with a higher risk of primary gout than allele C [OR (95% CI) = 1.755 (1.278, 2.410), P < .001]. There was also a higher risk of primary gout in genotype (CG + GG) compared with genotype CC [OR (95% CI) = 1.876 (1.303, 2.701), P = .001]. However, no significant difference in allelic or genotypic frequency was observed between primary gout patients and hyperuricemia patients (P > .0167). Similarly, there were no obvious differences in the other two polymorphisms among the three groups (P > .05). Our results reveal that P2RX7 rs2230911 may be associated with primary gout risk in a Chinese Han male population and allele G may be a susceptibility factor for
Gunst, Annika; Jern, Patrick; Westberg, Lars; Johansson, Ada; Salo, Benny; Burri, Andrea; Spector, Tim; Eriksson, Elias; Sandnabba, N Kenneth; Santtila, Pekka
2015-03-01
Female sexual desire and arousal problems have been shown to have a heritable component of moderate size. Previous molecular genetic studies on sexual desire have mainly focused on genes associated with neurotransmitters such as dopamine and serotonin. Nevertheless, there is reason to believe that hormones with more specific functions concerning sexuality could have an impact on sexual desire and arousal. The aim of the present study was to investigate the possible effects of 17 single nucleotide polymorphisms (SNPs) located in estrogen receptor genes on female sexual desire and subjective and genital arousal (lubrication). Based on previous research, we hypothesized that ESR1 and ESR2 are relevant genes that contribute to female sexual desire and arousal. The desire, arousal, and lubrication subdomains of the Female Sexual Function Index self-report questionnaire were used. The present study involved 2,448 female twins and their sisters aged 18-49 who had submitted saliva samples for genotyping. The participants were a subset from a large-scale, population-based sample. We found nominally significant main effects on sexual desire for three ESR2 -linked SNPs when controlled for anxiety, suggesting that individuals homozygous for the G allele of the rs1271572 SNP, and the A allele of the rs4986938 and rs928554 SNPs had lower levels of sexual desire. The rs4986938 SNP also had a nominally significant effect on lubrication. No effects for any of the SNPs on subjective arousal could be detected. The number of nominally significant results for SNPs in the ESR2 gene before correcting for multiple testing suggests that further studies on the possible influence of this gene on interindividual variation in female sexual functioning are warranted. In contrast, no support for an involvement of ESR1 was obtained. Our results should be interpreted with caution until replicated in independent, large samples. © 2014 International Society for Sexual Medicine.
Hovsepian, Silva; Javanmard, Shaghayegh Haghjooy; Mansourian, Marjan; Hashemipour, Mahin; Tajadini, Mohamadhasan; Kelishadi, Roya
2018-01-01
Background: Genetically, predisposed children are considered as at-risk individuals for cardiovascular disease. In this study, we aimed to compare the frequency of four-lipid regulatory polymorphism in obese and normal-weight children with and without cardiometabolic risk factors. Materials and Methods: In this nested case–control study, 600 samples of four groups of participants consisted of those with normal weight with and without cardiometabolic risk factors and obese with and without cardiometabolic risk factors. Allelic and genotypic frequencies of GCKR (rs780094), GCKR (rs1260333), MLXIPL (rs3812316), and FADS (rs174547) polymorphisms were compared in the four studied groups. Results: Data of 528 samples were complete and included in this study. The mean (standard deviation) age of participants was 15.01 (2.21) years. Frequency of tt allele (minor allele) of GCKR (rs1260333) polymorphism was significantly lower in normal weight metabolically healthy participants than metabolically unhealthy normal weight (MUHNW) and obese children with and without cardiometabolic risk factor (P = 0.01). Frequency of ga allele of GCKR (rs780094) polymorphism was significantly higher in normal weight children with cardiometabolic risk factor than in their obese counterparts with cardiometabolic risk factor (P = 0.04). Frequency of cg and gg alleles (minor type) of MLXIPL (rs3812316) polymorphism in normal weight metabolically healthy participants was significantly higher than MUHNW (P = 0.04) and metabolically healthy obese children (P = 0.04). Conclusion: The findings of our study indicated that the minor allele of GCKR (rs1260333) single nucleotide polymorphisms (SNPs) could have pathogenic effect for obesity and cardiometabolic risk factors. Ga allele of GCKR (rs780094) SNPs had a protective effect on obesity. Minor alleles of MLXIPL (rs3812316) could have a protective effect for obesity and cardiometabolic risk factors. PMID:29531563
Kaidonis, Georgia; Craig, Jamie E; Gillies, Mark C; Abhary, Sotoodeh; Essex, Rohan W; Chang, John H; Pal, Bishwanath; Pefkianaki, Maria; Daniell, Mark; Lake, Stewart; Petrovsky, Nikolai; Burdon, Kathryn P
2016-03-01
To investigate, in a large cohort of 2494 individuals with diabetes mellitus, whether functional single nucleotide polymorphisms in the promoter region of tumour necrosis factor (TNF) and lymphotoxin-alpha (LTA) genes are associated with type of diabetes or presence of diabetic retinopathy. A total of 334 type 1 diabetes and 999 type 2 diabetes participants with sight-threatening diabetic retinopathy, and 260 type 1 diabetes and 901 type 2 diabetes participants with no diabetic retinopathy or minimal non-proliferative diabetic retinopathy, were genotyped for two single nucleotide polymorphisms (rs1800629 and rs361525). The A allele of rs1800629 was associated with type 1 diabetes (p < 0.001; odds ratio = 0.62). After adjustment for age, sex, diabetes duration, HbA1c, hypertension and nephropathy, no significant association was found between rs1800629 or rs361525 and sight-threatening diabetic retinopathy. An association between the A allele of rs1800629 and type of diabetes was found. No association was found between two promoter variants of TNF and LTA, and diabetic retinopathy in a large cohort of Caucasian patients with type 1 diabetes and type 2 diabetes. © The Author(s) 2016.
Liang, J; Zhu, Y; Liu, X-K; Qiu, Q-Q; Sun, Y-T; Wang, Y; Pei, Y; Yang, M-Q; Qi, L
2018-06-22
Obesity is strongly associated with insulin resistance and elevated plasma glucose levels. The rs9356744 polymorphism in the CDKAL1 gene is associated with body mass index (BMI) only in East Asians. Here, we examined the effect of the rs9356744 polymorphism on glucose-related traits and prediabetes in Chinese adults. A total of 2 357 participants were enrolled from the Cardiometabolic Risk in Chinese (CRC) Study, including 499 persons with prediabetes, 204 persons with type 2 diabetes, and 1 654 normoglycemic controls. The rs9356744 polymorphism in CDKAL1 was genotyped and analyzed in all participants. Despite the positive relationship between obesity and glucose traits, the T allele of rs9356744, which is associated with a predisposition to obesity, was correlated with lower levels of 2-h oral glucose tolerance test (OGTT) plasma glucose (2hPG) (β=- 0.2104 and P =0.0233), glycated hemoglobin (HbA1c) (β=- 0.0551 and P =0.0298) and higher levels of homeostasis model of assessment β-cell function (HOMA-B) (β=5.282 and P =0.0424). After further adjustment for BMI, the levels of HOMA-B maintained a similar increased trend across rs9356744 genotype (β=3.277 and P =0.1958). In stratified analyses, the associations of rs9356744 with 2hPG and HbA1c were significant for individuals with a low BMI. Moreover, an antagonism action of BMI and rs9356744 on 2hPG ( P for interaction=0.0055) was observed. In addition, we found a protective effect of rs9356744 on prediabetes. The CDKAL1 rs9356744 T allele associated with a predisposition to obesity showed a protective effect on HbA1c, 2hPG, and prediabetes. BMI was mediator of the association between the genetic variant and HbA1c, 2hPG, and prediabetes. © Georg Thieme Verlag KG Stuttgart · New York.
Lian, Yulong; Xiao, Jing; Wang, Qian; Ning, Li; Guan, Suzhen; Ge, Hua; Li, Fuye; Liu, Jiwen
2014-08-12
It is debatable whether or not glucocorticoid receptor (GR) polymorphisms moderate susceptibility to PTSD. Our objective was to examine the effects of stressful life events, social support, GR genotypes, and gene-environment interactions on the etiology of PTSD. Three tag single nucleotide polymorphisms, trauma events, stressful life events, and social support were assessed in 460 patients with PTSD and 1158 control subjects from a Chinese Han population. Gene-environment interactions were analyzed by generalized multifactor dimensionality reduction (GMDR). Variation in GR at rs41423247 and rs258747, stressful life events, social support, and the number of traumatic events were each separately associated with the risk for PTSD. A gene-environment interaction among the polymorphisms, rs41423247 and rs258747, the number of traumatic events, stressful life events, and social support resulted in an increased risk for PTSD. High-risk individuals (a large number of traumatic events, G allele of rs258747 and rs41423247, high level stressful life events, and low social support) had a 3.26-fold increased risk of developing PTSD compared to low-risk individuals. The association was statistically significant in the sub-groups with and without childhood trauma. Our data support the notion that stressful life events, the number of trauma events, and social support may play a contributing role in the risk for PTSD by interacting with GR gene polymorphisms.
Five Polymorphisms and Breast Cancer Risk: Results from the Breast Cancer Association Consortium
Gaudet, Mia M.; Milne, Roger L.; Cox, Angela; Camp, Nicola J.; Goode, Ellen L.; Humphreys, Manjeet K.; Dunning, Alison M.; Morrison, Jonathan; Giles, Graham G.; Severi, Gianluca; Baglietto, Laura; English, Dallas R.; Couch, Fergus J.; Olson, Janet E.; Wang, Xianshu; Chang-Claude, Jenny; Flesch-Janys, Dieter; Abbas, Sascha; Salazar, Ramona; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Lindblom, Annika; Margolin, Sara; Heikkinen, Tuomas; Kämpjärvi, Kati; Aaltonen, Kirsimari; Nevanlinna, Heli; Bogdanova, Natalia; Coinac, Irina; Schürmann, Peter; Dörk, Thilo; Bartram, Claus R.; Schmutzler, Rita K.; Tchatchou, Sandrine; Burwinkel, Barbara; Brauch, Hiltrud; Torres, Diana; Hamann, Ute; Justenhoven, Christina; Ribas, Gloria; Arias, José I.; Benitez, Javier; Bojesen, Stig E.; Nordestgaard, Børge G.; Flyger, Henrik L.; Peto, Julian; Fletcher, Olivia; Johnson, Nichola; Silva, Isabel dos Santos; Fasching, Peter A.; Beckmann, Matthias W.; Strick, Reiner; Ekici, Arif B.; Broeks, Annegien; Schmidt, Marjanka K.; van Leeuwen, Flora E.; Van’t Veer, Laura J.; Southey, Melissa C.; Hopper, John L.; Apicella, Carmel; Haiman, Christopher A.; Henderson, Brian E.; Le Marchand, Loic; Kolonel, Laurence N.; Kristensen, Vessela; Alnæs, Grethe Grenaker; Hunter, David J.; Kraft, Peter; Cox, David G.; Hankinson, Susan E.; Seynaeve, Caroline; Vreeswijk, Maaike P.G.; Tollenaar, Rob A.E.M.; Devilee, Peter; Chanock, Stephen; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Czene, Kamila; Hall, Per; Li, Yuqing; Liu, Jianjun; Balasubramanian, Sabapathy; Rafii, Saeed; Reed, Malcolm W.R.; Pooley, Karen A.; Conroy, Don; Baynes, Caroline; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Shen, Chen-Yang; Wang, Hui-Chun; Yu, Jyh-Cherng; Wu, Pei-Ei; Anton-Culver, Hoda; Ziogoas, Argyrios; Egan, Kathleen; Newcomb, Polly; Titus-Ernstoff, Linda; Dietz, Amy Trentham; Sigurdson, Alice J.; Alexander, Bruce H.; Bhatti, Parveen; Allen-Brady, Kristina; Cannon-Albright, Lisa A.; Wong, Jathine; Chenevix-Trench, Georgia; Spurdle, Amanda B.; Beesley, Jonathan; Pharoah, Paul D.P.; Easton, Doug F.; Garcia-Closas, Montserrat
2009-01-01
Previous studies have suggested that minor alleles for ERCC4 rs744154, TNF rs361525, CASP10 rs13010627, PGR rs1042838, and BID rs8190315 may influence breast cancer risk, but the evidence is inconclusive due to their small sample size. These polymorphisms were genotyped in more than 30,000 breast cancer cases and 30,000 controls, primarily of European descent, from 30 studies in the Breast Cancer Association Consortium. We calculated odds ratios (OR) and 95% confidence intervals (95% CI) as a measure of association. We found that the minor alleles for these polymorphisms were not related to invasive breast cancer risk overall in women of European descent: ECCR4 per-allele OR (95% CI) = 0.99 (0.97–1.02), minor allele frequency = 27.5%; TNF 1.00 (0.95–1.06), 5.0%; CASP10 1.02 (0.98–1.07), 6.5%; PGR 1.02 (0.99–1.06), 15.3%; and BID 0.98 (0.86–1.12), 1.7%. However, we observed significant between-study heterogeneity for associations with risk for single-nucleotide polymorphisms (SNP) in CASP10, PGR, and BID. Estimates were imprecise for women of Asian and African descent due to small numbers and lower minor allele frequencies (with the exception of BID SNP). The ORs for each copy of the minor allele were not significantly different by estrogen or progesterone receptor status, nor were any significant interactions found between the polymorphisms and age or family history of breast cancer. In conclusion, our data provide persuasive evidence against an overall association between invasive breast cancer risk and ERCC4 rs744154, TNF rs361525, CASP10 rs13010627, PGR rs1042838, and BID rs8190315 genotypes among women of European descent. PMID:19423537
Interleukin 1 beta promoter polymorphism is associated with keratoconus in a Japanese population
Mikami, Takenori; Teshigawara, Takeshi; Takeuchi, Masaki; Uemoto, Riyo; Kawagoe, Tatsukata; Nomura, Eiichi; Asukata, Yuri; Ishioka, Misaki; Iwasaki, Miki; Fukagawa, Kazumi; Konomi, Kenji; Shimazaki, Jun; Nishida, Teruo; Mizuki, Nobuhisa
2013-01-01
Purpose Polymorphisms in the interleukin 1 alpha (IL1A) and IL1B gene regions were previously associated with keratoconus in a Korean population. In the present study, we investigated whether the IL1A and IL1B polymorphisms are associated with keratoconus in a Japanese population. Methods A total of 169 Japanese patients with keratoconus and 390 Japanese healthy controls were recruited. We genotyped one IL1A single nucleotide polymorphism (SNP; rs2071376) and two IL1B SNPs (rs1143627 and rs16944) to compare the frequencies of alleles, genotypes, and haplotypes between cases and controls. Results Statistically significant association was observed for rs1143627 (−31 T>C) in the IL1B promoter region; the T allele of rs1143627 was associated with an increased risk of keratoconus (p=0.014, corrected p value [pc]=0.043, odds ratio=1.38). The C allele of rs16944 (−511 C>T) in the IL1B promoter region had a 1.33-fold increased risk of keratoconus, although this increase did not reach statistical significance (p=0.033, pc=0.098). The TT genotype of rs1143627 was weakly associated with an increased risk of keratoconus (p=0.033, pc=0.099, odds ratio=1.52). However, no significant differences were found in the allele and genotype frequencies between the cases and controls for rs2071376 in IL1A. Regarding haplotypic diversity, the haplotype created by the T allele of rs1143627 and C allele of rs16944 was associated with a 1.72-fold increased risk of keratoconus (p=4.0×10−5, pc=1.6×10−4). Conclusions Our results replicate associations reported recently in a Korean population. Thus, IL1B may play an important role in the development of keratoconus through genetic polymorphisms. PMID:23592922
Interleukin 1 beta promoter polymorphism is associated with keratoconus in a Japanese population.
Mikami, Takenori; Meguro, Akira; Teshigawara, Takeshi; Takeuchi, Masaki; Uemoto, Riyo; Kawagoe, Tatsukata; Nomura, Eiichi; Asukata, Yuri; Ishioka, Misaki; Iwasaki, Miki; Fukagawa, Kazumi; Konomi, Kenji; Shimazaki, Jun; Nishida, Teruo; Mizuki, Nobuhisa
2013-01-01
Polymorphisms in the interleukin 1 alpha (IL1A) and IL1B gene regions were previously associated with keratoconus in a Korean population. In the present study, we investigated whether the IL1A and IL1B polymorphisms are associated with keratoconus in a Japanese population. A total of 169 Japanese patients with keratoconus and 390 Japanese healthy controls were recruited. We genotyped one IL1A single nucleotide polymorphism (SNP; rs2071376) and two IL1B SNPs (rs1143627 and rs16944) to compare the frequencies of alleles, genotypes, and haplotypes between cases and controls. Statistically significant association was observed for rs1143627 (-31 T>C) in the IL1B promoter region; the T allele of rs1143627 was associated with an increased risk of keratoconus (p=0.014, corrected p value [pc]=0.043, odds ratio=1.38). The C allele of rs16944 (-511 C>T) in the IL1B promoter region had a 1.33-fold increased risk of keratoconus, although this increase did not reach statistical significance (p=0.033, pc=0.098). The TT genotype of rs1143627 was weakly associated with an increased risk of keratoconus (p=0.033, pc=0.099, odds ratio=1.52). However, no significant differences were found in the allele and genotype frequencies between the cases and controls for rs2071376 in IL1A. Regarding haplotypic diversity, the haplotype created by the T allele of rs1143627 and C allele of rs16944 was associated with a 1.72-fold increased risk of keratoconus (p=4.0×10(-5), pc=1.6×10(-4)). Our results replicate associations reported recently in a Korean population. Thus, IL1B may play an important role in the development of keratoconus through genetic polymorphisms.
Ding, Xiang; Hao, Qiukui; Yang, Ming; Chen, Tie; Chen, Shanping; Yue, Jirong; Leng, Sean X; Dong, Birong
2017-08-14
Recent evidence indicates that ataxia telangiectasia mutated (ATM) is a cytoplasmic protein that involves in insulin signaling pathways. When ATM gene is mutated, this event appears to contribute to the development of insulin resistance and type 2 diabetes mellitus (T2DM). Up to date, little information about the relationship between ATM gene polymorphism and T2DM is available. This study aimed to explore potential association between a genetic variant [single nucleotide polymorphism (SNP), i.e. rs189037C > T] in the ATM promoter region and T2DM in older adults in China. We conducted a 1:1 age- and sex-matched case-control study. It enrolled 160 patients including 80 type 2 diabetic and 80 nondiabetic patients who were aged 60 years and above. Genotyping of the polymorphism rs189037 in the promoter of the ATM gene was performed using polymerase chain reaction-restriction fragment length polymorphism. Chi-square test or Fisher's exact test (when an expected cell count was <5) and unpaired Student's t test were used for categorical and continuous variables, respectively. Logistic regression was used to estimate odds ratio (OR) and 95% confidence interval (CI) with adjustment for factors associated with T2DM. Significant association was found between the genotypes of the ATM rs189037 polymorphism and T2DM (P = 0.037). The frequency of CT genotype is much higher in patients without T2DM than in diabetics (60.0% versus 40.0%, P = 0.012). After adjustment of the major confounding factors, such difference remained significant (OR for non-T2DM is 2.62, 95%CI = 1.05-6.53, P = 0.038). Similar effect of CT genotype on T2DM was observed in male population (adjusted: OR = 0.27, 95%CI = 0.09-0.84, P = 0.024). In addition, the percentage of TT genotype in diabetics with coronary artery disease (CAD) was considerably lower than in those without CAD (17.9% versus 61.5%, P = 0.004). Our study suggests that the ATM rs189037 polymorphism is associated with reduced
The rs4285184 polymorphism of the MGAT1 gene as a risk factor for obesity in the Mexican population.
Tapia-Rivera, José C; Baltazar-Rodríguez, Luz M; Cárdenas-Rojas, Martha I; Álvarez, Alan; Bustos-Saldaña, Rafael; Delgado-Enciso, Iván; Valdez-Velázquez, Laura L; Guzmán-Esquivel, José; Ramírez-Flores, Mario
2017-02-23
Obesity is a factor that contributes to the morbidity of certain diseases and to worldwide mortality. MGAT1 is a glycosyltransferase involved in the synthesis of protein-bound and lipid-bound oligosaccharides and its polymorphisms are possibly involved in the etiology of obesity. We investigated the association of the rs4285184 polymorphism of the MGAT1 gene with obesity in adults in the State of Colima, Mexico. A case-control study was conducted that included 244 subjects. All of them were grouped according to their percentage of body fat, determined through bioelectrical impedance, and they were genotyped for the rs4285184 polymorphism of the MGAT1 gene through PCR-RFLP. The results were analyzed for their association with the percentage of body fat. The G allele had a frequency of 49.19 and 38.75% for the cases and controls, respectively (P=.020) (OR 1.53; 95% CI 1.068-2.193). The frequency of the A/G+G/G genotype was 75% in the obese patients, which was significantly higher compared with the 57.5% of the control group (P=.004) (OR 2.217; 95% CI 1.287-3.821). The presence of the rs4285184 polymorphism of the MGAT1 gene increased the risk for developing body fat associated with obesity in the Mexican population. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.
Kaiser, Rachel; Taylor, Kimberly E; Deng, Yun; Zhao, Jian; Li, Yonghong; Nititham, Joanne; Chang, Monica; Catanese, Joseph; Begovich, Ann B; Brown, Elizabeth E; Edberg, Jeffrey C; McGwin, Gerald; Alarcón, Graciela S; Ramsey-Goldman, Rosalind; Reveille, John D; Vila, Luis M; Petri, Michelle; Kimberly, Robert P; Feng, Xuebing; Sun, Lingyun; Shen, Nan; Li, Wei; Lu, Jian-Xin; Wakeland, Edward K; Li, Quan-Zhen; Yang, Wanling; Lau, Yu-Lung; Liu, Fei-Lan; Chang, Deh-Ming; Yu, Chack-Yung; Song, Yeong W; Tsao, Betty P; Criswell, Lindsey A
2013-01-01
The increased risk of thrombosis in systemic lupus erythematosus (SLE) may be partially explained by interrelated genetic pathways for thrombosis and SLE. The present study was undertaken to investigate whether 33 established and novel single-nucleotide polymorphisms (SNPs) in 20 genes involved in hemostasis pathways that have been associated with deep venous thrombosis (DVT) in the general population are risk factors for SLE among Asian subjects. Patients in the discovery cohort were enrolled in 1 of 2 North American SLE cohorts. Patients in the replication cohort were enrolled in 1 of 4 Asian or 2 North American cohorts. We first genotyped 263 Asian patients with SLE and 357 healthy Asian control subjects for 33 SNPs in the discovery phase, and then genotyped 5 SNPs in up to an additional 1,496 patients and 993 controls in the replication phase. Patients were compared to controls for bivariate association with minor alleles. Principal components analysis was used to control for intra-Asian ancestry in the replication cohort. Two genetic variants in the gene VKORC1 were highly significant in both the discovery and replication cohorts: rs9934438 (in the discovery cohort, odds ratio [OR] 2.45, P=2×10(-9); in the replication cohort, OR 1.54, P=4×10(-6)) and rs9923231 (in the discovery cohort, OR 2.40, P=6×10(-9); in the replication cohort, OR 1.53, P=5×10(-6)). These associations were significant in the replication cohort after adjustment for intra-Asian ancestry: for rs9934438, OR 1.34, P=0.0029; for rs9923231, OR 1.34, P=0.0032. Genetic variants in VKORC1, which are involved in vitamin K reduction and associated with DVT, correlate with SLE development in Asian subjects. These results suggest that there may be intersecting genetic pathways for the development of SLE and thrombosis. Copyright © 2013 by the American College of Rheumatology.
Dong, Chaoling; Ptacek, Travis S; Redden, David T; Zhang, Kui; Brown, Elizabeth E; Edberg, Jeffrey C; McGwin, Gerald; Alarcón, Graciela S; Ramsey-Goldman, Rosalind; Reveille, John D; Vilá, Luis M; Petri, Michelle; Qin, Aijian; Wu, Jianming; Kimberly, Robert P
2014-05-01
To investigate whether the Fcγ receptor IIIa-66L/R/H (FcγRIIIa-66L/R/H) polymorphism influences net effective receptor function and to assess if the FCGR3A combined genotypes formed by FcγRIIIa-66L/R/H and FcγRIIIa-176F/V, as well as copy number variation (CNV), confer risk of developing systemic lupus erythematosus (SLE) and lupus nephritis. FcγRIIIa variants, expressed on A20 IIA1.6 cells, were used in flow cytometry-based human IgG-binding assays. Using Pyrosequencing methodology, FCGR3A single-nucleotide polymorphism and CNV genotypes were determined in a cohort of 1,728 SLE patients and 2,404 healthy controls. The FcγRIIIa-66L/R/H (rs10127939) polymorphism influenced ligand binding capacity in the presence of the FcγRIIIa-176V (rs396991) allele. There was a trend toward an association of the low-binding FcγRIIIa-176F allele with lupus nephritis among African Americans (P = 0.0609) but not among European Americans (P > 0.10). Nephritis among African American patients with SLE was associated with FcγRIIIa low-binding haplotypes containing the 66L/R/H and 176F variants (P = 0.03) and with low-binding genotype combinations (P = 0.002). No association was observed among European American patients with SLE. The distribution of FCGR3A CNV was not significantly different among controls and SLE patients with or without nephritis. FcγRIIIa-66L/R/H influences ligand binding. The low-binding haplotypes formed by 66L/R/H and 176F confer enhanced risk of lupus nephritis in African Americans. FCGR3A CNVs are not associated with SLE or lupus nephritis in either African Americans or European Americans. Copyright © 2014 by the American College of Rheumatology.
Wu, I-Chen; Zhao, Yang; Zhai, Rihong; Liu, Geoffrey; Ter-Minassian, Monica; Asomaning, Kofi; Su, Li; Liu, Chen-Yu; Chen, Feng; Kulke, Matthew H; Heist, Rebecca S; Christiani, David C
2011-04-01
There is an increasing incidence of esophageal adenocarcinoma (EA) among younger people in the western populations. However, the association between genetic polymorphisms and the age of EA onset is unclear. In this study, 1330 functional/tagging single-nucleotide polymorphisms (SNPs) from 354 cancer-related genes were genotyped in 335 white EA patients. Twenty important SNPs that have the highest importance scores and lowest classification error rate were identified by the random forest algorithm to be associated with early onset of EA (age ≤ 55 years). Subsequent logistic regression analysis indicated that 10 SNPs (rs2070744 of NOS3, rs720321 of BCL2, rs17757541 of BCL2, rs11775256 of TNFRSF10A, rs1035142 of CASP8, rs2236302 of MMP14, rs4740363 of ABL1, rs696217 of GHRL, rs2445762 of CYP19A1, and rs11941492 of VEGFR2/KDR) were significantly associated with early onset of EA (≤55 vs >55 years, all P < .05 after adjusting for co-variates and false discovery rate). Among them, five SNPs in the NOS3, BCL2, TNFRSF10A, and CASP8 genes were known to be involved in apoptosis processes. In Kaplan-Meier analyses, rs2070744 of NOS3, rs720321 of BCL2, and rs1035142 of CASP8 were also significantly associated with early onset of EA. Moreover, there was a higher risk of developing EA at a younger age when one had more risk genotypes. In conclusion, polymorphisms in cancer-related genes, especially those in the apoptotic pathway, play an important role in the development of younger-aged EA in a dose-response manner.
Megías-Vericat, Juan E; Montesinos, Pau; Herrero, María J; Moscardó, Federico; Bosó, Virginia; Martínez-Cuadrón, David; Poveda, José L; Sanz, Miguel Á; Aliño, Salvador F
2017-07-01
Several novel single nucleotide polymorphisms (SNPs) involved in cytarabine cytotoxicity and related to clinical outcomes have been reported recently in a series of 232 pediatric patients with acute myeloid leukemia (AML). We report the first adult AML cohort in which the influence of these SNPs in cytarabine efficacy and toxicity was analyzed. Six of polymorphisms with clinical significance in the previous study [rs12036333, rs10758713, rs9883101, rs6550826, IRX2: rs2897047, mutated in colorectal cancers (MCC): rs7729269] were analyzed in a cohort of 225 adult patients at initial diagnosis of AML treated with an induction scheme of idarubicin plus cytarabine. The variant alleles of rs12036333 and rs10758713 confirmed the previous associations with lower survival rates. The minor alleles of rs9883101 and rs6550826 were also related to lower survival, in concordance with higher cytarabine-induced cytotoxicity observed in pediatric patients. However, discordant findings between AML adult and pediatric population were observed with IRX2 rs2897047, showing higher survival in heterozygous genotype carriers. The heterozygous genotype of MCC rs7729269 was associated with higher cytarabine-induced toxicities (renal, hepatic, lung, skin toxicities), whereas lower time to thrombocytopenia recovery was associated with the MCC rs7729269 minor allele. This study confirms the influence in survival rates of these polymorphisms in an adult AML population. Novel associations between MCC SNPs and cytarabine toxicities were reported and should be validated in prospective studies involving larger groups of patients.
Single nucleotide polymorphisms in obesity-related genes and the risk of esophageal cancers.
Doecke, James D; Zhao, Zhen Zhen; Stark, Mitchell S; Green, Adèle C; Hayward, Nicholas K; Montgomery, Grant W; Webb, Penelope M; Whiteman, David C
2008-04-01
Rates of adenocarcinoma of the esophagus (EAC) and esophagogastric junction (EGJAC) have been rising rapidly in recent decades, in contrast to the declining rates of esophageal squamous cell carcinomas (ESCC). Obesity is a major risk factor for both EAC and EGJAC, but not ESCC, and there is speculation that obesity promotes adenocarcinoma development through endocrine and related pathways. We therefore compared the prevalence of 12 single nucleotide polymorphisms (SNPs) in nine candidate genes previously implicated in obesity pathways (LEP, LEPR, ADIPOQ, POMC, PPARalpha, PPARgamma, RXRgamma, GHRL, and INSIG2) in a large Australian case-control study comprising DNA samples from 260 EAC cases, 301 EGJAC cases, 213 ESCC cases, and 1,352 population controls. No SNPs were associated with EGJAC or ESCC. Although several SNPs seemed to be associated with EAC on crude analysis [ADIPOQ (rs1501299), LEP (5'-untranslated region), PPARgamma (H447H), and GHRL (M72L)], effect sizes were modest and none of the associations was significant after correcting for multiple comparisons. Further, we found no consistent evidence that any of the genotypes were associated with risk of EAC or EGJAC within strata of body mass index (<25.0 kg/m(2), 25.0-29.9 kg/m(2), >30 kg/m(2)). In conclusion, our data suggest that these SNPs do not play a major role in esophageal carcinogenesis.
Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia
2013-01-01
Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.
HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.
Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi
2007-04-04
To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value <10(-11). SNP rs11200638 conferred disease risk in an autosomal recessive fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.
Younus, Laith A; Algenabi, Abdul Hussein A; Abdul-Zhara, Mohammed S; Hussein, Majid K
2017-09-05
The variation of the SNPs in FTO (fat mass and obesity associated) gene are improved to be associated with obesity and type 2 diabetes (T2DM) in some ethnic groups for example in European while, this consistency is controversial in Asians and there were few studies in Iraqi population about the effect of this gene on the development of T2DM in obese patients. Therefore, the objective of this study is to investigate the impact of the two common FTO gene variants in the development of T2DM in obese Iraqi patients. A case-control study in which the FTO gene variants rs9939609 and rs17817449 were genotyping in a total of 800 individuals, 400 T2DM obese patients (patients group) and 400 healthy control obese volunteers (control group) to explore the relation of these SNPs with T2DM in obese Iraqi population. The patients group was enrolled from diabetic clinic in Al Najaf al Ashraf based on WHO guidelines of T2DM. From whole blood the DNA was extraction and genotyped by using ScaI and AlwNI enzymes respectively in the PCR-RFLP technique. Multinomial logistic regression was applied to compare the proportions of genotypes and alleles. The odd's ratio, t-test P value at 95% confidence interval were measured before and after adjustment of BMI, age and sex adjustment. The genetic power, Hardy Weinberg equilibrium and haplotype analysis were tested in the present study. It was observed that the presence of T allele in the two SNPs rs9939609 and rs17817449 in the FTO gene polymorphisms was associated with increased risk for the development of T2DM in Iraqi obese individuals. The minor allele (T) in rs9939609 was significantly higher (P=0.0001) in T2DM (31.25%) when compared with that of the control obese group (20%). The Homozygous genotype (TT) significantly (OR=3.25, CI 95% 1.87-5.64, P=0.000) increased the risk of T2DM by three folds with respect to those of wild type (AA) after adjustment for age, sex and BMI, furthermore, it was significantly increased the risk in the
Kim, Young Jong; Park, Jin Kyung; Kang, Won Sub; Kim, Su Kang; Park, Hae Jeong; Nam, Min; Kim, Jong Woo
2015-01-01
LAMB1 encodes laminin beta-1, which is expressed during early development of the human nervous system, and could be involved in the pathogenesis of neurodevelopmental disorders. In our study, we aimed to investigate whether single nucleotide polymorphisms (SNPs) in LAMB1 were associated with autism spectrum disorder (ASD) and with related clinical severities of ASD. Two coding SNPs (rs20556 and rs25659) and two intronic SNPs (rs2158836 and rs2237659) were compared between 180 patients with ASD and 147 healthy control subjects using direct sequencing. The Korean version of the Childhood Autism Rating Scale (K-CARS) was used to assess clinical severities. Multiple logistic regression models were employed to analyze genetic data, and associations with symptom severity were tested with the Kruskal-Wallis and the Mann-Whitney U tests. None of the four examined SNPs was associated with ASD risk. However, the GG genotype of rs2158836 was associated with more severe symptoms for the "object use" and "non-verbal communication" measures. The results of our study suggest the association between rs2158836 polymorphisms and symptom severity in ASD.
Yanagimachi, Masakatsu; Naruto, Takuya; Miyamae, Takako; Hara, Takuma; Kikuchi, Masako; Hara, Ryoki; Imagawa, Tomoyuki; Mori, Masaaki; Sato, Hidenori; Goto, Hiroaki; Yokota, Shumpei
2011-04-01
Systemic-onset juvenile idiopathic arthritis (systemic JIA) and macrophage activation syndrome (MAS), the most devastating complication of systemic JIA, are characterized by abnormal levels of proinflammatory cytokines. Interferon regulatory factor 5 (IRF5) is a member of the IRF family of transcription factors, and acts as a master transcription factor in the activation of genes encoding proinflammatory cytokines. Polymorphisms in the IRF5 gene have been associated with susceptibility to autoimmune diseases such as systemic lupus erythematosus (SLE) and rheumatoid arthritis. Our aim was to assess associations of IRF5 gene polymorphisms with susceptibility to systemic JIA and MAS. Three IRF5 single-nucleotide polymorphisms (rs729302, rs2004640, and rs2280714) were genotyped using TaqMan assays in 81 patients with systemic JIA (33 with MAS, 48 without) and 190 controls. There were no associations of the IRF5 gene polymorphisms or haplotypes under study with susceptibility to systemic JIA. There was a significant association of the rs2004640 T allele with MAS susceptibility (OR 4.11; 95% CI 1.84, 9.16; p = 0.001). The IRF5 haplotype (rs729302 A, rs2004640 T, and rs2280714 T), which was reported as conferring an increased risk of SLE, was significantly associated with MAS susceptibility in patients with systemic JIA (OR 4.61; 95% CI 1.73, 12.3; p < 0.001). IRF5 gene polymorphism is a genetic factor influencing susceptibility to MAS in patients with systemic JIA, and IRF5 contributes to the pathogenesis of MAS in these patients.
Rupérez, Azahara I.; Gil-Campos, Mercedes; Leis, Rosaura; Cañete, Ramón; Tojo, Rafael
2017-01-01
Leptin is an endocrine hormone that has a critical role in body weight homoeostasis and mediates its effects via the leptin receptor (LEPR). Common polymorphisms in the genes coding leptin receptors have been associated with metabolic abnormalities. We assessed the association of 28 LEPR polymorphisms with body mass index (BMI) and their relationship with obesity-related phenotypes, inflammation and cardiovascular disease risk biomarkers. A multicentre case-control study was conducted in 522 children (286 with obesity and 236 with normal-BMI). All anthropometric, metabolic factors and biomarkers were higher in children with obesity except apolipoprotein (Apo)-AI, cholesterol, high-density lipoprotein cholesterol (HDL-c), and adiponectin, which were lower in the obesity group; and glucose, low-density lipoprotein cholesterol (LDL-c), and matrix metalloproteinase-9 that did not differ between groups. We identified the associations between rs11208659, rs11804091, rs10157275, rs9436303 and rs1627238, and BMI in the whole population, as well as the association of rs11804091, rs10157275, and rs1327118 with BMI in the female group, although only the rs11804091 remained associated after Bonferroni correction (p = 0.038). This single nucleotide polymorphisms (SNP) was also associated with insulin (p = 0.004), homeostasis model assessment for insulin resistance (HOMA-IR) (p = 0.006), quantitative insulin sensitivity check index (QUICKI) (p = 0.005) and adiponectin (p = 0.046) after adjusting for age, Tanner stage and BMI. Our results show a sex-specific association between the rs11804091 and obesity suggesting an influence of this SNP on insulin resistance. PMID:28771179
Dzhugashvili, Maia; Luengo-Gil, Ginés; García, Teresa; González-Conejero, Rocío; Conesa-Zamora, Pablo; Escolar, Pedro Pablo; Calvo, Felipe; Vicente, Vicente; Ayala de la Peña, Francisco
2014-11-01
To investigate whether polymorphisms of genes related to inflammation are associated with pathologic response (primary endpoint) in patients with rectal cancer treated with primary chemoradiation therapy (PCRT). Genomic DNA of 159 patients with locally advanced rectal cancer treated with PCRT was genotyped for polymorphisms rs28362491 (NFKB1), rs1213266/rs5789 (PTGS1), rs5275 (PTGS2), and rs16944/rs1143627 (IL1B) using TaqMan single nucleotide polymorphism genotyping assays. The association between each genotype and pathologic response (poor response vs complete or partial response) was analyzed using logistic regression models. The NFKB1 DEL/DEL genotype was associated with pathologic response (odds ratio [OR], 6.39; 95% confidence interval [CI], 0.78-52.65; P=.03) after PCRT. No statistically significant associations between other polymorphisms and response to PCRT were observed. Patients with the NFKB1 DEL/DEL genotype showed a trend for longer disease-free survival (log-rank test, P=.096) and overall survival (P=.049), which was not significant in a multivariate analysis that included pathologic response. Analysis for 6 polymorphisms showed that patients carrying the haplotype rs28362491-DEL/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G (13.7% of cases) had a higher response rate to PCRT (OR, 8.86; 95% CI, 1.21-64.98; P=.034) than the reference group (rs28362491-INS/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G). Clinically significant (grade ≥2) acute organ toxicity was also more frequent in patients with that same haplotype (OR, 4.12; 95% CI, 1.11-15.36; P=.037). Our results suggest that genetic variation in NFKB-related inflammatory pathways might influence sensitivity to primary chemoradiation for rectal cancer. If confirmed, an inflammation-related radiogenetic profile might be used to select patients with rectal cancer for preoperative combined-modality treatment. Copyright © 2014 Elsevier Inc. All rights reserved.
Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra
2014-01-01
Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR.
Escalante-Santiago, David; Feria-Romero, Iris Angélica; Ribas-Aparicio, Rosa María; Rayo-Mares, Dario; Fagiolino, Pietro; Vázquez, Marta; Escamilla-Núñez, Consuelo; Grijalva-Otero, Israel; López-García, Miguel Angel; Orozco-Suárez, Sandra
2014-01-01
Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1/ABCB1 and MRP2/ABCC2 in patients with antiepileptic-drugs resistant epilepsy (ADR) is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with ADR and patients with good response (CTR) to antiepileptic drugs (AEDs) in a rigorously selected population. We analyzed 22 samples In Material and Methods, from drug-resistant patients with epilepsy and 7 samples from patients with good response to AEDs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA) and rs2032582 (AT and AG) were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT) and 66744T > A (TG) were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy (ADR) used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with ADR. PMID:25346718
Wang, Tao; Wang, Yan; Lv, Dong-Mei; Song, Jin-Fang; Lu, Qian; Gao, Xing; Zhang, Fan; Guo, Hao; Li, Wei; Yin, Xiao-Xing
2014-02-01
To investigate the associations of NOS1AP rs12742393 polymorphism with the risk of type 2 diabetes mellitus (T2DM) and repaglinide therapeutic efficacy in Chinese patients with T2DM. Prospective case-control study. Academic medical center. A total of 300 patients with T2DM and 200 healthy volunteers were enrolled to identify NOS1AP rs12742393 genotypes using the polymerase chain reaction-restriction fragment length polymorphism assay. Eighty-four patients with various genotypes were randomly selected to receive oral repaglinide as a single-agent therapy (3 mg/day) for 8 weeks. Anthropometric measurements and fasting plasma glucose (FPG), postprandial plasma glucose, hemoglobin A1c , fasting serum insulin (FINS), postprandial serum insulin, homeostasis model assessment for insulin resistance (HOMA-IR), triglyceride, total cholesterol, low-density lipoprotein-cholesterol, and high-density lipoprotein-cholesterol tests were obtained before and after repaglinide treatment. The risk C allelic frequency of NOS1AP rs12742393 was higher in patients with T2DM than in healthy volunteers (p<0.001). Patients with T2DM and genotypes AA and AC at NOS1AP rs12742393 had a significant reduction in FPG (mmol/l) compared with those with genotype CC (p<0.01). Patients with CC homozygotes and AC heterozygotes had a greater increase in FINS (mU/l) than those with wild-type AA (p<0.05). In addition, the carriers of genotype CC at NOS1AP rs12742393 had higher differential values of HOMA-IR compared with genotypes AC and AA carriers (p<0.001). The effects of repaglinide treatment on FPG (p<0.01), FINS (p<0.05) and HOMA-IR (p<0.001) were reduced in patients with T2DM carrying the NOS1AP rs12742393 risk C allele compared with the AA genotype carriers. The NOS1AP rs12742393 polymorphism is associated with therapeutic efficacy of repaglinide in Chinese T2DM patients. © 2013 Pharmacotherapy Publications, Inc.
Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA
Watson, Claire L.; Lockwood, Diana N. J.
2009-01-01
Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306
Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients
NASA Astrophysics Data System (ADS)
Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier
2016-05-01
We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f
Vargas-Alarcon, Gilberto; Martinez-Rodriguez, Nancy; Velazquez-Cruz, Rafael; Perez-Mendez, Oscar; Posadas-Sanchez, Rosalinda; Posadas-Romero, Carlos; Peña-Duque, Marco Antonio; Martinez-Rios, Marco Antonio; Ramirez-Fuentes, Silvestre; Fragoso, Jose Manuel
2017-10-01
Hypertension is a major public health problem affecting about 30% of the adult population and is associated with an increased risk of developing metabolic and cardiovascular disease. Recent reports have shown that the T-cadherin receptor characteristically expressed on endothelial and vascular smooth muscle cells is involved in hypertension. The aim of the present study was to evaluate the role of cadherin-13 (CDH13) gene polymorphisms as susceptibility markers for hypertension in Mexican population. Six CDH13 polymorphisms (rs11646213, rs11646411, rs6563943, rs3096277, rs3784990 and rs254340) were genotyped by 5' exonuclease TaqMan assays in a group of 644 hypertensive and 765 non-hypertensive individuals. Under co-dominant, recessive, and additive models, the CDH13 T>A (rs11646213) polymorphism was associated with decreased risk of developing hypertension when compared to non-hypertensive individuals (OR=0.61, 95% CI: 0.42-0.89, P co-dom =0.019; OR=0.63, 95% CI: 0.46-0.87, P res =0.005; OR=0.80, 95% CI: 0.66-0.96, P add =0.016, respectively). All models were adjusted by gender, age, body index mass, type II diabetes mellitus, alcohol consumption, dyslipidemia and smoking habit. Linkage disequilibrium analysis showed one haplotype (TCACGG) with decreased frequency in hypertensive when compared to non-hypertensive individuals (OR=0.52, 95% CI: 0.33-0.82, P=0.0053). In summary, our data suggests that the CDH13 T>A (rs11646213) polymorphism is associated with decreased risk of developing hypertension in the Mexican population. In addition, it was possible to distinguish one haplotype associated with decreased risk and two for increased risk of develop hypertension. Copyright © 2016 Elsevier GmbH. All rights reserved.
Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.
2016-01-01
The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325
Canto, Patricia; Granados, Jesús Benítez; Feria-Bernal, Guillermo; Coral-Vázquez, Ramón Mauricio; García-García, Eduardo; Tejeda, María Elena; Tapia, André; Rojano-Mejía, David; Méndez, Juan Pablo
2017-07-04
Obesity constitutes a risk factor for the development of aggressive forms of prostate cancer. It has been proposed, that prostate cancer has a genetic predisposition and that PPARGC1A and ADIPOQ polymorphisms play a role in the development of this condition. To analyse the association of two PPARGC1A and ADIPOQ polymorphisms as well as their haplotypes, with the development of aggressive prostate cancer in Mexican-Mestizo men with overweight or obesity. Two hundred fifty seven men with prostate cancer of Mexican-Mestizo origin were included. Body mass index (BMI) was determined and the degree of prostate cancer aggressiveness by the D'Amico classification. DNA was obtained. Rs7665116 and rs2970870 of PPARGC1A, and rs266729 and rs1501299 of ADIPOQ were studied by real-time PCR allelic discrimination. Pairwise linkage disequilibrium, between single nucleotide polymorphisms was calculated and haplotype analysis was performed. A higher-risk (D'Amico classification) was observed in 21.8% of patients. An association of cancer aggressiveness with rs2970870 of PPARGC1A, and rs501299 of ADIPOQ, as well as with one haplotype of ADIPOQ was documented. This is the first study regarding the relationship of PPARGC1A and ADIPOQ polymorphisms, and the aggressiveness of prostate cancer in men with overweight or obesity.
Yadav, Suresh Kumar; Singh, Sudhir; Gupta, Shalini; Brahma Bhatt, Madan Lal; Mishra, Durga P; Roy, D; Sanyal, Somali
2018-01-01
Genetic variations in nucleotide excision repair genes can alter the risk of squamous cell carcinoma of head and neck (SCCHN). The present study has genotyped 334 subjects from North Indian population for xeroderma pigmentosum complementation Group C (XPC) rs2228001A>C, XPC rs77907221 polyadenylate (PAT) deletion/insertion (D/I), xeroderma pigmentosum complementation Group D - rs13181A>C, and xeroderma pigmentosum complementation Type G rs17655 G>C polymorphisms with polymerase chain reaction (PCR)-restriction-fragment length polymorphism or allele-specific PCR methods. Compared to D allele, I allele for XPC PAT D/I polymorphism was associated with significantly decreased the risk of SCCHN (odds ratios = 0.67, 95% confidence interval [CI] =0.48-0.94, P = 0.03). Haplotype CI constituted from XPC polymorphisms was also associated with decreased risk of SCCHN (P = 0.004). In contrast, haplotype Crohn's disease significantly increased the risk for SCCHN (P < 0.00). A significant early onset of SCCHN was observed in individuals with CC genotype for XPC A>C polymorphism (P = 0.004). Our results suggest a possible risk modulation for SCCHN with XPC polymorphisms in North Indian population.
Murat, M; Aekeper, A; Yuan, L Y; Alim, T; Du, G J; Abdusamat, A; Wu, G W; Aniwer, Y
2015-10-29
Here, we have investigated the correlation between calcium oxalate stone formation and Fn gene polymorphisms in urinary calculi patients among the Uighur population (Xinjiang region). In this case control study, genomic DNA extracted from the peripheral blood of 129 patients with calcium oxalate stones (patient group) and 94 normal people (control group) was used to genotype polymorphisms in the rs6725958, rs10202709, and rs35343655 sites of the Fn gene by polymerase chain reaction-restriction fragment length polymorphism. Subsequently, the association between different genotypes and susceptibility to calcium oxalate stone formation was compared among the patient and control groups. Single nucleotide polymorphisms (SNPs) were detected in the rs6725958, rs10202709, and rs35343655 sites of the Fn gene among the patient and control groups. The genotype distributions of the three loci complied with the Hardy-Weinberg equilibrium. The results of allele frequencies of the patient/control group for polymorphisms in the rs6725958 site of the Fn gene were C = 179 (69.92%)/119 (63.30%) and A = 77 (30.08%)/69 (36.70%), in the rs10202709 site were C = 245 (95.70%)/176 (93.63%) and T = 11 (4.30%)/12 (6.38%), and in the rs35343655 site of the Fn gene were A = 139 (54.30%)/87 (46.28%) and G = 117 (45.70%)/101 (53.72%). We observed no significant differences between the three SNPs and development of calcium oxalate stones. Polymorphisms in rs6725958, rs10202709, and rs35343655 of the Fn gene had no obvious effect on the susceptibility to the development of calcium oxalate stones in the Uighur population, residing in the Xinjiang region of China.
Vagnini, Laura D.; Nascimento, Adriana M.; Canas, Maria do Carmo T.; Renzi, Adriana; Oliveira-Pelegrin, Gabriela R.; Petersen, Claudia G.; Mauri, Ana L.; Oliveira, João Batista A.; Baruffi, Ricardo L.R.; Cavagna, Mario; Franco, José G.
2015-01-01
Objective The aim of this study was to investigate the relationship between herpesvirus-associated ubiquitin-specific protease (HAUSP A/G, rs1529916), tumor protein p53 (TP53 Arg/Pro, rs1042522), leukemia inhibitory factor (LIF G/T, rs929271), glycoprotein 130 (gp130 A/T, rs1900173) and vascular endothelial growth factor (VEGF G/A, rs1570360) polymorphisms and recurrent implantation failure (RIF) in Brazilian women. Subjects and Methods A total of 120 women with RIF (i.e. those with ≥5 cleaved embryos transferred and a minimum of 2 failed in vitro fertilization/intracytoplasmic sperm injection attempts) were included. The control group involved 89 women who had experienced at least 1 live birth (without any infertility treatment). DNA was extracted from the peripheral blood of all participants, and the abovementioned single-nucleotide polymorphisms (SNPs) were genotyped by real-time polymerase chain reaction. The data were evaluated using Fisher's test. Results A significant difference between the RIF and control groups was found in the VEGF gene where the GG genotype showed a 2.1-fold increased chance of not being included in the RIF group, while the presence of an A allele increased this risk 1.6-fold. No significant differences were found for the other polymorphisms. Conclusion This study showed an association between the VEGF -1154G/A polymorphism and RIF in Brazilian women. PMID:26305668
Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E
2007-09-01
HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.
Shetova, I M; Timofeev, D Iu; Shamalov, N A; Bondarenko, E A; Slominskiĭ, P A; Limborskaia, S A; Skvortsova, V I
2012-01-01
The analysis of association between DNA markers and total stroke risk was performed in 950 Slavonic patients. Patients with cardioembolic stroke were selected for a genome-wide association study. The HUMANCYTOSNP12 v.2 microchip was used to analyze all DNA samples on a panel of 301 000 single nucleotide polymorphisms. SNP rs1842993 on chromosome 7 was found to be associated with cardioembolic stroke risk.
CBR1 rs9024 genotype status impacts the bioactivation of loxoprofen in human liver.
Lombraña, Adolfo Quiñones; Li, Nasi; Del Solar, Virginia; Ekin Atilla-Gokcumen, G; Blanco, Javier G
2018-05-31
Loxoprofen is an anti-inflammatory drug that requires bioactivation into the trans-OH metabolite to exert pharmacological activity. Evidence suggests that carbonyl reductase 1 (CBR1) is important during the bioactivation of loxoprofen. Here, we examined the impact of the functional single nucleotide polymorphism CBR1 rs9024 on the bioactivation of loxoprofen in a collection of human liver samples. The synthesis ratios of trans-OH loxoprofen/cis-OH loxoprofen were 33% higher in liver cytosols from donors homozygous for the CBR1 rs9024 G allele in comparison to the ratios in samples from donors with heterozygous GA genotypes. Complementary studies examined the impact of CBR1 rs9024 on the bioactivation of loxoprofen in lymphoblastoid cell lines. CBR1 rs9024 genotype status impacts the synthesis of the bioactive trans-OH metabolite of loxoprofen in human liver. This article is protected by copyright. All rights reserved.
Association and family studies of DRD2 gene polymorphisms in alcohol dependence syndrome.
Małecka, Iwona; Jasiewicz, Andrzej; Suchanecka, Aleksandra; Samochowiec, Jerzy; Grzywacz, Anna
2014-11-06
The human dopamine receptor 2 gene DRD2 plays a central role in susceptibility to Alcohol Dependence Syndrome (ADS). The aim of this study was to evaluate 3 single nucleotide polymorphisms: D2 (rs1076560), Tag1D (rs1800498), Tag1B (rs1079597) located in dopamine receptor 2 DRD2 gene and its role in alcohol dependence. DNA was provided from alcohol dependent (AD) patients (n=171) and healthy control subjects (n=160) all of Polish descent. The history of alcoholism was obtained using the Polish version of the SSAGA (Semi-Structured Assessment for the Genetics of Alcoholism). We conducted case-control association study and transmission disequilibrium test (TDT). Samples were genotyped using real-time PCR method. We did not confirm the association between studied polymorphisms and alcohol dependence syndrome. TDT reveled an adequate transmission of both alleles in the group of alcohol families. The lack of association of studied polymorphisms and ADS does not preclude its participation in the pathogenesis. Further research is needed to determine the actual contribution of DRD2 gene in the pathogenesis of alcoholism.
Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija
2012-04-01
Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.
Ortega-Rojas, Jenny; Morales, Luis; Guerrero, Esneyder; Arboleda-Bustos, Carlos E; Mejia, Adriana; Forero, Diego; Lopez, Luis; Pardo, Rodrigo; Arboleda, Gonzalo; Yunis, Juan; Arboleda, Humberto
2016-01-01
We evaluated the association of several single-nucleotide polymorphisms in different genes including APOE, TOMM40, CR1, PVRL2, SORL1, PICALM, and GWA_14q32.13 in a Colombian sample of Late-Onset Alzheimer disease (LOAD) patients. A case-control study was conducted in 362 individuals (181 LOADs and 181 controls) to determine the association of single-nucleotide polymorphisms in APOE (e2, e3, and e4), TOMM40 (rs2075650), CR1 (rs665640), PVRL2 (rs6859), SORL1 (rs11218304), PICALM (rs3851179), and GWA_14q32.13 (rs11622883) with LOAD in a sample from Colombia. We were able to confirm the previously reported association of the APOE4 allele with AD. In addition, we report a new significant association with rs2075650 of TOMM40 for LOAD in our sample. We did not detect any significant interaction between TOMM40 and APOE4 carriers (heterozygous or homozygous) for disease risk development. However, Kaplan-Meier survival analyses suggest that AD patients with TOMM40 allele rs2075650-G have an average age of disease onset of 6 years earlier compared with carriers of the A allele. In addition, the age of disease onset is earlier if APOE4/4 is present. Our findings suggest that rs2075650 of TOMM40 could be involved in earlier presentation of LOAD in the Colombian population.
Duellman, Tyler; Warren, Christopher; Yang, Jay
2014-01-01
Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221
Hu, Yingyan; Hong, Wu; Smith, Alicia; Yu, Shunying; Li, Zezhi; Wang, Dongxiang; Yuan, Chengmei; Cao, Lan; Wu, Zhiguo; Huang, Jia; Fralick, Drew; Phillips, Michael Robert; Fang, Yiru
2017-11-01
Recent research findings suggest that BDNF and BDNF signaling pathways participate in the development of major depressive disorder. Mitogen-activated extracellular signal-regulated kinase (MEK) is the most important kinase in the extracellular signal-regulated kinase pathway, and the extracellular signal-regulated kinase pathway is the key signaling pathway of BDNF, so it may play a role in development of depressive disorder. The aim of this study is to investigate the association between polymorphisms of the MAP2K1 (also known as MEK) gene and depressive disorder. Three single nucleotide polymorphisms (SNPs), were significantly associated with depressive disorder: rs1549854 (p = 0.006), rs1432441 (p = 0.025), and rs7182853 (p = 0.039). When subdividing the sample by gender, two of the SNPs remained statistically associated with depressive disorder in females: rs1549854 (p = 0.013) and rs1432441 (p = 0.04). The rs1549854 and rs1432441 polymorphisms of the MAP2K1 gene may be associated with major depressive disorder, especially in females. This study is the first to report that the MAP2K1 gene may be a genetic marker for depressive disorder. Copyright © 2017 Elsevier B.V. All rights reserved.
Genetic analysis of interleukin 18 gene polymorphisms in alopecia areata.
Celik, Sumeyya Deniz; Ates, Omer
2018-06-01
Alopecia areata (AA), which appears as nonscarring hair shedding on any hair-bearing area, is a common organ-specific autoimmune condition. Cytokines have important roles in the development of AA. Interleukin (IL) 18 is a significant proinflammatory cytokine that was found higher in the patients with AA. We aimed to investigate whether the IL-18 (rs187238 and rs1946518) single nucleotide polymorphisms (SNPs) may be associated with AA and/or clinical outcome of patients with AA in Turkish population. Genotyping of rs187238 and rs1946518 SNPs were detected using sequence-specific primer-polymerase chain reaction (SSP-PCR) method in 200 patients with AA and 200 control subjects. The genotype distribution of rs1946518 (-607C>A) SNP was found to be statistically significantly different among patients with AA and controls (P = .0008). Distribution of CC+CA genotypes and frequency of -607/allele C of rs1946518 SNP were higher in patients with AA (P = .001, P = .001, respectively). The genotype distribution of rs187238 (-137G>C) SNP was found to be statistically significantly different among patients with AA and control subjects (P = .0014). Distribution of GG genotype and frequency of -137/allele G of rs187238 SNP were higher in patients with AA (P = .0003, P = .001, respectively). The rs1946518 (-607C>A) and rs187238 (-137G>C) polymorphisms were found associated with alopecia areata disease. The study suggests that IL-18 rs187238 and rs1946518 SNPs may be the cause of the AA susceptibility. © 2018 Wiley Periodicals, Inc.
Peng, Xiulan; Song, Jia; Wang, Jun; Dong, Weiguo
2014-01-01
Background Many studies have investigated the associations between the signal transducer and activator of transcription 3 (STAT3) in the susceptibility to ulcerative colitis (UC) and Crohn's disease (CD). However, the results remain inconsistent. This meta-analysis determined the risk of STAT3 rs744166 polymorphism-conferred UC and CD susceptibility. Materials and Methods Electronic databases, including PubMed, EMBASE and the Cochrane Library, were searched for all eligible studies that evaluated the association between STAT3 rs744166 polymorphisms with UC and CD risk up to August 21, 2014. The pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated using fixed- or random-effects models. Results Twelve studies containing 10298 patients with CD, 4244 patients with UC and 11191 controls were included in this meta-analysis. The results indicated that the STAT3 rs744166 polymorphism was associated with CD and UC susceptibility (CD: GA+AA vs. GG, OR = 1.20, 95%CI, 1.11–1.30, I 2 = 0%, P unadjusted<0.00001, P Bonferroni<0.00005, P FDR<0.00001; UC: GA+AA vs. GG, OR = 1.21, 95%CI, 1.08–1.36, I 2 = 1%, P unadjusted = 0.001, P Bonferroni = 0.005, P FDR = 0.00125). In subgroup analyses by ethnicity, the significant association was found only among Caucasians. However, when grouped by age of onset, positive associations were found both among adults and children. In addition, when stratified by study design and genotyping methods, the risk of CD was significantly associated with the STAT3 rs744166 polymorphism in hospital-based and population-based groups and in SNP Array and SNPlex groups. For UC, significant associations were also found in population-based, PCR-RFLP and SNPlex groups. Moreover, these findings were sufficiently robust to withstand the Bonferroni correction and false discovery rate (FDR). Conclusion This meta-analysis indicates that carriers of the STAT3 rs744166 ‘A’ allele have a significantly greater
Dai, Yu; Zeng, Tianshu; Xiao, Fei; Chen, Lulu; Kong, Wen
2017-01-01
We conducted a case/control study to assess the impact of SNP rs3087243 and rs231775 within the CTLA4 gene, on the susceptibility to Graves' disease (GD) in a Chinese Han dataset (271 cases and 298 controls). The frequency of G allele for rs3087243 and rs231775 was observed to be significantly higher in subjects with GD than in control subjects (p = 0.005 and p = 0.000, respectively). After logistic regression analysis, a significant association was detected between SNP rs3087243 and GD in the additive and recessive models. Similarly, association for the SNP rs231775 could also be detected in the additive model, dominant model and recessive model. A meta-analysis, including 27 published datasets along with the current dataset, was performed to further confirm the association. Consistent with our case/control results, rs3087243 and rs231775 showed a significant association with GD in all genetic models. Of note, ethnic stratification revealed that these two SNPs were associated with susceptibility to GD in populations of both Asian and European descent. In conclusion, our data support that the rs3087243 and rs231775 polymorphisms within the CTLA4 gene confer genetic susceptibility to GD. PMID:29299173
Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing
NASA Astrophysics Data System (ADS)
Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación
2016-05-01
A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori
Handoko, H Y; Nancarrow, D J; Mowry, B J; McGrath, J J
2006-01-01
The association between vitamin D levels and skeletal growth has long been recognized. However, exposure to low levels of vitamin D during early life is also known to alter brain development, and is a candidate risk factor for schizophrenia. This study examines the association between four polymorphisms in the vitamin D receptor (VDR) and 1) risk of schizophrenia, and 2) three anthropometric variables (height, head size, and head shape). Four single-nucleotide polymorphisms (SNPs; rs10735810/FokI, rs1544410/BsmI, rs7975232/ApaI, and rs731236/TaqI) in the VDR gene were genotyped in 179 individuals with schizophrenia and 189 healthy controls. No significant associations were detected between any of the four VDR SNPs and risk of schizophrenia. Patients were slightly but significantly shorter compared to controls. Of the four SNPs, only rs10735810/FokI was associated with any of the anthropometric measures: the M4 isoform of this SNP was significantly associated with larger head size (P = 0.002). In light of the evidence demonstrating a role for vitamin D during brain development, the association between polymorphisms in VDR and brain development warrants closer scrutiny.
Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C
2012-05-01
We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.
CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.
Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru
2015-11-01
Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.
Rafighdoost, Houshang; Hashemi, Mohammad; Asadi, Hossein; Bahari, Gholamreza
2018-01-22
Nonsyndromic cleft lip with or without cleft palate is a common congenital deformity worldwide with multifaceted etiology. Interaction of genes and environmental factors has been indicated to be related with susceptibility to nonsyndromic cleft lip with or without cleft palate. Some WNT genes which are involved in craniofacial embryogenesis may play a key role in the pathogenesis of nonsyndromic cleft lip with or without cleft palate. In the present study, we aimed to inspect the relationship between WNT3 (rs3809857 and rs9890413), WNT3A (rs752107 and rs3121310), and WNT10a rs201002930 (c.392 C>T) polymorphisms and nonsyndromic cleft lip with or without cleft palate in an Iranian population. The present case-control study was carried out on 120 unrelated nonsyndromic cleft lip with or without cleft palate patients and 112 healthy subjects. The variants were genotyped by polymerase chain reaction-restriction fragment length polymorphism method. The findings suggest that the rs3809857 polymorphism significantly decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.16, 95% confidence interval = 0.03-0.75, P = 0.020, TT vs GG), recessive (odds ratio = 0.16, 95% confidence interval = 0.03-0.72, P = 0.009, TT vs GG + GT) inheritance models. The rs9890413 variant marginally decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.41, 95% confidence interval = 0.17-0.99, P = 0.047, AG vs AA) model. Regarding C392T variant, the findings revealed that this variant significantly decreased the risk of nonsyndromic cleft lip with or without cleft palate in codominant (odds ratio = 0.24, 95% confidence interval = 0.10-0.58, P = 0.002, CT vs CC) and allele (odds ratio = 0.26, 95% confidence interval = 0.11-0.62, P = 0.002, T vs C) models. No significant association was observed between the rs752107 and rs3121310 variants
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Alaylıoğlu, Merve; Gezen-Ak, Duygu; Dursun, Erdinç; Bilgiç, Başar; Hanağası, Haşmet; Ertan, Turan; Gürvit, Hakan; Emre, Murat; Eker, Engin; Uysal, Ömer; Yılmazer, Selma
2016-07-01
Previous studies have demonstrated that clusterin (CLU), which is also known as apolipoprotein J, is involved in the pathogenesis of Alzheimer disease (AD). In this study, we investigated the association between rs2279590, rs11136000, and rs9331888 single-nucleotide polymorphisms (SNPs) in CLU and apolipoprotein E (APOE) genotypes in a cohort of Turkish patients with late-onset AD (LOAD). There were 183 patients with LOAD and 154 healthy controls included in the study. The CLU and APOE polymorphisms were genotyped using the LightSNiP assay. The "GG" genotype of rs9331888 was significantly more frequent in patients with LOAD. The "CC" genotype of the SNP was significantly more frequent in controls. The rs9331888 "GG" genotype in patients and the "CC" genotype in controls were significantly higher in non-∊4 allele carriers of APOE The haplotype analysis showed the CLU "GCG" haplotype was a risk haplotype. Our findings indicate the rs9331888 SNP of CLU is associated with LOAD independent of APOE. © The Author(s) 2016.
Shunmugam, Vicneswari; Say, Yee-How
2016-02-01
α-adrenergic receptor 2A (ADRA2A) and angiotensin-converting enzyme (ACE) genes have been variably associated with obesity and its related phenotypes in different populations worldwide. This cross-sectional study aims to investigate the association of adrenergic receptor α2A (ADRA2A) rs553668 and angiotensin-converting enzyme (ACE) I/D single nucleotide polymorphisms (SNPs) with obesity traits (body mass index-BMI; waist-hip ratio-WHR; total body fat percentage - TBF) in a Malaysian population. Demographic and clinical variables were initially collected from 230 subjects via convenience sampling among residents and workers in Setapak, Malaysia, but in the end only 214 multi-ethnic Malaysians (99 males; 45 Malays, 116 ethnic Chinese, and 53 ethnic Indians) were available for statistical analysis. Genotyping was performed by polymerase chain reaction using DNA extracted from mouthwash samples. The overall minor allele frequencies (MAFs) for ADRA2A rs553668 and ACE I/D were 0.55 and 0.56, respectively. Allele distribution of ACE I/D was significantly associated with ethnicity and WHR class. Logistic regression analysis showed that subjects with the ACE II genotype and I allele were, respectively, 2.15 and 1.55 times more likely to be centrally obese, but when adjusted for age and ethnicity, this association was abolished. Covariate analysis controlling for age, gender, and ethnicity also showed similar results, where subjects carrying the II genotype or I allele did not have significantly higher WHR. Combinatory genotype and allele analysis for ADRA2A rs553668 and ACE I/D showed that subjects with both ADRA2A rs553668 GG and ACE I/D II genotypes had significant lowest WHR compared to other genotype combinations. The ACE II genotype might be a protective factor against central adiposity risk among the Malaysian population when in combination with the ADRA2A rs553668 GG genotype.
Winters, Alexandra H; Levan, Tricia D; Vogel, Stefanie N; Chesko, Kirsty L; Pollin, Toni I; Viscardi, Rose M
2013-08-01
Ureaplasma spp. respiratory tract colonization is a risk factor for bronchopulmonary dysplasia (BPD) in preterm infants, but differences in host susceptibility have not been elucidated. We hypothesized that variants in genes regulating the innate immune response are associated with altered risk for Ureaplasma spp. respiratory colonization and BPD in preterm infants. Twenty-four tag single nucleotide polymorphisms (SNPs) from Toll-like receptor (TLR)1, TLR2, TLR4 and TLR6 were assayed in 298 infants <33 weeks gestation who had serial respiratory cultures for Ureaplasma spp. and were evaluated for BPD. The majority of subjects (N = 205 [70%]) were African-American. One hundred ten (37%) were Ureaplasma positive. Four SNPs in TLR2 and TLR6 were significantly associated with Ureaplasma respiratory tract colonization. Single SNPs in TLR2, TLR4 and TLR6 were associated with BPD. TLR6 SNP rs5743827 was associated with both a decreased risk for Ureaplasma respiratory tract colonization and decreased risk for BPD (odds ratio: 0.54 [0.34-0.86] and odds ratio: 0.54 [0.31-0.95], respectively). There was a significant additive interaction between Ureaplasma colonization and genotype at TLR6 SNP rs5743827 (Padditive = 0.023), with an attributable proportion due to interaction of 0.542. Polymorphisms in host defense genes may alter susceptibility to Ureaplasma infection and severity of the inflammatory response contributing to BPD. These observations implicate host genetic susceptibility as a major factor in BPD pathogenesis in Ureaplasma-infected preterms.
Falfán-Valencia, Ramcés; Pavón-Romero, Gandhi F; Camarena, Angel; García, María de la Luz; Galicia-Negrete, Gustavo; Negrete-García, María Cristina; Teran, Luis Manuel
2012-01-01
Aspirin exacerbated respiratory disease (AERD) is characterized by chronic hyperplastic rhinosinusitis, nasal polyposis, asthma, and aspirin sensitivity. The mechanisms which produce these manifestations of intolerance are not fully defined, current research focuses on cyclooxygenase 1 (COX-1) inhibition, metabolism of arachidonic acid, and the COX pathway to the lipoxygenase (LO) route, inducing increased synthesis of leukotrienes (LT). The biological plausibility of this model has led to the search for polymorphisms in genes responsible for proinflammatory cytokines synthesis, such as IL1B and IL8. We performed a genetic association study between IL8-251 (rs4073) and IL1B-511 (rs16944) polymorphisms in AERD, aspirin-tolerant asthma (ATA), and healthy control subjects. Using allelic discrimination by real-time PCR, we found statistically nonsignificant associations between AERD, ATA, and healthy control subjects for the GG and GA genotypes of IL1B (rs16944). Interestingly, the AA genotype showed an increased frequency in the AERD patients versus the ATA group (GF = 0.19 versus 0.07, p = 0.018, OR 2.98, and 95% CI 1.17-7.82). This is the first observation that IL1B polymorphisms are involved in AERD. Thus, future studies must investigate whether interleukin-1β is released in the airways of AERD patients and whether it relates to genetic polymorphisms in the IL1B gene.
Falfán-Valencia, Ramcés; Pavón-Romero, Gandhi F.; Camarena, Angel; García, María de la Luz; Galicia-Negrete, Gustavo; Negrete-García, María Cristina; Teran, Luis Manuel
2012-01-01
Aspirin exacerbated respiratory disease (AERD) is characterized by chronic hyperplastic rhinosinusitis, nasal polyposis, asthma, and aspirin sensitivity. The mechanisms which produce these manifestations of intolerance are not fully defined, current research focuses on cyclooxygenase 1 (COX-1) inhibition, metabolism of arachidonic acid, and the COX pathway to the lipoxygenase (LO) route, inducing increased synthesis of leukotrienes (LT). The biological plausibility of this model has led to the search for polymorphisms in genes responsible for proinflammatory cytokines synthesis, such as IL1B and IL8. We performed a genetic association study between IL8-251 (rs4073) and IL1B-511 (rs16944) polymorphisms in AERD, aspirin-tolerant asthma (ATA), and healthy control subjects. Using allelic discrimination by real-time PCR, we found statistically nonsignificant associations between AERD, ATA, and healthy control subjects for the GG and GA genotypes of IL1B (rs16944). Interestingly, the AA genotype showed an increased frequency in the AERD patients versus the ATA group (GF = 0.19 versus 0.07, p = 0.018, OR 2.98, and 95% CI 1.17–7.82). This is the first observation that IL1B polymorphisms are involved in AERD. Thus, future studies must investigate whether interleukin-1β is released in the airways of AERD patients and whether it relates to genetic polymorphisms in the IL1B gene. PMID:22132000
2013-01-01
Background In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body weight. We used a linear regression model. Selected genes corresponded to folate metabolism, vitamins B-12, A, and E, and cholesterol pathways or lipid metabolism. Methods Extracted DNA from both the Sacramento and Beltsville populations was analyzed using an allele discrimination assay with a MALDI-TOF mass spectrometry platform. The adjusted phenotype, y, was HDL levels adjusted for gender and body weight only statistical analyses were performed using the genotype association and regression modules from the SNP Variation Suite v7. Results Statistically significant SNP (where P values were adjusted for false discovery rate) included: CETP (rs7499892 and rs5882); SLC46A1 (rs37514694; rs739439); SLC19A1 (rs3788199); CD36 (rs3211956); BCMO1 (rs6564851), APOA5 (rs662799), and ABCA1 (rs4149267). Many prior association trends of the SNP with HDL were replicated in our cross-validation study. Significantly, the association of SNP in folate transporters (SLC46A1 rs37514694 and rs739439; SLC19A1 rs3788199) with HDL was identified in our study. Conclusions Given recent literature on the role of niacin in the biogenesis of HDL, focus on status and metabolism of B-vitamins and metabolites of eccentric cleavage of β-carotene with lipid metabolism is exciting for future study. PMID:23656756
Li, Ning; Zhang, Chao; Chen, Zhaoquan; Bai, Lilu; Nie, Min; Zhou, Bin; Xu, Huanxi
2015-02-01
Several studies have investigated the association of the interleukin (IL) 17A and IL-17F polymorphisms and cancer of various organs. However, the role of the IL-17A and IL-17F polymorphisms in oral squamous cell carcinoma (OSCC) remains unclear. Thus we sought to clarify the association of the rs2275913, rs763780, and rs2397084 polymorphisms with OSCC in a Chinese population. A TaqMan single-nucleotide polymorphism Genotyping Assay (ABI, Foster, CA) was used to measure the distributions of the IL-17A (rs2275913) and IL-17F (rs763780, rs2397084) polymorphisms in 121 OSCC patients and 103 healthy controls. The association of those polymorphisms and clinical OSCC patient characteristic also was evaluated. Individuals carrying the rs2275913 A allele and AA genotype had an increased risk of OSCC (odds ratio [OR], 1.463; 95% confidence interval [CI], 0.807 to 2.652; and OR, 2.713; 95% CI, 1.250 to 5.889, respectively). The frequency of the rs2397084 T allele was significantly associated with a higher risk of OSCC than the G allele (OR, 1.501; 95% CI, 1.026 to 2.196). No difference in rs763780 frequencies was observed. The rs2275913 AA and rs2397084 TT genotypes also were associated with late clinical stages and poor tumor differentiation. In addition, stratification analysis indicated that the rs2275913 AA genotype increased OSCC risk among smoking and drinking populations (OR, 4.000; 95% CI, 1.404 to 11.394; and OR, 3.500; 95% CI, 1.018 to 12.030, respectively). In a smoking population, an rs9382084 T-allele carrier has a greater potential risk of OSCC than the overall population (OR, 2.200; 95% CI, 1.009 to 4.797). The results of this study suggest a significant association of rs2275913 and rs2397084 but not rs763780 with OSCC risk, and this was related to tumor stage and differentiation. In addition, the IL-17A and IL-17F polymorphisms can interact with smoking and drinking to enhance the risk of OSCC developing. Copyright © 2015 American Association of Oral and
Zhao, Wei; Bian, Yusong; Zhu, Wei; Zou, Peng; Tang, Guotai
2014-06-01
Regulator of telomere elongation helicase 1 (RTEL1) is critical for genome stability and tumor avoidance. Many studies have reported the associations of RTEL1 rs6010620 with glioma risk, but individually published results were inconclusive. This meta-analysis was performed to quantitatively summarize the evidence for such a relationship. The PubMed, Embase, and Web of Science were systematically searched to identify relevant studies. The odds ratio (OR) and 95 % confidence interval (95 % CI) were computed to estimate the strength of the association using a fixed or random effects model. Ten studies were eligible for meta-analysis including data on glioma with 6,490 cases and 9,288 controls. Overall, there was a significant association between RTEL1 rs6010620 polymorphism and glioma risk in all four genetic models (GG vs. AA: OR=1.87, 95 % CI=1.60-2.18, P heterogeneity=0.552; GA vs. AA: OR=1.30, 95 % CI=1.16-1.46, P heterogeneity=0.495; dominant model-GG+GA vs. AA: OR=1.46, 95 % CI=1.31-1.63, P heterogeneity=0.528; recessive model-GG vs. GA+AA: OR=1.36, 95 % CI=1.27-1.46, P heterogeneity=0.093). Subgroup analyses by ethnicity showed that RTEL1 rs6010620 polymorphism resulted in a higher risk of glioma among both Asians and Caucasians. In the stratified analysis by ethnicity and source of controls, significantly increased risk was observed for Asians and Europeans in all genetic models, population-based studies in all genetic models, and hospital-based studies in three genetic models (heterozygote comparison, homozygote comparison, and dominant model). Our meta-analysis suggested that RTEL1 rs6010620 polymorphism is likely to be associated with increased glioma risk, which lends further biological plausibility to these findings.