Sample records for nucleotide polymorphisms associate

  1. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  2. Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

    PubMed

    Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

    2015-05-01

    Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  3. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  4. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  5. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  6. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  7. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey

    PubMed Central

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-01-01

    Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596

  8. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey.

    PubMed

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-05-05

    Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.

  9. Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

    PubMed

    Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

    2017-06-13

    We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

  10. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  12. CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

    PubMed

    Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

    2015-11-01

    Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

  13. Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

    PubMed

    Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

    2016-04-01

    Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

  14. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

    PubMed

    Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-11-01

    Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  15. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

    PubMed Central

    Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-01-01

    Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

  16. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  17. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  18. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  19. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  20. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  1. A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

    PubMed Central

    Urschitz, Johann; Sultan, Omar; Ward, Kenneth

    2011-01-01

    Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

  2. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  3. No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population.

    PubMed

    Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan

    2004-09-01

    Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

  4. Polymorphism of SLC25A32, the folate transporter gene, is associated with plasma folate levels and bone fractures in Japanese postmenopausal women.

    PubMed

    Urano, Tomohiko; Shiraki, Masataka; Saito, Mitsuru; Sasaki, Noriko; Ouchi, Yasuyoshi; Inoue, Satoshi

    2014-10-01

    Elevation of homocysteine is associated with an increased risk for bone fractures. We previously reported that the methylenetetrahydrofolate reductase (MTHFR) gene polymorphism is associated with homocysteine levels and fracture. The association between the fracture and folate levels or their related gene polymorphisms is not completely clear. We speculated that the SLC25A32 gene, the mitochondrial inner membrane folate transporter, also could be implicated in the regulation of folate metabolism and fracture. A total of 851 Japanese postmenopausal women participated in the association study between the single nucleotide polymorphism genotype and plasma homocysteine or folate. We also tested the association between the candidate single nucleotide polymorphism and 663 postmenopausal women. The AA genotype of rs2241777 single nucleotide polymorphism at the 3'UTR region in the SLC25A32 gene was associated with lower plasma folate concentration compared with the other genotypes in 851 postmenopausal women. A total of 674 postmenopausal ambulatory Japanese women were followed up for 5.5 ± 0.1 years (mean ± SE). The AA genotype groups also showed an apparently higher rate and earlier onset of incident fractures than the other genotypes. A total of 407 participants had >70% young-adult mean bone mineral density at the start of the observation. These results show that the SLC25A32 gene polymorphism could be a risk factor for lower folate concentration and future fracture. © 2013 Japan Geriatrics Society.

  5. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  6. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  7. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  8. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  9. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  10. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  11. Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

    PubMed

    Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

    2010-08-01

    Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  12. Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

    PubMed

    Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

    2016-11-18

    Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

  13. 17q25 Locus Is Associated With White Matter Hyperintensity Volume in Ischemic Stroke, But Not With Lacunar Stroke Status

    PubMed Central

    Adib-Samii, Poneh; Rost, Natalia; Traylor, Matthew; Devan, William; Biffi, Alessandro; Lanfranconi, Silvia; Fitzpatrick, Kaitlin; Bevan, Steve; Kanakis, Allison; Valant, Valerie; Gschwendtner, Andreas; Malik, Rainer; Richie, Alexa; Gamble, Dale; Segal, Helen; Parati, Eugenio A.; Ciusani, Emilio; Holliday, Elizabeth G.; Maguire, Jane; Wardlaw, Joanna; Worrall, Bradford; Bis, Joshua; Wiggins, Kerri L.; Longstreth, Will; Kittner, Steve J.; Cheng, Yu-Ching; Mosley, Thomas; Falcone, Guido J.; Furie, Karen L.; Leiva-Salinas, Carlos; Lau, Benison C.; Khan, Muhammed Saleem; Sharma, Pankaj; Fornage, Myriam; Mitchell, Braxton D.; Psaty, Bruce M.; Sudlow, Cathie; Levi, Christopher; Boncoraglio, Giorgio B.; Rothwell, Peter M.; Meschia, James; Dichgans, Martin; Rosand, Jonathan; Markus, Hugh S.

    2013-01-01

    Background and Purpose Recently, a novel locus at 17q25 was associated with white matter hyperintensities (WMH) on MRI in stroke-free individuals. We aimed to replicate the association with WMH volume (WMHV) in patients with ischemic stroke. If the association acts by promoting a small vessel arteriopathy, it might be expected to also associate with lacunar stroke. Methods We quantified WMH on MRI in the stroke-free hemisphere of 2588 ischemic stroke cases. Association between WMHV and 6 single-nucleotide polymorphisms at chromosome 17q25 was assessed by linear regression. These single-nucleotide polymorphisms were also investigated for association with lacunar stroke in 1854 cases and 51 939 stroke-free controls from METASTROKE. Meta-analyses with previous reports and a genetic risk score approach were applied to identify other novel WMHV risk variants and uncover shared genetic contributions to WMHV in community participants without stroke and ischemic stroke. Results Single-nucleotide polymorphisms at 17q25 were associated with WMHV in ischemic stroke, the most significant being rs9894383 (P=0.0006). In contrast, there was no association between any single-nucleotide polymorphism and lacunar stroke. A genetic risk score analysis revealed further genetic components to WMHV shared between community participants without stroke and ischemic stroke. Conclusions This study provides support for an association between the 17q25 locus and WMH. In contrast, it is not associated with lacunar stroke, suggesting that the association does not act by promoting small-vessel arteriopathy or the same arteriopathy responsible for lacunar infarction. PMID:23674528

  14. Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

    PubMed

    Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

    2014-12-01

    Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

    PubMed Central

    2013-01-01

    Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

  16. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

    PubMed

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

    2017-08-01

    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  17. Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

    PubMed Central

    Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

    2016-01-01

    Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

  18. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  19. SRD5A1 and SRD5A2 are associated with treatment for benign prostatic hyperplasia with the combination of 5α-reductase inhibitors and α-adrenergic receptor antagonists.

    PubMed

    Gu, Xin; Na, Rong; Huang, Tao; Wang, Li; Tao, Sha; Tian, Lu; Chen, Zhuo; Jiao, Yang; Kang, Jian; Zheng, Siqun; Xu, Jianfeng; Sun, Jielin; Qi, Jun

    2013-08-01

    Common treatments for benign prostatic hyperplasia include 5α-reductase inhibitors and α-adrenergic receptor antagonists. However, these treatments can only partially decrease the risk of benign prostatic hyperplasia progression. SRD5A1 and SRD5A2 are 5α-reductase inhibitor targets. We investigated the association between drug efficacy and single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a Chinese population. We genotyped 11 tagging single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a total of 426 benign prostatic hyperplasia cases and 1,008 controls from Xinhua Hospital, Shanghai, People's Republic of China. Cases were treated with type II 5α-reductase inhibitors and α-adrenergic receptor antagonists. We tested the association of tagging single nucleotide polymorphisms with benign prostatic hyperplasia risk/progression, clinical characteristics at baseline, including the I-PSS (International Prostate Symptom Score) and total prostate volume, and changes in clinical characteristics after treatment. The 11 tagging single nucleotide polymorphisms were not significantly associated with benign prostatic hyperplasia risk or progression (each p >0.05). In the SRD5A1 gene rs6884552 and rs3797177 were significantly associated with baseline I-PSS (p = 0.04 and 0.003, respectively). In the SRD5A2 gene rs523349 (V89L) and rs9332975 were significantly associated with baseline total prostate volume (p = 0.01 and 0.001, respectively). In SRD5A1 rs166050 was significantly associated with the posttreatment change in total prostate volume (p = 0.04). In SRD5A2 rs523349 and rs612224 were significantly associated with the posttreatment I-PSS change (p = 0.03 and 0.009, respectively). SRD5A1 and SRD5A2 single nucleotide polymorphisms are significantly associated with the clinical characteristics of benign prostatic hyperplasia and the efficacy of benign prostatic hyperplasia treatment. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  20. Association between Single Nucleotide Polymorphism of Vitamin D Receptor Gene FokI Polymorphism and Clinical Progress of Benign Prostatic Hyperplasia

    PubMed Central

    Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de

    2015-01-01

    Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834

  1. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  2. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  3. Generalization of Associations of Kidney-Related Genetic Loci to American Indians

    PubMed Central

    Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.

    2014-01-01

    Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711

  4. Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

    PubMed

    Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

    2012-10-01

    To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

  5. Association study between alcoholism and endocannabinoid metabolic enzyme genes encoding fatty acid amide hydrolase and monoglyceride lipase in a Japanese population.

    PubMed

    Iwasaki, Shinya; Ishiguro, Hiroki; Higuchi, Susumu; Onaivi, Emmanuel S; Arinami, Tadao

    2007-08-01

    Fatty acid amide hydrolase (FAAH) and monoglyceride lipase (MGLL) are the major endocannabinoid metabolic enzymes. Owing to the importance of endocannabinoid system in addiction, the Pro129Thr polymorphism in the FAAH gene has reportedly been associated with substance abuse and dependence in a Caucasian population. To determine whether the single nucleodtide polymorphisms of the FAAH and MGLL genes are associated with alcoholism in a Japanese population. We conducted case-control studies for total 14 tag single nucleotide polymorphisms in those two genes using Japanese 729 patients with alcoholism and 799 healthy controls. Genotype and allele frequencies were compared between these groups. None of these genetic markers, however, showed significant association with alcoholism in Japanese. Whereas we examined associations in a larger sample size between alcoholism and tag single nucleotide polymorphisms that covered most regions of these endocannabinoid metabolic enzyme genes, we found that these are not associated with susceptibility to alcoholism in a Japanese population.

  6. Obesity-Related Genomic Loci Are Associated with Type 2 Diabetes in a Han Chinese Population

    PubMed Central

    Zhao, Qi; He, Jiang; Chen, Li; Zhao, Zhigang; Li, Qiang; Ge, Jiapu; Chen, Gang; Guo, Xiaohui; Lu, Juming; Weng, Jianping; Jia, Weiping; Ji, Linong; Xiao, Jianzhong; Shan, Zhongyan; Liu, Jie; Tian, Haoming; Ji, Qiuhe; Zhu, Dalong; Zhou, Zhiguang; Shan, Guangliang; Yang, Wenying

    2014-01-01

    Background and Aims Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population. Methods We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance) were analyzed using logistic and linear regression models, respectively. Results Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI) = 1.14 (1.06, 1.22) for the A allele of rs12970134, P = 4.75×10−4; OR (95% CI) = 1.10 (1.03, 1.17) for the G allele of rs10938397, P = 4.54×10−3). When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10−2) and that of GNPDA2 was attenuated (P = 1.26×10−1), suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10−2). In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes) showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05). Conclusions This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population. PMID:25093408

  7. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  8. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

    Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

  10. Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

    PubMed

    Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

    2017-04-01

    Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

  11. Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.

    PubMed

    Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up

    2007-04-01

    Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.

  12. Genotype-Phenotype Study of the Middle Gangetic Plain in India Shows Association of rs2470102 with Skin Pigmentation.

    PubMed

    Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy

    2017-03-01

    Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  14. Association between Tryptophan Hydroxylase 2 Gene Polymorphism and Completed Suicide

    ERIC Educational Resources Information Center

    Fudalej, Sylwia; Ilgen, Mark; Fudalej, Marcin; Kostrzewa, Grazyna; Barry, Kristen; Wojnar, Marcin; Krajewski, Pawel; Blow, Frederic; Ploski, Rafal

    2010-01-01

    The association between suicide and a single nucleotide polymorphism (rs1386483) was examined in the recently identified tryptophan hydroxylase 2 (TPH2) gene. Blood samples of 143 suicide victims and 162 age- and sex-matched controls were examined. The frequency of the TT genotype in the TPH2 polymorphism was higher in suicide victims than in…

  15. Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

    PubMed

    Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

    2012-01-01

    PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

  16. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    PubMed Central

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

    2016-01-01

    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  17. Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

    PubMed

    Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

    2012-07-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

  18. Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

    PubMed

    Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

    2014-07-01

    Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken.

    PubMed

    Han, R-L; Lan, X-Y; Zhang, L-Z; Ren, G; Jing, Y-J; Li, M-J; Zhang, B; Zhao, M; Guo, Y-K; Kang, X-T; Chen, H

    2010-01-01

    Visfatin is a peptide that is predominantly expressed in visceral adipose tissue and is hypothesized to be related to obesity and insulin resistance. In this study, a novel silent single-nucleotide polymorphism (SNP) was found in exon 7 of the chicken visfatin gene (also known as PBEF1) by single-stranded conformation polymorphism (SSCP) and DNA sequencing. In total, 836 chickens forming an F2 resource population of Gushi chicken crossed with Anka broiler were genotyped by XbaI forced RFLP, and the associations of this polymorphism with chicken growth, carcass characteristics, and meat quality were analyzed. Significant associations were found between the polymorphism and 4-week body weight (BW4), 6-week body weight (BW6), 4-week body slanting length (BSL4), fat bandwidth (FBW), breast muscle water loss rate (BWLR) and breast muscle fiber density (BFD) (P < 0.05), as well as 4-week breastbone length (BBL4) (P < 0.01). These observations suggested that the polymorphism in exon7 of the visfatin gene had significant effects on the early growth traits of chicken.

  20. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    PubMed

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.

    PubMed

    Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A

    2012-03-01

    Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.

  2. The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

    PubMed

    Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

    2018-03-01

    Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

  3. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    USDA-ARS?s Scientific Manuscript database

    In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

  4. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil.

    PubMed

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-02-01

    This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.

  5. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil

    PubMed Central

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-01-01

    OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237

  6. No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

    PubMed Central

    Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-01-01

    Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

  7. No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

    PubMed

    Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-06-16

    Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

  8. Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

    PubMed

    Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

    2008-01-01

    Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

  9. [Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

    PubMed

    Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

    2014-04-01

    Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

  10. Mycobacterium leprae: genes, pseudogenes and genetic diversity

    PubMed Central

    Singh, Pushpendra; Cole, Stewart T

    2011-01-01

    Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636

  11. Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

    DTIC Science & Technology

    2013-10-01

    identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

  12. Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

    USDA-ARS?s Scientific Manuscript database

    Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

  13. Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

    PubMed

    Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

    2007-09-01

    HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

  14. Identification of one polymorphism from the PAPP-A2 gene associated to fertility in Romosinuano beef heifers raised under a subtropical environment

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to identify single nucleotide polymorphisms (SNP) associated to fertility in female cows raised under a subtropical environment. Re-sequencing of 9 genes associated to GH-IGF endocrine pathway located in bovine chromosome 5, identified 75 SNP useful for associative ge...

  15. Interactions between genetic variants associated with adiposity traits and soft drinks in relation to longitudinal changes in body weight and waist circumference.

    PubMed

    Olsen, Nanna J; Ängquist, Lars; Larsen, Sofus C; Linneberg, Allan; Skaaby, Tea; Husemoen, Lise Lotte N; Toft, Ulla; Tjønneland, Anne; Halkjær, Jytte; Hansen, Torben; Pedersen, Oluf; Overvad, Kim; Ahluwalia, Tarunveer S; Sørensen, Thorkild Ia; Heitmann, Berit L

    2016-09-01

    Intake of sugar-sweetened beverages is associated with obesity, and this association may be modified by a genetic predisposition to obesity. We examined the interactions between a molecular genetic predisposition to various aspects of obesity and the consumption of soft drinks, which are a major part of sugar-sweetened beverages, in relation to changes in adiposity measures. A total of 4765 individuals were included in the study. On the basis of 50 obesity-associated single nucleotide polymorphisms that are associated with body mass index (BMI), waist circumference (WC), or the waist-to-hip ratio adjusted for BMI (WHRBMI), the following 4 genetic predisposition scores (GRSs) were constructed: a complete genetic predisposition score including all 50 single nucleotide polymorphisms (GRSComplete), a genetic predisposition score including BMI-associated single nucleotide polymorphisms (GRSBMI), a genetic predisposition score including waist circumference-associated single nucleotide polymorphisms (GRSWC), and a genetic predisposition score including the waist-to-hip ratio adjusted for BMI-associated single nucleotide polymorphisms (GRSWHR). Associations between soft drink intake and the annual change (Δ) in body weight (BW), WC, or waist circumference adjusted for BMI (WCBMI) and possible interactions with the GRSs were examined with the use of linear regression analyses and meta-analyses. For each soft drink serving per day, soft drink consumption was significantly associated with a higher ΔBW of 0.07 kg/y (95% CI: 0.01, 0.13 kg/y; P = 0.020) but not with the ΔWC or ΔWCBMI In analyses of the ΔBW, we showed an interaction only with the GRSWC (per risk allele for each soft drink serving per day: -0.06 kg/y; 95% CI: -0.10, -0.02 kg/y; P = 0.006). In analyses of the ΔWC, we showed interactions only with the GRSBMI and GRSComplete [per risk allele for each soft drink serving per day: 0.05 cm/y (95% CI: 0.02, 0.09 cm/y; P = 0.001) and 0.05 cm/y (95% CI: 0.02, 0.07 cm/y; P = 0.001), respectively]. Nearly identical results were observed in analyses of the ΔWCBMI CONCLUSIONS: A genetic predisposition to a high WC may attenuate the association between soft drink intake and BW gain. A genetic predisposition to high BMI as well as a genetic predisposition to high BMI, WC, and WHRBMI combined may strengthen the association between soft drink intake and WC gain. However, the public health impact may be limited. © 2016 American Society for Nutrition.

  16. Genetic Variants of TPCN2 Associated with Type 2 Diabetes Risk in the Chinese Population

    PubMed Central

    Zhang, Yu; Fan, Xiaofang; Zhang, Ning; Zheng, Hui; Song, Yuping; Shen, Chunfang; Shen, Jiayi; Ren, Fengdong; Yang, Jialin

    2016-01-01

    Objective The aim of this study was to determine whether TPCN2 genetic variants are associated with type 2 diabetes and to elucidate which variants in TPCN2 confer diabetes susceptibility in the Chinese population. Research Design and Methods The sample population included 384 patients with type 2 diabetes and 1468 controls. Anthropometric parameters, glycemic and lipid profiles and insulin resistance were measured. We selected 6 TPCN2 tag single nucleotide polymorphisms (rs35264875, rs267603153, rs267603154, rs3829241, rs1551305, and rs3750965). Genotypes were determined using a Sequenom MassARRAY SNP genotyping system. Results Ultimately, we genotyped 3 single nucleotide polymorphisms (rs3750965, rs3829241, and rs1551305) in all individuals. There was a 5.1% higher prevalence of the rs1551305 variant allele in type 2 diabetes individuals (A) compared with wild-type homozygous individuals (G). The AA genotype of rs1551305 was associated with a higher diabetes risk (p<0.05). The distributions of rs3829241 and rs3750965 polymorphisms were not significantly different between the two groups. HOMA-%B of subjects harboring the AA genotype of rs1551305 decreased by 14.87% relative to the GG genotype. Conclusions TPCN2 plays a role in metabolic regulation, and the rs1551305 single nucleotide polymorphism is associated with type 2 diabetes risk. Future work will begin to unravel the underlying mechanisms. PMID:26918892

  17. Allelic imbalance of multiple sclerosis susceptibility genes IKZF3 and IQGAP1 in human peripheral blood.

    PubMed

    Keshari, Pankaj K; Harbo, Hanne F; Myhr, Kjell-Morten; Aarseth, Jan H; Bos, Steffan D; Berge, Tone

    2016-04-14

    Multiple sclerosis is a chronic inflammatory, demyelinating disease of the central nervous system. Recent genome-wide studies have revealed more than 110 single nucleotide polymorphisms as associated with susceptibility to multiple sclerosis, but their functional contribution to disease development is mostly unknown. Consistent allelic imbalance was observed for rs907091 in IKZF3 and rs11609 in IQGAP1, which are in strong linkage disequilibrium with the multiple sclerosis associated single nucleotide polymorphisms rs12946510 and rs8042861, respectively. Using multiple sclerosis patients and healthy controls heterozygous for rs907091 and rs11609, we showed that the multiple sclerosis risk alleles at IKZF3 and IQGAP1 are expressed at higher levels as compared to the protective allele. Furthermore, individuals homozygous for the multiple sclerosis risk allele at IQGAP1 had a significantly higher total expression of IQGAP1 compared to individuals homozygous for the protective allele. Our data indicate a possible regulatory role for the multiple sclerosis-associated IKZF3 and IQGAP1 variants. We suggest that such cis-acting mechanisms may contribute to the multiple sclerosis association of single nucleotide polymorphisms at IKZF3 and IQGAP1.

  18. rs11613352 polymorphism (TT genotype) associates with a decrease of triglycerides and an increase of HDL in familial hypercholesterolemia patients.

    PubMed

    Aledo, Rosa; Padró, Teresa; Mata, Pedro; Alonso, Rodrigo; Badimon, Lina

    2015-04-01

    Recent genome-wide association studies have identified a locus on chromosome 12q13.3 associated with plasma levels of triglyceride and high-density lipoprotein cholesterol, with rs11613352 being the lead single nucleotide polymorphism in this genome-wide association study locus. The aim of the study is to investigate the involvement of rs11613352 in a population with high cardiovascular risk due to familial hypercholesterolemia. The single nucleotide polymorphism was genotyped by Taqman(®) assay in a cohort of 601 unrelated familial hypercholesterolemia patients and its association with plasma triglyceride and high-density lipoprotein cholesterol levels was analyzed by multivariate methods based on linear regression. Minimal allele frequency was 0.17 and genotype frequencies were 0.69, 0.27, and 0.04 for CC, CT, and TT genotypes, respectively. The polymorphism is associated in a recessive manner (TT genotype) with a decrease in triglyceride levels (P=.002) and with an increase in high-density lipoprotein cholesterol levels (P=.021) after adjusting by age and sex. The polymorphism rs11613352 may contribute to modulate the cardiovascular risk by modifying plasma lipid levels in familial hypercholesterolemia patients. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  19. Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

    PubMed

    Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

    2008-05-01

    Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.

  20. Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine

    PubMed Central

    Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

    2009-01-01

    OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852

  1. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  2. Genetic Factors Influencing Coagulation Factor XIII B-Subunit Contribute to Risk of Ischemic Stroke.

    PubMed

    Hanscombe, Ken B; Traylor, Matthew; Hysi, Pirro G; Bevan, Stephen; Dichgans, Martin; Rothwell, Peter M; Worrall, Bradford B; Seshadri, Sudha; Sudlow, Cathie; Williams, Frances M K; Markus, Hugh S; Lewis, Cathryn M

    2015-08-01

    Abnormal coagulation has been implicated in the pathogenesis of ischemic stroke, but how this association is mediated and whether it differs between ischemic stroke subtypes is unknown. We determined the shared genetic risk between 14 coagulation factors and ischemic stroke and its subtypes. Using genome-wide association study results for 14 coagulation factors from the population-based TwinsUK sample (N≈2000 for each factor), meta-analysis results from the METASTROKE consortium ischemic stroke genome-wide association study (12 389 cases, 62 004 controls), and genotype data for 9520 individuals from the WTCCC2 ischemic stroke study (3548 cases, 5972 controls-the largest METASTROKE subsample), we explored shared genetic risk for coagulation and stroke. We performed three analyses: (1) a test for excess concordance (or discordance) in single nucleotide polymorphism effect direction across coagulation and stroke, (2) an estimation of the joint effect of multiple coagulation-associated single nucleotide polymorphisms in stroke, and (3) an evaluation of common genetic risk between coagulation and stroke. One coagulation factor, factor XIII subunit B (FXIIIB), showed consistent effects in the concordance analysis, the estimation of polygenic risk, and the validation with genotype data, with associations specific to the cardioembolic stroke subtype. Effect directions for FXIIIB-associated single nucleotide polymorphisms were significantly discordant with cardioembolic disease (smallest P=5.7×10(-04)); the joint effect of FXIIIB-associated single nucleotide polymorphisms was significantly predictive of ischemic stroke (smallest P=1.8×10(-04)) and the cardioembolic subtype (smallest P=1.7×10(-04)). We found substantial negative genetic covariation between FXIIIB and ischemic stroke (rG=-0.71, P=0.01) and the cardioembolic subtype (rG=-0.80, P=0.03). Genetic markers associated with low FXIIIB levels increase risk of ischemic stroke cardioembolic subtype. © 2015 The Authors.

  3. Calving traits of crossbred Brahman Cows are Associated with Heat Shock Protein 70 Genetic Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Objectives were to: 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 gene, and 2) evaluate associations between Hsp70 SNP and calving rates of Brahman-influenced cows. Specific primers were designed for PCR amplification of a 539 b...

  4. Polymorphism in the GALNT1 Gene and Epithelial Ovarian Cancer in Non-Hispanic White Women: The Ovarian Cancer Association Consortium

    PubMed Central

    Phelan, Catherine M.; Tsai, Ya-Yu; Goode, Ellen L.; Vierkant, Robert A.; Fridley, Brooke L.; Beesley, Jonathan; Chen, Xiao Qing; Webb, Penelope M.; Chanock, Stephen; Cramer, Daniel W.; Moysich, Kirsten; Edwards, Robert P.; Chang-Claude, Jenny; Garcia-Closas, Montserrat; Yang, Hannah; Wang-Gohrke, Shan; Hein, Rebecca; Green, Adele C.; Lissowska, Jolanta; Carney, Michael E.; Lurie, Galina; Wilkens, Lynne R.; Ness, Roberta B.; Pearce, Celeste Leigh; Wu, Anna H.; Van Den Berg, David J.; Stram, Daniel O.; Terry, Kathryn L.; Whiteman, David C.; Whittemore, Alice S.; DiCioccio, Richard A.; McGuire, Valerie; Doherty, Jennifer A.; Rossing, Mary Anne; Anton-Culver, Hoda; Ziogas, Argyrios; Hogdall, Claus; Hogdall, Estrid; Kjaer, Susanne Krüger; Blaakaer, Jan; Quaye, Lydia; Ramus, Susan J.; Jacobs, Ian; Song, Honglin; Pharoah, Paul D.P.; Iversen, Edwin S.; Marks, Jeffrey R.; Pike, Malcolm C.; Gayther, Simon A.; Cunningham, Julie M.; Goodman, Marc T.; Schildkraut, Joellen M.; Chenevix-Trench, Georgia; Berchuck, Andrew; Sellers, Thomas A.

    2010-01-01

    Aberrant glycosylation is a well-described hallmark of cancer. In a previous ovarian cancer case control study that examined polymorphisms in 26 glycosylation-associated genes, we found strong statistical evidence (P = 0.00017) that women who inherited two copies of a single-nucleotide polymorphism in the UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferase, GALNT1, had decreased ovarian cancer risk. The current study attempted to replicate this observation. The GALNT1 single-nucleotide polymorphism rs17647532 was genotyped in 6,965 cases and 8,377 controls from 14 studies forming the Ovarian Cancer Association Consortium. The fixed effects estimate per rs17647532 allele was null (odds ratio, 0.99; 95% confidence interval, 0.92–1.07). When a recessive model was fit, the results were unchanged. Test for hetero geneity of the odds ratios revealed consistency across the 14 replication sites but significant differences compared with the original study population (P = 0.03). This study underscores the need for replication of putative findings in genetic association studies. PMID:20142253

  5. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

    PubMed

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

    2014-06-01

    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  6. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review.

    PubMed

    Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

    2015-07-01

    Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association.

  7. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

    PubMed

    Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

    2017-06-26

    Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  8. Association between RTEL1 gene polymorphisms and COPD susceptibility in a Chinese Han population.

    PubMed

    Ding, Yipeng; Xu, Heping; Yao, Jinjian; Xu, Dongchuan; He, Ping; Yi, Shengyang; Li, Quanni; Liu, Yuanshui; Wu, Cibing; Tian, Zhongjie

    2017-01-01

    We investigated the association between single-nucleotide polymorphisms in regulation of telomere elongation helicase 1 ( RTEL1 ), which has been associated with telomere length in several brain cancers and age-related diseases, and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese Han population. In a case-control study that included 279 COPD cases and 290 healthy controls, five single-nucleotide polymorphisms in RTEL1 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. In the genotype model analysis, we determined that rs4809324 polymorphism had a decreased effect on the risk of COPD (CC versus TT: OR =0.28; 95% CI =0.10-0.82; P =0.02). In the genetic model analysis, we found that the "C/C" genotype of rs4809324 was associated with a decreased risk of COPD based on the codominant model (OR =0.33; 95% CI =0.13-0.86; P =0.022) and recessive model (OR =0.32; 95% CI =0.12-0.80; P =0.009). Our data shed new light on the association between genetic polymorphisms of RTEL1 and COPD susceptibility in the Chinese Han population.

  9. The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

    PubMed

    Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

    2011-01-01

    Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

  10. No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

    PubMed

    Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

    2012-07-30

    This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Testing for genetic association taking into account phenotypic information of relatives.

    PubMed

    Uh, Hae-Won; Wijk, Henk Jan van der; Houwing-Duistermaat, Jeanine J

    2009-12-15

    We investigated efficient case-control association analysis using family data. The outcome of interest was coronary heart disease. We employed existing and new methods that take into account the correlations among related individuals to obtain the proper type I error rates. The methods considered for autosomal single-nucleotide polymorphisms were: 1) generalized estimating equations-based methods, 2) variance-modified Cochran-Armitage (MCA) trend test incorporating kinship coefficients, and 3) genotypic modified quasi-likelihood score test. Additionally, for X-linked single-nucleotide polymorphisms we proposed a two-degrees-of-freedom test. Performance of these methods was tested using Framingham Heart Study 500 k array data.

  12. Genome-Wide Association Study Identifies Risk Variants for Lichen Planus in Patients With Hepatitis C Virus Infection.

    PubMed

    Nagao, Yumiko; Nishida, Nao; Toyo-Oka, Licht; Kawaguchi, Atsushi; Amoroso, Antonio; Carrozzo, Marco; Sata, Michio; Mizokami, Masashi; Tokunaga, Katsushi; Tanaka, Yasuhito

    2017-06-01

    There is a close relationship between hepatitis C virus (HCV) infection and lichen planus, a chronic inflammatory mucocutaneous disease. We performed a genome-wide association study (GWAS) to identify genetic variants associated with HCV-related lichen planus. We conducted a GWAS of 261 patients with HCV infection treated at a tertiary medical center in Japan from October 2007 through January 2013; a total of 71 had lichen planus and 190 had normal oral mucosa. We validated our findings in a GWAS of 38 patients with HCV-associated lichen planus and 7 HCV-infected patients with normal oral mucosa treated at a medical center in Italy. Single-nucleotide polymorphisms in NRP2 (rs884000) and IGFBP4 (rs538399) were associated with risk of HCV-associated lichen planus (P < 1 × 10 -4 ). We also found an association between a single-nucleotide polymorphism in the HLA-DR/DQ genes (rs9461799) and susceptibility to HCV-associated lichen planus. The odds ratios for the minor alleles of rs884000, rs538399, and rs9461799 were 3.25 (95% confidence interval, 1.95-5.41), 0.40 (95% confidence interval, 0.25-0.63), and 2.15 (95% confidence interval, 1.41-3.28), respectively. In a GWAS of Japanese patients with HCV infection, we replicated associations between previously reported polymorphisms in HLA class II genes and risk for lichen planus. We also identified single-nucleotide polymorphisms in NRP2 and IGFBP4 loci that increase and reduce risk of lichen planus, respectively. These genetic variants might be used to identify patients with HCV infection who are at risk for lichen planus. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  13. The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study

    USDA-ARS?s Scientific Manuscript database

    Background-Low high-density lipoprotein cholesterol (HDL-C) is associated with an increased risk for atherosclerosis and concentrations are modulated by genetic and environmental factors such as smoking. Objective- To assess whether the association of common single nucleotide polymorphisms (SNPs...

  14. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  15. Genetics of Oxidative Stress in Obesity

    PubMed Central

    Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.

    2014-01-01

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334

  16. Genetics of oxidative stress in obesity.

    PubMed

    Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M

    2014-02-20

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.

  17. Association between ghrelin gene variations, body mass index, and waist-to-hip ratio in patients with polycystic ovary syndrome.

    PubMed

    Xu, L; Shi, Y; Gu, J; Wang, Y; Wang, L; You, L; Qi, X; Ye, Y; Chen, Z

    2014-03-01

    To investigate the association between 2 single nucleotide polymorphisms (SNP501A/C and 604 G/A) in the promoter of the ghrelin gene and the hormonal and metabolic phenotypes of polycystic ovary syndrome (PCOS) in a Chinese population. 285 patients with PCOS and 260 healthy controls were selected for a prospective, case-control study at Shandong Provincial Hospital, Jinan, China. All subjects underwent genotype analysis of the 2 single nucleotide polymorphisms of the ghrelin gene. Measurements were also taken of blood lipids, glucose, and hormone levels, and calculations of body mass index (BMI) and waist-to-hip ratio (WHR) were performed to detect hormonal and metabolic phenotypes. No significant diff erences in polymorphism genotypes were found between PCOS patients and healthy controls. However, the frequency of the -501 A/C A allele was significantly higher in the PCOS group than in the control group. PCOS -501 A/C A carriers had significantly higher BMI and WHR than PCOS women with the CC genotype. -604 G/A polymorphisms were not associated with clinical or biochemical characteristics of PCOS. The -501 A/C polymorphism of the ghrelin gene is associated with metabolic features of PCOS in a Chinese population. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.

  18. Polymorphism of the renalase gene in gestational diabetes mellitus.

    PubMed

    Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna

    2017-01-01

    Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

  19. Polygenic Overlap Between C-Reactive Protein, Plasma Lipids, and Alzheimer Disease.

    PubMed

    Desikan, Rahul S; Schork, Andrew J; Wang, Yunpeng; Thompson, Wesley K; Dehghan, Abbas; Ridker, Paul M; Chasman, Daniel I; McEvoy, Linda K; Holland, Dominic; Chen, Chi-Hua; Karow, David S; Brewer, James B; Hess, Christopher P; Williams, Julie; Sims, Rebecca; O'Donovan, Michael C; Choi, Seung Hoan; Bis, Joshua C; Ikram, M Arfan; Gudnason, Vilmundur; DeStefano, Anita L; van der Lee, Sven J; Psaty, Bruce M; van Duijn, Cornelia M; Launer, Lenore; Seshadri, Sudha; Pericak-Vance, Margaret A; Mayeux, Richard; Haines, Jonathan L; Farrer, Lindsay A; Hardy, John; Ulstein, Ingun Dina; Aarsland, Dag; Fladby, Tormod; White, Linda R; Sando, Sigrid B; Rongve, Arvid; Witoelar, Aree; Djurovic, Srdjan; Hyman, Bradley T; Snaedal, Jon; Steinberg, Stacy; Stefansson, Hreinn; Stefansson, Kari; Schellenberg, Gerard D; Andreassen, Ole A; Dale, Anders M

    2015-06-09

    Epidemiological findings suggest a relationship between Alzheimer disease (AD), inflammation, and dyslipidemia, although the nature of this relationship is not well understood. We investigated whether this phenotypic association arises from a shared genetic basis. Using summary statistics (P values and odds ratios) from genome-wide association studies of >200 000 individuals, we investigated overlap in single-nucleotide polymorphisms associated with clinically diagnosed AD and C-reactive protein (CRP), triglycerides, and high- and low-density lipoprotein levels. We found up to 50-fold enrichment of AD single-nucleotide polymorphisms for different levels of association with C-reactive protein, low-density lipoprotein, high-density lipoprotein, and triglyceride single-nucleotide polymorphisms using a false discovery rate threshold <0.05. By conditioning on polymorphisms associated with the 4 phenotypes, we identified 55 loci associated with increased AD risk. We then conducted a meta-analysis of these 55 variants across 4 independent AD cohorts (total: n=29 054 AD cases and 114 824 healthy controls) and discovered 2 genome-wide significant variants on chromosome 4 (rs13113697; closest gene, HS3ST1; odds ratio=1.07; 95% confidence interval=1.05-1.11; P=2.86×10(-8)) and chromosome 10 (rs7920721; closest gene, ECHDC3; odds ratio=1.07; 95% confidence interval=1.04-1.11; P=3.38×10(-8)). We also found that gene expression of HS3ST1 and ECHDC3 was altered in AD brains compared with control brains. We demonstrate genetic overlap between AD, C-reactive protein, and plasma lipids. By conditioning on the genetic association with the cardiovascular phenotypes, we identify novel AD susceptibility loci, including 2 genome-wide significant variants conferring increased risk for AD. © 2015 American Heart Association, Inc.

  20. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    PubMed

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  1. Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

    PubMed Central

    Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

  2. Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

    PubMed

    Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

  3. Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

    PubMed

    Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

    2014-07-01

    Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

  4. Characterizing the genetic risk for Type 2 diabetes in a Malaysian multi-ethnic cohort.

    PubMed

    Abdullah, N; Abdul Murad, N A; Attia, J; Oldmeadow, C; Mohd Haniff, E A; Syafruddin, S E; Abd Jalal, N; Ismail, N; Ishak, M; Jamal, R; Scott, R J; Holliday, E G

    2015-10-01

    To characterize the association with Type 2 diabetes of known Type 2 diabetes risk variants in people in Malaysia of Malay, Chinese and Indian ancestry who participated in the Malaysian Cohort project. We genotyped 1604 people of Malay ancestry (722 cases, 882 controls), 1654 of Chinese ancestry (819 cases, 835 controls) and 1728 of Indian ancestry (851 cases, 877 controls). First, 62 candidate single-nucleotide polymorphisms previously associated with Type 2 diabetes were assessed for association via logistic regression within ancestral groups and then across ancestral groups using a meta-analysis. Second, estimated odds ratios were assessed for excess directional concordance with previously studied populations. Third, a genetic risk score aggregating allele dosage across the candidate single-nucleotide polymorphisms was tested for association within and across ancestral groups. After Bonferroni correction, seven individual single-nucleotide polymorphisms were associated with Type 2 diabetes in the combined Malaysian sample. We observed a highly significant excess in concordance of effect directions between Malaysian and previously studied populations. The genetic risk score was strongly associated with Type 2 diabetes in all Malaysian groups, explaining from 1.0 to 1.7% of total Type 2 diabetes risk variance. This study suggests there is substantial overlap of the genetic risk alleles underlying Type 2 diabetes in Malaysian and other populations. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.

  5. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review

    PubMed Central

    Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

    2015-01-01

    Context: Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. Evidence Acquisition: The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. Results: The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. Conclusions: In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association. PMID:26425125

  6. Association of functional polymorphisms of the transforming growth factor B1 gene with survival and graft-versus-host disease after unrelated donor hematopoietic stem cell transplantation

    PubMed Central

    Berro, Mariano; Mayor, Neema P.; Maldonado-Torres, Hazael; Cooke, Louise; Kusminsky, Gustavo; Marsh, Steven G.E.; Madrigal, J. Alejandro; Shaw, Bronwen E.

    2010-01-01

    Background Many genetic factors play major roles in the outcome of hematopoietic stem cell transplants from unrelated donors. Transforming growth factor β1 is a member of a highly pleiotrophic family of growth factors involved in the regulation of numerous immunomodulatory processes. Design and Methods We investigated the impact of single nucleotide polymorphisms at codons 10 and 25 of TGFB1, the gene encoding for transforming growth factor β1, on outcomes in 427 mye-loablative-conditioned transplanted patients. In addition, transforming growth factor β1 plasma levels were measured in 263 patients and 327 donors. Results Patients homozygous for the single nucleotide polymorphism at codon 10 had increased non-relapse mortality (at 3 years: 46.8% versus 29.4%, P=0.014) and reduced overall survival (at 5 years 29.3% versus 42.2%, P=0.013); the differences remained statistically significant in multivariate analysis. Donor genotype alone had no impact, although multiple single nucleotide polymorphisms within the pair were significantly associated with higher non-relapse mortality (at 3 years: 44% versus 29%, P=0.021) and decreased overall survival (at 5 years: 33.8% versus 41.9%, P=0.033). In the 10/10 HLA matched transplants (n=280), recipients of non-wild type grafts tended to have a higher incidence of acute graft-versus-host disease grades II-IV (P=0.052). In multivariate analysis, when analyzed with patients’ genotype, the incidences of both overall and grades II-IV acute graft-versus-host disease were increased (P=0.025 and P=0.009, respectively) in non-wild-type pairs. Conclusions We conclude that increasing numbers of single nucleotide polymorphisms in codon 10 of TGFB1 in patients and donors are associated with a worse outcome following hematopoietic stem cell transplantation from unrelated donors. PMID:19713222

  7. Cyclooxygenase 2 gene polymorphisms and chronic periodontitis in a North Indian population: a pilot study

    PubMed Central

    Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq

    2012-01-01

    Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695

  8. Single nucleotide polymorphism (SNP) discovery in rainbow trout using restriction site associated DNA (RAD) sequencing of doubled haploids and assessment of polymorphism in a population survey

    USDA-ARS?s Scientific Manuscript database

    Background: Our goal is to produce a high-throughput SNP genotyping platform for genomic analyses in rainbow trout that will enable fine mapping of QTL, whole genome association studies, genomic selection for improved aquaculture production traits, and genetic analyses of wild populations that aid ...

  9. Association of Ugrp2 gene polymorphisms with adenoid hypertrophy in the pediatric population.

    PubMed

    Atilla, Mahmut Huntürk; Özdaş, Sibel; Özdaş, Talih; Baştimur, Sibel; Muz, Sami Engin; Öz, Işılay; Kurt, Kenan; İzbirak, Afife; Babademez, Mehmet Ali; Vatandaş, Nilgün

    2017-08-01

    Adenoid hypertrophy is a condition that presents itself as the chronic enlargement of adenoid tissues; it is frequently observed in the pediatric population. The Ugrp2 gene, a member of the secretoglobin superfamily, encodes a low-molecular weight protein that functions in the differentiation of upper airway epithelial cells. However, little is known about the association of Ugrp2 genetic variations with adenoid hypertrophy. The aim of this study is to investigate the association of single nucleotide polymorphisms in the Ugrp2 gene with adenoid hypertrophy and its related phenotypes. A total of 219 children, comprising 114 patients suffering from adenoid hypertrophy and 105 healthy patients without adenoid hypertrophy, were enrolled in this study. Genotypes of the Ugrp2 gene were determined by DNA sequencing. We identified four single nucleotide polymorphisms (IVS1-189G>A, IVS1-89T>G, c.201delC, and IVS2-15G>A) in the Ugrp2 gene. Our genotype analysis showed that the Ugrp2 (IVS1-89T>G) TG and (c.201delC) CdelC genotypes and their minor alleles were associated with a considerable increase in the risk of adenoid hypertrophy compared with the controls (p=0.012, p=0.009, p=0.013, and p=0.037, respectively). Furthermore, Ugrp2 (GTdelCG, GTdelCA) haplotypes were significantly associated with adenoid hypertrophy (four single nucleotide polymorphisms ordered from 5' to 3'; p=0.0001). Polymorfism-Polymorfism interaction analysis indicated a strong interaction between combined genotypes of the Ugrp2 gene contributing to adenoid hypertrophy, as well as an increased chance of its diagnosis (p<0.0001). In addition, diplotypes carrying the mutant Ugrp2 (c.201delC) allele were strongly associated with an increased risk of adenoid hypertrophy with asthma and adenoid hypertrophy with allergies (p=0.003 and p=0.0007, respectively). Some single nucleotide polymorphisms and their combinations in the Ugrp2 gene are associated with an increased risk of developing adenoid hypertrophy. Therefore, we tried to underline the importance of genetic factors associated with adenoid hypertrophy and adenoid hypertrophy-related clinical phenotypes. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  10. Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

    PubMed

    López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

    2017-12-01

    This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

  11. Association between RTEL1 gene polymorphisms and COPD susceptibility in a Chinese Han population

    PubMed Central

    Ding, Yipeng; Xu, Heping; Yao, Jinjian; Xu, Dongchuan; He, Ping; Yi, Shengyang; Li, Quanni; Liu, Yuanshui; Wu, Cibing; Tian, Zhongjie

    2017-01-01

    Objective We investigated the association between single-nucleotide polymorphisms in regulation of telomere elongation helicase 1 (RTEL1), which has been associated with telomere length in several brain cancers and age-related diseases, and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese Han population. Methods In a case–control study that included 279 COPD cases and 290 healthy controls, five single-nucleotide polymorphisms in RTEL1 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. Results In the genotype model analysis, we determined that rs4809324 polymorphism had a decreased effect on the risk of COPD (CC versus TT: OR =0.28; 95% CI =0.10–0.82; P=0.02). In the genetic model analysis, we found that the “C/C” genotype of rs4809324 was associated with a decreased risk of COPD based on the codominant model (OR =0.33; 95% CI =0.13–0.86; P=0.022) and recessive model (OR =0.32; 95% CI =0.12–0.80; P=0.009). Conclusion Our data shed new light on the association between genetic polymorphisms of RTEL1 and COPD susceptibility in the Chinese Han population. PMID:28360516

  12. Association of "ADAM10" and "CAMK2A" Polymorphisms with Conduct Disorder: Evidence from Family-Based Studies

    ERIC Educational Resources Information Center

    Jian, Xue-Qiu; Wang, Ke-Sheng; Wu, Tie-Jian; Hillhouse, Joel J.; Mullersman, Jerald E.

    2011-01-01

    Twin and family studies have shown that genetic factors play a role in the development of conduct disorder (CD). The purpose of this study was to identify genetic variants associated with CD using a family-based association study. We used 4,720 single nucleotide polymorphisms (SNPs) from the Illumina Panel and 11,120 SNPs from the Affymetrix 10K…

  13. Further Evidence of the Association of the Diacylglycerol Kinase Kappa (DGKK) Gene With Hypospadias.

    PubMed

    Hozyasz, Kamil Konrad; Mostowska, Adrianna; Kowal, Andrzej; Mydlak, Dariusz; Tsibulski, Alexander; Jagodzinski, Pawel P

    2018-02-18

    Hypospadias is a common developmental anomaly of the male external genitalia. In previous studies conducted on West European, Californian, and Han Chinese populations the relationship between polymorphic variants of the diacylglycerol kinase kappa (DGKK) gene and hypospadias have been reported. The aim was to study the possible associations between polymorphic variants of the DGKK gene and hypospadias using an independent sample of the Polish population. Ten single nucleotide polymorphisms in DGKK, which were reported to have an impact on the risk of hypospadias in other populations, were genotyped using high-resolution melting curve analysis in a group of 166 boys with isolated anterior (66%) and middle (34%) forms of hypospadias and 285 properly matched controls without congenital anomalies. Two DGKK variants rs11091748 and rs12171755 were associated with increased risk of hypospadias in the Polish population. These results were statistically significant, even after applying the Bonferroni correction for multiple comparisons (P < .005). All the tested nucleotide variants were involved in haplotype combinations associated with hypospadias. The global p-values for haplotypes comprising of rs4143304-rs11091748, rs11091748-rs17328236, rs1934179-rs4554617, rs1934183-rs1934179-rs4554617 and rs12171755-rs1934183-rs1934179-rs4554617 were statistically significant, even after the permutation test correction. Our study provides strong evidence of an association between DGKK nucleotide variants, haplotypes and hypospadias susceptibility.

  14. Amino acid sequence of the Amur tiger prion protein.

    PubMed

    Wu, Changde; Pang, Wanyong; Zhao, Deming

    2006-10-01

    Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.

  15. No association between apolipoprotein E or N-acetyltransferase 2 gene polymorphisms and age-related hearing loss.

    PubMed

    Dawes, Piers; Platt, Hazel; Horan, Michael; Ollier, William; Munro, Kevin; Pendleton, Neil; Payton, Antony

    2015-01-01

    Age-related hearing loss has a genetic component, but there have been limited genetic studies in this field. Both N-acetyltransferase 2 and apolipoprotein E genes have previously been associated. However, these studies have either used small sample sizes, examined a limited number of polymorphisms, or have produced conflicting results. Here we use a haplotype tagging approach to determine association with age-related hearing loss and investigate epistasis between these two genes. Candidate gene association study of a continuous phenotype. We investigated haplotype tagging single nucleotide polymorphisms in the N-acetyltransferase 2 gene and the presence/absence of the apolipoprotein E ε4 allele for association with age-related hearing loss in a cohort of 265 Caucasian elderly volunteers from Greater Manchester, United Kingdom. Hearing phenotypes were generated using principal component analysis of the hearing threshold levels for the better ear (severity, slope, and concavity). Genotype data for the N-acetyltransferase 2 gene was obtained from existing genome-wide association study data from the Illumina 610-Quadv1 chip. Apolipoprotein E genotyping was performed using Sequenom technology. Linear regression analysis was performed using Plink and Stata software. No significant associations (P value, > 0.05) were observed between the N-acetyltransferase 2 or apolipoprotein E gene polymorphisms and any hearing factor. No significant association was observed for epistasis analysis of apolipoprotein E ε4 and the N-acetyltransferase 2 single nucleotide polymorphism rs1799930 (NAT2*6A). We found no evidence to support that either N-acetyltransferase 2 or apolipoprotein E gene polymorphisms are associated with age-related hearing loss in a cohort of 265 elderly volunteers. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  16. Exploring single nucleotide polymorphisms previously related to obesity and metabolic traits in pediatric-onset type 2 diabetes.

    PubMed

    Miranda-Lora, América Liliana; Cruz, Miguel; Aguirre-Hernández, Jesús; Molina-Díaz, Mario; Gutiérrez, Jorge; Flores-Huerta, Samuel; Klünder-Klünder, Miguel

    2017-07-01

    To evaluate the association of 64 obesity-related polymorphisms with pediatric-onset type 2 diabetes and other glucose- and insulin-related traits in Mexican children. Case-control and case-sibling designs were followed. We studied 99 patients with pediatric-onset type 2 diabetes, their siblings (n = 101) without diabetes, 83 unrelated pediatric controls and 137 adult controls. Genotypes were determined for 64 single nucleotide polymorphisms, and a possible association was examined between those genotypes and type 2 diabetes and other quantitative traits, after adjusting for age, sex and body mass index. In the case-pediatric control and case-adult control analyses, five polymorphisms were associated with increased likelihood of pediatric-onset type 2 diabetes; only one of these polymorphisms (CADM2/rs1307880) also showed a consistent effect in the case-sibling analysis. The associations in the combined analysis were as follows: ADORA1/rs903361 (OR 1.9, 95% CI 1.2; 3.0); CADM2/rs13078807 (OR 2.2, 95% CI 1.2; 4.0); GNPDA2/rs10938397 (OR 2.2, 95% CI 1.4; 3.7); VEGFA/rs6905288 (OR 1.4, 95% CI 1.1; 2.1) and FTO/rs9939609 (OR 1.8, 95% CI 1.0; 3.2). We also identified 16 polymorphisms nominally associated with quantitative traits in participants without diabetes. ADORA/rs903361, CADM2/rs13078807, GNPDA2/rs10938397, VEGFA/rs6905288 and FTO/rs9939609 are associated with an increased risk of pediatric-onset type 2 diabetes in the Mexican population.

  17. Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

    PubMed

    Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

    2015-09-15

    Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Polymorphisms in the microglial marker molecule CX3CR1 affect the blood volume of the human brain.

    PubMed

    Sakai, Mai; Takeuchi, Hikaru; Yu, Zhiqian; Kikuchi, Yoshie; Ono, Chiaki; Takahashi, Yuta; Ito, Fumiaki; Matsuoka, Hiroo; Tanabe, Osamu; Yasuda, Jun; Taki, Yasuyuki; Kawashima, Ryuta; Tomita, Hiroaki

    2018-06-01

    CX3CR1, a G-protein-coupled receptor, is involved in various inflammatory processes. Two non-synonymous single nucleotide polymorphisms, V249I (rs3732379) and T280M (rs3732378), are located in the sixth and seventh transmembrane domains of the CX3CR1 protein, respectively. Previous studies have indicated significant associations between T280M and leukocyte functional characteristics, including adhesion, signaling, and chemotaxis, while the function of V249I is unclear. In the brain, microglia are the only proven and widely accepted CX3CR1-expressing cells. This study aimed to specify whether there were specific brain regions on which these two single nucleotide polymorphisms exert their biological impacts through their functional effects on microglia. Associations between the single nucleotide polymorphisms and brain characteristics, including gray and white matter volumes, white matter integrity, resting arterial blood volume, and cerebral blood flow, were evaluated among 1300 healthy Japanese individuals. The major allele carriers (V249 and T280) were significantly associated with an increased total arterial blood volume of the whole brain, especially around the bilateral precuneus, left posterior cingulate cortex, and left posterior parietal cortex. There were no significant associations between the genotypes and other brain structural indicators. This finding suggests that the CX3CR1 variants may affect arterial structures in the brain, possibly via interactions between microglia and brain microvascular endothelial cells. © 2018 The Authors. Psychiatry and Clinical Neurosciences © 2018 Japanese Society of Psychiatry and Neurology.

  19. Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

    PubMed

    Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

    2015-09-25

    ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

  20. Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.

    PubMed

    Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E

    2014-02-01

    The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.

  1. Genetic polymorphisms and the risk of stroke after cardiac surgery.

    PubMed

    Grocott, Hilary P; White, William D; Morris, Richard W; Podgoreanu, Mihai V; Mathew, Joseph P; Nielsen, Dahlia M; Schwinn, Debra A; Newman, Mark F

    2005-09-01

    Stroke represents a significant cause of morbidity and mortality after cardiac surgery. Although the risk of stroke varies according to both patient and procedural factors, the impact of genetic variants on stroke risk is not well understood. Therefore, we tested the hypothesis that specific genetic polymorphisms are associated with an increased risk of stroke after cardiac surgery. Patients undergoing cardiac surgery utilizing cardiopulmonary bypass surgery were studied. DNA was isolated from preoperative blood and analyzed for 26 different single-nucleotide polymorphisms. Multivariable logistic regression modeling was used to determine the association of clinical and genetic characteristics with stroke. Permutation analysis was used to adjust for multiple comparisons inherent in genetic association studies. A total of 1635 patients experiencing 28 strokes (1.7%) were included in the final genetic model. The combination of the 2 minor alleles of C-reactive protein (CRP; 3'UTR 1846C/T) and interleukin-6 (IL-6; -174G/C) polymorphisms, occurring in 583 (35.7%) patients, was significantly associated with stroke (odds ratio, 3.3; 95% CI, 1.4 to 8.1; P=0.0023). In a multivariable logistic model adjusting for age, the CRP and IL-6 single-nucleotide polymorphism combination remained significantly associated with stroke (P=0.0020). We demonstrate that common genetic variants of CRP (3'UTR 1846C/T) and IL-6 (-174G/C) are significantly associated with the risk of stroke after cardiac surgery, suggesting a pivotal role of inflammation in post-cardiac surgery stroke.

  2. The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsugu, H.; Horowitz, R.; Gibson, N.

    1994-12-01

    Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

  3. Association between ADAM metallopeptidase domain 33 gene polymorphism and risk of childhood asthma: a meta-analysis.

    PubMed

    Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B

    2017-08-31

    This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.

  4. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass.

    PubMed

    Zillikens, M Carola; Demissie, Serkalem; Hsu, Yi-Hsiang; Yerges-Armstrong, Laura M; Chou, Wen-Chi; Stolk, Lisette; Livshits, Gregory; Broer, Linda; Johnson, Toby; Koller, Daniel L; Kutalik, Zoltán; Luan, Jian'an; Malkin, Ida; Ried, Janina S; Smith, Albert V; Thorleifsson, Gudmar; Vandenput, Liesbeth; Hua Zhao, Jing; Zhang, Weihua; Aghdassi, Ali; Åkesson, Kristina; Amin, Najaf; Baier, Leslie J; Barroso, Inês; Bennett, David A; Bertram, Lars; Biffar, Rainer; Bochud, Murielle; Boehnke, Michael; Borecki, Ingrid B; Buchman, Aron S; Byberg, Liisa; Campbell, Harry; Campos Obanda, Natalia; Cauley, Jane A; Cawthon, Peggy M; Cederberg, Henna; Chen, Zhao; Cho, Nam H; Jin Choi, Hyung; Claussnitzer, Melina; Collins, Francis; Cummings, Steven R; De Jager, Philip L; Demuth, Ilja; Dhonukshe-Rutten, Rosalie A M; Diatchenko, Luda; Eiriksdottir, Gudny; Enneman, Anke W; Erdos, Mike; Eriksson, Johan G; Eriksson, Joel; Estrada, Karol; Evans, Daniel S; Feitosa, Mary F; Fu, Mao; Garcia, Melissa; Gieger, Christian; Girke, Thomas; Glazer, Nicole L; Grallert, Harald; Grewal, Jagvir; Han, Bok-Ghee; Hanson, Robert L; Hayward, Caroline; Hofman, Albert; Hoffman, Eric P; Homuth, Georg; Hsueh, Wen-Chi; Hubal, Monica J; Hubbard, Alan; Huffman, Kim M; Husted, Lise B; Illig, Thomas; Ingelsson, Erik; Ittermann, Till; Jansson, John-Olov; Jordan, Joanne M; Jula, Antti; Karlsson, Magnus; Khaw, Kay-Tee; Kilpeläinen, Tuomas O; Klopp, Norman; Kloth, Jacqueline S L; Koistinen, Heikki A; Kraus, William E; Kritchevsky, Stephen; Kuulasmaa, Teemu; Kuusisto, Johanna; Laakso, Markku; Lahti, Jari; Lang, Thomas; Langdahl, Bente L; Launer, Lenore J; Lee, Jong-Young; Lerch, Markus M; Lewis, Joshua R; Lind, Lars; Lindgren, Cecilia; Liu, Yongmei; Liu, Tian; Liu, Youfang; Ljunggren, Östen; Lorentzon, Mattias; Luben, Robert N; Maixner, William; McGuigan, Fiona E; Medina-Gomez, Carolina; Meitinger, Thomas; Melhus, Håkan; Mellström, Dan; Melov, Simon; Michaëlsson, Karl; Mitchell, Braxton D; Morris, Andrew P; Mosekilde, Leif; Newman, Anne; Nielson, Carrie M; O'Connell, Jeffrey R; Oostra, Ben A; Orwoll, Eric S; Palotie, Aarno; Parker, Stephen C J; Peacock, Munro; Perola, Markus; Peters, Annette; Polasek, Ozren; Prince, Richard L; Räikkönen, Katri; Ralston, Stuart H; Ripatti, Samuli; Robbins, John A; Rotter, Jerome I; Rudan, Igor; Salomaa, Veikko; Satterfield, Suzanne; Schadt, Eric E; Schipf, Sabine; Scott, Laura; Sehmi, Joban; Shen, Jian; Soo Shin, Chan; Sigurdsson, Gunnar; Smith, Shad; Soranzo, Nicole; Stančáková, Alena; Steinhagen-Thiessen, Elisabeth; Streeten, Elizabeth A; Styrkarsdottir, Unnur; Swart, Karin M A; Tan, Sian-Tsung; Tarnopolsky, Mark A; Thompson, Patricia; Thomson, Cynthia A; Thorsteinsdottir, Unnur; Tikkanen, Emmi; Tranah, Gregory J; Tuomilehto, Jaakko; van Schoor, Natasja M; Verma, Arjun; Vollenweider, Peter; Völzke, Henry; Wactawski-Wende, Jean; Walker, Mark; Weedon, Michael N; Welch, Ryan; Wichmann, H-Erich; Widen, Elisabeth; Williams, Frances M K; Wilson, James F; Wright, Nicole C; Xie, Weijia; Yu, Lei; Zhou, Yanhua; Chambers, John C; Döring, Angela; van Duijn, Cornelia M; Econs, Michael J; Gudnason, Vilmundur; Kooner, Jaspal S; Psaty, Bruce M; Spector, Timothy D; Stefansson, Kari; Rivadeneira, Fernando; Uitterlinden, André G; Wareham, Nicholas J; Ossowski, Vicky; Waterworth, Dawn; Loos, Ruth J F; Karasik, David; Harris, Tamara B; Ohlsson, Claes; Kiel, Douglas P

    2017-07-19

    Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray absorptiometry or bioelectrical impedance analysis, adjusted for sex, age, height, and fat mass. Twenty-one single-nucleotide polymorphisms were significantly associated with lean body mass either genome wide (p < 5 × 10 -8 ) or suggestively genome wide (p < 2.3 × 10 -6 ). Replication in 63,475 (47,227 of European ancestry) individuals from 33 cohorts for whole body lean body mass and in 45,090 (42,360 of European ancestry) subjects from 25 cohorts for appendicular lean body mass was successful for five single-nucleotide polymorphisms in/near HSD17B11, VCAN, ADAMTSL3, IRS1, and FTO for total lean body mass and for three single-nucleotide polymorphisms in/near VCAN, ADAMTSL3, and IRS1 for appendicular lean body mass. Our findings provide new insight into the genetics of lean body mass.Lean body mass is a highly heritable trait and is associated with various health conditions. Here, Kiel and colleagues perform a meta-analysis of genome-wide association studies for whole body lean body mass and find five novel genetic loci to be significantly associated.

  5. Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

    USDA-ARS?s Scientific Manuscript database

    Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

  6. Impact of Genetic Polymorphisms on 6-Thioguanine Nucleotide Levels and Toxicity in Pediatric Patients with IBD Treated with Azathioprine.

    PubMed

    Lee, Mi-Na; Kang, Ben; Choi, So Yoon; Kim, Mi Jin; Woo, Sook Young; Kim, Jong-Won; Choe, Yon Ho; Lee, Soo-Youn

    2015-12-01

    Thiopurine-related toxicity results in discontinuation of therapy in up to 30% of patients with inflammatory bowel disease. Although thiopurine S-methyltransferase (TPMT) is implicated in toxicity, not all toxicity can be attributed to TPMT polymorphisms. We investigated the effects of polymorphisms of genes involved in thiopurine and folate metabolism pathways on 6-thioguanine nucleotide levels and toxicity. Retrospective clinical data and blood samples were collected from 132 pediatric patients with inflammatory bowel disease treated with azathioprine. Eighty-seven genetic polymorphisms of 30 genes were screened using the MassARRAY system, and 70 polymorphisms of 28 genes were selected for further analysis. TPMT genotype (P < 0.001), concurrent use of mesalazine (P = 0.006), ABCC5 (rs2293001) (P < 0.001), ITPA (rs2236206 and rs8362) (P = 0.010 and P = 0.003), and ABCB1 (rs2032582) (P = 0.028) were all associated with the ratio of 6-thioguanine nucleotides to azathioprine dose. ADK (rs10824095) (P = 0.004, odds ratio [OR] = 6.220), SLC29A1 (rs747199) (P = 0.016, OR = 5.681), and TYMS (rs34743033) (P = 0.045, OR = 3.846) were associated with neutropenia. ABCC1 (rs2074087) (P = 0.022, OR = 3.406), IMPDH1 (rs2278294) (P = 0.027, OR = 0.276), and IMPDH2 (rs11706052) (P = 0.034, OR = 3.639) had a significant impact on lymphopenia. This study describes genetic polymorphisms in genes whose products may affect pharmacokinetics and which may predict the relative likelihood of benefit or risk from thiopurine treatment. These findings may serve as a basis for personalized thiopurine therapy in pediatric patients with inflammatory bowel disease, although our data need to be validated in further studies.

  7. Functional Analysis of a Novel Genome-Wide Association Study Signal in SMAD3 That Confers Protection From Coronary Artery Disease.

    PubMed

    Turner, Adam W; Martinuk, Amy; Silva, Anada; Lau, Paulina; Nikpay, Majid; Eriksson, Per; Folkersen, Lasse; Perisic, Ljubica; Hedin, Ulf; Soubeyrand, Sebastien; McPherson, Ruth

    2016-05-01

    A recent genome-wide association study meta-analysis identified an intronic single nucleotide polymorphism in SMAD3, rs56062135C>T, the minor allele (T) which associates with protection from coronary artery disease. Relevant to atherosclerosis, SMAD3 is a key contributor to transforming growth factor-β pathway signaling. Here, we seek to identify ≥1 causal coronary artery disease-associated single nucleotide polymorphisms at the SMAD3 locus and characterize mechanisms whereby the risk allele(s) contribute to coronary artery disease risk. By genetic and epigenetic fine mapping, we identified a candidate causal single nucleotide polymorphism rs17293632C>T (D', 0.97; r(2), 0.94 with rs56062135) in intron 1 of SMAD3 with predicted functional effects. We show that the sequence encompassing rs17293632 acts as a strong enhancer in human arterial smooth muscle cells. The common allele (C) preserves an activator protein (AP)-1 site and enhancer function, whereas the protective (T) allele disrupts the AP-1 site and significantly reduces enhancer activity (P<0.001). Pharmacological inhibition of AP-1 activity upstream demonstrates that this allele-specific enhancer effect is AP-1 dependent (P<0.001). Chromatin immunoprecipitation experiments reveal binding of several AP-1 component proteins with preferential binding to the (C) allele. We show that rs17293632 is an expression quantitative trait locus for SMAD3 in blood and atherosclerotic plaque with reduced expression of SMAD3 in carriers of the protective allele. Finally, siRNA knockdown of SMAD3 in human arterial smooth muscle cells increases cell viability, consistent with an antiproliferative role. The coronary artery disease-associated rs17293632C>T single nucleotide polymorphism represents a novel functional cis-acting element at the SMAD3 locus. The protective (T) allele of rs17293632 disrupts a consensus AP-1 binding site in a SMAD3 intron 1 enhancer, reduces enhancer activity and SMAD3 expression, altering human arterial smooth muscle cell proliferation. © 2016 American Heart Association, Inc.

  8. Uncovering drug-responsive regulatory elements

    PubMed Central

    Luizon, Marcelo R; Ahituv, Nadav

    2015-01-01

    Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

  9. Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

    PubMed

    Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

    2017-04-04

    Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

  10. EIF3G is associated with narcolepsy across ethnicities.

    PubMed

    Holm, Anja; Lin, Ling; Faraco, Juliette; Mostafavi, Sara; Battle, Alexis; Zhu, Xiaowei; Levinson, Douglas F; Han, Fang; Gammeltoft, Steen; Jennum, Poul; Mignot, Emmanuel; Kornum, Birgitte R

    2015-11-01

    Type 1 narcolepsy, an autoimmune disease affecting hypocretin (orexin) neurons, is strongly associated with HLA-DQB1*06:02. Among polymorphisms associated with the disease is single-nucleotide polymorphism rs2305795 (c.*638G>A) located within the P2RY11 gene. P2RY11 is in a region of synteny conserved in mammals and zebrafish containing PPAN, EIF3G and DNMT1 (DNA methyltransferase 1). As mutations in DNMT1 cause a rare dominant form of narcolepsy in association with deafness, cerebellar ataxia and dementia, we questioned whether the association with P2RY11 in sporadic narcolepsy could be secondary to linkage disequilibrium with DNMT1. Based on genome-wide association data from two cohorts of European and Chinese ancestry, we found that the narcolepsy association signal drops sharply between P2RY11/EIF3G and DNMT1, suggesting that the association with narcolepsy does not extend into the DNMT1 gene region. Interestingly, using transethnic mapping, we identified a novel single-nucleotide polymorphism rs3826784 (c.596-260A>G) in the EIF3G gene also associated with narcolepsy. The disease-associated allele increases EIF3G mRNA expression. EIF3G is located in the narcolepsy risk locus and EIF3G expression correlates with PPAN and P2RY11 expression. This suggests shared regulatory mechanisms that might be affected by the polymorphism and are of relevance to narcolepsy.

  11. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  12. Association between genetic polymorphisms in the XRCC1, XRCC3, XPD, GSTM1, GSTT1, MSH2, MLH1, MSH3, and MGMT genes and radiosensitivity in breast cancer patients.

    PubMed

    Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca; Sani, Cristina; Biti, Giampaolo; Livi, Lorenzo; Barletta, Emanuela; Costantini, Adele Seniori; Gorini, Giuseppe

    2011-09-01

    Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Individual genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR=53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR=38.26; 95% CI, 1.19-1232.52). To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. A Family-Based Association Study of CYP11A1 and CYP11B1 Gene Polymorphisms With Autism in Chinese Trios.

    PubMed

    Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing

    2016-05-01

    Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,P< .001). Our findings provide further support for the hypothesis that a susceptibility gene for autism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.

  14. [Association of single nucleotide polymorphism at interleukin-10 gene 1082 nt with the risk of gastric cancer in Chinese population].

    PubMed

    Zhou, Shao-zhang; Zhu, Wei-liang; Li, Ming-ying; Li, Hong-yi; Zhang, Ji-ren

    2008-08-01

    To study the association of single nucleotide polymorphism at interleukin-10 gene 1082 locus with Helicobacter pylori (Hp) infection and the risk of gastric cancer in high prevalent region (Shaanxi Province)aand low prevalence region (Guangdong Province) in China. The genomic DNA was extracted from the peripheral blood of 104 healthy individuals, 104 gastric cancer patients from Guangdong Province, and from 102 healthy volunteers and 102 gastric cancer patients in Shaanxi Province, China. The single nucleotide polymorphism at IL-10 gene 1082 locus was analyzed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The serum levels of anit-Hp IgG was measured by enzyme-linked immunosorbent assay. The frequencies of IL-10-1082 A/A, A/G and G/G genotypes in the 412 subjects were 86.7%, 10.7% and 2.4%, respectively. In the low prevalence region, the number of carriers of IL-10-1082 G* was much greater in the cancer patients than in the healthy controls (14.4% vs 7.7%, Chi2=4.02, P<0.05, OR=1.01, 95% CI=1.08-3.10). The presence of IL-10-1082 G* was associated with significantly increased risk of gastric cancer following Hp infection (Chi(2)=5.36, P<0.05, OR=6.0, 95% CI=1.23-17.52). In the high prevalence region, the frequency of IL-10-1082 G* was slightly higher among the cancer patients than in the healthy controls, but this difference was not statistically significant (12.7% vs 16.6%, P>0.05). The G* genotype of IL-10 gene 1082 locus may be associated with increased risk of gastric cancer in China.

  15. Promoter Polymorphism G-6A, which Modulates Angiotensinogen Gene Expression, Is Associated with Non-Familial Sick Sinus Syndrome

    PubMed Central

    Chen, Jan-Yow; Liou, Ying-Ming; Wu, Hong-Dar Isaac; Lin, Kuo-Hung; Chang, Kuan-Cheng

    2012-01-01

    Background It is well known that familial sick sinus syndrome (SSS) is caused by functional alterations of ion channels and gap junction. Limited information is available on the mechanism of age-related non-familial SSS. Although evidence shows a close link between arrhythmia and the renin-angiotensin system (RAS), it remains to be determined whether the RAS is involved in the pathogenesis of non-familial SSS. Methods In this study, 113 patients with documented non-familial SSS and 125 controls were screened for angiotensinogen (AGT) and gap junction protein-connexin 40 (Cx40) promoter polymorphisms by gene sequencing, followed by an association study. A luciferase assay was used to determine the transcriptional activity of the promoter polymorphism. The interaction between nuclear factors and the promoter polymorphism was characterized by an electrophoretic mobility shift assay (EMSA). Results Association study showed the Cx40 -44/+71 polymorphisms are not associated with non-familial SSS; however, it indicated that four polymorphic sites at positions -6, -20, -152, and -217 in the AGT promoter are linked to non-familial SSS. Compared to controls, SSS patients had a lower frequency of the G-6A AA genotype (OR 2.88, 95% CI 1.58–5.22, P = 0.001) and a higher frequency of the G allele at -6 position (OR 2.65, 95% CI 1.54–4.57, P = 0.0003). EMSA and luciferase assays confirmed that nucleotide G at position -6 modulates the binding affinity with nuclear factors and yields a lower transcriptional activity than nucleotide A (P<0.01). Conclusion G-6A polymorphism, which modulates the transcriptional activity of the AGT promoter, may contribute to non-familial SSS susceptibility. PMID:22242192

  16. Genetic Associations With White Matter Hyperintensities Confer Risk of Lacunar Stroke

    PubMed Central

    Rutten-Jacobs, Loes C.A.; Thijs, Vincent; Holliday, Elizabeth G.; Levi, Chris; Bevan, Steve; Malik, Rainer; Boncoraglio, Giorgio; Sudlow, Cathie; Rothwell, Peter M.; Dichgans, Martin; Markus, Hugh S.

    2016-01-01

    Background and Purpose— White matter hyperintensities (WMH) are increased in patients with lacunar stroke. Whether this is because of shared pathogenesis remains unknown. Using genetic data, we evaluated whether WMH-associated genetic susceptibility factors confer risk of lacunar stroke, and therefore whether they share pathogenesis. Methods— We used a genetic risk score approach to test whether single nucleotide polymorphisms associated with WMH in community populations were associated with magnetic resonance imaging–confirmed lacunar stroke (n=1,373), as well as cardioembolic (n=1,331) and large vessel (n=1,472) Trial of Org 10172 in Acute Stroke Treatment subtypes, against 9,053 controls. Second, we separated lacunar strokes into those with WMH (n=568) and those without (n=787) and tested for association with the risk score in these 2 groups. In addition, we evaluated whether WMH-associated single nucleotide polymorphisms are associated with lacunar stroke, or in the 2 groups. Results— The WMH genetic risk score was associated with lacunar stroke (odds ratio [OR; 95% confidence interval [CI

  17. No association of the neuropeptide Y (Leu7Pro) and ghrelin gene (Arg51Gln, Leu72Met, Gln90Leu) single nucleotide polymorphisms with eating disorders.

    PubMed

    Kindler, Jochen; Bailer, Ursula; de Zwaan, Martina; Fuchs, Karoline; Leisch, Friedrich; Grün, Bettina; Strnad, Alexandra; Stojanovic, Mirjana; Windisch, Julia; Lennkh-Wolfsberg, Claudia; El-Giamal, Nadja; Sieghart, Werner; Kasper, Siegfried; Aschauer, Harald

    2011-06-01

    Genetic factors likely contribute to the biological vulnerability of eating disorders. Case-control association study on one neuropeptide Y gene (Leu7Pro) polymorphism and three ghrelin gene (Arg51Gln, Leu72Met and Gln90Leu) polymorphisms. 114 eating disorder patients (46 with anorexia nervosa, 30 with bulimia nervosa, 38 with binge eating disorder) and 164 healthy controls were genotyped. No differences were detected between patients and controls for any of the four polymorphisms in allele frequency and genotype distribution (P > 0.05). Allele frequencies and genotypes had no significant influence on body mass index (P > 0.05) in eating disorder patients. Positive findings of former case-control studies of associations between ghrelin gene polymorphisms and eating disorders could not be replicated. Neuropeptide Y gene polymorphisms have not been investigated in eating disorders before.

  18. Using PCR-RFLP Technology to Teach Single Nucleotide Polymorphism for Undergraduates

    ERIC Educational Resources Information Center

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a…

  19. Association of a single nucleotide polymorphism in the akirin 2 gene with economically important traits in Korean native cattle.

    PubMed

    Kim, H; Lee, S K; Hong, M W; Park, S R; Lee, Y S; Kim, J W; Lee, H K; Jeong, D K; Song, Y H; Lee, S J

    2013-12-01

    The akirin 2 gene, located on chromosome 9 in cattle, was previously reported to be associated with nuclear factor-kappa B (NF-κB), involved in immune reactions and marbling of meat. To determine whether a single nucleotide polymorphism (SNP) in akirin 2 is associated with economically important traits of Korean native cattle, the c.*188G>A SNP DNA marker in the 3'-UTR region of akirin 2 was analyzed for its association with carcass weight, longissimus muscle area and marbling. The c.*188G>A SNP was genotyped by polymerase chain reaction restriction fragment length polymorphism, and the frequency of the AA, AG, and GG genotypes were 6.82%, 71.29% and 21.88% respectively. This SNP was significantly associated with longissimus muscle area (Bonferroni corrected P < 0.05), and marbling score (Bonferroni corrected P < 0.01). These results suggest that the c.*188G>A SNP of akirin 2 might be useful as a DNA marker for longissimus muscle area and marbling scores in Korean native cattle. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  20. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

    PubMed

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

    2014-05-09

    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

  1. Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

    PubMed

    García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

    2017-12-01

    Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

  2. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

    PubMed

    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

    2016-01-01

    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

  3. TERT rs2736098 polymorphism and cancer risk: results of a meta-analysis.

    PubMed

    Qi, Hao-Yu; Zou, Peng; Zhao, Lin; Zhu, Jue; Gu, Ai-Hua

    2012-01-01

    Several studies have demonstrated associations between the TERT rs2736098 single nucleotide polymorphisms (SNPs) and susceptibility to cancer development. However, there are conflicting results. A systematic meta-analysis was therefore performed to establish the cancer risk associated with the polymorphism. In this meta-analysis, a total of 6 case-control studies, including 5,567 cases and 6,191 controls, were included. Crude odds ratios with 95% confidence intervals were used to assess the strength of associations in several genetic models. Our results showed no association reaching the level of statistical significance for overall risk. Interestingly, in the stratified analyses (subdivided by ethnicity), significantly increased risks were found in the Asian subgroup which indicates the TERT rs2736098 polymorphism may have controversial involvement in cancer susceptibility. Overall, this meta-analysis indicates that the TERT rs2736098 polymorphism may have little involvement in cancer susceptibility.

  4. Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

    2010-12-01

    Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

  5. [Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

    PubMed

    Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

    2008-07-01

    Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (P<0.01) and significant association with wool yield in site C (P<0.05). It was concluded from the results that FGF5 gene could be the potential major gene affecting wool yield or link with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

  6. Polymorphism of LRP5, but not of TNFRSF11B, is associated with a decrease in bone mineral density in postmenopausal Maya-Mestizo women.

    PubMed

    Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

    2013-01-01

    Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.

  7. Unique CD44 intronic SNP is associated with tumor grade in breast cancer: a case control study and in silico analysis.

    PubMed

    Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan

    2018-01-01

    CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca

    Purpose: Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Methods and Materials: Individualmore » genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Results: Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR = 53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR = 38.26; 95% CI, 1.19-1232.52). Conclusions: To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings.« less

  9. Effects of the BDNF Val66Met Polymorphism on Anxiety-Like Behavior Following Nicotine Withdrawal in Mice

    PubMed Central

    Lee, Bridgin G.; Anastasia, Agustin; Hempstead, Barbara L.; Lee, Francis S.

    2015-01-01

    Introduction: Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. Methods: This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNFMet/Met) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Results: Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNFMet/Met mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNFMet/Met mice; and (3) an increase in BDNF prodomain in BDNFMet/Met mice following nicotine withdrawal. Conclusions: Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNFMet/Met mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. PMID:25744957

  10. Atrial Fibrillation Genetic Risk and Ischemic Stroke Mechanisms.

    PubMed

    Lubitz, Steven A; Parsons, Owen E; Anderson, Christopher D; Benjamin, Emelia J; Malik, Rainer; Weng, Lu-Chen; Dichgans, Martin; Sudlow, Cathie L; Rothwell, Peter M; Rosand, Jonathan; Ellinor, Patrick T; Markus, Hugh S; Traylor, Matthew

    2017-06-01

    Atrial fibrillation (AF) is a leading cause of cardioembolic stroke, but the relationship between AF and noncardioembolic stroke subtypes are unclear. Because AF may be unrecognized, and because AF has a substantial genetic basis, we assessed for predisposition to AF across ischemic stroke subtypes. We examined associations between AF genetic risk and Trial of Org 10172 in Acute Stroke Treatment stroke subtypes in 2374 ambulatory individuals with ischemic stroke and 5175 without from the Wellcome Trust Case-Control Consortium 2 using logistic regression. We calculated AF genetic risk scores using single-nucleotide polymorphisms associated with AF in a previous independent analysis across a range of preselected significance thresholds. There were 460 (19.4%) individuals with cardioembolic stroke, 498 (21.0%) with large vessel, 474 (20.0%) with small vessel, and 814 (32.3%) individuals with strokes of undetermined cause. Most AF genetic risk scores were associated with stroke, with the strongest association ( P =6×10 - 4 ) attributed to scores of 944 single-nucleotide polymorphisms (each associated with AF at P <1×10 - 3 in a previous analysis). Associations between AF genetic risk and stroke were enriched in the cardioembolic stroke subset (strongest P =1.2×10 - 9 , 944 single-nucleotide polymorphism score). In contrast, AF genetic risk was not significantly associated with noncardioembolic stroke subtypes. Comprehensive AF genetic risk scores were specific for cardioembolic stroke. Incomplete workups and subtype misclassification may have limited the power to detect associations with strokes of undetermined pathogenesis. Future studies are warranted to determine whether AF genetic risk is a useful biomarker to enhance clinical discrimination of stroke pathogeneses. © 2017 American Heart Association, Inc.

  11. New genetic variants associated with prostate cancer

    Cancer.gov

    Researchers have newly identified 23 common genetic variants -- one-letter changes in DNA known as single-nucleotide polymorphisms or SNPs -- that are associated with risk of prostate cancer. These results come from an analysis of more than 10 million SNP

  12. Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

    PubMed Central

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

  13. Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

    PubMed

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

  14. Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study

    PubMed Central

    Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjuan; Li, Shanqu

    2015-01-01

    Background Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. Material/Methods In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Results Using the χ2 test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes “CC” of rs2297440 and “GG” of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Conclusions Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population. PMID:26156397

  15. Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study.

    PubMed

    Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjun; Li, Shanqu

    2015-07-09

    Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Using the χ(2) test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes "CC" of rs2297440 and "GG" of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population.

  16. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  17. Associations of polymorphisms in the Pit-1 gene with growth and carcass traits in Angus beef cattle.

    PubMed

    Zhao, Q; Davis, M E; Hines, H C

    2004-08-01

    The Pit-1 gene was studied as a candidate for genetic markers of growth and carcass traits. Angus beef cattle that were divergently selected for high- or low-blood serum IGF-I concentration were used in this study. The single-strand conformation polymorphism method was used to identify polymorphism in the Pit-1 gene including regions from intron 2 to exon 6. Two polymorphisms, Pit1I3H (HinfI) and Pit1I3NL (NlaIII), were detected in intron 3 of the Pit-1 gene. One polymorphism, Pit1I4N (BstNI), was found in intron 4, and a single nucleotide polymorphism, Pit1I5, was found in intron 5. The previously reported polymorphism in exon 6, Pit1E6H (HinfI), was also studied in 416 Angus beef cattle. Associations of the polymorphisms with growth traits, carcass traits, and IGF-I concentration were analyzed using a general linear model procedure. No significant associations were observed between these polymorphisms and growth and carcass traits.

  18. Genetic associations with lipoprotein subfraction measures differ by ethnicity in the multi-ethnic study of atherosclerosis (MESA)

    USDA-ARS?s Scientific Manuscript database

    A recent genome-wide association study associated 62 single nucleotide polymorphisms (SNPs) from 43 genomic loci, with fasting lipoprotein subfractions in European–Americans (EAs) at genome-wide levels of significance across three independent samples. Whether these associations are consistent across...

  19. Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.

    PubMed

    Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao

    2017-02-07

    Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.

  20. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

    PubMed

    Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

    2014-01-01

    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

  1. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    PubMed

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  2. Genome-environment associations in sorghum landraces predict adaptive traits

    USDA-ARS?s Scientific Manuscript database

    Improving environmental adaptation in crops is essential for food security under global change, but phenotyping adaptive traits remains a major bottleneck. If associations between single-nucleotide polymorphism (SNP) alleles and environment of origin in crop landraces reflect adaptation, then these ...

  3. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

    PubMed

    Khrustaleva, A M; Gritsenko, O F; Klovach, N V

    2013-11-01

    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

  4. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    PubMed

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  5. Promoter polymorphism at the tumour necrosis factor/lymphotoxin-alpha locus is associated with type of diabetes but not with susceptibility to sight-threatening diabetic retinopathy.

    PubMed

    Kaidonis, Georgia; Craig, Jamie E; Gillies, Mark C; Abhary, Sotoodeh; Essex, Rohan W; Chang, John H; Pal, Bishwanath; Pefkianaki, Maria; Daniell, Mark; Lake, Stewart; Petrovsky, Nikolai; Burdon, Kathryn P

    2016-03-01

    To investigate, in a large cohort of 2494 individuals with diabetes mellitus, whether functional single nucleotide polymorphisms in the promoter region of tumour necrosis factor (TNF) and lymphotoxin-alpha (LTA) genes are associated with type of diabetes or presence of diabetic retinopathy. A total of 334 type 1 diabetes and 999 type 2 diabetes participants with sight-threatening diabetic retinopathy, and 260 type 1 diabetes and 901 type 2 diabetes participants with no diabetic retinopathy or minimal non-proliferative diabetic retinopathy, were genotyped for two single nucleotide polymorphisms (rs1800629 and rs361525). The A allele of rs1800629 was associated with type 1 diabetes (p < 0.001; odds ratio = 0.62). After adjustment for age, sex, diabetes duration, HbA1c, hypertension and nephropathy, no significant association was found between rs1800629 or rs361525 and sight-threatening diabetic retinopathy. An association between the A allele of rs1800629 and type of diabetes was found. No association was found between two promoter variants of TNF and LTA, and diabetic retinopathy in a large cohort of Caucasian patients with type 1 diabetes and type 2 diabetes. © The Author(s) 2016.

  6. Exploring genetic variants predisposing to diabetes mellitus and their association with indicators of socioeconomic status.

    PubMed

    Schmidt, Börge; Dragano, Nico; Scherag, André; Pechlivanis, Sonali; Hoffmann, Per; Nöthen, Markus M; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne

    2014-06-16

    The relevance of disease-related genetic variants for the explanation of social inequalities in complex diseases is unclear and empirical analyses are largely missing. The aim of our study was to examine whether genetic variants predisposing to diabetes mellitus are associated with socioeconomic status in a population-based cohort. We genotyped 11 selected diabetes-related single nucleotide polymorphisms in 4655 participants (age 45-75 years) of the Heinz Nixdorf Recall study. Diabetes status was self-reported or defined by blood glucose levels. Education, income and paternal occupation were assessed as indicators of socioeconomic status. Multiple regression analyses were used to examine the association of socioeconomic status and diabetes by estimating sex-specific and age-adjusted prevalence ratios and their corresponding 95%-confidence intervals. To explore the relationship between individual single nucleotide polymorphisms and socioeconomic status sex- and age-adjusted odds ratios were computed. We adjusted the alpha-level for multiple testing of 11 single nucleotide polymorphisms using Bonferroni's method (α(BF) ~ 0.005). In addition, we explored the association of a genetic risk score with socioeconomic status. Social inequalities in diabetes were observed for all indicators of socioeconomic status. However, there were no significant associations between individual diabetes-related risk alleles and socioeconomic status with odds ratios ranging from 0.87 to 1.23. Similarly, the genetic risk score analysis revealed no evidence for an association. Our data provide no evidence for an association between 11 diabetes-related risk alleles and different indicators of socioeconomic status in a population-based cohort, suggesting that the explored genetic variants do not contribute to health inequalities in diabetes.

  7. Single Nucleotide Polymorphism in ATM Gene, Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study

    PubMed Central

    Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen

    2014-01-01

    Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391

  8. Promoter polymorphisms of ST3GAL4 and ST6GAL1 genes and associations with risk of premalignant and malignant lesions of the cervix.

    PubMed

    Rivera-Juarez, Maria de Los Angeles; Rosas-Murrieta, Nora Hilda; Mendieta-Carmona, Victoriano; Hernandez-Pacheco, Raquel Esneidy; Zamora-Ginez, Irma; Rodea-Avila, Carlos; Apresa-Garcia, Teresa; Garay-Villar, Onix; Aguilar-Lemarroy, Adriana; Jave-Suarez, Luis Felipe; Diaz-Orea, Maria Alicia; Milflores-Flores, Lorena; Reyes-Salinas, Juan Salvador; Ceja-Utrera, Francisco Javier; Vazquez-Zamora, Victor Javier; Vargas-Maldonado, Tomas; Reyes-Carmona, Sandra; Sosa-Jurado, Francisca; Santos-Lopez, Gerardo; Reyes-Leyva, Julio; Vallejo-Ruiz, Veronica

    2014-01-01

    Sialyltransferase gene expression is altered in several cancers, including examples in the cervix. Transcriptional regulation of the responsible genes depends on different promoters. We aimed to determine the association of single-nucleotide polymorphisms in the B3 promoter of the ST3GAL4 gene and the P1 promoter of the ST6GAL1 gene with cervical premalignant lesions or cervical cancer. A blood sample and/or cervical scrapes were obtained from 104 women with normal cytology, 154 with premalignant lesions and 100 with cervical cancer. We also included 119 blood samples of random donors. The polymorphisms were identified by sequencing from PCR products. For the B3 promoter, a fragment of 506 bp (from nucleotide -408 to +98) was analyzed, and for the P1 promoter a 490 bp (-326 to +164) fragment. The polymorphism analysis showed that at SNP rs10893506, genotypes CC and CT of the ST3GAL4 B3 promoter were associated with the presence of premalignant lesions (OR=2.89; 95%CI 1.72-4.85) and cervical cancer (OR=2.23; 95%CI 1.27-3.91). We detected only one allele of each polymorphism in the ST6GAL1 P1 promoter. We did not detect any genetic variability in the P1 promoter region in our study population. Our results suggest that the rs10893506 polymorphism -22C/T may increase susceptibility to premalignant and malignant lesions of the cervix.

  9. Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

    PubMed

    Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

    2016-04-28

    The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

  10. [Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].

    PubMed

    Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo

    2012-06-01

    To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.

  11. Interaction of TLR-IFN and HLA polymorphisms on susceptibility of chronic HBV infection in Southwest Han Chinese.

    PubMed

    He, Dengming; Tao, Shiqi; Guo, Shimin; Li, Maoshi; Wu, Junqiu; Huang, Hongfei; Guo, Xinwu; Yan, Guohua; Zhu, Peng; Wang, Yuming

    2015-08-01

    The toll-like receptor-interferon (TLR-IFN) signalling pathway plays a crucial role in HBV infection. Human leucocyte antigen (HLA) polymorphisms are associated with chronic HBV infection by genome wide association study (GWAS). We aimed to explore interaction between TLR-IFN and HLA gene polymorphisms in susceptibility of chronic HBV infection. In the Chinese Southwest Han population, 1191 chronic HBV infection patients and 273 HBV clearance were selected. A total of 39 single nucleotide polymorphism loci in 23 genes of the TLR-IFN pathway and four HLA polymorphism loci associated with chronic HBV infection identified by GWAS were selected for genotyping. SNPStats, QVALUE, and multifactor dimensionality reduction were used for statistical analysis. A significant association was seen in several of the TLR-IFN pathway genes, TLR9 rs352140 (OR = 0.70, P = 0.0088), IL1B rs16944 (OR = 0.67, P = 0.016), IL12B rs3212227 (OR = 1.38, P = 0.021), IFNGR1 rs3799488 (OR = 1.48, P = 0.0048), IFNGR2 rs1059293 (OR = 0.27, P = 0.011), MX1 rs467960 (OR = 0.68, P = 0.022), as well as four loci in HLA, rs3077 (OR = 0.55, P < 0.0001), rs2856718 (OR = 0.60, P = 4e-04), rs9277535 (OR = 0.54, P < 0.0001) and rs7453920 (OR = 0.43, P < 0.0001). A synergistic relationship was seen between rs9277535 and rs16944 (0.13%), rs1143623 and rs6613 (0.10%). The combination of rs9277535 in HLA and rs16944 in IL1B was the best model to predict chronic HBV infection (testing accuracy = 0.6040, P = 0.0010, cross-validation consistency = 10/10). TLR-IFN pathway gene polymorphisms are associated with chronic HBV infection. Interactions with polymorphisms in these genes may be one mechanism by which HLA polymorphisms influence susceptibility to chronic HBV infection, as specific single nucleotide polymorphism combinations are highly predictive of chronic HBV infection. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.

  12. Associations between a polymorphism in the hydroxysteroid (11-beta) dehydrogenase 1 gene, neuroticism and postpartum depression.

    PubMed

    Iliadis, S I; Comasco, E; Hellgren, C; Kollia, N; Sundström Poromaa, I; Skalkidou, A

    2017-01-01

    This study examined the association between a single nucleotide polymorphism in the hydroxysteroid (11-beta) dehydrogenase 1 gene and neuroticism, as well as the possible mediatory role of neuroticism in the association between the polymorphism and postpartum depressive symptoms. 769 women received questionnaires containing the Edinburgh Postnatal Depression Scale (EPDS) at six weeks postpartum and demographic data at pregnancy week 17 and 32 and at six weeks postpartum, as well as the Swedish universities Scales of Personality at pregnancy week 32. Linear regression models showed an association between the GG genotype and depressive symptoms. When neuroticism was introduced in the model, it was associated with EPDS score, whereas the association between the GG genotype and EPDS became borderline significant. A path analysis showed that neuroticism had a mediatory role in the association between the polymorphism and EPDS score. The use of the EPDS, which is a self-reporting instrument. Neuroticism was associated with the polymorphism and had a mediatory role in the association between the polymorphism and postpartum depression. This finding elucidates the genetic background of neuroticism and postpartum depression. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Marker-assisted backcross approach for important agronomic traits of sorghum

    USDA-ARS?s Scientific Manuscript database

    Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

  14. Association of N-acetyltransferase-2 and glutathione S-transferase polymorphisms with idiopathic male infertility in Vietnam male subjects.

    PubMed

    Trang, Nguyen Thi; Huyen, Vu Thi; Tuan, Nguyen Thanh; Phan, Tran Duc

    2018-04-25

    N-acetyltransferase-2 (NAT2) and Glutathione S-transferases (GSTs) are phase-II xenobiotic metabolizing enzymes participating in detoxification of toxic arylamines, aromatic amines, hydrazines and reactive oxygen species (ROS), which are produced under oxidative and electrophile stresses. The purpose of this research was to investigate whether two common single-nucleotide polymorphisms (SNP) of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) associated with susceptibility to idiopathic male infertility. A total 300 DNA samples (150 infertile patients and 150 healthy control) were genotyped for the polymorphisms by ARMS - PCR. We revealed a significant association between the NAT2 variant genotypes (CT + TT (rs1799929), (OR: 3.74; p < 0.001)) and (GA + AA (rs1799930), (OR: 3.75; p < 0.001)) or GSTP1 variant genotypes (GA + AA (rs1695), (OR: 5.11; p < 0,001)) and (CT + TT (rs1138272), (OR: 7.42; p < 0,001) with idiopathic infertility risk. Our findings rate the effect of single-nucleotide polymorphisms of GSTP1 and/or NAT2 in modulation of the risk of male infertility in subjects from Vietnam. This pilot study is the first (as far as we know) to reveal that polymorphisms of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) are some novel genetic markers for susceptibility to idiopathic male infertility. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Impact of vitamin D receptor gene polymorphisms in pathogenesis of Type-1 diabetes mellitus

    PubMed Central

    Kamel, Mahmoud M; Fouad, Shawky A; Salaheldin, Omina; El-Razek, Abd El-Rahman A Abd; El-Fatah, Abeer I Abd

    2014-01-01

    Background: Type 1 diabetes mellitus (TIDM) results from an immune-mediated destruction of insulin-producing-cells in the pancreatic islets of Langerhans. There are clear differences in immunogenetic predisposition to type1 diabetes among countries. Studies have indicated that vitamin D supplementation in early childhood decreases the risk of TIDM. Vitamin D exerts its action via the nuclear vitamin D receptor (VDR), which shows an extensive polymorphism. VDR gene polymorphisms have been associated with altered gene expression or gene function. Four single nucleotide polymorphisms (SNPs) in the VDR gene produce variation in four recognition sites. These recognition sites variants include Fok I, Bsm I, Apa I and Taq I. Aim of the study: TO investigate the relationship between VDR gene polymorphisms (at positions Taq I and Apa I) and the incidence of TIDM in Egyptian peoples. Subjects and methods: This study included 74 patients with type 1 DM in addition to 28 healthy age and sex matched control subjects. All of them were subjected to full history taking and clinical examination. Three ml of venous blood were withdrawn from each patient at fasting and postprandial times and used for genomic DNA extraction, estimation of Hb A1C, as well as, fasting and postprandial C-peptide and blood glucose levels. Results: Apa I recognition site was found in low frequency in diabetic patients (14/74) 18.9% while, its frequency was high (16/28) 57.1% among normal subjects. Taq I has two recognition sites. The first was found at nucleotide number 293 that was found in a frequency of (2/28) 7.1% in normal non-diabetic individuals while it was detected in (14/74) 18.9% in diabetic patients. The second Taq I recognition site was found at nucleotide number 494 without any differences between diabetic and normal individuals. Conclusion: This study indicates that there is an association between VDR genetic polymorphism and incidence of TIDM in Egyptian patients. PMID:25664062

  16. Genome wide association analysis for seedling response traits to thermal stress in sorghum germplasm

    USDA-ARS?s Scientific Manuscript database

    The sorghum association panel exhibited extensive variation for seedling traits under cold and heat stress. Genome-wide analyses identified thirty single nucleotide polymorphisms (SNPs) that were strongly associated with traits measured at seedling stage under cold stress and tagged genes that act a...

  17. Group B Streptococcus Infections Caused by Improper Sourcing and Handling of Fish for Raw Consumption, Singapore, 2015-2016.

    PubMed

    Chau, Man L; Chen, Swaine L; Yap, Min; Hartantyo, Sri H P; Chiew, Paul K T; Fernandez, Charlene J; Wong, Wai K; Fong, Rockey K; Tan, Wei L; Tan, Brian Z Y; Ng, Youming; Aung, Kyaw T; Mehershahi, Kurosh S; Goh, Christopher; Kang, Joanne S L; Barkham, Timothy; Leong, Adeline O K; Gutiérrez, Ramona A; Ng, Lee C

    2017-12-01

    We assessed microbial safety and quality of raw fish sold in Singapore during 2015-2016 to complement epidemiologic findings for an outbreak of infection with group B Streptococcus serotype III sequence type (ST) 283 associated with raw fish consumption. Fish-associated group B Streptococcus ST283 strains included strains nearly identical (0-2 single-nucleotide polymorphisms) with the human outbreak strain, as well as strains in another distinct ST283 clade (57-71 single-nucleotide polymorphisms). Our investigations highlight the risk for contamination of freshwater fish (which are handled and distributed separately from saltwater fish sold as sashimi) and the need for improved hygienic handling of all fish for raw consumption. These results have led to updated policy and guidelines regarding the sale of ready-to-eat raw fish dishes in Singapore.

  18. Niemann-Pick C1 modulates hepatic triglyceride metabolism and its genetic variation contributes to serum triglyceride levels.

    PubMed

    Uronen, Riikka-Liisa; Lundmark, Per; Orho-Melander, Marju; Jauhiainen, Matti; Larsson, Kristina; Siegbahn, Agneta; Wallentin, Lars; Zethelius, Björn; Melander, Olle; Syvänen, Ann-Christine; Ikonen, Elina

    2010-08-01

    To study how Niemann-Pick disease type C1 (NPC1) influences hepatic triacylglycerol (TG) metabolism and to determine whether this is reflected in circulating lipid levels. In Npc1(-/-) mice, the hepatic cholesterol content is increased but the TG content is decreased. We investigated lipid metabolism in Npc1(-/-) mouse hepatocytes and the association of NPC1 single-nucleotide polymorphisms with circulating TGs in humans. TGs were reduced in Npc1(-/-) mouse serum and hepatocytes. In Npc1(-/-) hepatocytes, the incorporation of [3H]oleic acid and [3H]acetate into TG was decreased, but shunting of oleic acid- or acetate-derived [3H]carbons into cholesterol was increased. Inhibition of cholesterol synthesis normalized TG synthesis, content, and secretion in Npc1(-/-) hepatocytes, suggesting increased hepatic cholesterol neogenesis as a cause for the reduced TG content and secretion. We found a significant association between serum TG levels and 5 common NPC1 single-nucleotide polymorphisms in a cohort of 1053 men, with the lowest P=8.7 x 10(-4) for the single-nucleotide polymorphism rs1429934. The association between the rs1429934 A allele and higher TG levels was replicated in 2 additional cohorts, which included 8041 individuals. This study provides evidence of the following: (1) in mice, loss of NPC1 function reduces hepatocyte TG content and secretion by increasing the metabolic flux of carbons into cholesterol synthesis; and (2) common variation in NPC1 contributes to serum TG levels in humans.

  19. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  20. Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

    PubMed

    Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

    2017-05-01

    Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

  1. Genetic discovery in Xylella fastidiosa through sequence analysis of selected randomly amplified polymorphic DNAs.

    PubMed

    Chen, Jianchi; Civerolo, Edwin L; Jarret, Robert L; Van Sluys, Marie-Anne; de Oliveira, Mariana C

    2005-02-01

    Xylella fastidiosa causes many important plant diseases including Pierce's disease (PD) in grape and almond leaf scorch disease (ALSD). DNA-based methodologies, such as randomly amplified polymorphic DNA (RAPD) analysis, have been playing key roles in genetic information collection of the bacterium. This study further analyzed the nucleotide sequences of selected RAPDs from X. fastidiosa strains in conjunction with the available genome sequence databases and unveiled several previously unknown novel genetic traits. These include a sequence highly similar to those in the phage family of Podoviridae. Genome comparisons among X. fastidiosa strains suggested that the "phage" is currently active. Two other RAPDs were also related to horizontal gene transfer: one was part of a broadly distributed cryptic plasmid and the other was associated with conjugal transfer. One RAPD inferred a genomic rearrangement event among X. fastidiosa PD strains and another identified a single nucleotide polymorphism of evolutionary value.

  2. Association between a polymorphism in the IL-12p40 gene and cytomegalovirus reactivation after kidney transplantation.

    PubMed

    Hoffmann, Thomas W; Halimi, Jean-Michel; Büchler, Mathias; Velge-Roussel, Florence; Goudeau, Alain; Al Najjar, Azmi; Boulanger, Marie-Denise; Houssaini, Tarik Sqalli; Marliere, Jean-Frédéric; Lebranchu, Yvon; Baron, Christophe

    2008-05-27

    Cytomegalovirus (CMV) infection is associated with a significant rate of morbidity after organ transplantation. The genetic factors influencing its occurrence have been little investigated. IL-12 plays a crucial role in anti-infectious immune responses, especially by stimulating IFNgamma production. An A-to-C single nucleotide polymorphism (SNP) within the 3'-untranslated region of the IL-12p40 gene has been characterized and was reported to be both functionally and clinically relevant. However, the impact of this single nucleotide polymorphism on events after organ transplantation has never been reported. In this study, we investigated the impact of the 3'-untranslated region polymorphism on the occurrence of CMV infection in 469 kidney recipients transplanted at the University Hospital of Tours between 1995 and 2005. The polymorphism was genotyped using the restriction fragment length polymorphism method and CMV infection was determined by pp65 antigenemia. Multifactorial Cox regression analysis demonstrated that the presence of the C allele was an independent risk factor for CMV infection (OR=1.52, P=0.043), the risk being even higher when study was restricted to patients with positive CMV serological status before the graft and who did not receive any CMV prophylaxis (OR=1.88, P=0.028). This study identified a new genetic risk factor for CMV reactivation after kidney transplantation. The results of our study suggest that C carriers might especially benefit from CMV prophylaxis.

  3. Decreased Nucleotide and Expression Diversity and Modified Coexpression Patterns Characterize Domestication in the Common Bean[W][OPEN

    PubMed Central

    Bellucci, Elisa; Bitocchi, Elena; Ferrarini, Alberto; Benazzo, Andrea; Biagetti, Eleonora; Klie, Sebastian; Minio, Andrea; Rau, Domenico; Rodriguez, Monica; Panziera, Alex; Venturini, Luca; Attene, Giovanna; Albertini, Emidio; Jackson, Scott A.; Nanni, Laura; Fernie, Alisdair R.; Nikoloski, Zoran; Bertorelle, Giorgio; Delledonne, Massimo; Papa, Roberto

    2014-01-01

    Using RNA sequencing technology and de novo transcriptome assembly, we compared representative sets of wild and domesticated accessions of common bean (Phaseolus vulgaris) from Mesoamerica. RNA was extracted at the first true-leaf stage, and de novo assembly was used to develop a reference transcriptome; the final data set consists of ∼190,000 single nucleotide polymorphisms from 27,243 contigs in expressed genomic regions. A drastic reduction in nucleotide diversity (∼60%) is evident for the domesticated form, compared with the wild form, and almost 50% of the contigs that are polymorphic were brought to fixation by domestication. In parallel, the effects of domestication decreased the diversity of gene expression (18%). While the coexpression networks for the wild and domesticated accessions demonstrate similar seminal network properties, they show distinct community structures that are enriched for different molecular functions. After simulating the demographic dynamics during domestication, we found that 9% of the genes were actively selected during domestication. We also show that selection induced a further reduction in the diversity of gene expression (26%) and was associated with 5-fold enrichment of differentially expressed genes. While there is substantial evidence of positive selection associated with domestication, in a few cases, this selection has increased the nucleotide diversity in the domesticated pool at target loci associated with abiotic stress responses, flowering time, and morphology. PMID:24850850

  4. Identification of single nucleotide polymorphism markers associated with cortisol response to crowding in Rainbow Trout

    USDA-ARS?s Scientific Manuscript database

    Understanding stress responses is essential for improving animal welfare and increasing agriculture production efficiency. Previously, we reported microsatellite markers associated with quantitative trait loci (QTL) affecting plasma cortisol response to crowding in rainbow trout. Our main objectives...

  5. Association of the rs7903146 single nucleotide polymorphism at the Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian subjects.

    PubMed

    Barra, Gustavo Barcelos; Dutra, Ludmila Alves Sanches; Watanabe, Sílvia Conde; Costa, Patrícia Godoy Garcia; Cruz, Patrícia Sales Marques da; Azevedo, Monalisa Ferreira; Amato, Angélica Amorim

    2012-11-01

    To investigate the association of the T allele of the single nucleotide polymorphism (SNP) rs7903146 of TCF7L2 with the occurrence of T2D in a sample of subjects followed up at the Brasilia University Hospital. The SNP rs7903146 of TCF7L2 was genotyped by allele-specific PCR in 113 patients with known T2D and in 139 non-diabetic controls in Brasilia, Brazil. We found that the T allele of the SNP rs7903146 of TCF7L2 was significantly associated with T2D risk (odds ratio of 3.92 for genotype TT in the recessive genetic model, p = 0.004 and 1.5 for T allele, p = 0.032). These results reinforce previous findings on the consistent association of this genetic factor and the risk of T2D in populations of diverse ethnic backgrounds.

  6. Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

    PubMed

    García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

    2013-12-01

    Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Genetics of osteoporosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

    Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

  8. Single nucleotide polymorphisms of DNA repair genes as predictors of radioresponse.

    PubMed

    Parliament, Matthew B; Murray, David

    2010-10-01

    Radiation therapy is a key modality in the treatment of cancer. Substantial progress has been made in unraveling the molecular events which underpin the responses of malignant and surrounding normal tissues to ionizing radiation. An understanding of the genes involved in processes such as DNA double-strand break repair, DNA damage response, cell-cycle control, apoptosis, cellular antioxidant defenses, and cytokine production, has evolved toward examination of how genetic variants, most often, single nucleotide polymorphisms (SNPs), may influence interindividual radioresponse. Experimental approaches, such as candidate SNP-association studies, genome-wide association studies, and massively parallel sequencing are being proposed to address these questions. We present a focused review of the evidence supporting an association between SNPs in DNA repair genes and radioresponse in normal tissues and tumors. Although preliminary results indicate possible associations, there are methodological weaknesses in many of the studies, and independent validation of SNPs as biomarkers of radioresponse in much larger cohorts will likely require research cooperation through international consortia. Copyright © 2010 Elsevier Inc. All rights reserved.

  9. Interferon regulatory factor 5 (IRF5) gene variants are associated with multiple sclerosis in three distinct populations

    PubMed Central

    Kristjansdottir, G; Sandling, J K; Bonetti, A; Roos, I M; Milani, L; Wang, C; Gustafsdottir, S M; Sigurdsson, S; Lundmark, A; Tienari, P J; Koivisto, K; Elovaara, I; Pirttilä, T; Reunanen, M; Peltonen, L; Saarela, J; Hillert, J; Olsson, T; Landegren, U; Alcina, A; Fernández, O; Leyva, L; Guerrero, M; Lucas, M; Izquierdo, G; Matesanz, F; Syvänen, A-C

    2008-01-01

    Background: IRF5 is a transcription factor involved both in the type I interferon and the toll-like receptor signalling pathways. Previously, IRF5 has been found to be associated with systemic lupus erythematosus, rheumatoid arthritis and inflammatory bowel diseases. Here we investigated whether polymorphisms in the IRF5 gene would be associated with yet another disease with features of autoimmunity, multiple sclerosis (MS). Methods: We genotyped nine single nucleotide polymorphisms and one insertion-deletion polymorphism in the IRF5 gene in a collection of 2337 patients with MS and 2813 controls from three populations: two case–control cohorts from Spain and Sweden, and a set of MS trio families from Finland. Results: Two single nucleotide polymorphism (SNPs) (rs4728142, rs3807306), and a 5 bp insertion-deletion polymorphism located in the promoter and first intron of the IRF5 gene, showed association signals with values of p<0.001 when the data from all cohorts were combined. The predisposing alleles were present on the same common haplotype in all populations. Using electrophoretic mobility shift assays we observed allele specific differences in protein binding for the SNP rs4728142 and the 5 bp indel, and by a proximity ligation assay we demonstrated increased binding of the transcription factor SP1 to the risk allele of the 5 bp indel. Conclusion: These findings add IRF5 to the short list of genes shown to be associated with MS in more than one population. Our study adds to the evidence that there might be genes or pathways that are common in multiple autoimmune diseases, and that the type I interferon system is likely to be involved in the development of these diseases. PMID:18285424

  10. Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

    PubMed

    Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

    2017-03-01

    The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

  11. Highlights from the functional single nucleotide polymorphisms associated with human muscle size and strength or FAMuSS study.

    PubMed

    Pescatello, Linda S; Devaney, Joseph M; Hubal, Monica J; Thompson, Paul D; Hoffman, Eric P

    2013-01-01

    The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity.

  12. Highlights from the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength or FAMuSS Study

    PubMed Central

    Pescatello, Linda S.; Devaney, Joseph M.; Hubal, Monica J.; Thompson, Paul D.; Hoffman, Eric P.

    2013-01-01

    The purpose of the Functional Single Nucleotide Polymorphisms Associated with Human Muscle Size and Strength study or FAMuSS was to identify genetic factors that dictated the response of health-related fitness phenotypes to resistance exercise training (RT). The phenotypes examined were baseline muscle strength and muscle, fat, and bone volume and their response to RT. FAMuSS participants were 1300 young (24 years), healthy men (42%) and women (58%) that were primarily of European-American descent. They were genotyped for ~500 polymorphisms and completed the Paffenbarger Physical Activity Questionnaire to assess energy expenditure and time spent in light, moderate, and vigorous intensity habitual physical activity and sitting. Subjects then performed a 12-week progressive, unilateral RT program of the nondominant arm with the dominant arm used as a comparison. Before and after RT, muscle strength was measured with the maximum voluntary contraction and one repetition maximum, while MRI measured muscle, fat, and bone volume. We will discuss the history of how FAMuSS originated, provide a brief overview of the FAMuSS methods, and summarize our major findings regarding genotype associations with muscle strength and size, body composition, cardiometabolic biomarkers, and physical activity. PMID:24455711

  13. Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

    PubMed

    Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

    2013-01-01

    To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index < or = 20 kg/m2) the frequency of the C/C genotype was significantly increased (p < 0.05) in PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

  14. Associations between serum bone-specific alkaline phosphatase activity, biochemical parameters, and functional polymorphisms of the tissue-nonspecific alkaline phosphatase gene in a Japanese population.

    PubMed

    Sogabe, Natsuko; Tanabe, Rieko; Haraikawa, Mayu; Maruoka, Yutaka; Orimo, Hideo; Hosoi, Takayuki; Goseki-Sone, Masae

    2013-01-01

    We had demonstrated that single nucleotide polymorphism (787T>C) in the tissue-nonspecific ALP (TNSALP) gene was associated with the bone mineral density (BMD). BMD was the lowest among TNSALP 787T homozygotes (TT-type) and highest among TNSALP 787T>C homozygotes (CC-type) in postmenopausal women. In the present study, we investigated the effects of the TNSALP genotype on associations among serum bonespecific alkaline phosphatase (BAP), serum calcium, and phosphorus in healthy young Japanese subjects. Young healthy adult subjects (n=193) were genotyped for the polymorphism, and we measured the levels of serum BAP, serum calcium, and phosphorus. Dietary nutrient intakes were calculated based on 3-day food records before the day of blood examinations. Grouped by the TNSALP genotype, a significant negative correlation between serum BAP and phosphorus was observed in 787T>C homozygotes (CC-type), but not in heterozygotes (TCtype), nor in 787T homozygotes (TT-type). In the present study, we revealed that the single nucleotide polymorphism 787T>C in the TNSALP gene had effects on the correlation between serum BAP and phosphorus in young adult subjects. These results suggest that variation in TNSALP may be an important determinant of phosphate metabolism. Our data may be useful for planning strategies to prevent osteoporosis.

  15. Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

    PubMed

    Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

    2017-01-01

    Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

  16. Prediction of Adult Dyslipidemia Using Genetic and Childhood Clinical Risk Factors: The Cardiovascular Risk in Young Finns Study.

    PubMed

    Nuotio, Joel; Pitkänen, Niina; Magnussen, Costan G; Buscot, Marie-Jeanne; Venäläinen, Mikko S; Elo, Laura L; Jokinen, Eero; Laitinen, Tomi; Taittonen, Leena; Hutri-Kähönen, Nina; Lyytikäinen, Leo-Pekka; Lehtimäki, Terho; Viikari, Jorma S; Juonala, Markus; Raitakari, Olli T

    2017-06-01

    Dyslipidemia is a major modifiable risk factor for cardiovascular disease. We examined whether the addition of novel single-nucleotide polymorphisms for blood lipid levels enhances the prediction of adult dyslipidemia in comparison to childhood lipid measures. Two thousand four hundred and twenty-two participants of the Cardiovascular Risk in Young Finns Study who had participated in 2 surveys held during childhood (in 1980 when aged 3-18 years and in 1986) and at least once in a follow-up study in adulthood (2001, 2007, and 2011) were included. We examined whether inclusion of a lipid-specific weighted genetic risk score based on 58 single-nucleotide polymorphisms for low-density lipoprotein cholesterol, 71 single-nucleotide polymorphisms for high-density lipoprotein cholesterol, and 40 single-nucleotide polymorphisms for triglycerides improved the prediction of adult dyslipidemia compared with clinical childhood risk factors. Adjusting for age, sex, body mass index, physical activity, and smoking in childhood, childhood lipid levels, and weighted genetic risk scores were associated with an increased risk of adult dyslipidemia for all lipids. Risk assessment based on 2 childhood lipid measures and the lipid-specific weighted genetic risk scores improved the accuracy of predicting adult dyslipidemia compared with the approach using only childhood lipid measures for low-density lipoprotein cholesterol (area under the receiver-operating characteristic curve 0.806 versus 0.811; P =0.01) and triglycerides (area under the receiver-operating characteristic curve 0.740 versus area under the receiver-operating characteristic curve 0.758; P <0.01). The overall net reclassification improvement and integrated discrimination improvement were significant for all outcomes. The inclusion of weighted genetic risk scores to lipid-screening programs in childhood could modestly improve the identification of those at highest risk of dyslipidemia in adulthood. © 2017 American Heart Association, Inc.

  17. Lack of association between ESR1 gene polymorphisms and premature ovarian failure in Serbian women.

    PubMed

    Li, J; Vujovic, S; Dalgleish, R; Thompson, J; Dragojevic-Dikic, S; Al-Azzawi, F

    2014-06-01

    It has previously been reported that estrogen receptor-alpha (ERα) gene (ESR1: estrogen receptor 1) polymorphisms are associated with premature ovarian failure (POF). The aim of this study was to investigate whether these genetic polymorphisms of ESR1 are associated with POF in Serbian women. A series of 197 POF cases matched with 547 fertile controls was recruited by the Institute for Endocrinology, Diabetes and Metabolic Disorders of Serbia between 2007 and 2010. Genomic DNA was extracted from saliva using Oragene® DNA sample collection kits. Two single-nucleotide polymorphisms (SNPs), PvuII and XbaI, in ESR1 were genotyped by dynamic allele-specific hybridization. Haplotype analyses were performed with the restriction fragment length polymorphism method. SNP and haplotype effects were analyzed by logistic regression models. No significant difference was found in the distribution of ESR1 PvuII and XbaI polymorphisms or haplotypes between the POF and control groups. The two ESR1 SNPs, PvuII and XbaI, are not commonly associated with POF in Serbian women and may not contribute to the genetic basis of the condition.

  18. Association of the serotonin transporter gene promoter region (5-HTTLPR) polymorphism with biased attention for emotional stimuli.

    PubMed

    Beevers, Christopher G; Wells, Tony T; Ellis, Alissa J; McGeary, John E

    2009-08-01

    A deletion polymorphism in the serotonin transporter-linked polymorphic region (5-HTTLPR) has been associated with vulnerability to affective disorders, yet the mechanism by which this gene confers vulnerability remains unclear. Two studies examined associations between the 5-HTTLPR polymorphism and attentional bias for emotional stimuli among nondepressed adults. Biased attention, attention engagement, and difficulty with attention disengagement were assessed with a spatial cuing task using emotional stimuli. Results from Study 1 (N = 38) indicated that short 5-HTTLPR allele carriers experienced greater difficulty disengaging their attention from sad and happy stimuli compared with long allele homozygotes. Study 2 participants (N = 144) were genotyped for the 5-HTTLPR polymorphism, including single nucleotide polymorphism rs25531 in the long allele of the 5-HTTLPR. Consistent with Study 1, individuals homozygous for the low-expressing 5-HTTLPR alleles (i.e., S and LG) experienced greater difficulty disengaging attention from sad, happy, and fear stimuli than high-expressing 5-HTTLPR homozygotes. Because this association exists in healthy adults, it may represent a susceptibility factor for affective disorders that becomes problematic during stressful life experiences.

  19. Cytotoxic T-lymphocyte-associated protein 4 gene polymorphism is related to rheumatoid arthritis in Egyptian population.

    PubMed

    Fattah, Shaimaa A; Ghattas, Maivel H; Saleh, Samy M; Abo-Elmatty, Dina M

    2017-02-01

    Cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) is a CD28-family receptor expressed on T-cells which suppresses T cell proliferation. CTLA-4 -318C/T polymorphism is involved in regulation of CTLA-4 expression. The study aimed to investigate the genetic association of CTLA-4 -318C/T polymorphism with rheumatoid arthritis (RA) and the activity and severity of the disease in the Egyptian population. A single nucleotide polymorphism (rs5742909) in CTLA-4 was genotyped in 100 RA patients and 100 healthy controls using polymerase chain reaction-restriction fragment length polymorphism. Diagnostic tests were measured for RA patients. The frequency of T allele in RA patients was significantly higher than in the control subjects (p = 0.002). CT and TT genotypes had high C-reactive protein, erythrocyte sedimentation rate and disease activity score 28 while CC genotype had a high rheumatoid factor. A minor allele of CTLA-4 rs5742909 polymorphism was associated with RA and the activity but not the severity of the disease.

  20. A Genome-Wide Association Study of Chronic Obstructive Pulmonary Disease in Hispanics

    PubMed Central

    Chen, Wei; Brehm, John M.; Manichaikul, Ani; Cho, Michael H.; Boutaoui, Nadia; Yan, Qi; Burkart, Kristin M.; Enright, Paul L.; Rotter, Jerome I.; Petersen, Hans; Leng, Shuguang; Obeidat, Ma’en; Bossé, Yohan; Brandsma, Corry-Anke; Hao, Ke; Rich, Stephen S.; Powell, Rhea; Avila, Lydiana; Soto-Quiros, Manuel; Silverman, Edwin K.; Tesfaigzi, Yohannes; Barr, R. Graham

    2015-01-01

    Rationale: Genome-wide association studies (GWAS) of chronic obstructive pulmonary disease (COPD) have identified disease-susceptibility loci, mostly in subjects of European descent. Objectives: We hypothesized that by studying Hispanic populations we would be able to identify unique loci that contribute to COPD pathogenesis in Hispanics but remain undetected in GWAS of non-Hispanic populations. Methods: We conducted a metaanalysis of two GWAS of COPD in independent cohorts of Hispanics in Costa Rica and the United States (Multi-Ethnic Study of Atherosclerosis [MESA]). We performed a replication study of the top single-nucleotide polymorphisms in an independent Hispanic cohort in New Mexico (the Lovelace Smokers Cohort). We also attempted to replicate prior findings from genome-wide studies in non-Hispanic populations in Hispanic cohorts. Measurements and Main Results: We found no genome-wide significant association with COPD in our metaanalysis of Costa Rica and MESA. After combining the top results from this metaanalysis with those from our replication study in the Lovelace Smokers Cohort, we identified two single-nucleotide polymorphisms approaching genome-wide significance for an association with COPD. The first (rs858249, combined P value = 6.1 × 10−8) is near the genes KLHL7 and NUPL2 on chromosome 7. The second (rs286499, combined P value = 8.4 × 10−8) is located in an intron of DLG2. The two most significant single-nucleotide polymorphisms in FAM13A from a previous genome-wide study in non-Hispanics were associated with COPD in Hispanics. Conclusions: We have identified two novel loci (in or near the genes KLHL7/NUPL2 and DLG2) that may play a role in COPD pathogenesis in Hispanic populations. PMID:25584925

  1. A genome-wide association study of chronic obstructive pulmonary disease in Hispanics.

    PubMed

    Chen, Wei; Brehm, John M; Manichaikul, Ani; Cho, Michael H; Boutaoui, Nadia; Yan, Qi; Burkart, Kristin M; Enright, Paul L; Rotter, Jerome I; Petersen, Hans; Leng, Shuguang; Obeidat, Ma'en; Bossé, Yohan; Brandsma, Corry-Anke; Hao, Ke; Rich, Stephen S; Powell, Rhea; Avila, Lydiana; Soto-Quiros, Manuel; Silverman, Edwin K; Tesfaigzi, Yohannes; Barr, R Graham; Celedón, Juan C

    2015-03-01

    Genome-wide association studies (GWAS) of chronic obstructive pulmonary disease (COPD) have identified disease-susceptibility loci, mostly in subjects of European descent. We hypothesized that by studying Hispanic populations we would be able to identify unique loci that contribute to COPD pathogenesis in Hispanics but remain undetected in GWAS of non-Hispanic populations. We conducted a metaanalysis of two GWAS of COPD in independent cohorts of Hispanics in Costa Rica and the United States (Multi-Ethnic Study of Atherosclerosis [MESA]). We performed a replication study of the top single-nucleotide polymorphisms in an independent Hispanic cohort in New Mexico (the Lovelace Smokers Cohort). We also attempted to replicate prior findings from genome-wide studies in non-Hispanic populations in Hispanic cohorts. We found no genome-wide significant association with COPD in our metaanalysis of Costa Rica and MESA. After combining the top results from this metaanalysis with those from our replication study in the Lovelace Smokers Cohort, we identified two single-nucleotide polymorphisms approaching genome-wide significance for an association with COPD. The first (rs858249, combined P value = 6.1 × 10(-8)) is near the genes KLHL7 and NUPL2 on chromosome 7. The second (rs286499, combined P value = 8.4 × 10(-8)) is located in an intron of DLG2. The two most significant single-nucleotide polymorphisms in FAM13A from a previous genome-wide study in non-Hispanics were associated with COPD in Hispanics. We have identified two novel loci (in or near the genes KLHL7/NUPL2 and DLG2) that may play a role in COPD pathogenesis in Hispanic populations.

  2. Systematic search for single nucleotide polymorphisms in a lymphoid tyrosine phosphatase gene (PTPN22): association between a promoter polymorphism and type 1 diabetes in Asian populations.

    PubMed

    Kawasaki, Eiji; Awata, Takuya; Ikegami, Hiroshi; Kobayashi, Tetsuro; Maruyama, Taro; Nakanishi, Koji; Shimada, Akira; Uga, Miho; Uga, Mho; Kurihara, Susumu; Kawabata, Yumiko; Tanaka, Shoichiro; Kanazawa, Yasuhiko; Lee, Inkyu; Eguchi, Katsumi

    2006-03-15

    The protein tyrosine phosphatase, nonreceptor 22 gene (PTPN22) maps to human chromosome 1p13.3-p13.1 and encodes an important negative regulator of T-cell activation, lymphoid-specific phosphatase (Lyp). Recently, the minor allele of a single-nucleotide polymorphism (SNP) at nucleotide position 1858 (rs2476601, +1858C > T) was found to be associated with type 1 diabetes. However, the degree of the association is variable among ethnic populations, suggesting the presence of other disease-associated variants in PTPN22. To examine this possibility, we carried out a systemic search for PTPN22 using direct sequencing of PCR-amplified products in the Japanese population. Association and linkage studies were also conducted in 1,690 Japanese samples, 180 Korean samples, and 472 Caucasian samples from 95 nuclear families. We identified five novel SNPs, but not the +1858C > T SNP. Of these two frequent SNPs, -1123G > C, and +2740C > T were in strong linkage disequilibrium (LD), and the -1123G > C promoter SNP was associated with acute-onset but not slow-onset type 1 diabetes in the Japanese population (odds ratio [OR] = 1.42, 95% CI = 1.07-1.89, P = 0.015). This association was observed also in Korean patients with type 1 diabetes (Mantel-Haenszel chi2= 6.543, P = 0.0105, combined OR = 1.41 95% CI = 1.09-1.82). Furthermore, the affected family-based control (AFBAC) association test and the transmission disequilibrium analysis of multiplex families of European descent from the British Diabetes Association (BDA) Warren Repository indicated that the association was stronger in -1123G > C compared to +1858C > T. In conclusion, the type 1 diabetes association with PTPN22 is confirmed, but it cannot be attributed solely to the +1858C > T variant. The promoter -1123G > C SNP is a more likely causative variant in PTPN22. 2006 Wiley-Liss, Inc.

  3. Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

    PubMed

    Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

    2017-05-01

    To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

  4. Using Single-Nucleotide Polymorphisms To Discriminate Disease-Associated from Carried Genomes of Neisseria meningitidis▿†

    PubMed Central

    Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King

    2011-01-01

    Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743

  5. Leu72Met408 Polymorphism of the Ghrelin Gene Is Associated With Early Phase of Gastric Emptying in the Patients With Functional Dyspepsia in Japan

    PubMed Central

    Yamawaki, Hiroshi; Futagami, Seiji; Shimpuku, Mayumi; Shindo, Tomotaka; Maruki, Yuuta; Nagoya, Hiroyuki; Kodaka, Yasuhiro; Sato, Hitomi; Gudis, Katya; Kawagoe, Tetsuro; Sakamoto, Choitsu

    2015-01-01

    Background/Aims There are no available data about the relationship between ghrelin gene genotypes and early phase of gastric emptying in functional dyspepsia (FD) as defined by Rome III classification. Methods We enrolled 74 patients presenting with typical symptoms of FD and 64 healthy volunteers. Gastric motility was evaluated using the 13C-acetate breath test. We used Rome III criteria to evaluate upper abdominal symptoms and self-rating questionnaires for depression (SRQ-D) scores to determine status of depression. The Arg51Gln (346G>A), preproghrelin (3056T>C), Leu72Met (408C>A), Gln90Leu (3412T>A) and G-protein β3 (825C>T) polymorphisms were analyzed in the DNA from blood samples of enrolled subjects. Genotyping was performed by polymerase chain reaction. Results There was a significant relationship between the Gln90Leu3412 genotype and SRQ-D score in FD patients (P = 0.009). Area under the curve at 15 minutes (AUC15) value was significantly associated with the Leu72Met408 genotype (P = 0.015) but not with entire gastric emptying. Conclusions The Leu72Met (408C>A) single nucleotide polymorphism was significantly associated with early phase of gastric emptying in FD patients. Further studies will be necessary to clarify the association between ghrelin gene single nucleotide polymorphisms and early phase of gastric emptying in FD patients. PMID:25540946

  6. Leu72Met408 Polymorphism of the Ghrelin Gene Is Associated With Early Phase of Gastric Emptying in the Patients With Functional Dyspepsia in Japan.

    PubMed

    Yamawaki, Hiroshi; Futagami, Seiji; Shimpuku, Mayumi; Shindo, Tomotaka; Maruki, Yuuta; Nagoya, Hiroyuki; Kodaka, Yasuhiro; Sato, Hitomi; Gudis, Katya; Kawagoe, Tetsuro; Sakamoto, Choitsu

    2015-01-01

    There are no available data about the relationship between ghrelin gene genotypes and early phase of gastric emptying in functional dyspepsia (FD) as defined by Rome III classification. We enrolled 74 patients presenting with typical symptoms of FD and 64 healthy volunteers. Gastric motility was evaluated using the 13C-acetate breath test. We used Rome III criteria to evaluate upper abdominal symptoms and self-rating questionnaires for depression (SRQ-D) scores to determine status of depression. The Arg51Gln (346G->A), preproghrelin (3056T->C), Leu72Met (408C->A), Gln90Leu (3412T->A) and G-protein 3 (825C->T) polymorphisms were analyzed in the DNA from blood samples of enrolled subjects. Genotyping was performed by polymerase chain reaction. There was a significant relationship between the Gln90Leu3412 genotype and SRQ-D score in FD patients (P = 0.009). Area under the curve at 15 minutes (AUC15) value was significantly associated with the Leu72Met408 genotype (P = 0.015) but not with entire gastric emptying. The Leu72Met (408C->A) single nucleotide polymorphism was significantly associated with early phase of gastric emptying in FD patients. Further studies will be necessary to clarify the association between ghrelin gene single nucleotide polymorphisms and early phase of gastric emptying in FD patients.

  7. Origin of the polymorphism of the involucrin gene in Asians.

    PubMed Central

    Djian, P; Delhomme, B; Green, H

    1995-01-01

    The involucrin gene, encoding a protein of the terminally differentiated keratinocyte, is polymorphic in the human. There is polymorphism of marker nucleotides a two positions in the coding region, and there are over eight polymorphic forms based on the number and kind of 10-codon tandem repeats in that part of the coding region most recently added in the human lineage. The involucrin alleles of Caucasians and Africans differ in both nucleotides and repeat patterns. We show that the involucrin alleles of East Asians (Chinese and Japanese) can be divided into two populations according to whether they possess the two marker nucleotides typical of Africans or Caucasians. The Asian population bearing Caucasian-type marker nucleotides has repeat patterns similar to those of Caucasians, whereas Asians bearing African-type marker nucleotides have repeat patterns that resemble those of Africans more than those of Caucasians. The existence of two populations of East Asian involucrin alleles gives support for the existence of a Eurasian stem lineage from which Caucasians and a part of the Asian population originated. PMID:7762559

  8. Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

    PubMed

    Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

    2017-01-01

    Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

  9. GSTO and AS3MT genetic polymorphisms and differences in urinary arsenic concentrations among residents in Bangladesh.

    PubMed

    Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C

    2012-05-01

    We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.

  10. A Genome-Wide Association Study for the Incidence of Persistent Bovine Viral Diarrhea Virus Infection in Cattle.

    USDA-ARS?s Scientific Manuscript database

    Bovine Viral Diarrhea Virus (BVDV) is a diverse group of viruses causing disease in ruminants. The objective was to determine genomic regions harboring single nucleotide polymorphisms (SNP) associated with presence or absence of persistent BVDV infections. A genome wide association approach based on...

  11. Association genetics in Pinus taeda L. I. wood property traits

    Treesearch

    Santiago C. Gonzalez-Martinez; Nicholas C. Wheeler; Elhan Ersoz; C. Dana Nelson; David B. Neale

    2007-01-01

    Genetic association is a powerful method for dissecting complex adaptive traits due to (i) fine-scale mapping resulting from historical recombination, (ii) wide coverage of phenotypic and genotypic variation within a single experiment, and (iii) the simultaneous discovery of loci and alleles. In this article, genetic association among single nucleotide polymorphisms (...

  12. Genome-Wide Association Study of Intelligence: Additive Effects of Novel Brain Expressed Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Shtir, Corina; Doyle, Alysa E.; Mick, Eric; McGough, James J.; McCracken, James; Biederman, Joseph; Smalley, Susan L.; Cantor, Rita M.; Faraone, Stephen V.; Nelson, Stanley F.

    2012-01-01

    Objective: The purpose of the present study was to identify common genetic variants that are associated with human intelligence or general cognitive ability. Method: We performed a genome-wide association analysis with a dense set of 1 million single-nucleotide polymorphisms (SNPs) and quantitative intelligence scores within an ancestrally…

  13. Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

    PubMed

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

    2011-05-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

  14. Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

    PubMed Central

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

    2011-01-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

  15. Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility

    DTIC Science & Technology

    2005-03-01

    identification of eight genetic loci in the familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late...1) investigate the association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct...addition, experiences derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome

  16. Calcium Signaling Pathway Genes RUNX2 and CACNA1C Are Associated With Calcific Aortic Valve Disease

    PubMed Central

    Guauque-Olarte, Sandra; Messika-Zeitoun, David; Droit, Arnaud; Lamontagne, Maxime; Tremblay-Marchand, Joël; Lavoie-Charland, Emilie; Gaudreault, Nathalie; Arsenault, Benoit J.; Dubé, Marie-Pierre; Tardif, Jean-Claude; Body, Simon C.; Seidman, Jonathan G.; Boileau, Catherine; Mathieu, Patrick; Pibarot, Philippe; Bossé, Yohan

    2016-01-01

    Background Calcific aortic valve stenosis (AS) is a life-threatening disease with no medical therapy. The genetic architecture of AS remains elusive. This study combines genome-wide association studies, gene expression, and expression quantitative trait loci mapping in human valve tissues to identify susceptibility genes of AS. Methods and Results A meta-analysis was performed combining the results of 2 genome-wide association studies in 474 and 486 cases from Quebec City (Canada) and Paris (France), respectively. Corresponding controls consisted of 2988 and 1864 individuals with European ancestry from the database of genotypes and phenotypes. mRNA expression levels were evaluated in 9 calcified and 8 normal aortic valves by RNA sequencing. The results were integrated with valve expression quantitative trait loci data obtained from 22 AS patients. Twenty-five single-nucleotide polymorphisms had P<5×10−6 in the genome-wide association studies meta-analysis. The calcium signaling pathway was the top gene set enriched for genes mapped to moderately AS-associated single-nucleotide polymorphisms. Genes in this pathway were found differentially expressed in valves with and without AS. Two single-nucleotide polymorphisms located in RUNX2 (runt-related transcription factor 2), encoding an osteogenic transcription factor, demonstrated some association with AS (genome-wide association studies P=5.33×10−5). The mRNA expression levels of RUNX2 were upregulated in calcified valves and associated with eQTL-SNPs. CACNA1C encoding a subunit of a voltage-dependent calcium channel was upregulated in calcified valves. The eQTL-SNP with the most significant association with AS located in CACNA1C was associated with higher expression of the gene. Conclusions This integrative genomic study confirmed the role of RUNX2 as a potential driver of AS and identified a new AS susceptibility gene, CACNA1C, belonging to the calcium signaling pathway. PMID:26553695

  17. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  18. Effects of the BDNF Val66Met Polymorphism on Anxiety-Like Behavior Following Nicotine Withdrawal in Mice.

    PubMed

    Lee, Bridgin G; Anastasia, Agustin; Hempstead, Barbara L; Lee, Francis S; Blendy, Julie A

    2015-12-01

    Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNF(Met/Met)) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNF(Met/Met) mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNF(Met/Met) mice; and (3) an increase in BDNF prodomain in BDNF(Met/Met) mice following nicotine withdrawal. Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNF(Met/Met) mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Association between toll-like receptors 9 (TLR9) gene polymorphism and risk of pulmonary tuberculosis: meta-analysis.

    PubMed

    Chen, Zhi; Wang, Wei; Liang, Jianqin; Wang, Jinhe; Feng, Shisheng; Zhang, Guangyu

    2015-05-08

    Previous studies indicated that the single nucleotide polymorphisms (SNPs) in TLR9 gene might be associated with Tuberculosis (TB) risk. However, the results are inconsistent and inconclusive. 1745 articles from four databases were involved in our study. A meta-analysis on the associations between the seven polymorphisms and TB risk was carried out by comparison using different genetic models. In this systematic review 8 studies from seven English articles were analyzed. Our results showed that rs352139 is significantly associated with TB risk (AA vs. AG, OR 0.77, 95% CI 0.65-0.92, P = 0.004). In the ethnic subgroup analysis, Indonesians with AA genotype had a decreased susceptibility while Mexicans with GG allele had an increased risk. The meta-analysis indicated that rs352139 polymorphism might be associated with decreased TB risk in Indonesians whereas increased risk in Mexicans. Whether the observed association was due to causal effect needs to be further studied.

  20. Pharmacogenomic studies of the anticancer and immunosuppressive thiopurines mercaptopurine and azathioprine

    PubMed Central

    Hawwa, Ahmed F; Millership, Jeff S; Collier, Paul S; Vandenbroeck, Koen; McCarthy, Anthony; Dempsey, Sid; Cairns, Carole; Collins, John; Rodgers, Colin; McElnay, James C

    2008-01-01

    AIMS To examine the allelic variation of three enzymes involved in 6-mercaptopurine/azathioprine (6-MP/AZA) metabolism and evaluate the influence of these polymorphisms on toxicity, haematological parameters and metabolite levels in patients with acute lymphoblastic leukaemia (ALL) or inflammatory bowel disease (IBD). METHODS Clinical data and blood samples were collected from 19 ALL paediatric patients and 35 IBD patients who were receiving 6-MP/AZA therapy. All patients were screened for seven genetic polymorphisms in three enzymes involved in mercaptopurine metabolism [xanthine oxidase, inosine triphosphatase (C94→A and IVS2+21A→C) and thiopurine methyltransferase]. Erythrocyte and plasma metabolite concentrations were also determined. The associations between the various genotypes and myelotoxicity, haematological parameters and metabolite concentrations were determined. RESULTS Thiopurine methyltransferase variant alleles were associated with a preferential metabolism away from 6-methylmercaptopurine nucleotides (P = 0.008 in ALL patients, P = 0.038 in IBD patients) favouring 6-thioguanine nucleotides (6-TGNs) (P = 0.021 in ALL patients). Interestingly, carriers of inosine triphosphatase IVS2+21A→C variants among ALL and IBD patients had significantly higher concentrations of the active cytotoxic metabolites, 6-TGNs (P = 0.008 in ALL patients, P = 0.047 in IBD patients). The study confirmed the association of thiopurine methyltransferaseheterozygosity with leucopenia and neutropenia in ALL patients and reported a significant association between inosine triphosphatase IVS2+21A→C variants with thrombocytopenia (P = 0.012). CONCLUSIONS Pharmacogenetic polymorphisms in the 6-MP pathway may help identify patients at risk for associated toxicities and may serve as a guide for dose individualization. WHAT IS ALREADY KNOWN ABOUT THIS SUBJECT6-Mercaptopurine (6-MP) and azathioprine (AZA) are both inactive prodrugs that require intracellular activation into the active 6-thioguanine nucleotides (6-TGNs).This metabolic process undergoes three different competitive pathways that are catalysed by three different enzymes; xanthine oxidase (XO), thiopurine methyltransferase (TPMT) and inosine triphosphatase (ITPA), all of which exhibit genetic polymorphisms.Although the impact of genetic variation in the TPMT gene on treatment outcome and toxicity has been demonstrated, the role of other polymorphisms remains less well known. WHAT THIS STUDY ADDS New information on the allelic variation of these three enzymes (XO, TPMT and ITPA) and their influence on 6-MP/AZA metabolism and toxicity.Confirmation of the association of TPMT polymorphism with haematological toxicity.Identified potential genetic characteristics that may contribute to higher risk of adverse events (such as ITPA IVS2+21A→C mutation). PMID:18662289

  1. Evidence from single nucleotide polymorphism analyses of ADVANCE study demonstrates EFNB3 as a hypertension risk gene.

    PubMed

    Tremblay, Johanne; Wang, Yujia; Raelson, John; Marois-Blanchet, Francois-Christophe; Wu, Zenghui; Luo, Hongyu; Bradley, Edward; Chalmers, John; Woodward, Mark; Harrap, Stephen; Hamet, Pavel; Wu, Jiangping

    2017-03-08

    EPH kinases and their ligands, ephrins (EFNs), have vital and diverse biological functions. We recently reported that Efnb3 gene deletion results in hypertension in female but not male mice. These data suggest that EFNB3 regulates blood pressure in a sex- and sex hormone-dependent way. In the present study, we conducted a human genetic study to assess the association of EFNB3 single nucleotide polymorphisms with human hypertension risks, using 3,448 patients with type 2 diabetes from the ADVANCE study (Action in Diabetes and Vascular Disease: Peterax and Diamicron MR Controlled Evaluation). We have observed significant association between 2 SNPs in the 3' untranslated region or within the adjacent region just 3' of the EFNB3 gene with hypertension, corroborating our findings from the mouse model. Thus, our investigation has shown that EFNB3 is a hypertension risk gene in certain individuals.

  2. Group B Streptococcus Infections Caused by Improper Sourcing and Handling of Fish for Raw Consumption, Singapore, 2015–2016

    PubMed Central

    Chau, Man L.; Chen, Swaine L.; Yap, Min; Hartantyo, Sri H.P.; Chiew, Paul K.T.; Fernandez, Charlene J.; Wong, Wai K.; Fong, Rockey K.; Tan, Wei L.; Tan, Brian Z.Y.; Ng, Youming; Aung, Kyaw T.; Mehershahi, Kurosh S.; Goh, Christopher; Kang, Joanne S.L.; Barkham, Timothy; Leong, Adeline O.K.; Gutiérrez, Ramona A.

    2017-01-01

    We assessed microbial safety and quality of raw fish sold in Singapore during 2015–2016 to complement epidemiologic findings for an outbreak of infection with group B Streptococcus serotype III sequence type (ST) 283 associated with raw fish consumption. Fish-associated group B Streptococcus ST283 strains included strains nearly identical (0–2 single-nucleotide polymorphisms) with the human outbreak strain, as well as strains in another distinct ST283 clade (57–71 single-nucleotide polymorphisms). Our investigations highlight the risk for contamination of freshwater fish (which are handled and distributed separately from saltwater fish sold as sashimi) and the need for improved hygienic handling of all fish for raw consumption. These results have led to updated policy and guidelines regarding the sale of ready-to-eat raw fish dishes in Singapore. PMID:29148967

  3. Artemisinin Resistance-Associated Polymorphisms at the K13-Propeller Locus Are Absent in Plasmodium falciparum Isolates from Haiti

    PubMed Central

    Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.

    2015-01-01

    Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258

  4. The D543N polymorphism of the SLC11A1/NRAMP1 gene is associated with treatment failure in male patients with pulmonary tuberculosis.

    PubMed

    Salinas-Delgado, Yvain; Galaviz-Hernández, Carlos; Toral, René García; Ávila Rejón, Carmen A; Reyes-Lopez, Miguel A; Martínez, Antonio Rojas; Martínez-Aguilar, Gerardo; Sosa-Macías, Martha

    2015-09-01

    Polymorphisms in SLC11A1/NRAMP1 have shown an important association with susceptibility to tuberculosis and progression to active disease. However, whether there is an association of these polymorphisms with treatment failure is unknown. The aim of this study was to determine the association of SLC11A1 polymorphisms with treatment failure in Mexican subjects with pulmonary tuberculosis. Thirty-three subjects with treatment failure were paired by age and body mass index with 33 patients who successfully completed treatment and were considered cured. We assessed the polymorphisms of SLC11A1 in the regions of D543N and INT4 via polymerase chain reaction real-time TaqMan® single nucleotide polymorphism (SNP) genotyping. We found that D543N (G/A genotype) was associated with treatment failure in patients with pulmonary tuberculosis [odds ratio (OR) 11.61, 95% confidence interval (CI) 3.66-36.78]. When adjusted by gender, this association remained significant in males (OR 11.09, 95% CI 3.46-35.51). In our male population, the presence of the D543N polymorphism of SLC11A1 is a risk factor for treatment failure. This finding should be confirmed in other populations.

  5. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

    PubMed

    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

    2009-07-14

    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  6. Do genetic modifiers of high-density lipoprotein cholesterol and triglyceride levels also modify their response to a lifestyle intervention in the setting of obesity and type-2 diabetes mellitus?: The Action for Health in Diabetes (Look AHEAD) study.

    PubMed

    Huggins, Gordon S; Papandonatos, George D; Erar, Bahar; Belalcazar, L Maria; Brautbar, Ariel; Ballantyne, Christie; Kitabchi, Abbas E; Wagenknecht, Lynne E; Knowler, William C; Pownall, Henry J; Wing, Rena R; Peter, Inga; McCaffery, Jeanne M

    2013-08-01

    High-density lipoprotein cholesterol (HDL-C) and triglycerides are cardiovascular risk factors susceptible to lifestyle behavior modification and genetics. We hypothesized that genetic variants identified by genome-wide association studies as associated with HDL-C or triglyceride levels modify 1-year treatment response to an intensive lifestyle intervention, relative to a usual care of diabetes mellitus support and education. We evaluated 82 single-nucleotide polymorphisms, which represent 31 loci demonstrated by genome-wide association studies to be associated with HDL-C and triglycerides, in 3561 participants who consented for genetic studies and met eligibility criteria. Variants associated with higher baseline HDL-C levels, cholesterol ester transfer protein (CETP) rs3764261 and hepatic lipase (LIPC) rs8034802, were found to be associated with HDL-C increases with intensive lifestyle intervention (P=0.0038 and 0.013, respectively) and had nominally significant treatment interactions (P=0.047 and 0.046, respectively). The fatty acid desaturase-2 rs1535 variant, associated with low baseline HDL-C (P=0.017), was associated with HDL-C increases with intensive lifestyle intervention (0.0037) and had a nominal treatment interaction (P=0.035). Apolipoprotein B (rs693) and LIPC (rs8034802) single-nucleotide polymorphisms showed nominally significant associations with HDL-C and triglyceride changes with intensive lifestyle intervention and a treatment interaction (P<0.05). Phosphatidylglycerophosphate synthase-1 single-nucleotide polymorphisms (rs4082919) showed the most significant triglyceride treatment interaction in the full cohort (P=0.0009). This is the first study to identify genetic variants modifying lipid responses to a randomized lifestyle behavior intervention in overweight or obese individuals with diabetes mellitus. The effects of genetic factors on lipid changes may differ from the effects on baseline lipids and are modifiable by behavioral intervention.

  7. The Q705K and F359L Single-Nucleotide Polymorphisms of NOD-Like Receptor Signaling Pathway: Association with Chronic Pancreatitis, Pancreatic Cancer, and Periodontitis.

    PubMed

    Miskiewicz, Andrzej; Szparecki, Grzegorz; Durlik, Marek; Rydzewska, Grażyna; Ziobrowski, Ireneusz; Górska, Renata

    2015-12-01

    The aim of this study was to establish the correlation between the occurrence of Q705K and F359L polymorphisms in patients diagnosed with pancreatic diseases and periodontal conditions of various degrees of severity. The above-mentioned genetic markers were assessed in patients with pancreatic cancer (n = 18) and chronic pancreatitis (n = 39) as well as in a healthy control group (n = 115). The established inclusion criteria were the following: Caucasian descent, non-smoking, and age range 20-80, with different levels of periodontitis activity according to S. Offenbacher's scale. The genotyping reactions were performed by means of an RT-PCR with the use of TaqMan(®) genotyping assay. Results of the study revealed that the state of periodontium was significantly worse in patients with chronic pancreatitis. The Q705K and F359L polymorphisms were associated with more advanced cases of periodontitis measured by clinical attachment level, whereas the Q705K was associated with intensified bleeding index. Furthermore, the F359L single-nucleotide polymorphism was significantly higher in the group with chronic pancreatitis (p < 0.0001; OR = 6.8571). Whereas, the prevalence of Q705K polymorphism was higher in the group of pancreatic cancer (p = 0.107; OR = 3.3939). This study suggests that the exaggerated inflammatory response provoked by Q705K and F359L might be the common denominator for periodontitis, pancreatic cancer, and chronic pancreatitis. These findings might constitute the basis for a new diagnostic and therapeutic approach.

  8. TNFA gene variants related to the inflammatory status and its association with cellular aging: From the CORDIOPREV study

    USDA-ARS?s Scientific Manuscript database

    Background: Several single nucleotide polymorphisms have been proposed as potential predictors of the development of age-related diseases. Objective: To explore whether Tumor Necrosis Factor Alpha (TNFA) gene variants were associated with inflammatory status, thus facilitating the rate of telomere s...

  9. Association mapping of fruit, seed and disease resistance traits in Theobroma cacao L

    USDA-ARS?s Scientific Manuscript database

    An association mapping approach was employed to find markers for color, size, girth and mass of fruits; seed number and butterfat content; and resistance to black pod and witches’ broom diseases in cacao (Theobroma cacao L.). Ninety-five microsatellites (SSRs) and 775 single nucleotide polymorphisms...

  10. Screening for Novel Germline Rare Mutations Associated with Aggressive Prostate Cancer

    DTIC Science & Technology

    2015-12-01

    amino acid substitution from Threonine (Thr) to Proline (Pro); while rs61756080 results to the amino acid substitution from Glycine (Gly) to Glutamic...Single nucleotide polymorphisms 20 in the gene encoding Krüppel-like factor 7 are associated with type 2 diabetes . Diabetologia. 2005 Jul;48(7

  11. Mitochondrial haplotypes are not associated with mice selectively bred for high voluntary wheel running.

    PubMed

    Wone, Bernard W M; Yim, Won C; Schutz, Heidi; Meek, Thomas H; Garland, Theodore

    2018-04-04

    Mitochondrial haplotypes have been associated with human and rodent phenotypes, including nonshivering thermogenesis capacity, learning capability, and disease risk. Although the mammalian mitochondrial D-loop is highly polymorphic, D-loops in laboratory mice are identical, and variation occurs elsewhere mainly between nucleotides 9820 and 9830. Part of this region codes for the tRNA Arg gene and is associated with mitochondrial densities and number of mtDNA copies. We hypothesized that the capacity for high levels of voluntary wheel-running behavior would be associated with mitochondrial haplotype. Here, we analyzed the mtDNA polymorphic region in mice from each of four replicate lines selectively bred for 54 generations for high voluntary wheel running (HR) and from four control lines (Control) randomly bred for 54 generations. Sequencing the polymorphic region revealed a variable number of adenine repeats. Single nucleotide polymorphisms (SNPs) varied from 2 to 3 adenine insertions, resulting in three haplotypes. We found significant genetic differentiations between the HR and Control groups (F st  = 0.779, p ≤ 0.0001), as well as among the replicate lines of mice within groups (F sc  = 0.757, p ≤ 0.0001). Haplotypes, however, were not strongly associated with voluntary wheel running (revolutions run per day), nor with either body mass or litter size. This system provides a useful experimental model to dissect the physiological processes linking mitochondrial, genomic SNPs, epigenetics, or nuclear-mitochondrial cross-talk to exercise activity. Copyright © 2018. Published by Elsevier B.V.

  12. Genetic associations of the INSIG2 rs7566605 polymorphism with obesity-related metabolic traits in Malaysian Malays.

    PubMed

    Apalasamy, Y D; Moy, F M; Rampal, S; Bulgiba, A; Mohamed, Z

    2014-07-04

    A genome-wide association study showed that the tagging single nucleotide polymorphism (SNP) rs7566605 in the insulin-induced gene 2 (INSIG2) was associated with obesity. Attempts to replicate this result in different populations have produced inconsistent findings. We aimed to study the association between the rs7566605 SNP with obesity and other metabolic parameters in Malaysian Malays. Anthropometric and obesity-related metabolic parameters and DNA samples were collected. We genotyped the rs7566605 polymorphism in 672 subjects using real-time polymerase chain reaction. No significant associations were found between the rs7566605 tagging SNP of INSIG2 with obesity or other metabolic parameters in the Malaysian Malay population. The INSIG2 rs7566605 SNP may not play a role in the development of obesity-related metabolic traits in Malaysian Malays.

  13. Interaction of IFNL3 with insulin resistance, steatosis and lipid metabolism in chronic hepatitis C virus infection.

    PubMed

    Eslam, Mohammed; Booth, David R; George, Jacob; Ahlenstiel, Golo

    2013-11-07

    Metabolic changes are inextricably linked to chronic hepatitis C (CHC). Recently polymorphisms in the IFNL3 (IL28B) region have been shown to be strongly associated with spontaneous and treatment induced recovery from hepatitis C virus (HCV) infection. Further, circumstantial evidence suggests a link between IFNL3 single nucleotide polymorphisms and lipid metabolism, steatosis and insulin resistance in CHC. The emerging picture suggests that the responder genotypes of IFNL3 polymorphisms are associated with a higher serum lipid profile, and less frequent steatosis and insulin resistance. This review analyzes the current data regarding this interaction and its meaning for HCV pathogenesis and disease progression.

  14. Adiponectin gene polymorphisms: Association with childhood obesity

    PubMed Central

    Fraga, Vanêssa Gomes; Gomes, Karina Braga

    2014-01-01

    The current childhood obesity epidemic represents a particular challenge for public health. Understanding of the etiological mechanisms of obesity remains integral in treating this complex disorder. In recent years, studies have elucidated the influence of hormones secreted by adipose tissue named adipokines. Adiponectin is a adipokine that exhibits important anti-inflammatory, insulin-sensitizing and anti-atherogenic properties and it is strongly associated to obesity development. It is well known that adiponectin levels decrease with obesity. Furthermore, studies show that some single nucleotide polymorphisms in the gene encoding adiponectin, ADIPOQ, may influence the expression of this protein. The objective of this paper is to provide an up-to-date review of ADIPOQ polymorphisms in the context of childhood obesity. PMID:27625863

  15. Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

    PubMed

    Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

    2017-04-01

    This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. An examination of the association between the 5-HTT promoter region polymorphism and depressogenic attributional styles in childhood

    PubMed Central

    Sheikh, Haroon I.; Hayden, Elizabeth P.; Singh, Shiva M.; Dougherty, Lea R.; Olino, Thomas M.; Durbin, C. Emily; Klein, Daniel N.

    2008-01-01

    Although a vast literature examining the role of attributional styles in depression has accumulated, the origins of such cognitions remain poorly understood. Investigators are increasingly interested in whether cognitive vulnerability to depression is linked to genetic variation. As a preliminary test of this hypothesis, we examined whether the serotonin transporter promoter polymorphism (5-HTTLPR) was associated with attributional styles in children. Thirty-eight children completed a self-report measure of attributional styles, the Child Attributional Style Questionnaire-Revised (CASQ-R). Children were also genotyped for the 5-HTTLPR polymorphism, including the single nucleotide polymorphism (SNP) rs25531 in the long allele of the 5-HTTLPR. The short alleles of the 5-HTTLPR and their putative functional equivalents were associated with increased levels of depressogenic attributions for negative events, as measured by the CASQ-R, lending support to the role of 5-HTTLPR polymorphisms in cognitive vulnerability to depression. PMID:19122845

  17. Estrogen Receptor 1 ( ESR1) Gene Polymorphisms and Obesity Phenotypes in a Population of Young Adults.

    PubMed

    Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; González-Jiménez, Emilio; Rueda-Medina, Blanca

    2017-06-01

    Obesity is considered an increasingly serious health problem determined by multiple genetic and environmental factors. Estrogens have been found to play a major role in body weight and adiposity regulation through estrogen receptor 1 ( ESR1). The aim of this study was to determine whether genotype and haplotype frequencies of ESR1 polymorphisms are associated with body composition measures in a population of 572 young adults. A lack of significant association between genotypes of ESR1 gene polymorphisms and obesity phenotypes was seen after adjustment for confounding factors. Linkage disequilibrium (LD) analysis identified a single LD block for the ESR1 gene including PvuII and XbaI single-nucleotide polymorphisms (SNPs) (pairwise r 2 = .66). None of the haplotypes identified revealed statistically significant associations with any of the obesity phenotypes. Our results suggest that polymorphisms of the ESR1 gene do not contribute significantly to the genetic risk for obesity phenotypes in a population of young Caucasian adults.

  18. [Association analysis between SNPs of the growth hormone receptor gene and growth traits in arctic fox].

    PubMed

    DU, Zhi-Heng; Liu, Zong-Yue; Bai, Xiu-Juan

    2010-06-01

    Using single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing, single nucleotide polymorphisms (SNPs) of growth hormone receptor (GHR) gene were detected in an arctic fox population. Correlation analysis between GHR polymorphisms and growth traits were carried out using the appropriate model. Four SNPs, G3A in the 5'UTR, C99T in the first exon, T59C and G65A in the fifth exon were identified on the arctic fox GHR gene. The G3A and C99T polymorphisms of GHR were associated with female fox body weight (Pamp;0.05) and the T59C and G65A polymorphisms of GHR were associated with male fox body weight (Pamp;0.05) and the skin length of the female fox (Pamp;0.01). Therefore, marker assistant selection on body weight and skin length of arctic foxes using these SNPs can be applied to get big and high quality arctic foxes.

  19. A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

    PubMed

    Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

    2013-12-01

    Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

  20. Association study between single nucleotide polymorphisms in promoter region of AVPR1A and Korean autism spectrum disorders.

    PubMed

    Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae

    2010-08-02

    To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  1. [Characterisation of three polymorphisms of the tryptophan hydroxylase 2 gene in a sample of Colombian population with major depressive disorder].

    PubMed

    Martínez-Idárraga, Adriana; Riveros-Barrera, Irene; Sánchez, Ricardo; Jaramillo, Luis Eduardo; Calvo-Gómez, José Manuel; Yunis-Londoño, Juan José

    Identify whether rs11179000, rs136494 and rs4570625 polymorphisms of the tryptophan hydroxylase 2 gene, are associated with a major depressive disorder in a sample of the Colombian population. Case-control study was conducted in which a comparison was made between subjects diagnosed with major depressive disorder at some point in adulthood or active symptoms at the time of evaluation, and subjects with no psychiatric disease. Subjects were studied in the Department of Psychiatry, Faculty of Medicine and the Institute of Genetics at the National University of Colombia. Polymorphisms were genotyped using Taqman probes in real time PCR. As well as studying the association between major depressive disorder and these (single nucleotide polymorphisms (SNPs), the association with other factors previously associated with depression were also analysed. No statistically significant association between genotypic and allelic frequencies of each polymorphism and major depressive disorder was found. Association between sex and complication during pregnancy / childbirth and major depressive disorder was observed. Association between sex and complication during pregnancy / childbirth and major depressive disorder was observed. There was no association between any polymorphism and major depressive disorder. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  2. Predicting stroke through genetic risk functions: the CHARGE Risk Score Project.

    PubMed

    Ibrahim-Verbaas, Carla A; Fornage, Myriam; Bis, Joshua C; Choi, Seung Hoan; Psaty, Bruce M; Meigs, James B; Rao, Madhu; Nalls, Mike; Fontes, Joao D; O'Donnell, Christopher J; Kathiresan, Sekar; Ehret, Georg B; Fox, Caroline S; Malik, Rainer; Dichgans, Martin; Schmidt, Helena; Lahti, Jari; Heckbert, Susan R; Lumley, Thomas; Rice, Kenneth; Rotter, Jerome I; Taylor, Kent D; Folsom, Aaron R; Boerwinkle, Eric; Rosamond, Wayne D; Shahar, Eyal; Gottesman, Rebecca F; Koudstaal, Peter J; Amin, Najaf; Wieberdink, Renske G; Dehghan, Abbas; Hofman, Albert; Uitterlinden, André G; Destefano, Anita L; Debette, Stephanie; Xue, Luting; Beiser, Alexa; Wolf, Philip A; Decarli, Charles; Ikram, M Arfan; Seshadri, Sudha; Mosley, Thomas H; Longstreth, W T; van Duijn, Cornelia M; Launer, Lenore J

    2014-02-01

    Beyond the Framingham Stroke Risk Score, prediction of future stroke may improve with a genetic risk score (GRS) based on single-nucleotide polymorphisms associated with stroke and its risk factors. The study includes 4 population-based cohorts with 2047 first incident strokes from 22,720 initially stroke-free European origin participants aged ≥55 years, who were followed for up to 20 years. GRSs were constructed with 324 single-nucleotide polymorphisms implicated in stroke and 9 risk factors. The association of the GRS to first incident stroke was tested using Cox regression; the GRS predictive properties were assessed with area under the curve statistics comparing the GRS with age and sex, Framingham Stroke Risk Score models, and reclassification statistics. These analyses were performed per cohort and in a meta-analysis of pooled data. Replication was sought in a case-control study of ischemic stroke. In the meta-analysis, adding the GRS to the Framingham Stroke Risk Score, age and sex model resulted in a significant improvement in discrimination (all stroke: Δjoint area under the curve=0.016, P=2.3×10(-6); ischemic stroke: Δjoint area under the curve=0.021, P=3.7×10(-7)), although the overall area under the curve remained low. In all the studies, there was a highly significantly improved net reclassification index (P<10(-4)). The single-nucleotide polymorphisms associated with stroke and its risk factors result only in a small improvement in prediction of future stroke compared with the classical epidemiological risk factors for stroke.

  3. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    PubMed Central

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  4. Association of a single-nucleotide polymorphism in the promoter region of the VEGF gene with the risk of renal cell carcinoma.

    PubMed

    Ajaz, Sadia; Khaliq, Shagufta; Abid, Aiysha; Hassan, Asad Shehzad; Hashmi, Altaf; Sultan, Gauhar; Mohsin, Rehan; Mubarrak, Mohammad; Naqvi, Syed Ali Anwar; Rizvi, Syed Adib-ul-Hasan; Mehdi, Syed Qasim

    2011-09-01

    Vascular endothelial growth factor (VEGF) protein plays an important role in tumor development and progression. Polymorphisms in the VEGF gene may lead to over- or underexpression of the protein and may be associated with either risk or progression of malignancy. The aim of this case-control study is to identify and quantify the correlation between VEGF polymorphisms and renal cell carcinoma (RCC). Restriction fragment length polymorphism methods were used for the analysis of VEGF polymorphisms at -2578 and +936 positions in the promoter and 3'-untranslated regions, respectively. The VEGF -2578 A-allele was associated with an increased risk of RCC (odds ratio: 1.6; 95% CI: 1.2-2.3) and A-carrier genotypes were strongly correlated (odds ratio: 2.7; 95% CI: 1.5-4.7) with higher risk. Comparison of VEGF +936 C/T polymorphism between patient and control groups revealed no association with renal carcinoma. Both VEGF -2578 C/A and VEGF +936 C/T polymorphisms showed no significant association with the histopathological parameters of RCC. This study shows that VEGF -2578 A-allele and A-carrier genotypes are associated with an increased risk of RCC. In groups with higher incidence of RCC, a screening test for this polymorphism may be recommended in conjunction with other established markers.

  5. Catalog of MicroRNA Seed Polymorphisms in Vertebrates

    PubMed Central

    Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja

    2012-01-01

    MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453

  6. An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau.

    PubMed

    Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

    2014-12-01

    Hemoglobin concentration at high altitude is considered an important marker of high altitude adaptation, and native Tibetans in the Qinghai-Tibetan plateau show lower hemoglobin concentrations than Han people who have emigrated from plains areas. Genetic studies revealed that EPAS1 plays a key role in high altitude adaptation and is associated with the low hemoglobin concentration in Tibetans. Three single nucleotide polymorphisms (rs13419896, rs4953354, rs1868092) of noncoding regions in EPAS1 exhibited significantly different allele frequencies in the Tibetan and Han populations and were associated with low hemoglobin concentrations in Tibetans. To explore the hereditary basis of high altitude polycythemia (HAPC) and investigate the association between EPAS1 and HAPC in the Han population, these 3 single nucleotide polymorphisms were assessed in 318 male Han Chinese HAPC patients and 316 control subjects. Genotyping was performed by high resolution melting curve analysis. The G-G-G haplotype of rs13419896, rs4953354, and rs1868092 was significantly more frequent in HAPC patients than in control subjects, whereas no differences in the allele or genotype frequencies of the 3 single nucleotide polymorphisms were found between HAPC patients and control subjects. Moreover, genotypes of rs1868092 (AA) and rs4953354 (GG) that were not observed in the Chinese Han in the Beijing population were found at frequencies of 1.6% and 0.9%, respectively, in our study population of HAPC patients and control subjects. Carriers of this EPAS1 haplotype (G-G-G, rs13419896, rs4953354, and rs1868092) may have a higher risk for HAPC. These results may contribute to a better understanding of the pathogenesis of HAPC in the Han population. Copyright © 2014 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  7. Inosine triphosphatase polymorphisms and ribavirin pharmacokinetics as determinants of ribavirin-associate anemia in patients receiving standard anti-HCV treatment.

    PubMed

    DʼAvolio, Antonio; Ciancio, Alessia; Siccardi, Marco; Smedile, Antonina; Baietto, Lorena; Simiele, Marco; Marucco, Diego Aguilar; Cariti, Giuseppe; Calcagno, Andrea; de Requena, Daniel Gonzalez; Sciandra, Mauro; Cusato, Jessica; Troshina, Giulia; Bonora, Stefano; Rizzetto, Mario; Di Perri, Giovanni

    2012-04-01

    Functional variants of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of plasma RBV concentrations on hemoglobin (Hb) decrement. Moreover, no data have been published on the possible interplay between these 2 factors. A retrospective analysis included 167 patients. The ITPA variants rs7270101 and rs1127354 were genotyped and tested using the χ test for association with Hb reduction at week 4. We also investigated, using multivariate logistic regression, the impact of RBV plasma exposure on Hb concentrations. Both single nucleotide polymorphisms were associated with Hb decrease. The carrier of at least 1 variant allele in the functional ITPA single nucleotide polymorphisms was associated with a lower decrement of Hb (-1.1 g/dL), as compared with patients without a variant allele (-2.75 g/dL; P = 4.09 × 10). RBV concentrations were not influenced by ITPA genotypes. A cut-off of 2.3 μg/mL of RBV was found to be associated with anemia (area-under-receiver operating characteristic = 0.630, sensitivity = 50.0%, and specificity = 69.5%, P = 0.008). In multivariate logistic regression analyses, the carrier of a variant allele (P = 0.005) and plasma RBV concentrations <2.3 μg/mL (P = 0.016) were independently associated with protection against clinically significant anemia at week 4. Although no direct relationship was found between ITPA polymorphisms and plasma RBV concentrations, both factors were shown to be significantly associated with anemia. A multivariate regression model based on ITPA genetic polymorphisms and RBV trough concentration was developed for predicting the risk of anemia. By relying upon these 2 variables, an individualized management of anemia seems to be feasible in recipients of pegylated interferon-RBV therapy.

  8. A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers.

    PubMed

    Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado

    2017-11-01

    Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.

  9. Variation in the γ-glutamyltransferase 1 gene and risk of chronic pancreatitis.

    PubMed

    Brand, Harrison; Diergaarde, Brenda; O'Connell, Michael R; Whitcomb, David C; Brand, Randall E

    2013-07-01

    Individuals with chronic pancreatitis are at increased risk for pancreatic cancer. We hypothesized that genetic variation in the γ-glutamyltransferase 1 (GGT1) gene, which was recently reported associated with pancreatic cancer risk in a genome-wide association study, is also associated with risk of chronic pancreatitis. Associations between common polymorphisms in GGT1 and chronic pancreatitis were evaluated using data and samples from the North American Pancreatitis Study 2. Patients (n = 496) and control subjects (n = 465) were genotyped for 4 single-nucleotide polymorphisms: rs4820599, rs2017869, rs8135987, and rs5751901. Odds ratios (ORs) and corresponding 95% confidence intervals (95% CI) for chronic pancreatitis risk were calculated using multiple logistic regression models. Interactions with cigarette smoking and alcohol use were explored. Single-nucleotide polymorphisms rs8135987 and rs4820599 were both statistically significantly associated with risk of chronic pancreatitis; compared with common allele homozygotes, individuals with at least 1 minor allele were at increased risk (rs8135987: OR, 1.36; 95% CI, 1.03-1.80 [P(trend) = 0.01]; rs4820599: OR, 1.39; 95% CI, 1.04-1.84 [P(trend) = 0.0]; adjusted for age, sex, race, smoking status, and alcohol use). No significant interactions with cigarette smoking and alcohol use were observed. Our results suggest that common variation in the GGT1 gene may also affect risk of chronic pancreatitis.

  10. Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

    PubMed Central

    Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

    2013-01-01

    Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

  11. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  12. Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility

    DTIC Science & Technology

    2006-03-01

    familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late onset, typical PD have not shown...association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct haplotypes based on the SNP...derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome-wide SNP

  13. Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

    PubMed Central

    Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

    2012-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

  14. Identification of the Q969R gain-of-function polymorphism in the gene encoding porcine NLRP3 and its distribution in pigs of Asian and European origin.

    PubMed

    Tohno, Masanori; Shinkai, Hiroki; Toki, Daisuke; Okumura, Naohiko; Tajima, Kiyoshi; Uenishi, Hirohide

    2016-10-01

    The nucleotide-binding domain, leucine-rich-containing family, pyrin-domain containing-3 (NLRP3) inflammasome comprises the major components caspase-1, apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC), and NLRP3. NLRP3 plays important roles in maintaining immune homeostasis mediated by intestinal microorganisms and in the immunostimulatory properties of vaccine adjuvants used to induce an immune response. In the present study, we first cloned a complementary DNA (cDNA) encoding porcine ASC because its genomic sequence was not completely determined. The availability of the ASC cDNA enabled us to reconstitute porcine NLRP3 inflammasomes using an in vitro system that led to the identification of the immune functions of porcine NLRP3 and ASC based on the production of interleukin-1β (IL-1β). Further, we identified six synonymous and six nonsynonymous single-nucleotide polymorphisms (SNPs) in the coding sequence of NLRP3 of six breeds of pigs, including major commercial breeds. Among the nonsynonymous SNPs, the Q969R polymorphism is associated with an increased release of IL-1β compared with other porcine NLRP3 variants, indicating that this polymorphism represents a gain-of-function mutation. This allele was detected in 100 % of the analyzed Chinese Jinhua and Japanese wild boars, suggesting that the allele is maintained in the major commercial native European breeds Landrace, Large White, and Berkshire. These findings represent an important contribution to our knowledge of the diversity of NLRP3 nucleotide sequences among various pig populations. Moreover, efforts to exploit the gain of function induced by the Q969R polymorphism promise to improve pig breeding and husbandry by conferring enhanced resistance to pathogens as well as contributing to vaccine efficacy.

  15. Bison PRNP genotyping and potential association with Brucella spp. seroprevalence

    USGS Publications Warehouse

    Seabury, C.M.; Halbert, N.D.; Gogan, P.J.P.; Templeton, J.W.; Derr, J.N.

    2005-01-01

    The implication that host cellular prion protein (PrPC) may function as a cell surface receptor and/or portal protein for Brucella abortus in mice prompted an evaluation of nucleotide and amino acid variation within exon 3 of the prion protein gene (PRNP) for six US bison populations. A non-synonymous single nucleotide polymorphism (T50C), resulting in the predicted amino acid replacement M17T (Met ??? Thr), was identified in each population. To date, no variation (T50: Met) has been detected at the corresponding exon 3 nucleotide and/or amino acid position for domestic cattle. Notably, 80% (20 of 25) of the Yellowstone National Park bison possessing the C/C genotype were Brucella spp. seropositive, representing a significant (P = 0.021) association between seropositivity and the C/C genotypic class. Moreover, significant differences in the distribution of PRNP exon 3 alleles and genotypes were detected between Yellowstone National Park bison and three bison populations that were either founded from seronegative stock or previously subjected to test-and-slaughter management to eradicate brucellosis. Unlike domestic cattle, no indel polymorphisms were detected within the corresponding regions of the putative bison PRNP promoter, intron 1, octapeptide repeat region or 3???-untranslated region for any population examined. This study provides the first evidence of a potential association between nucleotide variation within PRNP exon 3 and the presence of Brucella spp. antibodies in bison, implicating PrPC in the natural resistance of bison to brucellosis infection. ?? 2005 International Society for Animal Genetics.

  16. Turner syndrome and genetic polymorphism: a systematic review

    PubMed Central

    de Marqui, Alessandra Bernadete Trovó

    2015-01-01

    Objective: To present the main results of the literature on genetic polymorphisms in Turner syndrome and their association with the clinical signs and the etiology of this chromosomal disorder. Data sources: The review was conducted in the PubMed database without any time limit, using the terms Turner syndrome and genetic polymorphism. A total of 116 articles were found, and based on the established inclusion and exclusion criteria 17 were selected for the review. Data synthesis: The polymorphisms investigated in patients with Turner syndrome were associated with growth deficit, causing short stature, low bone mineral density, autoimmunity and cardiac abnormalities, which are frequently found in patients with Turner syndrome. The role of single nucleotide polymorphisms in the etiology of Turner syndrome, i.e., in chromosomal nondisjunction, was also confirmed. Conclusions: Genetic polymorphisms appear to be associated with Turner syndrome. However, in view of the small number of published studies and their contradictory findings, further studies in different populations are needed in order to clarify the role of genetic variants in the clinical signs and etiology of the Turner syndrome. PMID:25765448

  17. Correlation of MSH3 polymorphisms with response and survival in advanced non-small cell lung cancer patients treated with first-line platinum-based chemotherapy.

    PubMed

    Xu, X-L; Yao, Y-L; Xu, W-Z; Feng, J-G; Mao, W-M

    2015-04-15

    Mismatch repair (MMR) genes, as well as the nucleotide excision repair genes, play an important role in removing cisplatin-DNA adducts, and the mutation of MMR genes in tumors can lead to a decreased response to platinum-based therapies. We examined MutS homolog 3 (MSH3), a mismatch repair gene, and whether polymorphisms of MSH3 were associated with response and survival in advanced non-small cell lung cancer (NCSLC) patients who were treated with platinum-based chemotherapy. The peripheral blood of 180 advanced NCSLC patients who were treated with first-line platinum-based chemotherapy was collected to determine the patients' genotypes of MSH3. The three genotypes of the MSH3 polymorphisms rs26279, rs1650697 and rs1105524 were investigated. A statistically significant association was observed between the polymorphism rs26279 (Ala1054Thr) and sensitivity to platinum-based chemotherapy (P = 0.014). A significant correlation was found between rs1105524 and progression-free survival (PFS), with the G/A and A/A genotypes (median survival time: 14.27 months; 95%CI = 9.80-18.75) suffering shorter survival than patients with the G/G genotype (median survival time: 26.37 months; 95%CI = 15.03-37.71) (P = 0.04). Our results showed that single nucleotide polymorphisms in MSH3 had an impact on the chemotherapy response and prognosis of advanced NCSLC patients who were treated with platinum-based chemotherapy.

  18. Unsupportive social interactions and affective states: examining associations of two oxytocin-related polymorphisms.

    PubMed

    McInnis, Opal A; McQuaid, Robyn J; Matheson, Kimberly; Anisman, Hymie

    2017-01-01

    Two single-nucleotide polymorphisms (SNPs) on oxytocin-related genes, specifically the oxytocin receptor (OXTR) rs53576 and the CD38 rs3796863 variants, have been associated with alterations in prosocial behaviors. A cross-sectional study was conducted among undergraduate students (N = 476) to examine associations between the OXTR and CD38 polymorphisms and unsupportive social interactions and mood states. Results revealed no association between perceived levels of unsupportive social interactions and the OXTR polymorphism. However, A carriers of the CD38 polymorphism, a variant previously associated with elevated oxytocin, reported greater perceived peer unsupportive interactions compared to CC carriers. As expected, perceived unsupportive interactions from peers was associated with greater negative affect, which was moderated by the CD38 polymorphism. Specifically, this relation was stronger among CC carriers of the CD38 polymorphism (a variant thought to be linked to lower oxytocin). When examining whether the OXTR polymorphism moderated the relation between unsupportive social interactions from peers and negative affect there was a trend toward significance, however, this did not withstand multiple testing corrections. These findings are consistent with the perspective that a variant on an oxytocin polymorphism that may be tied to lower oxytocin is related to poor mood outcomes in association with negative social interactions. At the same time, having a genetic constitution presumed to be associated with higher oxytocin was related to increased perceptions of unsupportive social interactions. These seemingly paradoxical findings could be related to previous reports in which variants associated with prosocial behaviors were also tied to relatively more effective coping styles to deal with challenges.

  19. Genome-wide association and genomic prediction identifies associated loci and predicts the sensitivity of Tobacco ringspot virus in soybean plant introduction

    USDA-ARS?s Scientific Manuscript database

    The genome-wide association study (GWAS) is a useful tool for detecting and characterizing traits of interest including those associated with disease resistance in soybean. The availability of 50,000 single nucleotide polymorphism (SNP) markers (SoySNP50K iSelect BeadChip; www.soybase.org) on 19,652...

  20. Impact of genomic polymorphisms on the repertoire of human MHC class I-associated peptides

    PubMed Central

    Granados, Diana Paola; Sriranganadane, Dev; Daouda, Tariq; Zieger, Antoine; Laumont, Céline M.; Caron-Lizotte, Olivier; Boucher, Geneviève; Hardy, Marie-Pierre; Gendron, Patrick; Côté, Caroline; Lemieux, Sébastien; Thibault, Pierre; Perreault, Claude

    2014-01-01

    For decades, the global impact of genomic polymorphisms on the repertoire of peptides presented by major histocompatibility complex (MHC) has remained a matter of speculation. Here we present a novel approach that enables high-throughput discovery of polymorphic MHC class I-associated peptides (MIPs), which play a major role in allorecognition. On the basis of comprehensive analyses of the genomic landscape of MIPs eluted from B lymphoblasts of two MHC-identical siblings, we show that 0.5% of non-synonymous single nucleotide variations are represented in the MIP repertoire. The 34 polymorphic MIPs found in our subjects are encoded by bi-allelic loci with dominant and recessive alleles. Our analyses show that, at the population level, 12% of the MIP-coding exome is polymorphic. Our method provides fundamental insights into the relationship between the genomic self and the immune self and accelerates the discovery of polymorphic MIPs (also known as minor histocompatibility antigens). PMID:24714562

  1. Polymorphisms in nucleotide excision repair genes and risk of primary prostate cancer in Chinese Han populations.

    PubMed

    Wang, Mengyun; Li, Qiaoxin; Gu, Chengyuan; Zhu, Yao; Yang, Yajun; Wang, Jiucun; Jin, Li; He, Jing; Ye, Dingwei; Wei, Qingyi

    2017-04-11

    Genetic variants of nucleotide excision repair (NER) genes have been extensively investigated for their roles in the development of prostate cancer (PCa); however, the published results have been inconsistent. In a hospital-based case-control study of 1,004 PCa cases and 1,055 cancer-free controls, we genotyped eight potentially functional single nucleotide polymorphisms (SNPs) of NER genes (i.e., XPC, rs2228001 T>G and rs1870134 G>C; XPD, rs13181 T>G and rs238406 G>T; XPG, rs1047768 T>C, rs751402 C>T, and rs17655 G>C; and XPF, rs2276464 G>C) and assessed their associations with risk of PCa by using logistic regression analysis. Among these eight SNPs investigated, only XPC rs1870134 CG/CC variant genotypes were associated with a decreased risk of prostate cancer under a dominant genetic model (adjusted odds ratio [OR] = 0.77, 95% confidence interval [CI] = 0.64-1.91, P = 0.003). Phenotype-genotype analysis also suggested that the XPC rs1870134 CG/CC variant genotypes were associated with significantly decreased expression levels of XPC mRNA in a mix population of different ethnicities. These findings suggested that XPC SNPs may contribute to risk of PCa in Eastern Chinese men.

  2. Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

    USGS Publications Warehouse

    Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori

    2010-01-01

    Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

  3. Association of bovine leptin polymorphisms with energy output and energy storage traits in progeny tested Holstein-Friesian dairy cattle sires

    PubMed Central

    2010-01-01

    Background Leptin modulates appetite, energy expenditure and the reproductive axis by signalling via its receptor the status of body energy stores to the brain. The present study aimed to quantify the associations between 10 novel and known single nucleotide polymorphisms in genes coding for leptin and leptin receptor with performance traits in 848 Holstein-Friesian sires, estimated from performance of up to 43,117 daughter-parity records per sire. Results All single nucleotide polymorphisms were segregating in this sample population and none deviated (P > 0.05) from Hardy-Weinberg equilibrium. Complete linkage disequilibrium existed between the novel polymorphism LEP-1609, and the previously identified polymorphisms LEP-1457 and LEP-580. LEP-2470 associated (P < 0.05) with milk protein concentration and calf perinatal mortality. It had a tendency to associate with milk yield (P < 0.1). The G allele of LEP-1238 was associated (P < 0.05) with reduced milk fat concentration, reduced milk protein concentration, longer gestation length and tended to associate (P < 0.1) with an increase in calving difficulty, calf perinatal mortality and somatic cells in the milk. LEP-963 exhibited an association (P < 0.05) with milk fat concentration, milk protein concentration, calving difficulty and gestation length. It also tended to associate with milk yield (P < 0.1). The R25C SNP associated (P < 0.05) with milk fat concentration, milk protein concentration, calving difficulty and length of gestation. The T allele of the Y7F SNP significantly associated with reduced angularity (P < 0.01) and reduced milk protein yield (P < 0.05). There was also a tendency (P < 0.1) for Y7F to associate with increased body condition score, reduced milk yield and shorter gestation (P < 0.1). A80V associated with reduced survival in the herd (P < 0.05). Conclusions Several leptin polymorphisms (LEP-2470, LEP-1238, LEP-963, Y7F and R25C) associated with the energetically expensive process of lactogenesis. Only SNP Y7F associated with energy storage. Associations were also observed between leptin polymorphisms and calving difficulty, gestation length and calf perinatal mortality. The lack of an association between the leptin variants investigated with calving interval in this large data set would question the potential importance of these leptin variants, or indeed leptin, in selection for improved fertility in the Holstein-Friesian dairy cow. PMID:20670403

  4. Re-sequencing of the APOAI promoter region and the genetic association of the -75G > A polymorphism with increased cholesterol and low density lipoprotein levels among a sample of the Kuwaiti population

    PubMed Central

    2013-01-01

    Background APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. Methods A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. Results The target sequence included a partial segment of the promoter region, 5’UTR and exon 1 located between nucleotides −141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. Conclusion This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport. PMID:24028463

  5. Re-sequencing of the APOAI promoter region and the genetic association of the -75G > A polymorphism with increased cholesterol and low density lipoprotein levels among a sample of the Kuwaiti population.

    PubMed

    Al-Bustan, Suzanne A; Al-Serri, Ahmad E; Annice, Babitha G; Alnaqeeb, Majed A; Ebrahim, Ghada A

    2013-09-12

    APOAI, a member of the APOAI/CIII/IV/V gene cluster on chromosome 11q23-24, encodes a major protein component of HDL that has been associated with serum lipid levels. The aim of this study was to determine the genetic association of polymorphisms in the APOAI promoter region with plasma lipid levels in a cohort of healthy Kuwaiti volunteers. A 435 bp region of the APOAI promoter was analyzed by re-sequencing in 549 Kuwaiti samples. DNA was extracted from blood taken from 549 healthy Kuwaiti volunteers who had fasted for the previous 12 h. Univariate and multivariate analysis was used to determine allele association with serum lipid levels. The target sequence included a partial segment of the promoter region, 5'UTR and exon 1 located between nucleotides -141 to +294 upstream of the APOAI gene on chromosome 11. No novel single nucleotide polymorphisms (SNPs) were observed. The sequences obtained were deposited with the NCBI GenBank with accession number [GenBank: JX438706]. The allelic frequencies for the three SNPs were as follows: APOAI rs670G = 0.807; rs5069C = 0.964; rs1799837G = 0.997 and found to be in HWE. A significant association (p < 0.05) was observed for the APOAI rs670 polymorphism with increased serum LDL-C. Multivariate analysis showed that APOAI rs670 was an independent predictive factor when controlling for age, sex and BMI for both LDL-C (OR: 1.66, p = 0.014) and TC (OR: 1.77, p = 0.006) levels. This study is the first to report sequence analysis of the APOAI promoter in an Arab population. The unexpected positive association found between the APOAI rs670 polymorphism and increased levels of LDL-C and TC may be due to linkage disequilibrium with other polymorphisms in candidate and neighboring genes known to be associated with lipid metabolism and transport.

  6. Stress and Bronchodilator Response in Children with Asthma

    PubMed Central

    Brehm, John M.; Ramratnam, Sima K.; Tse, Sze Man; Croteau-Chonka, Damien C.; Pino-Yanes, Maria; Rosas-Salazar, Christian; Litonjua, Augusto A.; Raby, Benjamin A.; Boutaoui, Nadia; Han, Yueh-Ying; Chen, Wei; Forno, Erick; Marsland, Anna L.; Nugent, Nicole R.; Eng, Celeste; Colón-Semidey, Angel; Alvarez, María; Acosta-Pérez, Edna; Spear, Melissa L.; Martinez, Fernando D.; Avila, Lydiana; Weiss, Scott T.; Soto-Quiros, Manuel; Ober, Carole; Nicolae, Dan L.; Barnes, Kathleen C.; Lemanske, Robert F.; Strunk, Robert C.; Liu, Andrew; London, Stephanie J.; Gilliland, Frank; Sleiman, Patrick; March, Michael; Hakonarson, Hakon; Duan, Qing Ling; Kolls, Jay K.; Fritz, Gregory K.; Hu, Donglei; Fani, Negar; Stevens, Jennifer S.; Almli, Lynn M.; Burchard, Esteban G.; Shin, Jaemin; McQuaid, Elizabeth L.; Ressler, Kerry; Canino, Glorisa

    2015-01-01

    Rationale: Stress is associated with asthma morbidity in Puerto Ricans (PRs), who have reduced bronchodilator response (BDR). Objectives: To examine whether stress and/or a gene regulating anxiety (ADCYAP1R1) is associated with BDR in PR and non-PR children with asthma. Methods: This was a cross-sectional study of stress and BDR (percent change in FEV1 after BD) in 234 PRs ages 9–14 years with asthma. We assessed child stress using the Checklist of Children’s Distress Symptoms, and maternal stress using the Perceived Stress Scale. Replication analyses were conducted in two cohorts. Polymorphisms in ADCYAP1R1 were genotyped in our study and six replication studies. Multivariable models of stress and BDR were adjusted for age, sex, income, environmental tobacco smoke, and use of inhaled corticosteroids. Measurements and Main Results: High child stress was associated with reduced BDR in three cohorts. PR children who were highly stressed (upper quartile, Checklist of Children’s Distress Symptoms) and whose mothers had high stress (upper quartile, Perceived Stress Scale) had a BDR that was 10.2% (95% confidence interval, 6.1–14.2%) lower than children who had neither high stress nor a highly stressed mother. A polymorphism in ADCYAP1R1 (rs34548976) was associated with reduced BDR. This single-nucleotide polymorphism is associated with reduced expression of the gene for the β2-adrenergic receptor (ADRB2) in CD4+ lymphocytes of subjects with asthma, and it affects brain connectivity of the amygdala and the insula (a biomarker of anxiety). Conclusions: High child stress and an ADCYAP1R1 single-nucleotide polymorphism are associated with reduced BDR in children with asthma. This is likely caused by down-regulation of ADRB2 in highly stressed children. PMID:25918834

  7. Stress and Bronchodilator Response in Children with Asthma.

    PubMed

    Brehm, John M; Ramratnam, Sima K; Tse, Sze Man; Croteau-Chonka, Damien C; Pino-Yanes, Maria; Rosas-Salazar, Christian; Litonjua, Augusto A; Raby, Benjamin A; Boutaoui, Nadia; Han, Yueh-Ying; Chen, Wei; Forno, Erick; Marsland, Anna L; Nugent, Nicole R; Eng, Celeste; Colón-Semidey, Angel; Alvarez, María; Acosta-Pérez, Edna; Spear, Melissa L; Martinez, Fernando D; Avila, Lydiana; Weiss, Scott T; Soto-Quiros, Manuel; Ober, Carole; Nicolae, Dan L; Barnes, Kathleen C; Lemanske, Robert F; Strunk, Robert C; Liu, Andrew; London, Stephanie J; Gilliland, Frank; Sleiman, Patrick; March, Michael; Hakonarson, Hakon; Duan, Qing Ling; Kolls, Jay K; Fritz, Gregory K; Hu, Donglei; Fani, Negar; Stevens, Jennifer S; Almli, Lynn M; Burchard, Esteban G; Shin, Jaemin; McQuaid, Elizabeth L; Ressler, Kerry; Canino, Glorisa; Celedón, Juan C

    2015-07-01

    Stress is associated with asthma morbidity in Puerto Ricans (PRs), who have reduced bronchodilator response (BDR). To examine whether stress and/or a gene regulating anxiety (ADCYAP1R1) is associated with BDR in PR and non-PR children with asthma. This was a cross-sectional study of stress and BDR (percent change in FEV1 after BD) in 234 PRs ages 9-14 years with asthma. We assessed child stress using the Checklist of Children's Distress Symptoms, and maternal stress using the Perceived Stress Scale. Replication analyses were conducted in two cohorts. Polymorphisms in ADCYAP1R1 were genotyped in our study and six replication studies. Multivariable models of stress and BDR were adjusted for age, sex, income, environmental tobacco smoke, and use of inhaled corticosteroids. High child stress was associated with reduced BDR in three cohorts. PR children who were highly stressed (upper quartile, Checklist of Children's Distress Symptoms) and whose mothers had high stress (upper quartile, Perceived Stress Scale) had a BDR that was 10.2% (95% confidence interval, 6.1-14.2%) lower than children who had neither high stress nor a highly stressed mother. A polymorphism in ADCYAP1R1 (rs34548976) was associated with reduced BDR. This single-nucleotide polymorphism is associated with reduced expression of the gene for the β2-adrenergic receptor (ADRB2) in CD4(+) lymphocytes of subjects with asthma, and it affects brain connectivity of the amygdala and the insula (a biomarker of anxiety). High child stress and an ADCYAP1R1 single-nucleotide polymorphism are associated with reduced BDR in children with asthma. This is likely caused by down-regulation of ADRB2 in highly stressed children.

  8. Association Mapping of Disease Resistance Traits in Rainbow Trout Using Restriction Site Associated DNA Sequencing

    PubMed Central

    Campbell, Nathan R.; LaPatra, Scott E.; Overturf, Ken; Towner, Richard; Narum, Shawn R.

    2014-01-01

    Recent advances in genotyping-by-sequencing have enabled genome-wide association studies in nonmodel species including those in aquaculture programs. As with other aquaculture species, rainbow trout and steelhead (Oncorhynchus mykiss) are susceptible to disease and outbreaks can lead to significant losses. Fish culturists have therefore been pursuing strategies to prevent losses to common pathogens such as Flavobacterium psychrophilum (the etiological agent for bacterial cold water disease [CWD]) and infectious hematopoietic necrosis virus (IHNV) by adjusting feed formulations, vaccine development, and selective breeding. However, discovery of genetic markers linked to disease resistance offers the potential to use marker-assisted selection to increase resistance and reduce outbreaks. For this study we sampled juvenile fish from 40 families from 2-yr classes that either survived or died after controlled exposure to either CWD or IHNV. Restriction site−associated DNA sequencing produced 4661 polymorphic single-nucleotide polymorphism loci after strict filtering. Genotypes from individual survivors and mortalities were then used to test for association between disease resistance and genotype at each locus using the program TASSEL. After we accounted for kinship and stratification of the samples, tests revealed 12 single-nucleotide polymorphism markers that were highly associated with resistance to CWD and 19 markers associated with resistance to IHNV. These markers are candidates for further investigation and are expected to be useful for marker assisted selection in future broodstock selection for various aquaculture programs. PMID:25354781

  9. Association of PTPN22 with rheumatoid arthritis among South Asians in the UK.

    PubMed

    Mastana, Sarabjit; Gilmour, Ashley; Ghelani, Anant; Smith, Hannah; Samanta, Ash

    2007-10-01

    To compare the distribution and assess genetic associations of the PTPN22 R620W single-nucleotide polymorphism among South Asian (Asiatic Indian) patients with rheumatoid arthritis (RA) and ethnically matched controls. DNA samples from 133 rheumatoid factor-positive South Asian RA patients and 149 control subjects from the East Midlands of the UK were genotyped for PTPN22 R620W polymorphism. Genotyping was performed by the polymerase chain reaction-restriction fragment length polymorphism method. The PTPN22 *T allele frequency was lower than in the Caucasian populations, but the disease association was significant (odds ratio 5.87, 95% confidence interval 1.68-20.52). Similar association was observed for genotypes containing *T allele. Our results suggest that the T variant acts as a susceptibility allele for autoantibody-positive RA among South Asians.

  10. Polymorphisms in RAI and in genes of nucleotide and base excision repair are not associated with risk of testicular cancer.

    PubMed

    Laska, Magdalena J; Nexø, Bjørn A; Vistisen, Kirsten; Poulsen, Henrik Enghusen; Loft, Steffen; Vogel, Ulla

    2005-07-28

    Testicular cancer has been suggested to be primed in utero and there is familiar occurrence, particularly brothers and sons of men with testicular cancer have increased risk. Although no specific causative genotoxic agents have been identified, variations in DNA repair capacity could be associated with the risk of testicular cancer. A case-control study of 184 testicular cancer cases and 194 population-based controls living in the Copenhagen Greater Area in Denmark was performed. We found that neither polymorphisms in several DNA repair genes nor alleles of several polymorphisms in the chromosomal of region 19q13.2-3, encompassing the genes ASE, ERCC1, RAI and XPD, were associated with risk of testicular cancer in Danish patients. This is in contrast to other cancers, where we reported strong associations between polymorphisms in ERCC1, ASE and RAI and occurrence of basal cell carcinoma, breast cancer and lung. To our knowledge this is the first study of DNA repair gene polymorphisms and risk of testicular cancer.

  11. The association of ghrelin polymorphisms with coronary artery disease and ischemic chronic heart failure in an elderly Chinese population.

    PubMed

    Zhang, Qin; Huang, Wei-Dong; Lv, Xue-Ying; Yang, Yun-Mei

    2011-04-01

    To investigate the association of coronary artery disease (CAD) and ischemic heart failure (IHF) with polymorphisms of the ghrelin gene in elderly Chinese patients. Fifty-six patients with ischemic heart failure, sixty patients with coronary artery disease without heart failure, and one hundred healthy control subjects participated in the study. The polymorphisms were evaluated by polymerase chain reaction, sequencing, and fragment length polymorphism analysis. Only one single nucleotide polymorphism (SNP), Leu72Met (408C/A), was observed across all samples. Gene frequencies of CC and allele frequencies of C were significantly greater in the CAD with IHF group than those in the CAD without IHF group (p=0.025, p=0.011). There was no significant association between the Leu72Met SNP with coronary artery disease risk factors. Our results suggest that a C allele at position 408 of the ghrelin gene is associated with genetic susceptibility to ischemic heart failure in Chinese elders. Copyright © 2010 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  12. Polymorphisms in the non-muscle myosin heavy chain 9 gene (MYH9) are strongly associated with end-stage renal disease historically attributed to hypertension in African Americans

    PubMed Central

    Freedman, Barry I.; Hicks, Pamela J.; Bostrom, Meredith A.; Cunningham, Mary E.; Liu, Yongmei; Divers, Jasmin; Kopp, Jeffrey B.; Winkler, Cheryl A.; Nelson, George W.; Langefeld, Carl D.; Bowden, Donald W.

    2009-01-01

    African Americans have high incidence rates of end-stage renal disease (ESRD) labeled as due to hypertension. As recent studies showed strong association with idiopathic and HIV-related focal segmental glomerulosclerosis and non-muscle myosin heavy chain 9 (MYH9) gene polymorphisms in this ethnic group, we tested for MYH9 associations in a variety of kidney diseases. Fifteen MYH9 single-nucleotide polymorphisms were evaluated in 175 African Americans with chronic glomerulonephritis-associated ESRD, 696 African Americans reportedly with hypertension-associated ESRD, and 948 control subjects without kidney disease. Significant associations were detected with 14 of the 15 polymorphisms in all 871 non-diabetic patients with ESRD. In hypertension-associated ESRD cases alone, significant associations were found with 13 MYH9 polymorphisms and the previously reported E1 haplotype. Thus, hypertension-associated ESRD in African Americans is substantially related to MYH9 gene polymorphisms and this may explain the poor response to blood pressure control in those diagnosed with hypertensive nephrosclerosis. It is possible that many African Americans classified as having hypertension-associated ESRD have occult MYH9-associated segmental or global glomerulosclerosis. Our study shows that gene-environment and/or gene–gene interactions may initiate kidney disease in genetically susceptible individuals, because African Americans homozygous for MYH9 risk alleles do not universally develop kidney disease. PMID:19177153

  13. Association between AMELX polymorphisms and dental caries in Koreans.

    PubMed

    Kang, S W; Yoon, I; Lee, H W; Cho, J

    2011-05-01

    Dental caries is greatly influenced disease by environmental factors, but recently there are increasing evidences for a genetic component in caries susceptibility. AMELX is the gene coding amelogenin, which is the most important factor for normal enamel development. The aim of this study was to examine the relationship between dental caries and single nucleotide polymorphisms (SNPs) in AMELX. For this study, we used DNA samples collected from 120 unrelated individuals older than 12 years of age. All of them were examined for their oral and dental status under the WHO recommended criteria, and clinical information such as DMFT and DMFS were evaluated. Individuals whose DMFT and DMFS index lower than 2 were designated 'very low caries experience' and higher than 3 were designated 'higher caries experience'. Genomic DNA was extracted from hair samples, and single nucleotide polymorphisms of AMELX were genotyped. Genotyping of three SNPs (rs17878486, rs5933871, rs5934997, intron) in AMELX gene was determined by direct sequencing and analyzed with SNPStats. There were significant associations between rs5933871 and rs5934997 SNP and caries susceptibility in the water fluoridation group. These results suggest that SNPs of AMELX might be associated with dental caries susceptibility in Korean population. © 2010 John Wiley & Sons A/S.

  14. Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern.

    PubMed

    Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F

    2016-04-01

    Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage  = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.

  15. A Single Nucleotide Polymorphism in the Phospholipase D1 Gene is Associated with Risk of Non-Small Cell Lung Cancer

    PubMed Central

    Ahn, Myung-Ju; Park, Shin-Young; Kim, Won Kyu; Cho, Ju Hwan; Chang, Brian Junho; Kim, Dong Jo; Ahn, Jin Seok; Park, Keunchil; Han, Joong-Soo

    2012-01-01

    Phospholipase D (PLD) has an important role in various biological functions including vesicular transport, endocytosis, exocytosis, cell migration, and mitosis. These cellular biological processes are deregulated in the development of various human tumors. In order to explore the relationship between the PLD1 gene and risk of non-small cell lung cancer (NSCLC), single nucleotide polymorphisms (SNP) in the PLD1 exon region were surveyed in 211 NSCLC patients and 205 normal controls. In this study, we identified six SNPs at exon 23 in the PLD1 gene. Among the six SNPs, the most notable was a heterozygous A to C transition at nucleotide 2698 (A2698C, p<0.001). In addition, the genotype frequencies of A2744C (AC+CC) and A2756C (AC+CC) were associated with gender (female, A2744C and A2756C: p=0.071) in NSCLC patients. Interestingly, although the SNP A2698C did not cause change in amino acid, correlation between odd ratio of NSCLC patients and the SNP A2698C was observed to be statistically significant. PMID:23675264

  16. Molecular characterization of the canine mitochondrial DNA control region for forensic applications.

    PubMed

    Eichmann, Cordula; Parson, Walther

    2007-09-01

    The canine mitochondrial DNA (mtDNA) control region of 133 dogs living in the area around Innsbruck, Austria was sequenced. A total of 40 polymorphic sites were observed in the first hypervariable segment and 15 in the second, which resulted in the differentiation of 40 distinct haplotypes. We observed five nucleotide positions that were highly polymorphic within different haplogroups, and they represent good candidates for mtDNA screening. We found five point heteroplasmic positions; all located in HVS-I and a polythymine region in HVS-II, the latter often being associated with length heteroplasmy. In contrast to human mtDNA, the canine control region contains a hypervariable 10 nucleotide repeat region, which is located between the two hypervariable regions. In our population sample, we observed eight different repeat types, which we characterized by direct sequencing and fragment length analysis. The discrimination power of the canine mtDNA control region was 0.93, not taking the polymorphic repeat region into consideration.

  17. Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

    PubMed

    Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

    2009-07-01

    Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

  18. Val66Met Polymorphism of BDNF Alters Prodomain Structure to Induce Neuronal Growth Cone Retraction

    PubMed Central

    Anastasia, Agustin; Deinhardt, Katrin; Chao, Moses V.; Will, Nathan E.; Irmady, Krithi; Lee, Francis S.; Hempstead, Barbara L.; Bracken, Clay

    2013-01-01

    A common single-nucleotide polymorphism in the human brain-derived neurotrophic factor (BDNF) gene results in a Val66Met substitution in the BDNF prodomain region. This single-nucleotide polymorphism is associated with alterations in memory and with enhanced risk to develop depression and anxiety disorders in humans. Here we show that the isolated BDNF prodomain is detected in the hippocampus and that it can be secreted from neurons in an activity-dependent manner. Using nuclear magnetic resonance spectroscopy and circular dichroism we find that the prodomain is intrinsically disordered, and the Val66Met substitution induces structural changes. Surprisingly, application of Met66 (but not Val66) BDNF prodomain induces acute growth cone retraction and a decrease in Rac activity in hippocampal neurons. Expression of p75NTR and differential engagement of the Met66 prodomain to the SorCS2 receptor are required for this effect. These results identify the Met66 prodomain as a new active ligand which modulates neuronal morphology. PMID:24048383

  19. Association of Allelic Interaction of Single Nucleotide Polymorphisms of Influx and Efflux Transporters Genes With Nonhematologic Adverse Events of Docetaxel in Breast Cancer Patients.

    PubMed

    Jabir, Rafid Salim; Ho, Gwo Fuang; Annuar, Muhammad Azrif Bin Ahmad; Stanslas, Johnson

    2018-05-04

    Nonhematologic adverse events (AEs) of docetaxel constitute an extra burden in the treatment of cancer patients and necessitate either a dose reduction or an outright switch of docetaxel for other regimens. These AEs are frequently associated with genetic polymorphisms of genes encoding for proteins involved docetaxel disposition. Therefore, we investigated that association in Malaysian breast cancer patients. A total of 110 Malaysian breast cancer patients were enrolled in the present study, and their blood samples were investigated for different single nucleotide polymorphisms using polymerase chain reaction restriction fragment length polymorphism. AEs were evaluated using the Common Terminology Criteria for Adverse Events, version 4.0. Fatigue, nausea, oral mucositis, and vomiting were the most common nonhematologic AEs. Rash was associated with heterozygous and mutant genotypes of ABCB1 3435C>T (P < .05). Moreover, patients carrying the GG genotype of ABCB1 2677G>A/T reported more fatigue than those carrying the heterozygous genotype GA (P < .05). The presence of ABCB1 3435-T, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-G alleles was significantly associated with nausea and oral mucositis. The coexistence of ABCB1 3435-C, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-A was significantly associated with vomiting (P < .05). The prevalence of nonhematologic AEs in breast cancer patients treated with docetaxel has been relatively high. The variant allele of ABCB1 3435C>T polymorphism could be a potential predictive biomarker of docetaxel-induced rash, and homozygous wild-type ABCB1 2677G>A/T might predict for a greater risk of fatigue. In addition, the concurrent presence of specific alleles could be predictive of vomiting, nausea, and oral mucositis. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Identification of SNP Haplotypes and Prospects of Association Mapping in Watermelon

    USDA-ARS?s Scientific Manuscript database

    Watermelon is the fifth most economically important vegetable crop cultivated world-wide. Implementing Single Nucleotide Polymorphism (SNP) marker technology in watermelon breeding and germplasm evaluation programs holds a key to improve horticulturally important traits. Next-generation sequencing...

  1. Clinical relevance of the interleukin 10 promoter polymorphisms in Chinese Han patients with major trauma: genetic association studies.

    PubMed

    Zeng, Ling; Gu, Wei; Chen, Kehong; Jiang, Dongpo; Zhang, Lianyang; Du, Dingyuan; Hu, Ping; Liu, Qing; Huang, Suna; Jiang, Jianxin

    2009-01-01

    An excessive inflammatory response is thought to account for the pathogenesis of sepsis and multiple organ dysfunction syndrome (MODS) after severe trauma. The interleukin-10 (IL-10) is a potent anti-inflammatory cytokine. The objectives of this prospective study were to investigate the distribution of IL-10 promoter polymorphisms in a cohort of 308 Chinese Han patients with major trauma, and to identify associations of IL-10 promoter polymorphisms with IL-10 production and incidence of sepsis and MODS. A total of 308 patients with major trauma were included in this study. The genotypes of polymorphisms -1082, -819 and -592 were determined by polymerase chain reaction-restriction fragment length polymorphism. The IL-10 levels in the supernatants were determined with enzyme-linked immunoabsorbent assay. The -1082A and -592A alleles were significantly associated with lower lipopolysaccharide-induced IL-10 production in an allele-dose dependent fashion. There was no significant difference for the -819 polymorphism. Except for the -1082 polymorphism, the -819 and -592 polymorphisms were not significantly associated with sepsis morbidity rate and MOD scores. Our results further confirm the functionality of the IL-10 promoter single nucleotide polymorphisms in relation to IL-10 production. They also suggest that individual difference in IL-10 production in trauma patients might be at least in part related to genetic variations in the IL-10 promoter region.

  2. Identification of single nucleotide polymorphism markers associated with bacterial cold water disease resistance and spleen size in rainbow trout

    USDA-ARS?s Scientific Manuscript database

    Bacterial cold water disease (BCWD) is one of the frequent causes of elevated mortality in salmonid aquaculture. Previously, we identified and validated microsatellites associated with QTL (quantitative trait loci) for BCWD resistance and spleen size in rainbow trout. The objective of this study was...

  3. Identification of single nucleotide polymorphism markers associated with bacterial cold water disease resistance and spleen size in rainbow trout

    USDA-ARS?s Scientific Manuscript database

    Bacterial cold water disease (BCWD) is one of the frequent causes of elevated mortality in salmonid aquaculture. Previously, we identified and validated microsatellite markers associated with QTL (quantitative trait loci) for BCWD resistance and spleen size in rainbow trout. The objective of this st...

  4. Genome-wide copy number variant analysis reveals variants associated with 10 diverse production traits in Holstein cattle

    USDA-ARS?s Scientific Manuscript database

    Copy number variation (CNV) is an important type of genetic variation contributing to phenotypic differences among mammals and may serve as an alternative molecular marker to single nucleotide polymorphism (SNP) for genome-wide association study (GWAS). Recently, GWAS analysis using CNV has been app...

  5. Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast

    PubMed Central

    Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora

    2006-01-01

    Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318

  6. 4G/5G Plasminogen Activator Inhibitor-1 Polymorphisms and Haplotypes Are Associated with Pneumonia

    PubMed Central

    Yende, Sachin; Angus, Derek C.; Ding, Jingzhong; Newman, Anne B.; Kellum, John A.; Li, Rongling; Ferrell, Robert E.; Zmuda, Joseph; Kritchevsky, Stephen B.; Harris, Tamara B.; Garcia, Melissa; Yaffe, Kristine; Wunderink, Richard G.

    2007-01-01

    Rationale: Plasminogen activator inhibitor (PAI)-1 inhibits urokinase and tissue plasminogen activator, required for host response to infection. Whether variation within the PAI-1 gene is associated with increased susceptibility to infection is unknown. Objectives: To ascertain the role of the 4G/5G polymorphism and other genetic variants within the PAI-1 gene. We hypothesized that variants associated with increased PAI-1 expression would be associated with an increased occurrence of community-acquired pneumonia (CAP). Methods: Longitudinal analysis (>12 yr) of the Health, Aging, and Body Composition cohort, aged 65–74 years at start of analysis. Measurements and Main Results: We genotyped the 4G/5G PAI-1 polymorphism and six additional single nucleotide polymorphisms. Of the 3,075 subjects, 272 (8.8%) had at least one hospitalization for CAP. Among whites, variants at the PAI4G,5G, PAI2846, and PAI7343 sites had higher risk of CAP (P = 0.018, 0.021, and 0.021, respectively). At these sites, variants associated with higher PAI-1 expression were associated with increased CAP susceptibility. Compared with the 5G/5G genotypes at PAI4G,5G site, the 4G/4G and 4G/5G genotypes were associated with a 1.98-fold increased risk of CAP (95% confidence interval, 1.2–3.2; P = 0.006). In whole blood stimulation assay, subjects with a 4G allele had 3.3- and 1.9-fold increased PAI-1 expression (P = 0.043 and 0.034, respectively). In haplotype analysis, the 4G/G/C/A haplotype at the PAI4G,5G, PAI2846, PAI4588, and PAI7343 single nucleotide polymorphisms was associated with higher CAP susceptibility, whereas the 5G/G/C/A haplotype was associated with lower CAP susceptibility. No associations were seen among blacks. Conclusions: Genotypes associated with increased expression of PAI-1 were associated with increased susceptibility to CAP in elderly whites. PMID:17761618

  7. Genetic polymorphism of matrix metalloproteinase family and chronic obstructive pulmonary disease susceptibility: a meta-analysis.

    PubMed

    Zhou, Hongbin; Wu, Yinfang; Jin, Yan; Zhou, Jiesen; Zhang, Chao; Che, Luanqing; Jing, Jiyong; Chen, Zhihua; Li, Wen; Shen, Huahao

    2013-10-02

    Matrix metalloproteinase (MMP) family is considered to be associated with chronic obstructive pulmonary disease (COPD) pathogenesis, however, no consistent results have been provided by previous studies. In this report, we performed Meta analysis to investigate the association between four kinds of MMP single nucleotide polymorphisms (SNP, MMP1 -1607 1G/2G, MMP3 -1171 5A/6A, MMP9 -1562 C/T, MMP12 -82 A/G) and COPD risk from 21 studies including 4184 cases and 5716 controls. Both overall and subgroup association between SNP and COPD susceptibility were tested. There was no evident association between MMP polymorphisms and COPD susceptibility in general population. On the other hand, subgroup analysis suggested that MMP9 -1562 C/T polymorphism was related to COPD, as we found that C allele carriers were at lower risk in some subgroups stratified by lung function, age and genotype identification method, compared with TT homozygotes. Our results indicated the genotype TT might be one genetic risk factor of severe COPD.

  8. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  9. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  10. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  11. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  12. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  13. A Meta-Analysis of the Association between DNMT1 Polymorphisms and Cancer Risk.

    PubMed

    Li, Hao; Liu, Jing-Wei; Sun, Li-Ping; Yuan, Yuan

    2017-01-01

    Previous studies have examined the associations of DNA methyltransferase 1 ( DNMT1 ) polymorphisms, including single nucleotide polymorphisms rs16999593 (T/C), rs2228611 (G/A), and rs2228612 (A/G), with cancer risk. However, the results are inconclusive. The aim of this meta-analysis is to elucidate the associations between DNMT1 polymorphisms and cancer susceptibility. The PubMed, Embase, Web of Science, and Chinese National Knowledge Infrastructure databases were searched systematically to identify potentially eligible reports. Odd ratios and 95% confidence intervals were used to evaluate the strength of association between three DNMT1 polymorphisms and cancer risk. A total of 16 studies were finally included in the meta-analysis, namely, nine studies of 3378 cases and 4244 controls for rs16999593, 11 studies of 3643 cases and 3866 controls for rs2228611, and three studies of 1343 cases and 1309 controls for rs2228612. The DNMT1 rs2228612 (A/G) polymorphism was significantly related to cancer risk in the recessive model. The meta-analysis also suggested that DNMT1 rs16999593 (T/C) may be associated with gastric cancer, while rs2228611 (G/A) may be associated with breast cancer. In future research, large-scale and well-designed studies are required to verify these findings.

  14. IGF-I gene variability is associated with an increased risk for AD.

    PubMed

    Vargas, Teo; Martinez-Garcia, Ana; Antequera, Desiree; Vilella, Elisabet; Clarimon, Jordi; Mateo, Ignacio; Sanchez-Juan, Pascual; Rodriguez-Rodriguez, Eloy; Frank, Ana; Rosich-Estrago, Marcel; Lleo, Alberto; Molina-Porcel, Laura; Blesa, Rafael; Gomez-Isla, Teresa; Combarros, Onofre; Bermejo-Pareja, Felix; Valdivieso, Fernando; Bullido, Maria Jesus; Carro, Eva

    2011-03-01

    Insulin-like growth factor I (IGF-I), a neuroprotective factor with a wide spectrum of actions in the adult brain, is involved in the pathogenesis of Alzheimer's disease (AD). Circulating levels of IGF-I change in AD patients and are implicated in the clearance of brain amyloid beta (Aβ) complexes. To investigate this hypothesis, we screened the IGF-I gene for various well known single nucleotide polymorphisms (SNPs) covering % of the gene variability in a population of 2352 individuals. Genetic analysis indicated different distribution of genotypes of 1 single nucleotide polymorphism, and 1 extended haplotype in the AD population compared with healthy control subjects. In particular, the frequency of rs972936 GG genotype was significantly greater in AD patients than in control subjects (63% vs. 55%). The rs972936 GG genotype was associated with an increased risk for disease, independently of apolipoprotein E genotype, and with enhanced circulating levels of IGF-I. These findings suggest that polymorphisms within the IGF-I gene could infer greater risk for AD through their effect on IGF-I levels, and confirm the physiological role IGF-I in the pathogenesis of AD. Copyright © 2011 IBRO. Published by Elsevier Inc. All rights reserved.

  15. Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

    PubMed

    Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

    2002-03-01

    Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

  16. Selective sweep at the Drosophila melanogaster Suppressor of Hairless locus and its association with the In(2L)t inversion polymorphism.

    PubMed Central

    Depaulis, F; Brazier, L; Veuille, M

    1999-01-01

    The hitchhiking model of population genetics predicts that an allele favored by Darwinian selection can replace haplotypes from the same locus previously established at a neutral mutation-drift equilibrium. This process, known as "selective sweep," was studied by comparing molecular variation between the polymorphic In(2L)t inversion and the standard chromosome. Sequence variation was recorded at the Suppressor of Hairless (Su[H]) gene in an African population of Drosophila melanogaster. We found 47 nucleotide polymorphisms among 20 sequences of 1.2 kb. Neutrality tests were nonsignificant at the nucleotide level. However, these sites were strongly associated, because 290 out of 741 observed pairwise combinations between them were in significant linkage disequilibrium. We found only seven haplotypes, two occurring in the 9 In(2L)t chromosomes, and five in the 11 standard chromosomes, with no shared haplotype. Two haplotypes, one in each chromosome arrangement, made up two-thirds of the sample. This low haplotype diversity departed from neutrality in a haplotype test. This pattern supports a selective sweep hypothesis for the Su(H) chromosome region. PMID:10388820

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fahrenkrog, Annette M.; Neves, Leandro G.; Resende, Jr., Marcio F. R.

    Genome-wide association studies (GWAS) have been used extensively to dissect the genetic regulation of complex traits in plants. These studies have focused largely on the analysis of common genetic variants despite the abundance of rare polymorphisms in several species, and their potential role in trait variation. Here, we conducted the first GWAS in Populus deltoides, a genetically diverse keystone forest species in North America and an important short rotation woody crop for the bioenergy industry. We searched for associations between eight growth and wood composition traits, and common and low-frequency single-nucleotide polymorphisms detected by targeted resequencing of 18 153 genesmore » in a population of 391 unrelated individuals. To increase power to detect associations with low-frequency variants, multiple-marker association tests were used in combination with single-marker association tests. Significant associations were discovered for all phenotypes and are indicative that low-frequency polymorphisms contribute to phenotypic variance of several bioenergy traits. Our results suggest that both common and low-frequency variants need to be considered for a comprehensive understanding of the genetic regulation of complex traits, particularly in species that carry large numbers of rare polymorphisms. Lastly, these polymorphisms may be critical for the development of specialized plant feedstocks for bioenergy.« less

  18. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  19. Brief Report: Glutamate Transporter Gene (SLC1A1) Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    PubMed Central

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2015-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive–compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples. PMID:20155310

  20. Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

    PubMed Central

    Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

    2016-01-01

    Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

  1. Glutamate transporter gene (SLC1A1) single nucleotide polymorphism (rs301430) and repetitive behaviors and anxiety in children with autism spectrum disorder.

    PubMed

    Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli

    2010-09-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.

  2. Association study of Toll-like receptor 5 (TLR5) and Toll-like receptor 9 (TLR9) polymorphisms in systemic lupus erythematosus.

    PubMed

    Demirci, F Yesim K; Manzi, Susan; Ramsey-Goldman, Rosalind; Kenney, Margaret; Shaw, Penny S; Dunlop-Thomas, Charmayne M; Kao, Amy H; Rhew, Elisa Y; Bontempo, Franklin; Kammerer, Candace; Kamboh, M Ilyas

    2007-08-01

    Toll-like receptors (TLR) play an important role in both adaptive and innate immunity. Variations in TLR genes have been shown to be associated with various infectious and inflammatory diseases. We investigated the association of TLR5 (Arg392Stop, rs5744168) and TLR9 (-1237T-->C, rs5743836) single nucleotide polymorphisms (SNP) with systemic lupus erythematosus (SLE) in Caucasian American subjects. We performed a case-control association study and genotyped 409 Caucasian women with SLE and 509 Caucasian healthy female controls using TaqMan allelic discrimination (rs5744168) or polymerase chain reaction-restriction fragment length polymorphism analysis (rs5743836). None of the 2 TLR SNP showed a statistically significant association with SLE risk in our cohort. Our results do not indicate a major influence of these putative functional TLR SNP on the susceptibility to (or protection from) SLE.

  3. Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

    PubMed

    Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

    2017-02-01

    The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

  4. Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

    PubMed

    Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

    2015-04-01

    Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

  5. Genes determining the severity of cerebral palsy: the role of single nucleotide polymorphisms on the amount and structure of apolipoprotein E

    PubMed Central

    Lien, Espen; Andersen, Guro; Bao, Yongde; Gordish-Dressman, Heather; Skranes, Jon S.; Blackman, James A.; Vik, Torstein

    2015-01-01

    Aim ApolipoproteinE (apoE) influences repair and other processes in the brain and the apoE4 variant is a risk factor for Alzheimer's disease and for prolonged recovery following traumatic brain injury. We previously reported that specific single nucleotide polymorphisms in the APOE or TOMM40 genes affecting the structure and production of apoE were associated with epilepsy, more impaired hand function and gastrostomy tube feeding in children with cerebral palsy (CP). This study explored how various combinations of the same polymorphisms may affect these clinical manifestations. Methods Successful DNA analyses of APOE and TOMM40 were carried out on 227 children. The CP Register of Norway provided details of gross and fine motor function, epilepsy and gastrostomy tube feeding. Possible associations between these clinical manifestations and various combinations of the APOEε2, ε3 or ε4 alleles and of the rs59007384 polymorphism in the TOMM40 gene were explored. Results Epilepsy, impaired fine motor function and gastrostomy tube feeding were less common in children carrying the combination of rs59007384 GG and APOEε2 or ε3 than in children with other combinations. Conclusion Our findings suggest that specific combinations of genes influence the structure and production of apoE differently and affect the clinical manifestations of CP. PMID:25703783

  6. Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

    PubMed

    Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

    2017-06-01

    Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

  7. Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

    PubMed

    Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

    2015-11-05

    Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

  8. Differential effects of donor and recipient IL28B and DDX58 SNPs on severity of HCV after liver transplantation.

    PubMed

    Biggins, Scott W; Trotter, James; Gralla, Jane; Burton, James R; Bambha, Kiran M; Dodge, Jennifer; Brocato, Megan; Cheng, Linling; McQueen, Matt; Forman, Lisa; Chang, Michael; Kam, Igal; Everson, Gregory; Spritz, Richard A; Klintmalm, Goran; Rosen, Hugo R

    2013-05-01

    IL28B single nucleotide polymorphisms are strongly associated with spontaneous HCV clearance and treatment response in non-transplant populations. A DDX58 single nucleotide polymorphism is associated with the antiviral response of innate lymphocytes. We aimed at evaluating the associations of donor and recipient IL28B (rs12979860 and rs8099917) and DDX58 (rs10813831) genotypes with severity of HCV recurrence after liver transplantation. In a case-control study of 523 liver transplantation recipients with HCV, we matched severe with mild recurrent HCV based on 2-year clinical and histologic follow-up. A total of 440 liver transplantation recipients (severe, n=235; mild, n=205) with recipient DNA and 225 (severe, n=123; mild, n=102) with both recipient and donor DNA were analyzed. IL28B [rs12979860, non-CC (vs. CC) and rs8099917, non-TT (vs. TT)] in the recipient-only analysis had higher risk of severe recurrent HCV [OR 1.57 and 1.58, p<0.05]. However, for the 225 with donor and recipient DNA, IL28B rs12979860 CC (vs. non-CC) and rs8099917 TT (vs. non-TT) and DDX58 rs10813831 non-GG (vs. GG) were associated with more (not less) severe recurrent HCV. The greatest risk of severe recurrent HCV was for rs12979860 CC donors in non-CC recipients (OR 7.02, p <0.001, vs. non-CC donor/recipient) and for rs8099917 TT donors in non-TT recipients (OR 5.78, p=0.001, vs. non-TT donor/recipient). These associations persisted after controlling for donor age, donor race, and donor risk index. IL28B and DDX58 single nucleotide polymorphisms that are favorable when present in the non-transplant setting or in the recipient are unfavorable when present in a donor liver graft. Copyright © 2013 European Association for the Study of the Liver. All rights reserved.

  9. Molecular characterization of beta-tubulin from Phakopsora pachyrhizi, the causal agent of Asian soybean rust

    PubMed Central

    2010-01-01

    β-tubulins are structural components of microtubules and the targets of benzimidazole fungicides used to control many diseases of agricultural importance. Intron polymorphisms in the intron-rich genes of these proteins have been used in phylogeographic investigations of phytopathogenic fungi. In this work, we sequenced 2764 nucleotides of the β-tubulin gene (Pp tubB) in samples of Phakopsora pachyrhizi collected from seven soybean fields in Brazil. Pp tubB contained an open reading frame of 1341 nucleotides, including nine exons and eight introns. Exon length varied from 14 to 880 nucleotides, whereas intron length varied from 76 to 102 nucleotides. The presence of only four polymorphic sites limited the usefulness of Pp tubB for phylogeographic studies in P. pachyrhizi. The gene structures of Pp tubB and orthologous β-tubulin genes of Melampsora lini and Uromyces viciae-fabae were highly conserved. The amino acid substitutions in β-tubulin proteins associated with the onset of benzimidazole resistance in model organisms, especially at His 6 , Glu 198 and Phe 200 , were absent from the predicted sequence of the P. pachyrhizi β-tubulin protein. PMID:21637494

  10. Higher magnesium intake is associated with lower fasting glucose and insulin, with no evidence of interaction with select genetic loci, in a meta-analysis of 15 charge consortium studies

    USDA-ARS?s Scientific Manuscript database

    Favorable associations between magnesium intake and glycemic traits, such as fasting glucose and insulin, are observed in observational and clinical studies, but whether genetic variation affects these associations is largely unknown. We hypothesized that single nucleotide polymorphisms (SNPs) assoc...

  11. Single nucleotide polymorphism of CC chemokine ligand 5 promoter gene in recipients may predict the risk of chronic graft-versus-host disease and its severity after allogeneic transplantation.

    PubMed

    Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun

    2007-10-15

    Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.

  12. Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

    PubMed

    Arruda, Mônica Barcellos; Campagnari, Francine; de Almeida, Tailah Bernardo; Couto-Fernandez, José Carlos; Tanuri, Amilcar; Cardoso, Cynthia Chester

    2016-01-01

    Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME) influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs) in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs), and 8 to protease inhibitors (PIs) containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001), while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009). Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

  13. Associations between novel single nucleotide polymorphisms in the Bos taurus growth hormone gene and performance traits in Holstein-Friesian dairy cattle.

    PubMed

    Mullen, M P; Berry, D P; Howard, D J; Diskin, M G; Lynch, C O; Berkowicz, E W; Magee, D A; MacHugh, D E; Waters, S M

    2010-12-01

    Growth hormone, produced in the anterior pituitary gland, stimulates the release of insulin-like growth factor-I from the liver and is of critical importance in the control of nutrient utilization and partitioning for lactogenesis, fertility, growth, and development in cattle. The aim of this study was to discover novel polymorphisms in the bovine growth hormone gene (GH1) and to quantify their association with performance using estimates of genetic merit on 848 Holstein-Friesian AI (artificial insemination) dairy sires. Associations with previously reported polymorphisms in the bovine GH1 gene were also undertaken. A total of 38 novel single nucleotide polymorphisms (SNP) were identified across a panel of 22 beef and dairy cattle by sequence analysis of the 5' promoter, intronic, exonic, and 3' regulatory regions, encompassing approximately 7 kb of the GH1 gene. Following multiple regression analysis on all SNP, associations were identified between 11 SNP (2 novel and 9 previously identified) and milk fat and protein yield, milk composition, somatic cell score, survival, body condition score, and body size. The G allele of a previously identified SNP in exon 5 at position 2141 of the GH1 sequence, resulting in a nonsynonymous substitution, was associated with decreased milk protein yield. The C allele of a novel SNP, GH32, was associated with inferior carcass conformation. In addition, the T allele of a previously characterized SNP, GH35, was associated with decreased survival. Both GH24 (novel) and GH35 were independently associated with somatic cell count, and 3 SNP, GH21, 2291, and GH35, were independently associated with body depth. Furthermore, 2 SNP, GH24 and GH63, were independently associated with carcass fat. Results of this study further demonstrate the multifaceted influences of GH1 on milk production, fertility, and growth-related traits in cattle. Copyright © 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

    PubMed Central

    Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

    2015-01-01

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

  15. BDNF Polymorphism Predicts General Intelligence after Penetrating Traumatic Brain Injury

    PubMed Central

    Rostami, Elham; Krueger, Frank; Zoubak, Serguei; Dal Monte, Olga; Raymont, Vanessa; Pardini, Matteo; Hodgkinson, Colin A.; Goldman, David; Risling, Mårten; Grafman, Jordan

    2011-01-01

    Neuronal plasticity is a fundamental factor in cognitive outcome following traumatic brain injury. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, plays an important role in this process. While there are many ways to measure cognitive outcome, general cognitive intelligence is a strong predictor of everyday decision-making, occupational attainment, social mobility and job performance. Thus it is an excellent measure of cognitive outcome following traumatic brain injury (TBI). Although the importance of the single-nucleotide polymorphisms polymorphism on cognitive function has been previously addressed, its role in recovery of general intelligence following TBI is unknown. We genotyped male Caucasian Vietnam combat veterans with focal penetrating TBI (pTBI) (n = 109) and non-head injured controls (n = 38) for 7 BDNF single-nucleotide polymorphisms. Subjects were administrated the Armed Forces Qualification Test (AFQT) at three different time periods: pre-injury on induction into the military, Phase II (10–15 years post-injury, and Phase III (30–35 years post-injury). Two single-nucleotide polymorphisms, rs7124442 and rs1519480, were significantly associated with post-injury recovery of general cognitive intelligence with the most pronounced effect at the Phase II time point, indicating lesion-induced plasticity. The genotypes accounted for 5% of the variance of the AFQT scores, independently of other significant predictors such as pre-injury intelligence and percentage of brain volume loss. These data indicate that genetic variations in BDNF play a significant role in lesion-induced recovery following pTBI. Identifying the underlying mechanism of this brain-derived neurotrophic factor effect could provide insight into an important aspect of post-traumatic cognitive recovery. PMID:22087305

  16. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  17. A variant of CLEC16A gene confers protection for Vogt-Koyanagi-Harada syndrome but not for Behcet's disease in a Chinese Han population.

    PubMed

    Li, Ke; Hou, Shengping; Qi, Jian; Kijlstra, Aize; Yang, Peizeng

    2015-03-01

    Vogt-Koyanagi-Harada (VKH) syndrome and Behcet's disease (BD) are two common form of uveitis in China. The aim of this study was to investigate the association of C-type lectin domain family 16, member A (CLEC16A) gene polymorphisms with Vogt-Koyanagi-Harada syndrome and Behcet's disease in a Chinese Han population. A two-stage association study was carried out in 988 VKH syndrome patients,400 BD patients and 976 healthy controls. Eight single nucleotide polymorphisms of CLEC16A gene were determined with the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The data were analyzed by χ(2) test or Fisher's exact test and corrected for multiple comparisons by the Bonferroni method. The first stage study showed that the frequency of the A allele of rs6498169 was significantly decreased in VKH syndrome patients (Pc = 1.1 × 10(-2), OR = 0.7, 95%CI = 0.6-0.9). No significant association was observed in the other 7 SNPs between VKH syndrome patients and controls. No association was found with BD for the 8 SNPs tested. We further confirmed the association of single nucleotide polymorphism rs6498169 with VKH syndrome in another cohort. Consistent with the first stage study, the combined study showed significantly lower frequencies of the AA genotype and the A allele of rs6498169 in VKH syndrome patients (Pc = 3.5 × 10(-4), OR = 0.6, 95%CI = 0.5-0.7; Pc = 8.2 × 10(-4), OR = 0.8, 95%CI = 0.7-0.9, respectively). In conclusion, the study suggested that a CLEC16A polymorphism may be protective against VKH syndrome in a Chinese Han population. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Distribution of HLA-G extended haplotypes and one HLA-E polymorphism in a large-scale study of mother-child dyads with and without severe preeclampsia and eclampsia.

    PubMed

    Nilsson, L L; Djurisic, S; Andersen, A-M N; Melbye, M; Bjerre, D; Ferrero-Miliani, L; Hackmon, R; Geraghty, D E; Hviid, T V F

    2016-10-01

    The etiological pathways and pathogenesis of preeclampsia have rendered difficult to disentangle. Accumulating evidence points toward a maladapted maternal immune system, which may involve aberrant placental expression of immunomodulatory human leukocyte antigen (HLA) class Ib molecules during pregnancy. Several studies have shown aberrant or reduced expression of HLA-G in the placenta and in maternal blood in cases of preeclampsia compared with controls. Unlike classical HLA class Ia loci, the nonclassical HLA-G has limited polymorphic variants. Most nucleotide variations are clustered in the 5'-upstream regulatory region (5'URR) and 3'-untranslated regulatory region (3'UTR) of HLA-G and reflect a stringent expressional control. Based on genotyping and full gene sequencing of HLA-G in a large number of cases and controls (n > 900), the present study, which to our knowledge is the largest and most comprehensive performed, investigated the association between the HLA-G 14-bp ins/del (rs66554220) and HLA-E polymorphisms in mother and newborn dyads from pregnancies complicated by severe preeclampsia/eclampsia and from uncomplicated pregnancies. Furthermore, results from extended HLA-G haplotyping in the newborns are presented in order to assess whether a combined contribution of nucleotide variations spanning the 5'URR, coding region, and 3'UTR of HLA-G describes the genetic association with severe preeclampsia more closely. In contrast to earlier findings, the HLA-G 14-bp ins/del polymorphism was not associated with severe preeclampsia. Furthermore, the polymorphism (rs1264457) defining the two nonsynonymous HLA-E alleles, HLA-E*01:01:xx:xx and HLA-E*01:03:xx:xx, were not associated with severe preeclampsia. Finally, no specific HLA-G haplotypes were significantly associated with increased risk of developing severe preeclampsia/eclampsia. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

    PubMed Central

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

    2004-01-01

    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  20. Protective Role of BST2 Polymorphisms in Mother-to-Child Transmission of HIV-1 and Adult AIDS Progression.

    PubMed

    Kamada, Anselmo J; Bianco, Anna M; Zupin, Luisa; Girardelli, Martina; Matte, Maria C C; Medeiros, Rúbia Marília de; Almeida, Sabrina Esteves de Matos; Rocha, Marineide M; Segat, Ludovica; Chies, José A B; Kuhn, Louise; Crovella, Sergio

    2016-07-01

    Bone marrow stromal cell antigen-2 (BST-2)/Tetherin is a restriction factor that prevents Human immunodeficiency virus type 1 (HIV-1) release from infected cells and mediates pro-inflammatory cytokine production. This study investigated the risk conferred by single nucleotide polymorphisms (rs919266, rs9192677, and rs9576) at BST-2 coding gene (BST2) in HIV-1 mother-to-child transmission and in disease progression. Initially, 101 HIV-1+ pregnant women and 331 neonates exposed to HIV-1 from Zambia were enrolled. Additional BST2 single nucleotide polymorphism analyses were performed in 2 cohorts with acquired immunodeficiency syndrome (AIDS) progression: an adult Brazilian cohort (37 rapid, 30 chronic and 21 long-term non-progressors) and an Italian pediatric cohort (21 rapid and 67 slow progressors). The rs9576A allele was nominally associated with protection during breastfeeding (P = 0.019) and individuals carrying rs919266 GA showed slower progression to AIDS (P = 0.033). Despite the influence of rs919266 and rs9576 on BST2 expression being still undetermined, a preventive role by BST2 polymorphisms was found during HIV-1 infection.

  1. [Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

    PubMed

    Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

    2015-07-01

    To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

  2. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

    PubMed

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

    2017-09-01

    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.

  3. Correlations between ACE single nucleotide polymorphisms and prognosis of patients with septic shock.

    PubMed

    Dou, Xin-Man; Cheng, Hui-Juan; Meng, Ling; Zhou, Lin-Lin; Ke, Yi-Hong; Liu, Li-Ping; Li, Yu-Min

    2017-04-30

    The aim of the present study is to investigate association between septic shock (SS) and angiotensin I-converting enzyme ( ACE ) single nucleotide polymorphisms (SNPs). From October 2009 to December 2016, 238 SS patients and 242 healthy individuals were selected for our study. ACE activity was detected, ACE rs4291 and rs4646994 polymorphisms were detected using PCR-restriction fragment length polymorphism (PCR-RFLP). The Kaplan-Meier survival curve was employed to evaluate the association between ACE SNPs and patients' survival and univariate and multivariate analyses to estimate risk factors for SS. ACE activity in the case group was increased in comparison with the control group. Allele and genotype frequencies of rs4291 and rs4646994 were different between the case and control groups. The TT genotype frequency of the rs4291 polymorphisms and the DD genotype of the rs4646994 polymorphisms of the case group were higher than those in the control group. The AT and TT genotypes indicated a significant elevation of ACE activity than the AA genotype, while a significant decline was found in the DI and II genotypes in comparison with the DI genotype. Patients with TT or DD genotypes had increased fatality rate within 7 and 30 days when compared with those with non-TT or non-DD genotypes. Lower sepsis-related organ failure assessment (SOFA) scores, rs4291, serum ACE and rs4646994 were all considered as risky factors for SS patients. The study demonstrates that TT genotype of rs4291 or DD genotype of rs4646994 may be indicative of a higher risk of SS and a poorer prognosis in SS patients. © 2017 The Author(s).

  4. Polymorphism in the PER3 promoter associates with diurnal preference and delayed sleep phase disorder.

    PubMed

    Archer, Simon N; Carpen, Jayshan D; Gibson, Mark; Lim, Gim Hui; Johnston, Jonathan D; Skene, Debra J; von Schantz, Malcolm

    2010-05-01

    To screen the PER3 promoter for polymorphisms and investigate the phenotypic associations of these polymorphisms with diurnal preference, delayed sleep phase disorder/syndrome (DSPD/DSPS), and their effects on reporter gene expression. Interspecific comparison was used to define the approximate extent of the PER3 promoter as the region between the transcriptional start site and nucleotide position -874. This region was screened in DNA pools using PCR and direct sequencing, which was also used to screen DNA from individual participants. The different promoter alleles were cloned into a luciferase expression vector and a deletion library created. Promoter activation was measured by chemiluminescence. N/A. DNA samples were obtained from volunteers with defined diurnal preference (3 x 80, selected from a pool of 1,590), and DSPD patients (n=23). N/A. We verified three single nucleotide polymorphisms (G -320T, C -319A, G -294A), and found a novel variable number tandem repeat (VNTR) polymorphism (-318 1/2 VNTR). The -320T and -319A alleles occurred more frequently in DSPD compared to morning (P = 0.042 for each) or evening types (P = 0.006 and 0.033). The allele combination TA2G was more prevalent in DSPD compared to morning (P 0.033) or evening types (P = 0.002). Luciferase expression driven by the TA2G combination was greater than for the more common GC2A (P < 0.05) and the rarer TA1G (P < 0.001) combinations. Deletion reporter constructs identified two enhancer regions (-703 to -605, and -283 to -80). Polymorphisms in the PER3 promoter could affect its expression, leading to potential differences in the observed functions of PER3.

  5. Association of ABCB1 and ABCG2 single nucleotide polymorphisms with clinical findings and response to chemotherapy treatments in Kurdish patients with breast cancer.

    PubMed

    Ghafouri, Houshiyar; Ghaderi, Bayazid; Amini, Sabrieh; Nikkhoo, Bahram; Abdi, Mohammad; Hoseini, Abdolhakim

    2016-06-01

    The possible interaction between gene polymorphisms and risk of cancer progression is very interesting. Polymorphisms in multi-drug resistance genes have an important role in response to anti-cancer drugs. The present study was aimed to evaluate the possible effects of ABCB1 C3435T and ABCG2 C421A single nucleotide polymorphisms on clinical and pathological outcomes of Kurdish patients with breast cancer. One hundred breast cancer patients and 200 healthy controls were enrolled in this case-control study. Clinical and pathological findings of all individuals were reported, and immunohistochemistry staining was used to assess the tissue expression of specific breast cancer proteins. The ABCB1 C3435T and ABCG2 C421 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). The distribution of different genotypes between patient and control groups was only significant for ABCG2 C421A. A allele of ABCG2 C421A polymorphisms were significantly higher in patients than in controls. Patients with AA genotype of ABCG2 C421A were at higher risk of progressing breast cancer. Patients with A allele of ABCG2 had complete response to chemotherapeutic agents. There was no statistically significant association between ABCB1 C3435T and ABCG2 C421A polymorphisms and tissue expression of ER, PR, Her2/neu, and Ki67. The ABCB1 C3435T has no correlation with clinical findings and treatment with chemotherapy drugs. The A allele of ABCG2 C421A may be a risk factor for progression of breast cancer in Kurdish patients. In addition, breast cancer patients with C allele of this polymorphism have weaker response to treatments with anthracyclines and Paclitaxol.

  6. Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

    USDA-ARS?s Scientific Manuscript database

    Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

  7. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  8. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  9. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  10. Multiple SNPs in Intron 41 of Thyroglobulin Gene Are Associated with Autoimmune Thyroid Disease in the Japanese Population

    PubMed Central

    Ban, Yoshiyuki; Tozaki, Teruaki; Taniyama, Matsuo; Skrabanek, Luce; Nakano, Yasuko; Ban, Yoshio; Hirano, Tsutomu

    2012-01-01

    Background The etiology of the autoimmune thyroid diseases (AITDs), Graves' disease (GD) and Hashimoto's thyroiditis (HT), is largely unknown. However, genetic susceptibility is believed to play a major role. Two whole genome scans from Japan and from the US identified a locus on chromosome 8q24 that showed evidence for linkage with AITD and HT. Recent studies have demonstrated an association between thyroglobulin (Tg) polymorphisms and AITD in Caucasians, suggesting that Tg is a susceptibility gene on 8q24. Objectives The objective of the study was to refine Tg association with AITD, by analyzing a panel of 25 SNPs across an extended 260 kb region of the Tg. Methods We studied 458 Japanese AITD patients (287 GD and 171 HT patients) and 221 matched Japanese control subjects in association studies. Case-control association studies were performed using 25 Tg single nucleotide polymorphisms (SNPs) chosen from a database of the Single Nucleotide Polymorphism Database (dbSNP). Haplotype analysis was undertaken using the computer program SNPAlyze version 7.0. Principal Findings and Conclusions In total, 5 SNPs revealed association with GD (P<0.05), with the strongest SNP associations at rs2256366 (P = 0.002) and rs2687836 (P = 0.0077), both located in intron 41 of the Tg gene. Because of the strong LD between these two strongest associated variants, we performed the haplotype analysis, and identified a major protective haplotype for GD (P = 0.001).These results suggested that the Tg gene is involved in susceptibility for GD and AITD in the Japanese. PMID:22662162

  11. MicroRNA-196a2 Biomarker and Targetome Network Analysis in Solid Tumors.

    PubMed

    Toraih, Eman A; Fawzy, Manal S; Mohammed, Eman A; Hussein, Mohammad H; El-Labban, Mohamad M

    2016-12-01

    MicroRNAs (miRNAs) have been linked to cancer development and progression. The molecular mechanisms underlying the genetic associations of the miRNA single nucleotide polymorphism with cancer vary by cancer site. As there are no previous studies on the miR-196a2 variant or expression in any type of cancer among our population, we aimed to determine the expression profile of mature miR-196a2 in various types of solid tumors and to analyze the impact of its polymorphism (rs11614913; C/T) on the expression levels. The study included 230 cancer patients (including 17 types of cancer), 26 patients with pre-cancer lesions, and 100 unrelated controls. Archived formalin-fixed, paraffin-embedded specimens (n = 197) were available for both miRNA expression analysis and single nucleotide polymorphism identification. Venous blood was collected from 59 histologically confirmed sporadic cancer patients and the study controls for single nucleotide polymorphism identification. Real-time polymerase chain reaction analysis was performed for allelic discrimination and relative quantification of miR-196a2 in the study samples. In silico target gene prediction and network analysis was performed. We found that individuals with the T variant were associated with cancer risk under all genetic association models, especially in colorectal, esophageal, skin, lung, thyroid, and renal cancer. Overall and stratified analysis showed miR-196a2 over-expression in most of the current malignant tumor samples relative to their corresponding cancer-free tissues. Carriers of the C allele had significantly higher expression levels of miR-196a2. Correlation with the clinicopathological features of cancer showed organ-specific effects. Gene enrichment analysis of predicted and validated targets speculated the putative role of miR-196a2 in cancer-associated biology. We highlighted cancer-type specific expression profiles of miR-196a2, which was correlated with the clinicopathological features in various types of cancer. Taken together, our results suggest that the miRNA signature could have promising diagnostic and prognostic significance.

  12. Association of microRNA-125a and microRNA-499a polymorphisms in chronic periodontitis in a sample south Indian population: A hospital-based genetic association study.

    PubMed

    Venugopal, Priyanka; Lavu, Vamsi; Rao, Suresh Ranga; Venkatesan, Vettriselvi

    2017-10-05

    Periodontitis is a chronic inflammatory disease, caused by interaction between periodontopathic bacteria and the host immune response. MicroRNAs are small, single-stranded molecules, which play a key role in the regulation of diverse biological processes. Dysregulation of microRNAs function can lead to several diseases such as autoimmune and chronic inflammatory diseases. The objective of the study was to determine the association between selected single nucleotide polymorphisms in miR-125a, miR-499 and LIN28 homology A with chronic periodontitis susceptibility in a sample population from south India. Genotyping of the single nucleotide polymorphisms in miR-125a (rs41275794, rs12976445, rs10404453 and rs12975333), miR-499 (rs3746444) and LIN28 homolog A (rs3811463) was performed in DNA from288 controls (individuals with healthy gingiva) and 262 cases (chronic periodontitis patients) by direct dye-terminator sequencing. Disease association analysis revealed a significant association of the variant alleles of the miR-499a polymorphism (rs3746444) in chronic periodontitis [OR=2.07; 95%CI (1.35-3.17)]. The risk associated C-allele frequency was found to be higher in chronic periodontitis subjects as compared to that of healthy individuals. Similar results were also observed in the dominant model [OR=2.42; 95% CI (1.67-3.51)]. The recessive model for miR-125a polymorphism (rs12976445) was also found to be statistically significant with OR=1.54 and 95% CI (1.03-2.30). The haplotype "GCGGCA" was found to be higher in chronic periodontitis subjects than in healthy individuals. Pairwise linkage disequilibrium analysis exhibited that the polymorphisms, rs41275794 and rs12976445 in miR-125a, were in strong linkage equilibrium (D'=0.97). Epistatic interaction by multifactorial dimensionality reduction analysis revealed that the genotypes of the polymorphisms of miR-125a (rs41275794, rs12976445, rs10404453), miR-499a (rs3746444) and LIN28 (rs3811463) were interacting significantly [OR=2.54 (1.65-3.92)], thereby contributing to the risk of chronic periodontitis. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. RNA Expression and Post-Transcriptional Editing Analyses of Cucumber Plastids Reveals Genetic Differences Associated with Chilling Tolerance

    USDA-ARS?s Scientific Manuscript database

    Tolerance to chilling injury in cucumber (Cucumis sativus L.) is associated with three plastomic single nucleotide polymorphisms (ptSNPs) at bp positions 4,813, 56,561, and 126,349 that are co-inherited. An understanding of the genetic expression of these ptSNPs as a response to chilling is critical...

  14. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  15. Association Analysis of Polymorphisms in TOMM40, CR1, PVRL2, SORL1, PICALM, and 14q32.13 Regions in Colombian Alzheimer Disease Patients.

    PubMed

    Ortega-Rojas, Jenny; Morales, Luis; Guerrero, Esneyder; Arboleda-Bustos, Carlos E; Mejia, Adriana; Forero, Diego; Lopez, Luis; Pardo, Rodrigo; Arboleda, Gonzalo; Yunis, Juan; Arboleda, Humberto

    2016-01-01

    We evaluated the association of several single-nucleotide polymorphisms in different genes including APOE, TOMM40, CR1, PVRL2, SORL1, PICALM, and GWA_14q32.13 in a Colombian sample of Late-Onset Alzheimer disease (LOAD) patients. A case-control study was conducted in 362 individuals (181 LOADs and 181 controls) to determine the association of single-nucleotide polymorphisms in APOE (e2, e3, and e4), TOMM40 (rs2075650), CR1 (rs665640), PVRL2 (rs6859), SORL1 (rs11218304), PICALM (rs3851179), and GWA_14q32.13 (rs11622883) with LOAD in a sample from Colombia. We were able to confirm the previously reported association of the APOE4 allele with AD. In addition, we report a new significant association with rs2075650 of TOMM40 for LOAD in our sample. We did not detect any significant interaction between TOMM40 and APOE4 carriers (heterozygous or homozygous) for disease risk development. However, Kaplan-Meier survival analyses suggest that AD patients with TOMM40 allele rs2075650-G have an average age of disease onset of 6 years earlier compared with carriers of the A allele. In addition, the age of disease onset is earlier if APOE4/4 is present. Our findings suggest that rs2075650 of TOMM40 could be involved in earlier presentation of LOAD in the Colombian population.

  16. Impact of EZH2 polymorphisms on urothelial cell carcinoma susceptibility and clinicopathologic features.

    PubMed

    Yu, Yung-Luen; Su, Kuo-Jung; Hsieh, Ming-Ju; Wang, Shian-Shiang; Wang, Po-Hui; Weng, Wei-Chun; Yang, Shun-Fa

    2014-01-01

    The gene EZH2, the polycomb group protein enhancer of zeste 2, encodes a transcriptional repressor that also serves as a histone methyltransferase that is associated with progression to more advanced disease in a variety of malignancies. EZH2 expression level in urothelial cell carcinoma (UCC) is highly correlated with tumor aggressiveness, but it has not been determined if specific EZH2 genetic variants are associated with UCC risk. This study investigated the potential associations of EZH2 single-nucleotide polymorphisms with UCC susceptibility and its clinicopathologic characteristics. A total of 233 UCC patients and 552 cancer-free controls, all of whom were from Taiwan, were analyzed for four EZH2 single-nucleotide polymorphisms (rs6950683, rs2302427, rs3757441, and rs41277434) using real-time PCR genotyping. After adjusting for other co-variants, we found that individuals carrying at least one C allele at EZH2 rs6950683 had a lower risk of developing UCC than did major allele carriers. The CCCA or TGTA haplotype among the four EZH2 sites was also associated with a reduced risk of UCC. Furthermore, UCC patients who carried at least one G allele at rs2302427 had a lower invasive tumor stage than did patients carrying the major allele. The rs6950683 SNPs of EZH2 might contribute to the prediction of UCC susceptibility. This is the first study to provide insight into risk factors associated with EZH2 variants in carcinogenesis of UCC in Taiwan.

  17. Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the Chlamydia trachomatis omp1 gene

    NASA Astrophysics Data System (ADS)

    Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.

    2018-04-01

    Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.

  18. Association of Leukotrichia in Vitiligo and Asp148Glu Polymorphism of Apurinic/Apyrimidinic Endonuclease 1.

    PubMed

    Aydin, A Fatih; Aydıngöz, İkbal Esen; Doğru-Abbasoğlu, Semra; Vural, Pervin; Uysal, Müjdat

    2017-01-01

    Oxidative stress and increased DNA damage have been implicated in the etiopathogenesis of vitiligo. Oxidative DNA damage is mainly repaired by the base excision repair (BER) pathway. We sought to determine whether polymorphisms in DNA repair genes may have a role in the pathogenesis of vitiligo. We conducted a study including 100 patients with vitiligo and age- and sex-matched 193 control subjects to examine the role of single-nucleotide polymorphisms of BER genes, human 8-oxoG DNA N-glycosylase 1 (codon 326), apurinic/apyrimidinic endonuclease 1 (APE1) (codon 148), and X-ray repair cross-complementing group 1 (codon 399) as risk factors for vitiligo. These polymorphisms were determined by quantitative real-time polymerase chain reaction and melting curve analysis. No significant association was observed between the variant alleles of studied genes and vitiligo. However, we showed that the presence of APE1 148Glu variant allele is associated with leukotrichia. This preliminary study suggests that APE1 (codon 148) polymorphism may play a role in vitiligo pathogenesis.

  19. Explorations in genome-wide association studies and network analyses with dairy cattle fertility traits

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction has improved the reliability of genomic e...

  20. Dairy consumption, systolic blood pressure, and risk of hypertension: Mendelian randomization study

    USDA-ARS?s Scientific Manuscript database

    Objective: To examine whether previous observed inverse associations of dairy intake with systolic blood pressure and risk of hypertension were causal. Design: Mendelian randomization study using the single nucleotide polymorphism rs4988235 related to lactase persistence as an instrumental variable...

  1. Large-scale enrichment and discovery of gene-associated SNPs

    USDA-ARS?s Scientific Manuscript database

    With the recent advent of massively parallel pyrosequencing by 454 Life Sciences it has become feasible to cost-effectively identify numerous single nucleotide polymorphisms (SNPs) within the recombinogenic regions of the maize (Zea mays L.) genome. We developed a modified version of hypomethylated...

  2. Artemisinin resistance-associated polymorphisms at the K13-propeller locus are absent in Plasmodium falciparum isolates from Haiti.

    PubMed

    Carter, Tamar E; Boulter, Alexis; Existe, Alexandre; Romain, Jean R; St Victor, Jean Yves; Mulligan, Connie J; Okech, Bernard A

    2015-03-01

    Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. © The American Society of Tropical Medicine and Hygiene.

  3. Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease

    PubMed Central

    Heidari, Mohammad Mehdi; Soheilyfar, Sorour

    2016-01-01

    Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013

  4. Molecular Characterization of the Lipid Genome-Wide Association Study Signal on Chromosome 18q11.2 Implicates HNF4A-Mediated Regulation of the TMEM241 Gene.

    PubMed

    Rodríguez, Alejandra; Gonzalez, Luis; Ko, Arthur; Alvarez, Marcus; Miao, Zong; Bhagat, Yash; Nikkola, Elina; Cruz-Bautista, Ivette; Arellano-Campos, Olimpia; Muñoz-Hernández, Linda L; Ordóñez-Sánchez, Maria-Luisa; Rodriguez-Guillen, Rosario; Mohlke, Karen L; Laakso, Markku; Tusie-Luna, Teresa; Aguilar-Salinas, Carlos A; Pajukanta, Päivi

    2016-07-01

    We recently identified a locus on chromosome 18q11.2 for high serum triglycerides in Mexicans. We hypothesize that the lead genome-wide association study single-nucleotide polymorphism rs9949617, or its linkage disequilibrium proxies, regulates 1 of the 5 genes in the triglyceride-associated region. We performed a linkage disequilibrium analysis and found 9 additional variants in linkage disequilibrium (r(2)>0.7) with the lead single-nucleotide polymorphism. To select the variants for functional analyses, we annotated the 10 variants using DNase I hypersensitive sites, transcription factor and chromatin states and identified rs17259126 as the lead candidate variant for functional in vitro validation. Using luciferase transcriptional reporter assay in liver HepG2 cells, we found that the G allele exhibits a significantly lower effect on transcription (P<0.05). The electrophoretic mobility shift and ChIPqPCR (chromatin immunoprecipitation coupled with quantitative polymerase chain reaction) assays confirmed that the minor G allele of rs17259126 disrupts an hepatocyte nuclear factor 4 α-binding site. To find the regional candidate gene, we performed a local expression quantitative trait locus analysis and found that rs17259126 and its linkage disequilibrium proxies alter expression of the regional transmembrane protein 241 (TMEM241) gene in 795 adipose RNAs from the Metabolic Syndrome In Men (METSIM) cohort (P=6.11×10(-07)-5.80×10(-04)). These results were replicated in expression profiles of TMEM241 from the Multiple Tissue Human Expression Resource (MuTHER; n=856). The Mexican genome-wide association study signal for high serum triglycerides on chromosome 18q11.2 harbors a regulatory single-nucleotide polymorphism, rs17259126, which disrupts normal hepatocyte nuclear factor 4 α binding and decreases the expression of the regional TMEM241 gene. Our data suggest that decreased transcript levels of TMEM241 contribute to increased triglyceride levels in Mexicans. © 2016 American Heart Association, Inc.

  5. Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium.

    PubMed

    Smith, Nicholas L; Felix, Janine F; Morrison, Alanna C; Demissie, Serkalem; Glazer, Nicole L; Loehr, Laura R; Cupples, L Adrienne; Dehghan, Abbas; Lumley, Thomas; Rosamond, Wayne D; Lieb, Wolfgang; Rivadeneira, Fernando; Bis, Joshua C; Folsom, Aaron R; Benjamin, Emelia; Aulchenko, Yurii S; Haritunians, Talin; Couper, David; Murabito, Joanne; Wang, Ying A; Stricker, Bruno H; Gottdiener, John S; Chang, Patricia P; Wang, Thomas J; Rice, Kenneth M; Hofman, Albert; Heckbert, Susan R; Fox, Ervin R; O'Donnell, Christopher J; Uitterlinden, Andre G; Rotter, Jerome I; Willerson, James T; Levy, Daniel; van Duijn, Cornelia M; Psaty, Bruce M; Witteman, Jacqueline C M; Boerwinkle, Eric; Vasan, Ramachandran S

    2010-06-01

    Although genetic factors contribute to the onset of heart failure (HF), no large-scale genome-wide investigation of HF risk has been published to date. We have investigated the association of 2,478,304 single-nucleotide polymorphisms with incident HF by meta-analyzing data from 4 community-based prospective cohorts: the Atherosclerosis Risk in Communities Study, the Cardiovascular Health Study, the Framingham Heart Study, and the Rotterdam Study. Eligible participants for these analyses were of European or African ancestry and free of clinical HF at baseline. Each study independently conducted genome-wide scans and imputed data to the approximately 2.5 million single-nucleotide polymorphisms in HapMap. Within each study, Cox proportional hazards regression models provided age- and sex-adjusted estimates of the association between each variant and time to incident HF. Fixed-effect meta-analyses combined results for each single-nucleotide polymorphism from the 4 cohorts to produce an overall association estimate and P value. A genome-wide significance P value threshold was set a priori at 5.0x10(-7). During a mean follow-up of 11.5 years, 2526 incident HF events (12%) occurred in 20 926 European-ancestry participants. The meta-analysis identified a genome-wide significant locus at chromosomal position 15q22 (1.4x10(-8)), which was 58.8 kb from USP3. Among 2895 African-ancestry participants, 466 incident HF events (16%) occurred during a mean follow-up of 13.7 years. One genome-wide significant locus was identified at 12q14 (6.7x10(-8)), which was 6.3 kb from LRIG3. We identified 2 loci that were associated with incident HF and exceeded genome-wide significance. The findings merit replication in other community-based settings of incident HF.

  6. DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

    PubMed

    González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

    2006-03-01

    Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

  7. A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

    PubMed Central

    Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

    2014-01-01

    SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

  8. Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean

    PubMed Central

    2012-01-01

    Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron-based markers for linkage and association mapping in common bean. The utility of these markers is discussed in relation with the usefulness of microsatellites, the molecular markers by excellence in this crop. PMID:22734675

  9. Association of single nucleotide polymorphisms in CACNA 1A/CACNA 1C/CACNA 1H calcium channel genes with diabetic peripheral neuropathy in Chinese population.

    PubMed

    Sun, Lin; Ma, Jun; Mao, Qian; Yang, Yun-Long; Ma, Lin-Lin; Niu, Ling; Liu, Li-Feng

    2018-06-29

    The present study was conducted to explore the correlations between single nucleotide polymorphisms (SNPs) in the calcium channel CACNA 1A, CACNA 1C, and CACNA 1H genes and diabetic peripheral neuropathy (DPN) amongst the Chinese population. In total, 281 patients diagnosed with type 2 diabetes participated in the present study. These patients were divided into the case group, which was subdivided into the DPN (143 cases) and the non-DPN groups (138 cases). Subsequently, 180 healthy individuals that had undergone routine health examinations were also recruited and assigned to the control group. PCR-restriction fragment length polymorphism (PCR-RFLP) was used to detect the genotype and allele frequencies of CACNA 1A, CACNA 1C, and CACNA 1H genes; logistic regression analysis to investigate the association of gene polymorphisms with DNP. Gene-gene interactions were then detected by generalized multifactor dimensionality reduction (GMDR). The results revealed that CACNA 1A rs2248069 and rsl6030, CACNA 1C rs216008 and rs2239050, and CACNA 1H rs3794619, and rs7191246 SNPs were all associated with DPN, while rs2248069, rsl6030, rs2239050, and rs7191246 polymorphisms were attributed to the susceptibility to DPN. It was also observed that the optimal models were three-, four- and five-dimensional models with a prediction accuracy of 61.05% and the greatest consistency of cross-validation was 10/10. In summary, these findings demonstrated that the SNPs in the CACNA 1A, CACNA 1C, and CACNA 1H genes were involved in the pathophysiology of DPN. In addition, polymorphisms in the CACNA 1A, CACNA 1C, and CACNA 1H genes and their interactions also had effects on DPN. © 2018 The Author(s).

  10. CLU rs9331888 Polymorphism Contributes to Alzheimer's Disease Susceptibility in Caucasian But Not East Asian Populations.

    PubMed

    Zhang, Shuyan; Li, Xuling; Ma, Guoda; Jiang, Yongshuai; Liao, Mingzhi; Feng, Rennan; Zhang, Liangcai; Liu, Jiafeng; Wang, Guangyu; Zhao, Bin; Jiang, Qinghua; Li, Keshen; Liu, Guiyou

    2016-04-01

    Large-scale genome-wide association studies (GWAS) identified three single nucleotide polymorphisms rs11136000, rs2279590, and rs9331888 in CLU gene to be significantly associated with Alzheimer's disease (AD) in Caucasian ancestry. Both rs11136000 and rs2279590 variants were successfully replicated in Asian population. However, previous studies reported either a weak association or no association between rs9331888 polymorphism and AD in Asian population. Here, we searched the PubMed, AlzGene, and Google Scholar databases. We selected 12 independent studies that evaluated the association between the rs9331888 polymorphism and AD using a case-control design. Using an additive model, we did not identify significant heterogeneity among these 12 studies. We observed significant association between rs9331888 polymorphism and AD in pooled populations (P = 2.26E - 07, odds ratio (OR) = 1.10, 95% confidence interval (CI) 1.06-1.14). In subgroup analysis, we did not identify significant heterogeneity in both Asian and Caucasian populations. We identified significant association in Caucasian population (P = 1.67E - 08, OR = 1.13, 95% CI 1.08-1.18) but not in East Asian population (P = 0.49, OR = 1.02, 95% CI 0.96-1.10).

  11. Genome-wide association study reveals putative regulators of bioenergy traits in Populus deltoides

    DOE PAGES

    Fahrenkrog, Annette M.; Neves, Leandro G.; Resende, Jr., Marcio F. R.; ...

    2016-09-06

    Genome-wide association studies (GWAS) have been used extensively to dissect the genetic regulation of complex traits in plants. These studies have focused largely on the analysis of common genetic variants despite the abundance of rare polymorphisms in several species, and their potential role in trait variation. Here, we conducted the first GWAS in Populus deltoides, a genetically diverse keystone forest species in North America and an important short rotation woody crop for the bioenergy industry. We searched for associations between eight growth and wood composition traits, and common and low-frequency single-nucleotide polymorphisms detected by targeted resequencing of 18 153 genesmore » in a population of 391 unrelated individuals. To increase power to detect associations with low-frequency variants, multiple-marker association tests were used in combination with single-marker association tests. Significant associations were discovered for all phenotypes and are indicative that low-frequency polymorphisms contribute to phenotypic variance of several bioenergy traits. Our results suggest that both common and low-frequency variants need to be considered for a comprehensive understanding of the genetic regulation of complex traits, particularly in species that carry large numbers of rare polymorphisms. Lastly, these polymorphisms may be critical for the development of specialized plant feedstocks for bioenergy.« less

  12. The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

    PubMed Central

    Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

    2018-01-01

    Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

  13. Rapid Differentiation between Livestock-Associated and Livestock-Independent Staphylococcus aureus CC398 Clades

    PubMed Central

    Larsen, Jesper; Soldanova, Katerina; Aziz, Maliha; Contente-Cuomo, Tania; Petersen, Andreas; Vandendriessche, Stien; Jiménez, Judy N.; Mammina, Caterina; van Belkum, Alex; Salmenlinna, Saara; Laurent, Frederic; Skov, Robert L.; Larsen, Anders R.; Andersen, Paal S.; Price, Lance B.

    2013-01-01

    Staphylococcus aureus clonal complex 398 (CC398) isolates cluster into two distinct phylogenetic clades based on single-nucleotide polymorphisms (SNPs) revealing a basal human clade and a more derived livestock clade. The scn and tet(M) genes are strongly associated with the human and the livestock clade, respectively, due to loss and acquisition of mobile genetic elements. We present canonical single-nucleotide polymorphism (canSNP) assays that differentiate the two major host-associated S. aureus CC398 clades and a duplex PCR assay for detection of scn and tet(M). The canSNP assays correctly placed 88 S. aureus CC398 isolates from a reference collection into the human and livestock clades and the duplex PCR assay correctly identified scn and tet(M). The assays were successfully applied to a geographically diverse collection of 272 human S. aureus CC398 isolates. The simple assays described here generate signals comparable to a whole-genome phylogeny for major clade assignment and are easily integrated into S. aureus CC398 surveillance programs and epidemiological studies. PMID:24244535

  14. A Genome-Wide Association Study Identifies Genomic Regions for Virulence in the Non-Model Organism Heterobasidion annosum s.s

    PubMed Central

    Dalman, Kerstin; Himmelstrand, Kajsa; Olson, Åke; Lind, Mårten; Brandström-Durling, Mikael; Stenlid, Jan

    2013-01-01

    The dense single nucleotide polymorphisms (SNP) panels needed for genome wide association (GWA) studies have hitherto been expensive to establish and use on non-model organisms. To overcome this, we used a next generation sequencing approach to both establish SNPs and to determine genotypes. We conducted a GWA study on a fungal species, analysing the virulence of Heterobasidion annosum s.s., a necrotrophic pathogen, on its hosts Picea abies and Pinus sylvestris. From a set of 33,018 single nucleotide polymorphisms (SNP) in 23 haploid isolates, twelve SNP markers distributed on seven contigs were associated with virulence (P<0.0001). Four of the contigs harbour known virulence genes from other fungal pathogens and the remaining three harbour novel candidate genes. Two contigs link closely to virulence regions recognized previously by QTL mapping in the congeneric hybrid H. irregulare × H. occidentale. Our study demonstrates the efficiency of GWA studies for dissecting important complex traits of small populations of non-model haploid organisms with small genomes. PMID:23341945

  15. Relationship of Genetic Polymorphisms of the Chemokine, CCL5, and Its Receptor, CCR5, with Coronary Artery Disease in Taiwan

    PubMed Central

    Ting, Ke-Hsin; Ueng, Kwo-Chang; Chiang, Whei-Ling; Chou, Ying-Erh; Yang, Shun-Fa; Wang, Po-Hui

    2015-01-01

    The chemokine receptor CCR5 polymorphism, which confers resistance to HIV infection, has been associated with reduced risk of cardiovascular disease. However, the association of the chemokine, CCL5, and its receptor, CCR5, polymorphism and coronary artery disease (CAD) in the Taiwanese has not been studied. In this study, 483 subjects who received elective coronary angiography were recruited from Chung Shan Medical University Hospital. CCL5-403 and CCR5-59029 were determined by polymerase chain reaction-restriction fragment length polymorphism. We found that CCL5-403 with TT genotype frequencies was significantly associated with the risk of CAD group (odds ratio = 3.063 and p = 0.012). Moreover, the frequencies of CCR5-59029 with GG or GA genotype were higher than AA genotype in acute coronary syndrome individuals (odds ratio = 1.853, CI = 1.176–2.921, p = 0.008). In conclusion, we found that CCL5-403 polymorphism may increase genetic susceptibility of CAD. CCL5-403 or CCR5-59029 single nucleotide polymorphism may include genotype score and it may predict cardiovascular event. PMID:26688689

  16. [Turner syndrome and genetic polymorphism: a systematic review].

    PubMed

    Trovó de Marqui, Alessandra Bernadete

    2015-01-01

    To present the main results of the literature on genetic polymorphisms in Turner Syndrome and their association with the clinical signs and the etiology of this chromosomal disorder. The review was conducted in the PubMed database without any time limit, using the terms Turner syndrome and genetic polymorphism. A total of 116 articles were found, and based on the established inclusion and exclusion criteria 17 were selected for the review. The polymorphisms investigated in patients with Turner Syndrome were associated with growth deficit, causing short stature, low bone mineral density, autoimmunity and cardiac abnormalities, which are frequently found in patients with Turner Syndrome. The role of single nucleotide polymorphisms (SNPs) in the etiology of Turner syndrome, i.e., in chromosomal nondisjunction, was also confirmed. Genetic polymorphisms appear to be associated with Turner Syndrome. However, in view of the small number of published studies and their contradictory findings, further studies in different populations are needed in order to clarify the role of genetic variants in the clinical signs and etiology of the Turner Syndrome. Copyright © 2015 Sociedade de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

  17. Single Nucleotide Polymorphisms in the TP53 Region and Susceptibility to Invasive Epithelial Ovarian Cancer

    PubMed Central

    Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat

    2009-01-01

    The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375

  18. Financial and Psychological Risk Attitudes Associated with Two Single Nucleotide Polymorphisms in the Nicotine Receptor (CHRNA4) Gene

    PubMed Central

    Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.

    2009-01-01

    With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267

  19. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  20. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  1. An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

    USDA-ARS?s Scientific Manuscript database

    Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

  2. Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

    PubMed

    Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

    2010-10-01

    The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

  3. Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

    PubMed

    An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

    2015-06-01

    Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Investigation of Genetic Variants Associated with Alzheimer Disease in Parkinson Disease Cognition.

    PubMed

    Barrett, Matthew J; Koeppel, Alexander F; Flanigan, Joseph L; Turner, Stephen D; Worrall, Bradford B

    2016-01-01

    Meta-analysis of genome-wide association studies have implicated multiple single nucleotide polymorphisms (SNPs) and associated genes with Alzheimer disease. The role of these SNPs in cognitive impairment in Parkinson disease (PD) remains incompletely evaluated. The objective of this study was to test alleles associated with risk of Alzheimer disease for association with cognitive impairment in Parkinson disease (PD). Two datasets with PD subjects accessed through the NIH database of Genotypes and Phenotypes contained both single nucleotide polymorphism (SNP) arrays and mini-mental state exam (MMSE) scores. Genetic data underwent rigorous quality control and we selected SNPs for genes associated with AD other than APOE. We constructed logistic regression and ordinal regression models, adjusted for sex, age at MMSE, and duration of PD, to assess the association between selected SNPs and MMSE score. In one dataset, PICALM rs3851179 was associated with cognitive impairment (MMSE <  24) in PD subjects > 70 years old (OR = 2.3; adjusted p-value = 0.017; n = 250) but not in PD subjects ≤ 70 years old. Our finding suggests that PICALM rs3851179 could contribute to cognitive impairment in older patients with PD. It is important that future studies consider the interaction of age and genetic risk factors in the development of cognitive impairment in PD.

  5. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. MYO9B gene polymorphisms are associated with the risk of inflammatory bowel diseases

    PubMed Central

    Yu, Qiang; Zhu, Chun-Fu; Kong, Zhi-Jun; Zhao, Hui; Tang, Li-Ming; Qin, Xi-Hu

    2016-01-01

    Myosin IXB (MYO9B) gene polymorphisms have been extensively investigated in terms of their associations with inflammatory bowel disease (IBD), with contradictory results. The aim of this meta-analysis was to evaluate associations between MY09B gene polymorphisms and the risk of IBD, Crohn's disease (CD) and ulcerative colitis (UC). Eligible studies from PubMed, Embase, and CNKI databases were identified. Pooled odds ratios (ORs) and 95% confidence intervals (95% CIs) were calculated. Ten studies published in eight papers reporting 8,975 cases and 9,482 controls were included in this meta-analysis. Five MY09B gene polymorphisms were evaluated: rs1545620, rs962917, rs1457092, rs2305764, and rs2305767. Our data suggested that the rs1545620 polymorphism was associated with a decreased risk of IBD. A similar result was found for rs2305767 and UC. The rs962917 single nucleotide polymorphism (SNP) increased the risk of IBD, CD and UC. Moreover, rs1457092 increased the risk of IBD and UC. Rs2305764 was also associated with an increased risk of IBD. Furthermore, stratification analyses indicated that rs1545620 decreased the risk of IBD, while rs962917 increased the risk of IBD, CD and UC in Caucasian populations. To sum up, our data indicate that these five SNPs in MY09B are significantly associated with the risk of IBD. PMID:27556856

  7. IL10A genotypic association with decreased IL-10 circulating levels in malaria infected individuals from endemic area of the Brazilian Amazon.

    PubMed

    Pereira, Virginia A; Sánchez-Arcila, Juan C; Teva, Antonio; Perce-da-Silva, Daiana S; Vasconcelos, Mariana P A; Lima, Cleoni A M; Aprígio, Cesarino J L; Rodrigues-da-Silva, Rodrigo N; Santos, Davi O; Banic, Dalma M; Bonecini-Almeida, Maria G; Lima-Júnior, Josué C; Oliveira-Ferreira, Joseli

    2015-01-28

    Cytokines play an important role in human immune responses to malaria and variation in their production may influence the course of infection and determine the outcome of the disease. The differential production of cytokines has been linked to single nucleotide polymorphisms in gene promoter regions, signal sequences, and gene introns. Although some polymorphisms play significant roles in susceptibility to malaria, gene polymorphism studies in Brazil are scarce. A population of 267 individuals from Brazilian Amazon exposed to malaria was genotyped for five single nucleotide polymorphisms (SNPs), IFNG + 874 T/A, IL10A-1082G/A, IL10A-592A/C, IL10A-819 T/C and NOS2A-954G/C. Specific DNA fragments were amplified by polymerase chain reaction, allowing the detection of the polymorphism genotypes. The polymorphisms IL10A-592A/C and IL10A-819 T/C were estimated by a single analysis due to the complete linkage disequilibrium between the two SNPs with D' = 0.99. Plasma was used to measure the levels of IFN-γ and IL-10 cytokines by Luminex and nitrogen radicals by Griess reaction. No differences were observed in genotype and allelic frequency of IFNG + 874 T/A and NOS2A-954G/C between positive and negative subjects for malaria infection. Interesting, the genotype NOS2A-954C/C was not identified in the study population. Significant differences were found in IL10A-592A/C and IL10A-819 T/C genotypes distribution, carriers of IL10A -592A/-819 T alleles (genotypes AA/TT + AC/TC) were more frequent among subjects with malaria than in negative subjects that presented a higher frequency of the variant C allele (p < 0.0001). The presence of the allele C was associated with low producer of IL-10 and low parasitaemia. In addition, the GTA haplotypes formed from combinations of investigated polymorphisms in IL10A were significantly associated with malaria (+) and the CCA haplotype with malaria (-) groups. The IL10A-1082G/A polymorphism showed high frequency of heterozygous AG genotype in the population, but it was not possible to infer any association of the polymorphism because their distribution was not in Hardy Weinberg equilibrium. This study shows that the IL10A-592A/C and IL10A-819 T/C polymorphisms were associated with malaria and decreased IL-10 levels and low parasite density suggesting that this polymorphism influence IL-10 levels and may influence in the susceptibility to clinical malaria.

  8. Polymorphisms of the bovine DKK2 and their associations with body measurement traits and meat quality traits in Qinchuan cattle.

    PubMed

    Zhan, Xiaoli; Gao, Jianbin; Huangfu, Yifan; Fu, Changzhen; Zan, Linsen

    2013-12-01

    The objective of this research were to detect bovine Dickkopf 2 (DKK2) gene polymorphism and analyze their associations with body measurement traits (BMT) and meat quality traits (MQT) of animals. Blood samples were taken from a total of 541 Qinchuan cattle aged from 18 to 24 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out DKK2 single-polymorphism nucleotide (SNPs) and to explore their possible association with BMT and MQT. Sequence analysis of DKK2 gene revealed 2 SNPs (C29 T and A169C) in 5' untranslated region (5'UTR) of exon 1.C29T and A164T SNPs are both synonymous mutation, which showed 2 genotypes namely (CC, CT) and (AA and AC), respectively. Association analysis of polymorphism with body measurement and meat quality traits at the two locus showed that there were significant effects on CT, BL, RL, PBW, BFT, LMA, and IFC. These results suggest that the DKK2 gene might have potential effects on BMT and MQT in Qinchuan cattle population and could be used for marker-assisted selection.

  9. C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.

    PubMed

    Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

    2015-01-01

    Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.

  10. A TaqI PCR-RFLP detecting a novel SNP in exon 2 of the bovine POU1F1 gene.

    PubMed

    Pan, Chuanying; Lan, Xianyong; Chen, Hong; Guo, Yikun; Shu, Jianhong; Lei, Chuzhao; Wang, Xinzhuang

    2008-08-01

    PCR-SSCP and DNA sequencing methods were applied to reveal three novel single nucleotide polymorphisms (SNPs) in exon 2 of the POU1F1 gene in 963 Chinese cattle belonging to eight breeds. Among them, a silent SNP (NM_174579:c.545G > A) detected by TaqI endonuclease is described. Frequencies of the POU1F1-G allele varied from 0.685 to 1.000. The association of TaqI polymorphism with growth traits was analyzed in 251 Nanyang cattle. No significant associations of the TaqI polymorphism with body weight and average daily gain for different growth periods (6, 12, 18, and 24 months old) were observed (P > 0.05), as well as for body sizes (P > 0.05).

  11. A survey of copy number variation in the porcine genome detected from whole-genome sequence

    USDA-ARS?s Scientific Manuscript database

    An important challenge to post-genomic biology is relating observed phenotypic variation to the underlying genotypic variation. Genome-wide association studies (GWAS) have made thousands of connections between single nucleotide polymorphisms (SNPs) and phenotypes, implicating regions of the genome t...

  12. Marker-assisted selection for resistance to bacterial cold water disease in a commercial rainbow trout breeding population

    USDA-ARS?s Scientific Manuscript database

    Bacterial cold water disease (BCWD), caused by Flavobacterium psychrophilum, is an endemic and problematic disease in rainbow trout (Oncorhynchus mykiss) aquaculture. Previously, we have identified SNPs (single nucleotide polymorphisms) associated with BCWD resistance in rainbow trout. The objective...

  13. Dairy consumption, systolic blood pressure, and risk of hypertension: Mendelian randomization study

    USDA-ARS?s Scientific Manuscript database

    This study examined whether previous observed inverse associations of dairy intake with systolic blood pressure and risk of hypertension were causal. A Mendelian randomization study was employed, using the single nucleotide polymorphism rs4988235 related to lactase persistence as an instrumental var...

  14. Genetic variants in PNPLA3 and risk of non-alcoholic fatty liver disease in a Han Chinese population.

    PubMed

    Peng, Xian-E; Wu, Yun-Li; Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

    2012-01-01

    We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case-control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7-8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98-5.09) or hypertension (ICR = 1.74, 95% CI: 0.52-3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese.

  15. Association of -330 interleukin-2 gene polymorphism with oral cancer.

    PubMed

    Singh, Prithvi Kumar; Kumar, Vijay; Ahmad, Mohammad Kaleem; Gupta, Rajni; Mahdi, Abbas Ali; Jain, Amita; Bogra, Jaishri; Chandra, Girish

    2017-12-01

    Cytokines play an important role in the development of cancer. Several single-nucleotide polymorphisms (SNPs) of cytokine genes have been reported to be associated with the development and severity of inflammatory diseases and cancer predisposition. This study was undertaken to evaluate a possible association of interleukin 2 (IL-2) (- 330A>C) gene polymorphisms with the susceptibility to oral cancer. The SNP in IL-2 (-330A>C) gene was genotyped in 300 oral cancer patients and in similar number of healthy volunteers by polymerase chain reaction (PCR)-restriction fragment length polymorphism and the association of the gene with the disease was evaluated. IL-2 (-330A>C) gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR): 3.0; confidence interval (CI): 2.14-4.20; P<0.001]. The C allele frequency was also significantly associated with oral cancer (OR: 1.80; CI: 1.39-2.33; P<0.001). IL-2 (-330A>C) gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (-330A>C) gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

  16. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c

  17. The Effect of XPD Polymorphisms on Digestive Tract Cancers Risk: A Meta-Analysis

    PubMed Central

    Zhang, Qian; Chen, Zhipeng; Lu, Kai; Shu, Yongqian; Chen, Tao; Zhu, Lingjun

    2014-01-01

    Background The Xeroderma pigmento-sum group D gene (XPD) plays a key role in nucleotide excision repair. Single nucleotide polymorphisms (SNP) located in its functional region may alter DNA repair capacity phenotype and cancer risk. Many studies have demonstrated that XPD polymorphisms are significantly associated with digestive tract cancers risk, but the results are inconsistent. We conducted a comprehensive meta-analysis to assess the association between XPD Lys751Gln polymorphism and digestive tract cancers risk. The digestive tract cancers that our study referred to, includes oral cancer, esophageal cancer, gastric cancer and colorectal cancer. Methods We searched PubMed and EmBase up to December 31, 2012 to identify eligible studies. A total of 37 case-control studies including 9027 cases and 16072 controls were involved in this meta-analysis. Statistical analyses were performed with Stata software (version 11.0, USA). Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of the association. Results The results showed that XPD Lys751Gln polymorphism was associated with the increased risk of digestive tract cancers (homozygote comparison (GlnGln vs. LysLys): OR = 1.12, 95% CI = 1.01–1.24, P = 0.029, P heterogeneity = 0.133). We found no statistical evidence for a significantly increased digestive tract cancers risk in the other genetic models. In the subgroup analysis, we also found the homozygote comparison increased the susceptibility of Asian population (OR = 1.28, 95% CI = 1.01–1.63, P = 0.045, P heterogeneity = 0.287). Stratified by cancer type and source of control, no significantly increased cancer risk was found in these subgroups. Additionally, risk estimates from hospital-based studies and esophageal studies were heterogeneous. Conclusions Our meta-analysis suggested that the XPD 751Gln/Gln genotype was a low-penetrate risk factor for developing digestive tract cancers, especially in Asian populations. PMID:24787743

  18. The effect of XPD polymorphisms on digestive tract cancers risk: a meta-analysis.

    PubMed

    Du, Haina; Guo, Nannan; Shi, Bin; Zhang, Qian; Chen, Zhipeng; Lu, Kai; Shu, Yongqian; Chen, Tao; Zhu, Lingjun

    2014-01-01

    The Xeroderma pigmento-sum group D gene (XPD) plays a key role in nucleotide excision repair. Single nucleotide polymorphisms (SNP) located in its functional region may alter DNA repair capacity phenotype and cancer risk. Many studies have demonstrated that XPD polymorphisms are significantly associated with digestive tract cancers risk, but the results are inconsistent. We conducted a comprehensive meta-analysis to assess the association between XPD Lys751Gln polymorphism and digestive tract cancers risk. The digestive tract cancers that our study referred to, includes oral cancer, esophageal cancer, gastric cancer and colorectal cancer. We searched PubMed and EmBase up to December 31, 2012 to identify eligible studies. A total of 37 case-control studies including 9027 cases and 16072 controls were involved in this meta-analysis. Statistical analyses were performed with Stata software (version 11.0, USA). Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of the association. The results showed that XPD Lys751Gln polymorphism was associated with the increased risk of digestive tract cancers (homozygote comparison (GlnGln vs. LysLys): OR = 1.12, 95% CI = 1.01-1.24, P = 0.029, P heterogeneity = 0.133). We found no statistical evidence for a significantly increased digestive tract cancers risk in the other genetic models. In the subgroup analysis, we also found the homozygote comparison increased the susceptibility of Asian population (OR = 1.28, 95% CI = 1.01-1.63, P = 0.045, P heterogeneity = 0.287). Stratified by cancer type and source of control, no significantly increased cancer risk was found in these subgroups. Additionally, risk estimates from hospital-based studies and esophageal studies were heterogeneous. Our meta-analysis suggested that the XPD 751Gln/Gln genotype was a low-penetrate risk factor for developing digestive tract cancers, especially in Asian populations.

  19. Association of VAV2 and VAV3 polymorphisms with cardiovascular risk factors

    PubMed Central

    Perretta-Tejedor, Nuria; Fernández-Mateos, Javier; García-Ortiz, Luis; Gómez-Marcos, Manuel A.; Recio-Rodríguez, José I.; Agudo-Conde, Cristina; Rodriguez-Sánchez, Emiliano; Morales, Ana I.; López-Hernández, Francisco J.; López-Novoa, José M.; González-Sarmiento, Rogelio; Martínez-Salgado, Carlos

    2017-01-01

    Hypertension, diabetes and obesity are cardiovascular risk factors closely associated to the development of renal and cardiovascular target organ damage. VAV2 and VAV3, members of the VAV family proto-oncogenes, are guanosine nucleotide exchange factors for the Rho and Rac GTPase family, which is related with cardiovascular homeostasis. We have analyzed the relationship between the presence of VAV2 rs602990 and VAV3 rs7528153 polymorphisms with cardiovascular risk factors and target organ damage (heart, vessels and kidney) in 411 subjects. Our results show that being carrier of the T allele in VAV2 rs602990 polymorphism is associated with an increased risk of obesity, reduced levels of ankle-brachial index and diastolic blood pressure and reduced retinal artery caliber. In addition, being carrier of T allele is associated with increased risk of target organ damage in males. On the other hand, being carrier of the T allele in VAV3 rs7528153 polymorphism is associated with a decreased susceptibility of developing a pathologic state composed by the presence of hypertension, diabetes, obesity or cardiovascular damage, and with an increased risk of developing altered basal glycaemia. This is the first report showing an association between VAV2 and VAV3 polymorphisms with cardiovascular risk factors and target organ damage. PMID:28157227

  20. Association between polymorphisms of the insulin-degrading enzyme gene and late-onset Alzheimer disease.

    PubMed

    Wang, Shitao; He, Feiyan; Wang, Ying

    2015-06-01

    The insulin-degrading enzyme (IDE) gene is a strong positional and biological candidate for late-onset Alzheimer disease (LOAD) susceptibility, with recent studies independently demonstrating an association between IDE gene variants and LOAD. However, previous data have been controversial. To investigate the relationship between IDE gene polymorphisms and LOAD risk, a case-control association study of 406 Han Chinese participants in Xinjiang, China, was undertaken. The LOAD and control groups consisted of 202 and 204 participants, respectively. The single-nucleotide polymorphisms rs1887922 and rs1999764 of the IDE gene were linked to LOAD incidence. The presence of the CT+CC genotype of rs1999764 had a protective effect compared to the TT genotype (adjusted P=.0001; odds ratio [OR]=0.226; 95% confidence interval [CI]=0.116-0.441), while the CT+CC genotype of rs1887922 was associated with increased LOAD risk (adjusted P=.0001; OR=3.640; 95% CI=1.889-7.016). Moreover, the effects of rs1887922 and rs1999764 were associated with LOAD risk independent of the apolipoprotein E ∊4 polymorphism and were more significant in men and women, respectively. These results demonstrate that the polymorphisms rs1887922 and rs1999764 of the IDE gene are associated with LOAD susceptibility in the Xinjiang Han population. © The Author(s) 2014.

  1. Association of Interleukin-1 Gene Single Nucleotide Polymorphisms with Keratoconus in Chinese Han Population.

    PubMed

    Wang, Yani; Wei, Wei; Zhang, Changning; Zhang, XueHui; Liu, Ming; Zhu, Xiuping; Xu, Kun

    2016-05-01

    To investigate whether interleukin-1 alpha (IL1A) and interleukin-1 beta (IL1B) polymorphisms are associated with keratoconus (KC) in unrelated Chinese Han patients. The IL1A (rs2071376) and IL1B (rs1143627, rs16944) polymorphisms were genotyped in 115 unrelated Chinese Han KC patients and 101 healthy Chinese Han volunteers with the Sequenom MassARRAY RS1000. Sequenom Typer 4.0 software, PLINK 1.07, Haploview 4.0 software platform were used to analyze the allelic variants of IL1A and IL1B genes, and their association with KC risk factors were assessed. Among the variants, the three SNPs (rs2071376 in IL1A, rs1143627 and rs16944 in the promoter region of IL1B) were different between the two groups. The A allele of rs2071376 (A > C, p = 0.017, OR = 1.968, 95% C.I. 1.313-3.425), the C allele of rs1143627 (C > T, p < 0.001, OR = 2.864, 95% C.I. 1.631-4.968) and the A allele of rs16944 (A > G, p = 0.002, OR = 2.401, 95% C.I. 1.396-4.161) were associated with a increased risk of KC in Chinese Han patients. This study showed that rs2071376, rs1143627 and rs16944 had significant differences in associations between KC patients and the control group when different genotypes were analyzed in three models (dominant, recessive, and additive). In the haplotype analysis, the two single nucleotide polymorphisms (SNPs), rs1143627 and rs16944 showed strong linkage disequilibrium. In addition, Haplotype "ACA" was found to be associated with a higher risk of developing KC (OR = 12.91, p < 0.001). Keratocyte apoptosis is an initiating event in the pathogenesis of KC which could be induced by the altered levels of IL1 gene. These findings confirmed that polymorphisms in IL1 genes were associated with risk of KC in the Chinese Han population, which help us to gain insight into the pathogenesis of KC.

  2. Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

    PubMed

    Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

    2010-05-01

    Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

  3. Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures.

    PubMed

    Handoko, H Y; Nancarrow, D J; Mowry, B J; McGrath, J J

    2006-01-01

    The association between vitamin D levels and skeletal growth has long been recognized. However, exposure to low levels of vitamin D during early life is also known to alter brain development, and is a candidate risk factor for schizophrenia. This study examines the association between four polymorphisms in the vitamin D receptor (VDR) and 1) risk of schizophrenia, and 2) three anthropometric variables (height, head size, and head shape). Four single-nucleotide polymorphisms (SNPs; rs10735810/FokI, rs1544410/BsmI, rs7975232/ApaI, and rs731236/TaqI) in the VDR gene were genotyped in 179 individuals with schizophrenia and 189 healthy controls. No significant associations were detected between any of the four VDR SNPs and risk of schizophrenia. Patients were slightly but significantly shorter compared to controls. Of the four SNPs, only rs10735810/FokI was associated with any of the anthropometric measures: the M4 isoform of this SNP was significantly associated with larger head size (P = 0.002). In light of the evidence demonstrating a role for vitamin D during brain development, the association between polymorphisms in VDR and brain development warrants closer scrutiny.

  4. Candidate genes for COPD in two large data sets.

    PubMed

    Bakke, P S; Zhu, G; Gulsvik, A; Kong, X; Agusti, A G N; Calverley, P M A; Donner, C F; Levy, R D; Make, B J; Paré, P D; Rennard, S I; Vestbo, J; Wouters, E F M; Anderson, W; Lomas, D A; Silverman, E K; Pillai, S G

    2011-02-01

    Lack of reproducibility of findings has been a criticism of genetic association studies on complex diseases, such as chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationships to COPD and genotyped these variants in a case-control study that included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post-bronchodilator forced expiratory volume in 1 s (FEV₁) % predicted and FEV₁/forced vital capacity (FVC)). The polymorphisms significantly associated to these phenotypes in this first study were tested in a second, family-based study that included 635 pedigrees with 1,910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p<0.05). Single-nucleotide polymorphisms rs17467825 and rs1155563 of the GC gene were significantly associated with FEV₁ % predicted and FEV₁/FVC, respectively, in both populations (p<0.05). This study has replicated associations to COPD phenotypes in the STAT1, NFKBIB/SIRT2 and GC genes in two independent populations, the associations of the former two genes representing novel findings.

  5. Novel Association of WNK4 Gene, Ala589Ser Polymorphism in Essential Hypertension, and Type 2 Diabetes Mellitus in Malaysia.

    PubMed

    Ghodsian, Nooshin; Ismail, Patimah; Ahmadloo, Salma; Heidari, Farzad; Haghvirdizadeh, Polin; Ataollahi Eshkoor, Sima; Etemad, Ali

    2016-01-01

    With-no-lysine (K) Kinase-4 (WNK4) consisted of unique serine and threonine protein kinases, genetically associated with an autosomal dominant form of hypertension. Argumentative consequences have lately arisen on the association of specific single nucleotide polymorphisms of WNK4 gene and essential hypertension (EHT). The aim of this study was to determine the association of Ala589Ser polymorphism of WNK4 gene with essential hypertensive patients in Malaysia. WNK4 gene polymorphism was specified utilizing mutagenically separated polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) method in 320 subjects including 163 cases and 157 controls. Close relation between Ala589Ser polymorphism and elevated systolic and diastolic blood pressure (SBP and DBP) was recognized. Sociodemographic factors including body mass index (BMI), age, the level of fasting blood sugar (FBS), low density lipoprotein (LDL), and triglyceride (TG) in the cases and healthy subjects exhibited strong differences (p < 0.05). The distribution of allele frequency and genotype of WNK4 gene Ala589Ser polymorphism showed significant differences (p < 0.05) between EHT subjects with or without type 2 diabetes mellitus (T2DM) and normotensive subjects, statistically. The WNK4 gene variation influences significantly blood pressure increase. Ala589Ser probably has effects on the enzymic activity leading to enhanced predisposition to the disorder.

  6. Correlation between facial morphology and gene polymorphisms in the Uygur youth population.

    PubMed

    He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao

    2017-04-25

    Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.

  7. Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

    PubMed

    Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

    2017-08-01

    Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

  8. Differential effects of chromosome 9p21 variation on subphenotypes of intracranial aneurysm: site distribution.

    PubMed

    Nakaoka, Hirofumi; Takahashi, Tomoko; Akiyama, Koichi; Cui, Tailin; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hata, Akira; Inoue, Ituro

    2010-08-01

    Recently, a genome-wide association study identified associations between single nucleotide polymorphisms on chromosome 9p21 and risk of harboring intracranial aneurysm (IA). Aneurysm characteristics or subphenotypes of IAs, such as history of subarachnoid hemorrhage, presence of multiple IAs and location of IAs, are clinically important. We investigated whether the association between 9p21 variation and risk of IA varied among these subphenotypes. We conducted a case-control study of 981 cases and 699 controls in Japanese. Four single nucleotide polymorphisms tagging the 9p21 risk locus were genotyped. The OR and 95% CI were estimated using logistic regression analyses. Among the 4 single nucleotide polymorphisms, rs1333040 showed the strongest evidence of association with IA (P=1.5x10(-6); per allele OR, 1.43; 95% CI, 1.24-1.66). None of the patient characteristics (gender, age, smoking, and hypertension) was a significant confounder or effect modifier of the association. Subgroup analyses of IA subphenotypes showed that among the most common sites of IAs, the association was strongest for IAs of the posterior communicating artery (OR, 1.69; 95% CI, 1.26-2.26) and not significant for IAs in the anterior communicating artery (OR, 1.22; 95% CI, 0.96-1.57). When dichotomizing IA sites, the association was stronger for IAs of the posterior circulation-posterior communicating artery group (OR, 1.73; 95% CI, 1.32-2.26) vs the anterior circulation group (OR, 1.28; 95% CI, 1.07-1.53). Heterogeneity in these ORs was significant (P=0.032). The associations did not vary when stratifying by history of subarachnoid hemorrhage (OR, 1.42; 95% CI, 1.18-1.71 for ruptured IA; OR, 1.27; 95% CI, 1.00-1.62 for unruptured IA) or by multiplicity of IA (OR, 1.57; 95% CI, 1.21-2.03 for multiple IAs; OR, 1.36; 95% CI, 1.15-1.61 for single IA). Our results suggest that genetic influence on formation may vary between IA subphenotypes.

  9. Variation of Cats under Domestication: Genetic Assignment of Domestic Cats to Breeds and Worldwide Random Bred Populations

    PubMed Central

    Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.

    2012-01-01

    Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373

  10. Initial evidence that polymorphisms in neurotransmitter-regulating genes contribute to being born small for gestational age

    PubMed Central

    Morgan, Angharad R.; Thompson, John M.D.; Waldie, Karen E.; Cornforth, Christine M.; Turic, Darko; Sonuga-Barke, Edmund J.S.; Lam, Wen-Jiun; Ferguson, Lynnette R.; Mitchell, Edwin A.

    2012-01-01

    Being born small for gestational age (SGA) is a putative risk factor for the development of later cognitive and psychiatric health problems. While the inter-uterine environment has been shown to play an important role in predicting birth weight, little is known about the genetic factors that might be important. Here we test the hypothesis that neurotransmitter-regulating genes implicated in psychiatric disorders previously shown to be associated with SGA (such as attention-deficit hyperactivity disorder) are themselves predictive of SGA. DNA was collected from 227 SGA and 319 appropriate for gestational age children taking part in the Auckland Birthweight Collaborative Study. Candidate single nucleotide polymorphisms in genes regulating activity within dopamine, serotonin, glutamate and gamma-aminobutyric acid pathways were genotyped. Multiple regression analysis, controlling for potentially confounding factors, supported nominally significant associations between SGA and single nucleotide polymorphisms in COMT, HTR2A, SLC1A1 and SLC6A1. This is the first evidence that genes implicated in psychiatric disorders previously linked to SGA status themselves predict SGA. This highlights the possibility that the link between SGA and psychiatric disorders such as attention-deficit hyperactivity disorder may in part be genetically determined – that SGA marks pre-existing genetic risk for later problems. PMID:27625810

  11. Toll-like receptor cascade and gene polymorphism in host-pathogen interaction in Lyme disease.

    PubMed

    Rahman, Shusmita; Shering, Maria; Ogden, Nicholas H; Lindsay, Robbin; Badawi, Alaa

    2016-01-01

    Lyme disease (LD) risk occurs in North America and Europe where the tick vectors of the causal agent Borrelia burgdorferi sensu lato are found. It is associated with local and systemic manifestations, and has persistent posttreatment health complications in some individuals. The innate immune system likely plays a critical role in both host defense against B. burgdorferi and disease severity. Recognition of B. burgdorferi, activation of the innate immune system, production of proinflammatory cytokines, and modulation of the host adaptive responses are all initiated by Toll-like receptors (TLRs). A number of Borrelia outer-surface proteins (eg, OspA and OspB) are recognized by TLRs. Specifically, TLR1 and TLR2 were identified as the receptors most relevant to LD. Several functional single-nucleotide polymorphisms have been identified in TLR genes, and are associated with varying cytokines types and synthesis levels, altered pathogen recognition, and disruption of the downstream signaling cascade. These single-nucleotide polymorphism-related functional alterations are postulated to be linked to disease development and posttreatment persistent illness. Elucidating the role of TLRs in LD may facilitate a better understanding of disease pathogenesis and can provide an insight into novel therapeutic targets during active disease or postinfection and posttreatment stages.

  12. Toll-like receptor cascade and gene polymorphism in host–pathogen interaction in Lyme disease

    PubMed Central

    Rahman, Shusmita; Shering, Maria; Ogden, Nicholas H; Lindsay, Robbin; Badawi, Alaa

    2016-01-01

    Lyme disease (LD) risk occurs in North America and Europe where the tick vectors of the causal agent Borrelia burgdorferi sensu lato are found. It is associated with local and systemic manifestations, and has persistent posttreatment health complications in some individuals. The innate immune system likely plays a critical role in both host defense against B. burgdorferi and disease severity. Recognition of B. burgdorferi, activation of the innate immune system, production of proinflammatory cytokines, and modulation of the host adaptive responses are all initiated by Toll-like receptors (TLRs). A number of Borrelia outer-surface proteins (eg, OspA and OspB) are recognized by TLRs. Specifically, TLR1 and TLR2 were identified as the receptors most relevant to LD. Several functional single-nucleotide polymorphisms have been identified in TLR genes, and are associated with varying cytokines types and synthesis levels, altered pathogen recognition, and disruption of the downstream signaling cascade. These single-nucleotide polymorphism-related functional alterations are postulated to be linked to disease development and posttreatment persistent illness. Elucidating the role of TLRs in LD may facilitate a better understanding of disease pathogenesis and can provide an insight into novel therapeutic targets during active disease or postinfection and posttreatment stages. PMID:27330321

  13. SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

    PubMed Central

    Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

    2000-01-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

  14. Two single nucleotide polymorphisms in the CYP17 and COMT Genes--relation to bone mass and longitudinal bone changes in postmenopausal women with or without hormone replacement therapy. The Danish Osteoporosis Prevention Study.

    PubMed

    Tofteng, C L; Abrahamsen, B; Jensen, J E B; Petersen, S; Teilmann, J; Kindmark, A; Vestergaard, P; Gram, J; Langdahl, B L; Mosekilde, L

    2004-08-01

    Sex steroids are important physiologic regulators of bone mass, and genes regulating sex steroid production and metabolism are obvious as candidate genes for osteoporosis susceptibility. We present data from a study of 1795 recent postmenopausal women, assigned to either hormone replacement therapy (HRT) or no treatment and followed for 5 years. The association between bone mass measurements and two single nucleotide polymorphisms, a T (A1) to C (A2) transition in the 5'-UTR of the cytochrome P450c17alpha (CYP17) gene and a G (Val) to A (Met) transition in exon 4 of the catechol- O-methyltransferase (COMT) gene, was evaluated. Association with CYP17 genotype was modified by body mass index (BMI). In lean women, individuals homozygous for the CYP17 A2 allele were 1 cm shorter and had lower baseline BMD (bone mineral density), BMC, and CSA (cross sectional area) in the spine and femoral neck than did other women (BMD spine A2A2: 0.975 g/cm2 versus 1.011 g/cm2 in A1A1 + A1A2, P = 0.002). Conversely, an adverse association with A2A2 and bone loss over 5 years seemed present only in overweight women, but differences were small. Response to HRT was not dependent on CYP17 genotype. COMT genotype was not associated with bone mass at baseline, bone loss in untreated women, or response to HRT. In conclusion, the A2 allele of the CYP17 T(27)-C polymorphism is associated with reduced bone mass and bone size in lean perimenopausal women, whereas high BMI protects against this negative association. The COMT G(1947)-A polymorphism is not associated with bone parameters in this study.

  15. SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

    PubMed

    Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

    2000-08-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P

  16. Association and family studies of DRD2 gene polymorphisms in alcohol dependence syndrome.

    PubMed

    Małecka, Iwona; Jasiewicz, Andrzej; Suchanecka, Aleksandra; Samochowiec, Jerzy; Grzywacz, Anna

    2014-11-06

    The human dopamine receptor 2 gene DRD2 plays a central role in susceptibility to Alcohol Dependence Syndrome (ADS). The aim of this study was to evaluate 3 single nucleotide polymorphisms: D2 (rs1076560), Tag1D (rs1800498), Tag1B (rs1079597) located in dopamine receptor 2 DRD2 gene and its role in alcohol dependence. DNA was provided from alcohol dependent (AD) patients (n=171) and healthy control subjects (n=160) all of Polish descent. The history of alcoholism was obtained using the Polish version of the SSAGA (Semi-Structured Assessment for the Genetics of Alcoholism). We conducted case-control association study and transmission disequilibrium test (TDT). Samples were genotyped using real-time PCR method. We did not confirm the association between studied polymorphisms and alcohol dependence syndrome. TDT reveled an adequate transmission of both alleles in the group of alcohol families. The lack of association of studied polymorphisms and ADS does not preclude its participation in the pathogenesis. Further research is needed to determine the actual contribution of DRD2 gene in the pathogenesis of alcoholism.

  17. Identification of relevant single-nucleotide polymorphisms in Pneumocystis jirovecii: relationship with clinical data.

    PubMed

    Esteves, F; Gaspar, J; Marques, T; Leite, R; Antunes, F; Mansinho, K; Matos, O

    2010-07-01

    Pneumocystis jirovecii is a poorly understood pathogen that causes opportunistic pneumonia (Pneumocystis pneumonia (PcP)) in patients with AIDS. The present study was aimed at correlating genetic differences in P. jirovecii isolates and clinical patient data. A description of genetic diversity in P. jirovecii isolates from human immunodeficiency virus-positive patients, based on the identification of multiple single-nucleotide polymorphisms (SNPs) at five distinct loci encoding mitochondrial large-subunit rRNA (mtLSU rRNA), cytochrome b (CYB), superoxide dismutase (SOD), dihydrofolate reductase (DHFR), and dihydropteroate synthase (DHPS), was achieved using PCR with DNA sequencing and restriction fragment length polymorphism analysis. The statistical analysis revealed several interesting correlations among the four most relevant SNPs (mt85, SOD110, SOD215, and DHFR312) and specific clinical parameters: mt85C was associated with undiagnosed or atypical PcP episodes and favourable follow-up; SOD215C was associated with favourable follow-up; and DHFR312T was associated with PcP cases presenting moderate to high parasite burdens. The genotypes mt85C/SOD215C and SOD110T/SOD215C were found to be associated with less virulent P. jirovecii infections, whereas the genotype SOD110T/SOD215T was found to be related to more virulent PcP episodes. The present work demonstrated that potential P. jirovecii haplotypes may be related to the clinical data and outcome of PcP.

  18. Association between single nucleotide polymorphisms of the transforming growth factor β1 gene and the risk of severe radiation esophagitis in patients with lung cancer.

    PubMed

    Guerra, Jose Luis Lopez; Gomez, Daniel; Wei, Qingyi; Liu, Zhengshen; Wang, Li-E; Yuan, Xianglin; Zhuang, Yan; Komaki, Ritusko; Liao, Zhongxing

    2012-12-01

    We investigated the association between single nucleotide polymorphisms (SNPs) in the transforming growth factor β1 (TGFβ1) gene and the risk of radiation-induced esophageal toxicity (RE) in patients with non-small-cell lung cancer (NSCLC). Ninety-seven NSCLC patients with available genomic DNA samples and mostly treated with intensity modulated radio(chemo)therapy from 2003 to 2006 were used as a test dataset and 101 NSCLC patients treated with 3-dimensional conformal radio(chemo)therapy from 1998 to 2002 were used as a validation set. We genotyped three SNPs of the TGFβ1 gene (rs1800469:C-509T, rs1800471:G915C, and rs1982073:T869C) by the polymerase chain reaction restriction fragment length polymorphism method. In the test dataset, the CT/TT genotypes of TGFβ1 rs1800469:C-509T were associated with a statistically significant higher risk of RE grade⩾3 in univariate (P=0.026) and multivariate analysis (P=0.045) when compared with the CC genotype. These results were again observed in both univariate (P=0.045) and multivariate (P=0.023) analysis in the validation dataset. We found and validated that the TGFβ1 rs1800469:C-509T genotype is associated with severe RE. This response marker may be used for guiding therapy intensity in an individual patient, which would further the goal of individualized therapy. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  19. Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

    PubMed

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

  20. Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

    PubMed

    Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

    2013-11-01

    Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

  1. Association Genetics of Coastal Douglas Fir (Pseudotsuga menziesii var. menziesii, Pinaceae). I. Cold-Hardiness Related Traits

    Treesearch

    Andrew J. Eckert; Andrew D. Bower; Jill L. Wegrzyn; Barnaly Pande; Kathleen D. Jermstad; Konstantin V. Krutovsky; J. Bradley St. Clair; David B. Neale

    2009-01-01

    Adaptation to cold is one of the greatest challenges to forest trees. This process is highly synchronized with environmental cues relating to photoperiod and temperature. Here, we use a candidate gene-based approach to search for genetic associations between 384 single-nucleotide polymorphism (SNP) markers from 117 candidate genes and 21 cold-hardiness related traits....

  2. A single nucleotide polymorphism in COQ9 affects mitochondrial and ovarian function and fertility in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    A single missense mutation at position 159 of COQ9 (GàA) has been associated with genetic variation in fertility in Holstein cattle, with the A allele associated with higher fertility. COQ9 is involved in the synthesis of coenzyme COQ10, a component of the electron transport system of the mitochondr...

  3. Association of single nucleotide polymorphisms in candidate genes previously related to genetic variation in fertility with phenotypic measurements of reproductive function in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    The objectives of this study were to evaluate the effect of 68 SNP previously associated with genetic merit for fertility and production on phenotype for reproductive and productive traits in a population of Holstein cows. In addition, we determined which SNP had repeated effects across three studie...

  4. Genome-wide copy number variant analysis in Holstein cattle reveals variants associated with 10 production traits including residual feed intake and dry matter intake

    USDA-ARS?s Scientific Manuscript database

    Copy number variation (CNV) is an important type of genetic variation contributing to phenotypic differences among mammals and may serve as an alternative molecular marker to single nucleotide polymorphism (SNP) for genome-wide association study (GWAS). Recently, GWAS analysis using CNV has been app...

  5. Identification of single-nucleotide polymorphic loci associated with biomass yield under water deficit in alfalfa (Medicago sativa L.) using genome-wide sequencing and association mapping

    USDA-ARS?s Scientific Manuscript database

    Alfalfa is a worldwide grown forage crop and is important due to its high biomass production and nutritional value. However, the production of alfalfa is challenged by adverse environmental stress factors such as drought and other stresses. Developing drought resistance alfalfa is an important breed...

  6. A non-stop S-antigen gene mutation is associated with late onset hereditary retinal degeneration in dogs

    PubMed Central

    Jordan, Julie Ann; Aguirre, Gustavo D.; Acland, Gregory M.

    2013-01-01

    Purpose To identify the causative mutation of canine progressive retinal atrophy (PRA) segregating as an adult onset autosomal recessive disorder in the Basenji breed of dog. Methods Basenji dogs were ascertained for the PRA phenotype by clinical ophthalmoscopic examination. Blood samples from six affected cases and three nonaffected controls were collected, and DNA extraction was used for a genome-wide association study using the canine HD Illumina single nucleotide polymorphism (SNP) array and PLINK. Positional candidate genes identified within the peak association signal region were evaluated. Results The highest -Log10(P) value of 4.65 was obtained for 12 single nucleotide polymorphisms on three chromosomes. Homozygosity and linkage disequilibrium analyses favored one chromosome, CFA25, and screening of the S-antigen (SAG) gene identified a non-stop mutation (c.1216T>C), which would result in the addition of 25 amino acids (p.*405Rext*25). Conclusions Identification of this non-stop SAG mutation in dogs affected with retinal degeneration establishes this canine disease as orthologous to Oguchi disease and SAG-associated retinitis pigmentosa in humans, and offers opportunities for genetic therapeutic intervention. PMID:24019744

  7. Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui

    2011-07-15

    Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this northern Chinese population.« less

  8. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  9. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  10. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  11. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

    PubMed

    Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

    2006-06-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

  12. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

    PubMed Central

    Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

    2006-01-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

  13. Modulation of risk of squamous cell carcinoma head and neck in North Indian population with polymorphisms in xeroderma pigmentosum complementation Group C gene.

    PubMed

    Yadav, Suresh Kumar; Singh, Sudhir; Gupta, Shalini; Brahma Bhatt, Madan Lal; Mishra, Durga P; Roy, D; Sanyal, Somali

    2018-01-01

    Genetic variations in nucleotide excision repair genes can alter the risk of squamous cell carcinoma of head and neck (SCCHN). The present study has genotyped 334 subjects from North Indian population for xeroderma pigmentosum complementation Group C (XPC) rs2228001A>C, XPC rs77907221 polyadenylate (PAT) deletion/insertion (D/I), xeroderma pigmentosum complementation Group D - rs13181A>C, and xeroderma pigmentosum complementation Type G rs17655 G>C polymorphisms with polymerase chain reaction (PCR)-restriction-fragment length polymorphism or allele-specific PCR methods. Compared to D allele, I allele for XPC PAT D/I polymorphism was associated with significantly decreased the risk of SCCHN (odds ratios = 0.67, 95% confidence interval [CI] =0.48-0.94, P = 0.03). Haplotype CI constituted from XPC polymorphisms was also associated with decreased risk of SCCHN (P = 0.004). In contrast, haplotype Crohn's disease significantly increased the risk for SCCHN (P < 0.00). A significant early onset of SCCHN was observed in individuals with CC genotype for XPC A>C polymorphism (P = 0.004). Our results suggest a possible risk modulation for SCCHN with XPC polymorphisms in North Indian population.

  14. p16 gene silencing along with p53 single-nucleotide polymorphism and risk of esophageal cancer in Northeast India.

    PubMed

    Das, Mandakini; Sharma, Santanu Kumar; Sekhon, Gaganpreet Singh; Mahanta, Jagadish; Phukan, Rup Kumar; Jalan, Bimal Kumar

    2017-05-01

    The high incidence of esophageal cancer in Northeast India and the unique ethnic background and dietary habits provide a great opportunity to study the molecular genetics behind esophageal squamous cell carcinoma in this part of the region. We hypothesized that in addition to currently known environmental risk factors for esophageal cancer, genetic and epigenetic factors are also involved in esophageal carcinogenesis in Northeast India. Therefore, in this study, we explored the possible association between the two important G1 cell cycle regulatory genes p16 and p53 and environmental risk factors and risk of esophageal carcinogenesis. A total of 100 newly diagnosed esophageal cancer cases along with equal number of age-, sex-, and ethnicity-matched controls were included in this study. Methylation-specific polymerase chain reaction was used to determine the p16 promoter methylation status. Single-nucleotide polymorphism at codon 72 of p53 gene was assessed by the polymerase chain reaction-restriction fragment length polymorphism method. Aberrant methylation of p16 gene was seen in 81% of esophageal cancer cases. Hypermethylation of p16 gene was not found in healthy controls. p53 Pro/Pro genotype was found to be a risk genotype in Northeast India compared with Arg/Pro and Arg/Arg. p53 variant/polymorphism was significantly associated with esophageal cancer risk in the study population under all three genetic models, namely, dominant model (Arg/Pro + Pro/Pro vs Arg/Arg odds ratio = 2.25, confidence interval = 1.19-4.26; p = 0.012), recessive model (Arg/Arg + Arg/Pro vs Pro/Pro odds ratio = 2.35, confidence interval = 1.24-4.44; p = 0.008), and homozygous model (Pro/Pro vs Arg/Arg odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). However, p53 variant/polymorphism was not statistically associated with esophageal cancer risk under the heterozygous model (Pro/Pro vs Arg/Pro). In the case-only analysis based on p16 methylation, the p53 variant/polymorphism (Pro/Pro or Arg/Pro) showed significant association for esophageal cancer risk (odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). Gene-gene and gene-environment interaction using the case-only approach revealed a strong association between p16 methylation, p53 single-nucleotide polymorphism, and environmental factors and esophageal cancer risk. Cases with p16 methylation and p53 variant/polymorphism (Pro/Pro or Arg/Pro) along with both betel quid and tobacco chewing habit (odds ratio = 8.29, confidence interval = 1.14-60.23; p = 0.037) conferred eightfold increased risk toward esophageal cancer development. This study reveals a synergistic interaction between epigenetic, genetic, and environmental factors and risk of esophageal cancer in this high-incidence region of Northeast India. The inactivation of either p16 or p53 in a majority of esophageal cancer cases in this study suggests the possible crosstalk between the important cell cycle genes.

  15. Reading and Generalist Genes

    ERIC Educational Resources Information Center

    Haworth, Claire M. A.; Meaburn, Emma L.; Harlaar, Nicole; Plomin, Robert

    2007-01-01

    Twin-study research suggests that many (but not all) of the same genes contribute to genetic influence on diverse learning abilities and disabilities, a hypothesis called "generalist genes". This generalist genes hypothesis was tested using a set of 10 DNA markers (single nucleotide polymorphisms [SNPs]) found to be associated with early reading…

  16. RNA-Seq identifies SNPs associated with muscle yield and quality in rainbow trout

    USDA-ARS?s Scientific Manuscript database

    Rainbow trout (Oncorhynchus mykiss) is one of the top five sport fish species in North America and the second most widely cultivated fish species for food. Quality attributes of fish flesh are important determinants of profitability for the food fish aquaculture industry. Single nucleotide polymorph...

  17. Development of a rapid serotyping method for Salmonella enterica using serotype-specific single-nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific to birds (S. e...

  18. Lipoprotein lipase variants interact with polyunsaturated fatty acids to modulate obesity traits in Puerto Ricans

    USDA-ARS?s Scientific Manuscript database

    Lipoprotein lipase (LPL) is a candidate gene for obesity based on its role in triglyceride hydrolysis and the partitioning of fatty acids towards storage or oxidation. Whether dietary fatty acids modify LPL associated obesity risk is unknown. We examined five single nucleotide polymorphisms (SNPs) (...

  19. Determination of single nucleotide polymorphisms associated with subclinical ketosis in Jersey cattle

    USDA-ARS?s Scientific Manuscript database

    Subclinical ketosis is a fresh cow disorder that is costly in terms of lost milk production and treatment cost. Although treatment and prevention strategies are available, prevention requires targeting animals that are likely to develop the disease. Whole-herd genotyping is becoming more common with...

  20. Population-Specific Patterns of Linkage Disequilibrium and SNP Variation in Spring and Winter Polyploid Wheat

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...

  1. Association of single nucleotide polymorphisms to resistance to chalkbrood in Apis mellifera

    USDA-ARS?s Scientific Manuscript database

    Chalkbrood is a honey bee brood disease that often affects colonies that are already under stress. Control of the disease can be as simple as ensuring adequate ventilation and food sources or using clean beekeeping equipment. However, when the infection goes unchecked, the overall health and produ...

  2. Partial-genome evaluation of postweaning feed intake and efficiency of crossbred beef cattle

    USDA-ARS?s Scientific Manuscript database

    Effects of individual single nucleotide polymorphisms (SNP), and variation explained by sets of SNP associated with dry matter intake (DMI), metabolic mid-test weight (MBW), BW gain (GN) and feed efficiency expressed as phenotypic and genetic residual feed intake (RFIp; RFIg) were estimated from wei...

  3. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    PubMed

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

    PubMed

    Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

    2018-06-01

    Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Association of vdr, cyp27b1, cyp24a1 and mthfr gene polymorphisms with oral lichen planus risk.

    PubMed

    Kujundzic, Bojan; Zeljic, Katarina; Supic, Gordana; Magic, Marko; Stanimirovic, Dragan; Ilic, Vesna; Jovanovic, Barbara; Magic, Zvonko

    2016-05-01

    The current study investigated the association between VDR EcoRV (rs4516035), FokI (rs2228570), ApaI (rs7975232) and TaqI (rs731236), CYP27B1 (rs4646536), CYP24A1 (rs2296241), and MTHFR (rs1801133) gene polymorphisms and risk of oral lichen planus (OLP) occurrence. The study group consisted of 65 oral lichen planus patients and 100 healthy blood donors in the control group. Single nucleotide polymorphisms were genotyped by real time PCR or PCR-restriction fragment length polymorphism (RFLP) method. Heterozygous as well as mutated genotype of vitamin D receptor (VDR) FokI (rs2228570) polymorphism was associated with increased oral lichen planus risk in comparison with wild type genotype (odds ratio (OR) = 3.877, p = 0.017, OR = 38.153, p = 0.001, respectively). A significantly decreased OLP risk was observed for heterozygous genotype of rs2296241 polymorphism in CYP24A1 gene compared with the wild type form (OR = 0.314, p = 0.012). VDR gene polymorphisms ApaI and TaqI were in linkage disequilibrium (D' = 0.71, r(2) = 0.22). Identified haplotype AT was associated with decreased OLP risk (OR = 0.592, p = 0.047). Our results highlight the possible important role of VDR FokI (rs2228570) and CYP24A1 rs2296241 gene polymorphisms for oral lichen planus susceptibility. Identification of new molecular biomarkers could potentially contribute to determination of individuals with OLP predisposition.

  6. Genetic polymorphisms in the vitamin D pathway in relation to lung cancer risk and survival

    PubMed Central

    Kong, Jinyu; Xu, Fangxiu; Qu, Jinli; Wang, Yu; Gao, Ming; Yu, Herbert; Qian, Biyun

    2015-01-01

    Studies have suggested that vitamin D may have protective effects against cancer development or tumor progression. To search for additional evidence, we investigated the role of genetic polymorphisms involved in the vitamin D pathway in non-small cell lung cancer (NSCLC). We evaluated common genetic polymorphisms associated with the vitamin D pathway in relation to NSCLC in a case-control study of 603 newly diagnosed NSCLC patients and 661 matched healthy controls. Seven single nucleotide polymorphisms (SNPs) were genotyped, the expression of CYP27B1 and CYP24A1 were measured in 153 tumor samples and their associations with genotypes and patient survival were also analyzed. In the case-control comparison, we found SNP rs3782130 (CYP27B1), rs7041 (GC), rs6068816 and rs4809957 (CYP24A1) associated with NSCLC risk. The risk of NSCLC was increased with the number of risk alleles. CYP27B1 and CYP24A1 expression were significantly different between tumor and normal tissues in NSCLC. High CYP27B1 expression was associated with better overall survival, and the expression was different by the rs3782130 genotype. The study suggests that some genetic polymorphisms involved in the vitamin D pathway may associate with NSCLC risk, and one of the polymorphisms (rs3782130) may affect gene expression and patient survival. PMID:25544771

  7. TLR9 Polymorphisms Are Associated with Altered IFN-γ Levels in Children with Cerebral Malaria

    PubMed Central

    Sam-Agudu, Nadia A.; Greene, Jennifer A.; Opoka, Robert O.; Kazura, James W.; Boivin, Michael J.; Zimmerman, Peter A.; Riedesel, Melissa A.; Bergemann, Tracy L.; Schimmenti, Lisa A.; John, Chandy C.

    2010-01-01

    Toll-like receptor (TLR) polymorphisms have been associated with disease severity in malaria infection, but mechanisms for this association have not been characterized. The TLR2, 4, and 9 single nucleotide polymorphism (SNP) frequencies and serum interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) levels were assessed in Ugandan children with cerebral malaria (CM, N = 65) and uncomplicated malaria (UM, N = 52). The TLR9 C allele at −1237 and G allele at 1174 were strongly linked, and among children with CM, those with the C allele at −1237 or the G allele at 1174 had higher levels of IFN-γ than those without these alleles (P = 0.03 and 0.008, respectively). The TLR9 SNPs were not associated with altered IFN-γ levels in children with UM or altered TNF-α levels in either group. We present the first human data that TLR SNPs are associated with altered cytokine production in parasitic infection. PMID:20348497

  8. MicroRNAs-1614-3p gene seed region polymorphisms and association analysis with chicken production traits.

    PubMed

    Li, Hong; Sun, Gui-Rong; Tian, Ya-Dong; Han, Rui-Li; Li, Guo-Xi; Kang, Xiang-Tao

    2013-05-01

    In the present study, a total of 860 chickens from a Gushi-Anka F2 resource population were used to evaluate the genetic effect of the gga-miR-1614-3p gene. A novel, silent, single nucleotide polymorphism (SNP, +5 C>T) was detected in the gga-miR-1614-3p gene seed region through AvaII polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and PCR products sequencing methods. Associations between the SNP and chicken growth, meat quality and carcass traits were performed by association analysis. The results showed that the SNP was significantly associated with breast muscle shear force and leg muscle water loss rate, wing weight, liver weight and heart weight (p<0.05), and highly significantly associated with the weight of the abdominal fat (p<0.01). The secondary structure of gga-miR-1614 and the free energy were altered due to the variation predicted by the M-fold program.

  9. Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

    PubMed

    Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

    2015-03-15

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. [The association between the DNA marker rs1842993 and risk for cardioembolic stroke in the Slavic population].

    PubMed

    Shetova, I M; Timofeev, D Iu; Shamalov, N A; Bondarenko, E A; Slominskiĭ, P A; Limborskaia, S A; Skvortsova, V I

    2012-01-01

    The analysis of association between DNA markers and total stroke risk was performed in 950 Slavonic patients. Patients with cardioembolic stroke were selected for a genome-wide association study. The HUMANCYTOSNP12 v.2 microchip was used to analyze all DNA samples on a panel of 301 000 single nucleotide polymorphisms. SNP rs1842993 on chromosome 7 was found to be associated with cardioembolic stroke risk.

  11. SLC30A8 nonsynonymous variant is associated with recovery following exercise and skeletal muscle size and strength.

    PubMed

    Sprouse, Courtney; Gordish-Dressman, Heather; Orkunoglu-Suer, E Funda; Lipof, Jason S; Moeckel-Cole, Stephanie; Patel, Ronak R; Adham, Kasra; Larkin, Justin S; Hubal, Monica J; Kearns, Amy K; Clarkson, Priscilla M; Thompson, Paul D; Angelopoulos, Theodore J; Gordon, Paul M; Moyna, Niall M; Pescatello, Linda S; Visich, Paul S; Zoeller, Robert F; Hoffman, Eric P; Tosi, Laura L; Devaney, Joseph M

    2014-01-01

    Genome-wide association studies have identified thousands of variants that are associated with numerous phenotypes. One such variant, rs13266634, a nonsynonymous single nucleotide polymorphism in the solute carrier family 30 (zinc transporter) member eight gene, is associated with a 53% increase in the risk of developing type 2 diabetes (T2D). We hypothesized that individuals with the protective allele against T2D would show a positive response to short-term and long-term resistance exercise. Two cohorts of young adults-the Eccentric Muscle Damage (EMD; n = 156) cohort and the Functional Single Nucleotide Polymorphisms Associated with Muscle Size and Strength Study (FAMuSS; n = 874)-were tested for association of the rs13266634 variant with measures of skeletal muscle response to resistance exercise. Our results were sexually dimorphic in both cohorts. Men in the EMD study with two copies of the protective allele showed less post-exercise bout strength loss, less soreness, and lower creatine kinase values. In addition, men in the FAMuSS, homozygous for the protective allele, showed higher pre-exercise strength and larger arm skeletal muscle volume, but did not show a significant difference in skeletal muscle hypertrophy or strength with resistance training.

  12. Range-wide parallel climate-associated genomic clines in Atlantic salmon

    PubMed Central

    Stanley, Ryan R. E.; Wringe, Brendan F.; Guijarro-Sabaniel, Javier; Bourret, Vincent; Bernatchez, Louis; Bentzen, Paul; Beiko, Robert G.; Gilbey, John; Clément, Marie; Bradbury, Ian R.

    2017-01-01

    Clinal variation across replicated environmental gradients can reveal evidence of local adaptation, providing insight into the demographic and evolutionary processes that shape intraspecific diversity. Using 1773 genome-wide single nucleotide polymorphisms we evaluated latitudinal variation in allele frequency for 134 populations of North American and European Atlantic salmon (Salmo salar). We detected 84 (4.74%) and 195 (11%) loci showing clinal patterns in North America and Europe, respectively, with 12 clinal loci in common between continents. Clinal single nucleotide polymorphisms were evenly distributed across the salmon genome and logistic regression revealed significant associations with latitude and seasonal temperatures, particularly average spring temperature in both continents. Loci displaying parallel clines were associated with several metabolic and immune functions, suggesting a potential basis for climate-associated adaptive differentiation. These climate-based clines collectively suggest evidence of large-scale environmental associated differences on either side of the North Atlantic. Our results support patterns of parallel evolution on both sides of the North Atlantic, with evidence of both similar and divergent underlying genetic architecture. The identification of climate-associated genomic clines illuminates the role of selection and demographic processes on intraspecific diversity in this species and provides a context in which to evaluate the impacts of climate change. PMID:29291123

  13. Vitamin D Receptor Gene Polymorphisms Associated with Childhood Autism

    PubMed Central

    Cieślińska, Anna; Kostyra, Elżbieta; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Fiedorowicz, Ewa; Teodorowicz, Małgorzata

    2017-01-01

    Background: Autism spectrum disorder (ASD) is a group of heterogeneous, behaviorally defined disorders whereby currently no biological markers are common to all affected individuals. A deregulated immune response may be contributing to the etiology of ASD. The active metabolite of vitamin D3 has an immunoregulatory role mediated by binding to the vitamin D receptor (VDR) in monocyte, macrophages, and lymphocytes. The effects of vitamin D and interaction with the VDR may be influenced by polymorphism in the VDR gene. Methods: Genetic association of four different VDR polymorphisms (Apa-I, Bsm-I, Taq-I, Fok-I) associated with susceptibility to the development of autism in children was investigated. Results: We uniquely found an association between the presence of the T allele at position Taq-I and presence of the a allele at position Apa-I of the VDR gene with decreased ASD incidence. There was also an association between female gender and the presence of the T allele. We found no statistical significant correlation between VDR single nucleotide polymorphisms (SNPs) and vitamin D3 concentration in serum of ASD children. Conclusion: Genetic polymorphism in two SNP in VDR may be correlated with development of ASD symptoms by influencing functionality of vitamin D3 metabolism, while vitamin D3 levels were not significantly different between ASD and non-ASD children. PMID:28891930

  14. Vitamin D Receptor Gene Polymorphisms Associated with Childhood Autism.

    PubMed

    Cieślińska, Anna; Kostyra, Elżbieta; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Fiedorowicz, Ewa; Teodorowicz, Małgorzata; Savelkoul, Huub F J

    2017-09-09

    Autism spectrum disorder (ASD) is a group of heterogeneous, behaviorally defined disorders whereby currently no biological markers are common to all affected individuals. A deregulated immune response may be contributing to the etiology of ASD. The active metabolite of vitamin D₃ has an immunoregulatory role mediated by binding to the vitamin D receptor (VDR) in monocyte, macrophages, and lymphocytes. The effects of vitamin D and interaction with the VDR may be influenced by polymorphism in the VDR gene. Genetic association of four different VDR polymorphisms (Apa-I, Bsm-I, Taq-I, Fok-I) associated with susceptibility to the development of autism in children was investigated. We uniquely found an association between the presence of the T allele at position Taq-I and presence of the a allele at position Apa-I of the VDR gene with decreased ASD incidence. There was also an association between female gender and the presence of the T allele. We found no statistical significant correlation between VDR single nucleotide polymorphisms (SNPs) and vitamin D₃ concentration in serum of ASD children. Genetic polymorphism in two SNP in VDR may be correlated with development of ASD symptoms by influencing functionality of vitamin D₃ metabolism, while vitamin D₃ levels were not significantly different between ASD and non-ASD children.

  15. Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors.

    PubMed

    Phababpha, Suphawadee; Kukongviriyapan, Upa; Pakdeechote, Poungrat; Senggunprai, Laddawan; Kukongviriyapan, Veerapol; Settasatian, Chatri; Tatsanavivat, Pyatat; Intharaphet, Phongsak; Senthong, Vichai; Komanasin, Nantarat; Settasatian, Nongnuch; Greenwald, Stephen E

    2013-06-21

    Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. A total of 208 Thai subjects, aged 35-75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai population.

  16. Association of arterial stiffness with single nucleotide polymorphism rs1333049 and metabolic risk factors

    PubMed Central

    2013-01-01

    Background Increased arterial stiffness is a cardiovascular outcome of metabolic syndrome (MetS). The chromosome 9p21 locus has been identified as a major locus for risk of coronary artery disease (CAD). The single nucleotide polymorphism (SNP), rs1333049 on chromosome 9p21.3 has been strongly associated with CAD and myocardial infarction. Increased arterial stiffness could be the link between the 9p21 polymorphism and increased cardiovascular risk. Since the impact of a genetic polymorphism on arterial stiffness especially in Asian populations has not been well defined, we aimed to investigate the association of arterial stiffness with rs 1333049 variant on chromosome 9p21.3 in Thai subjects with and without MetS risk factors. Methods A total of 208 Thai subjects, aged 35–75 years, 135 with and 73 without MetS, according to IDF and NCEP-ATPIII criteria, were included in this study. Aortic-femoral pulse wave velocity (afPWV), brachial-ankle pulse wave velocity (baPWV) and aortic ankle pulse wave velocity (aaPWV) were measured and used as markers of arterial stiffness. The chromosome 9p21.3 locus, represented by the rs 1333049 variant and blood biochemistry were evaluated. Results Arterial stiffness was elevated in subjects with MetS when compared with nonMetS subjects. PWV, especially afPWV increased progressively with increasing number of MetS risk factors (r = 0.322, P <0.001). We also found that the frequency distribution of the rs1333049 genotypes is significantly associated with the afPWV (P <0.05). In multivariate analyses, there was an association between homozygous C allele and afPWV (Odds ratio (OR), 8.16; 95% confidence interval (CI), 1.91 to 34.90; P = 0.005), while the GC genotype was not related to afPWV (OR, 1.79; 95% CI, 0.84 to 3.77; P = 0.129) when compared with the GG genotype. Conclusions Our findings demonstrate for the first time that arterial stiffness is associated with genetic polymorphism in 9p21 and metabolic risk factors in a Thai population. PMID:23787071

  17. Antiretroviral therapy modifies the genetic effect of known type 2 diabetes-associated risk variants in HIV-infected women.

    PubMed

    Frasco, Melissa A; Karim, Roksana; Van Den Berg, David; Watanabe, Richard M; Anastos, Kathryn; Cohen, Mardge; Gange, Stephen J; Gustafson, Deborah R; Liu, Chenglong; Tien, Phyllis C; Mack, Wendy J; Pearce, Celeste L

    2014-07-31

    Type 2 diabetes mellitus incidence is increased in HIV-infected persons. We examined the associations of diabetes mellitus with known diabetes mellitus-risk alleles from the general population in the context of HIV infection, and explored effect modification by combination antiretroviral therapy (cART). The Women's Interagency HIV Study is a prospective cohort of HIV-infected women. Seventeen European-derived diabetes mellitus-risk polymorphisms were genotyped in the eligible participants of the Women's Interagency HIV Study. Analyses were run separately for non-African Americans (Whites, Hispanics, Asians, and other; n = 378, 49 with incident diabetes mellitus) and African Americans (n = 591, 49 with incident diabetes mellitus). Cox proportional-hazards models were fit to estimate hazard ratios for diabetes mellitus overall and within strata of cART. In non-African Americans, heterogeneity across cART regimen was observed for nine of the 14 polymorphisms (phet < 0.05). One polymorphism was statistically significantly inversely associated with diabetes mellitus risk among women taking two nucleotide reverse transcriptase inhibitors (NRTIs) + non-nucleotide reverse transcriptase inhibitor (NNRTI). Five polymorphisms were statistically significantly associated with diabetes mellitus among women treated with at least two NRTIs + at least one protease inhibitor and one polymorphism was associated with diabetes mellitus among those treated with at least three NRTIs ± NNRTI. The hazard ratio per risk allele for IGF2BP2 rs1470579 was 2.67 (95% confidence interval 1.67-4.31) for women taking cART with at least two NRTIs + at least one protease inhibitor and 2.45 (95% confidence interval 1.08-5.53) in women taking at least three NRTIs ± NNRTI (phet = 2.50 × 10⁻³). No such associations were observed in the African Americans. Genetic susceptibility to diabetes mellitus, based on the variants studied, is substantially elevated among HIV-infected women using cART containing three or more NRTI/protease inhibitor components. A personalized medicine approach to cART selection may be indicated for HIV-infected persons carrying these diabetes mellitus-risk variants.

  18. Association between rs6812193 polymorphism and sporadic Parkinson's disease susceptibility.

    PubMed

    Huo, Qiang; Li, Tao; Zhao, Peiqing; Wang, Lianqing

    2015-08-01

    Recently, the association of a single nucleotide polymorphism rs6812193 C/T with sporadic Parkinson's disease (PD) susceptibility has been widely evaluated, but the results remained inconsistent. This association should be clarified because of the importance of it on human health and quality of life. We performed a comprehensive meta-analysis to evaluate the association between the rs6812193 polymorphism and sporadic PD. PubMed was used to retrieve articles published up to June 2014 for all studies evaluating the rs6812193 polymorphism and PD in humans. Ethnicity-specific subgroup analysis was also performed based on ethnicity susceptibility. A total of 17 independent study samples (15 Caucasians and 2 Asians) including 17,956 cases and 52,751 controls were used in the presented study. The MAFT (minor allele T frequency) in PD patients of European descent is obviously higher than Asian cases (p < 0.01). The results suggested the rs6812193 polymorphism (allele T vs. C) is significantly associated with PD susceptibility among overall samples (OR 0.882, 95 % CI 0.856-0.908) and Caucasian population (OR 0.881, 95 % CI 0.856-0.907), but not in Asian samples (OR 0.918, 95 % CI 0.721-1.168). No evidence of publication bias was observed. Throughout our analysis, the rs6812193 polymorphism is significantly associated with sporadic PD susceptibility in Caucasian samples, and ethnicity might be the key point of inconsistency in rs6812193 studies. Further studies are warranted to re-examine the observed associations, especially in different ethnicities.

  19. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    NASA Astrophysics Data System (ADS)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  20. Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

    PubMed

    Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

    2010-06-01

    Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

  1. Human Fetuin-A Rs4918 Polymorphism and its Association with Obesity in Healthy Persons and in Patients with Myocardial Infarction in Two Hungarian Cohorts.

    PubMed

    Temesszentandrási, György; Vörös, Krisztián; Márkus, Bernadett; Böröcz, Zoltán; Kaszás, Edit; Prohászka, Zoltán; Falus, András; Cseh, Károly; Kalabay, László

    2016-08-04

    BACKGROUND Human fetuin A (AHSG) has been associated with the development of obesity, insulin resistance, type 2 diabetes mellitus, and atherosclerosis. Observations on the role of AHSG rs4918 single-nucleotide polymorphism are contradictory. We investigated the association between variants of rs4918 and parameters of obesity, lipid status, tumor necrosis factor-α (TNFα), adipokines (adiponectin, resistin, leptin), and insulin resistance in healthy persons and in patients with previous myocardial infarction. MATERIAL AND METHODS This was a cross-sectional study comprising cohort 1 (81 healthy individuals) and cohort 2 (157 patients with previous myocardial infarction). We used the allele-specific KASP genotyping assay to detect rs4918 polymorphism. RESULTS In cohort 1, G-nucleotide carriers had significantly lower serum TNFα, adiponectin, and higher leptin concentrations than in non-G carriers. These differences, however, were not observed in cohort 2. In cohort 2, G-carriers had lower BMI and waist circumferences than in non-G carriers. The G allele was more frequent among lean than obese patients (RR=1.067, 95%CI=1.053-2.651, p=0.015). An association between BMI and rs4918 polymorphism was observed among patients without diabetes (CC/CG/GG genotypes: p=0.003, G vs. non-G allele: p=0.008) but not in diabetics. In addition, a strong linearity between BMI and the CC/CG/GG genotypes (association value: 4.416, p=0.036) and the frequency of the G allele (7.420, p=0.006) could be identified. In cohort 2, non-obese, non-diabetic G-carriers still had lower BMI and waist circumferences than in non-G carriers. CONCLUSIONS The rs4918 minor variant is associated with lower TNFα and adiponectin, higher leptin levels in healthy persons, and more favorable anthropomorphic parameters of obesity in cohort 2.

  2. Human Fetuin-A Rs4918 Polymorphism and its Association with Obesity in Healthy Persons and in Patients with Myocardial Infarction in Two Hungarian Cohorts

    PubMed Central

    Temesszentandrási, György; Vörös, Krisztián; Márkus, Bernadett; Böröcz, Zoltán; Kaszás, Edit; Prohászka, Zoltán; Falus, András; Cseh, Károly; Kalabay, László

    2016-01-01

    Background Human fetuin A (AHSG) has been associated with the development of obesity, insulin resistance, type 2 diabetes mellitus, and atherosclerosis. Observations on the role of AHSG rs4918 single-nucleotide polymorphism are contradictory. We investigated the association between variants of rs4918 and parameters of obesity, lipid status, tumor necrosis factor-α (TNFα), adipokines (adiponectin, resistin, leptin), and insulin resistance in healthy persons and in patients with previous myocardial infarction. Material/Methods This was a cross-sectional study comprising cohort 1 (81 healthy individuals) and cohort 2 (157 patients with previous myocardial infarction). We used the allele-specific KASP genotyping assay to detect rs4918 polymorphism. Results In cohort 1, G-nucleotide carriers had significantly lower serum TNFα, adiponectin, and higher leptin concentrations than in non-G carriers. These differences, however, were not observed in cohort 2. In cohort 2, G-carriers had lower BMI and waist circumferences than in non-G carriers. The G allele was more frequent among lean than obese patients (RR=1.067, 95%CI=1.053–2.651, p=0.015). An association between BMI and rs4918 polymorphism was observed among patients without diabetes (CC/CG/GG genotypes: p=0.003, G vs. non-G allele: p=0.008) but not in diabetics. In addition, a strong linearity between BMI and the CC/CG/GG genotypes (association value: 4.416, p=0.036) and the frequency of the G allele (7.420, p=0.006) could be identified. In cohort 2, non-obese, non-diabetic G-carriers still had lower BMI and waist circumferences than in non-G carriers. Conclusions The rs4918 minor variant is associated with lower TNFα and adiponectin, higher leptin levels in healthy persons, and more favorable anthropomorphic parameters of obesity in cohort 2. PMID:27487851

  3. Lack of association between FokI polymorphism in vitamin D receptor gene (VDR) & type 2 diabetes mellitus in the Tunisian population

    PubMed Central

    Mahjoubi, Imen; Kallel, Amani; Sbaï, Mohamed Hédi; Ftouhi, Bochra; ben Halima, Meriam; Jemaa, Zeineb; Feki, Moncef; Slimane, Hedia; Jemaa, Riadh; Kaabachi, Naziha

    2016-01-01

    Background & objectives: The impact of several environmental and genetic factors on diabetes is well documented. Though the association between the vitamin D receptor (VDR) gene polymorphisms and type 2 diabetes mellitus (T2DM) has been analyzed in different ethnic groups, the results have been inconsistent. The aim of this study was to evaluate the possible association between VDR FokI polymorphism and genetic susceptibility to T2DM in Tunisian population. Methods: A total of 439 unrelated patients with T2DM and 302 healthy controls were included in the study. Genomic DNA was extracted from blood and genotyped for the single nucleotide polymorphism (SNP) of FokI (T/C: (rs2228570) by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. Results: The genotype distribution and the relative allelic frequencies for the FokI polymorphism were not significantly different between T2DM and controls: in T2DM patients the frequencies of the CC, CT, and TT genotypes were 52.6, 41.0, and 6.1 per cent, respectively, and in controls the genotype frequencies were 55.6, 38.7, and 5.6 per cent, respectively. In our study, the TT genotype of the FokI polymorphism was not associated with T2DM (OR =1.19, 95% CI 0.63 - 2.25, P=0.577). Interpretation & conclusions: Our study showed no significant association of the FokI polymorphism in the vitamin D receptor gene with type 2 diabetes mellitus in Tunisian population. PMID:27834325

  4. XRCC3 polymorphisms are associated with the risk of developing radiation-induced late xerostomia in nasopharyngeal carcinoma patients treated with intensity modulation radiated therapy.

    PubMed

    Zou, Yan; Song, Tao; Yu, Wei; Zhao, Ruping; Wang, Yong; Xie, Ruifei; Chen, Tian; Wu, Bo; Wu, Shixiu

    2014-03-01

    The incidence of radiation-induced late xerostomia varies greatly in nasopharyngeal carcinoma patients treated with radiotherapy. The single-nucleotide polymorphisms in genes involved in DNA repair and fibroblast proliferation may be correlated with such variability. The purpose of this paper was to evaluate the association between the risk of developing radiation-induced late xerostomia and four genetic polymorphisms: TGFβ1 C-509T, TGFβ1 T869C, XRCC3 722C>T and ATM 5557G>A in nasopharyngeal carcinoma patients treated with Intensity Modulation Radiated Therapy. The severity of late xerostomia was assessed using a patient self-reported validated xerostomia questionnaire. Polymerase chain reaction-ligation detection reaction methods were performed to determine individual genetic polymorphism. The development of radiation-induced xerostomia associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for equivalent uniform dose. A total of 43 (41.7%) patients experienced radiation-induced late xerostomia. Univariate Cox proportional hazard analyses showed a higher risk of late xerostomia for patients with XRCC3 722 TT/CT alleles. In multivariate analysis adjusted for clinical and dosimetric factors, XRCC3 722C>T polymorphisms remained a significant factor for higher risk of late xerostomia. To our knowledge, this is the first study that demonstrated an association between genetic polymorphisms and the risk of radiation-induced late xerostomia in nasopharyngeal carcinoma patients treated with Intensity Modulation Radiated Therapy. Our findings suggest that the polymorphisms in XRCC3 are significantly associated with the risk of developing radiation-induced late xerostomia.

  5. The relationship between methylenetetrahydrofolate reductase polymorphism and hematological malignancy.

    PubMed

    Jiang, Ni; Zhu, Xishan; Zhang, Hongmei; Wang, Xiaoli; Zhou, Xinna; Gu, Jiezhun; Chen, Baoan; Ren, Jun

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is the key enzyme for folate metabolism. Previous studies suggest a relationship between its single nucleotide polymorphisms (SNP) of C677T and A1298C with a variety of tumor susceptibility including hematological malignancy. SNP frequency distribution in different ethnic populations might lead to differences in disease susceptibility. There has been little research in Chinese people on the MTHFR SNP with the susceptibility of the hematological malignancy. Therefore, this study investigated the relationship between MTHFR SNPs and hematological malignancy in Jiangsu province in China. Gene microarray was used to detect MTHFR C677T and A1298C single nucleotide polymorphism loci on 157 healthy controls and 127 patients from Jiangsu province with hematological malignancies (30 with multiple myeloma, 28 with non-Hodgkin's lymphoma, 22 with acute lymphoblastic leukemia, 40 with acute myeloid leukemia, and seven with chronic myeloid leukemia). The allele frequency of 677T was 41.3% in patients and 33.1% in controls, showed significant difference (chi2 = 4.08, p = 0.043); 677TT genotype with a high susceptibility to hematological malignancy (OR 1.96, 95% CI 1.01 - 4.45, p = 0.041). In subgroup analyses, the genotypes 677TT and 1298CC were associated with significantly increased multiple myeloma risk (TT vs. CC: OR 8.92, 95% CI 1.06 - 75.24, p = 0.006; CC vs. AA: OR = 4.80, 95% CI 1.56 - 14.73, p = 0.044). No associations were found between polymorphisms and susceptibilities to acute lymphoblastic leukemia, acute myeloid leukemia, or non-Hodgkin's lymphoma. MTHFRC677T polymorphisms influence the risk of hematological malignancy among the population in Jiangsu province. Both MTHFR 677TT and MTHFR 1298CC genotypes increase susceptibility to myeloid leukemia.

  6. Influence of variation in the catechol-O-methyltransferase gene on the clinical outcome after lumbar spine surgery for one-level symptomatic disc disease: a report on 176 cases.

    PubMed

    Rut, Marcin; Machoy-Mokrzyńska, Anna; Ręcławowicz, Daniel; Słoniewski, Paweł; Kurzawski, Mateusz; Droździk, Marek; Safranow, Krzysztof; Morawska, Michalina; Białecka, Monika

    2014-02-01

    This study was aimed at the evaluation of the relationship between genetic polymorphisms of catechol-O-methyltransferase (COMT) (rs4680:A > G-Val158Met, rs6269:A > G, rs4633:C > T, rs4818:C > G) and pain sensitivity after lumbar discectomy. All patients had one-level symptomatic disc herniation from L3 to S1. The primary data recorded included visual analogue pain scales assessing back and leg pain, Oswestry Disability Questionnaire assessing quality of life and pain intensity, received/filled pre- and postoperatively. Each subject was genotyped for single-nucleotide polymorphism in the COMT gene. Clinical outcome was measured by difference between pre- and postoperative values and those results were analyzed with genetics findings. Pain intensity was associated with the COMT polymorphism. Carriers of rs6269 AA, rs4633 TT, rs4818 CC, and rs4680 AA genotypes were characterized by the lowest preoperative scores related to pain intensity and lower pain intensity at 1 year after the surgery. The rs4633 CC, rs4680 GG genotypes demonstrated significant clinical improvement in VASBACK score at 1 year after the surgery. Patients with COMT haplotype associated with low metabolic activity of enzyme (A_C_C_G) showed better clinical outcome measured by ODI score and VASBACK score 1 year after surgery. We did not observe any significant correlation between leg pain and single-nucleotide polymorphisms in the COMT gene. The results of our study indicate that polymorphism in the COMT gene may play an important role in the mechanism of pain perception, which may have a potential implication for clinical decision-making in the future.

  7. Effect of interactions of polymorphisms in the Melanocortin-4 receptor gene with dietary factors on the risk of obesity and Type 2 diabetes: a systematic review.

    PubMed

    Koochakpoor, G; Hosseini-Esfahani, F; Daneshpour, M S; Hosseini, S A; Mirmiran, P

    2016-08-01

    To perform a systematic review of the effect of interaction between Melanocortin-4 receptor (MC4R) single nucleotide polymorphisms and diet on the development of obesity and Type 2 diabetes. Environmental factors, such as nutrient intakes or feeding behaviours, can modulate the association of polymorphism in the MC4R gene with obesity and Type 2 diabetes mellitus. A systematic literature search was conducted in the PubMed, Scopus and Google Scholar databases, with a combination of the following keywords: Diet*, nutr*, melanocortin receptor, melanocortin 4 receptor and MC4R. To assess the quality of observational studies, we used a 12-item quality checklist, derived from the STREGA statement. A total of 14 articles were selected based on the inclusion and exclusion criteria. Consumption of highly salty foods and adherence to a Mediterranean dietary pattern can modulate the association between MC4R polymorphisms and the risk of obesity or Type 2 diabetes. Despite the highly contradictory results of intervention studies, after short-term lifestyle interventions, children with variant alleles of MC4R single nucleotide polymorphisms can lose more body weight, compared with non-carriers, although they may have difficulty in maintaining this weight loss in the long-term. To interpret the results of studies on adults, we need further studies. The interaction between MC4R genes with dietary factors plays a significant role in the development of obesity or Type 2 diabetes phenotypes. Early detection of MC4R risk alleles in individuals and modification of their diet based on these results could be an efficient strategy to prevent obesity or diabetes in these subgroups. © 2015 Diabetes UK.

  8. A single nucleotide polymorphism in APOA5 determines triglyceride levels in Hong Kong and Guangzhou Chinese

    PubMed Central

    Jiang, Chao Qiang; Liu, Bin; Cheung, Bernard MY; Lam, Tai Hing; Lin, Jie Ming; Li Jin, Ya; Yue, Xiao Jun; Ong, Kwok Leung; Tam, Sidney; Wong, Ka Sing; Tomlinson, Brian; Lam, Karen SL; Thomas, G Neil

    2010-01-01

    Single nucleotide polymorphisms (SNPs) in the apolipoprotein A5 (APOA5) gene have been associated with hypertriglyceridaemia. We investigated which SNPs in the APOA5 gene were associated with triglyceride levels in two independent Chinese populations. In all, 1375 subjects in the Hong Kong Cardiovascular Risk Factor Prevalence Study were genotyped for five tagging SNPs chosen from HapMap. Replication was sought in 1996 subjects from the Guangzhou Biobank Cohort Study. Among the five SNPs, rs662799 (-1131T>C) was strongly related to log-transformed triglyceride levels among Hong Kong subjects (β=0.192, P=2.6 × 10−13). Plasma triglyceride level was 36.1% higher in CC compared to TT genotype. This association was confirmed in Guangzhou subjects (β=0.159, P=1.3 × 10−12), and was significantly irrespective of sex, age group, obesity, metabolic syndrome, hypertension, diabetes, smoking and alcohol drinking. The odds ratios and 95% confidence interval for plasma triglycerides ≥1.7 mmol/l associated with TC and CC genotypes were, respectively, 1.81 (1.37–2.39) and 2.22 (1.44–3.43) in Hong Kong and 1.27 (1.05–1.54) and 1.97 (1.42–2.73) in Guangzhou. Haplotype analysis suggested the association was due to rs662799 only. The corroborative findings in two independent populations indicate that the APOA5-1131T>C polymorphism is an important and clinically relevant determinant of plasma triglyceride levels in the Chinese population. PMID:20571505

  9. Pharmacogenomic studies of the anticancer and immunosuppressive thiopurines mercaptopurine and azathioprine.

    PubMed

    Hawwa, Ahmed F; Millership, Jeff S; Collier, Paul S; Vandenbroeck, Koen; McCarthy, Anthony; Dempsey, Sid; Cairns, Carole; Collins, John; Rodgers, Colin; McElnay, James C

    2008-10-01

    To examine the allelic variation of three enzymes involved in 6-mercaptopurine/azathioprine (6-MP/AZA) metabolism and evaluate the influence of these polymorphisms on toxicity, haematological parameters and metabolite levels in patients with acute lymphoblastic leukaemia (ALL) or inflammatory bowel disease (IBD). Clinical data and blood samples were collected from 19 ALL paediatric patients and 35 IBD patients who were receiving 6-MP/AZA therapy. All patients were screened for seven genetic polymorphisms in three enzymes involved in mercaptopurine metabolism [xanthine oxidase, inosine triphosphatase (C94-->A and IVS2+21A-->C) and thiopurine methyltransferase]. Erythrocyte and plasma metabolite concentrations were also determined. The associations between the various genotypes and myelotoxicity, haematological parameters and metabolite concentrations were determined. Thiopurine methyltransferase variant alleles were associated with a preferential metabolism away from 6-methylmercaptopurine nucleotides (P = 0.008 in ALL patients, P = 0.038 in IBD patients) favouring 6-thioguanine nucleotides (6-TGNs) (P = 0.021 in ALL patients). Interestingly, carriers of inosine triphosphatase IVS2+21A-->C variants among ALL and IBD patients had significantly higher concentrations of the active cytotoxic metabolites, 6-TGNs (P = 0.008 in ALL patients, P = 0.047 in IBD patients). The study confirmed the association of thiopurine methyltransferase heterozygosity with leucopenia and neutropenia in ALL patients and reported a significant association between inosine triphosphatase IVS2+21A-->C variants with thrombocytopenia (P = 0.012). CONCLUSIONS; Pharmacogenetic polymorphisms in the 6-MP pathway may help identify patients at risk for associated toxicities and may serve as a guide for dose individualization.

  10. Single nucleotide polymorphism in toll-like receptor 6 is associated with a decreased risk for ureaplasma respiratory tract colonization and bronchopulmonary dysplasia in preterm infants.

    PubMed

    Winters, Alexandra H; Levan, Tricia D; Vogel, Stefanie N; Chesko, Kirsty L; Pollin, Toni I; Viscardi, Rose M

    2013-08-01

    Ureaplasma spp. respiratory tract colonization is a risk factor for bronchopulmonary dysplasia (BPD) in preterm infants, but differences in host susceptibility have not been elucidated. We hypothesized that variants in genes regulating the innate immune response are associated with altered risk for Ureaplasma spp. respiratory colonization and BPD in preterm infants. Twenty-four tag single nucleotide polymorphisms (SNPs) from Toll-like receptor (TLR)1, TLR2, TLR4 and TLR6 were assayed in 298 infants <33 weeks gestation who had serial respiratory cultures for Ureaplasma spp. and were evaluated for BPD. The majority of subjects (N = 205 [70%]) were African-American. One hundred ten (37%) were Ureaplasma positive. Four SNPs in TLR2 and TLR6 were significantly associated with Ureaplasma respiratory tract colonization. Single SNPs in TLR2, TLR4 and TLR6 were associated with BPD. TLR6 SNP rs5743827 was associated with both a decreased risk for Ureaplasma respiratory tract colonization and decreased risk for BPD (odds ratio: 0.54 [0.34-0.86] and odds ratio: 0.54 [0.31-0.95], respectively). There was a significant additive interaction between Ureaplasma colonization and genotype at TLR6 SNP rs5743827 (Padditive = 0.023), with an attributable proportion due to interaction of 0.542. Polymorphisms in host defense genes may alter susceptibility to Ureaplasma infection and severity of the inflammatory response contributing to BPD. These observations implicate host genetic susceptibility as a major factor in BPD pathogenesis in Ureaplasma-infected preterms.

  11. Association of tumour necrosis factor-alpha G/A -238 and G/A -308 single nucleotide polymorphisms with juvenile idiopathic arthritis.

    PubMed

    Maddah, M; Harsini, S; Ziaee, V; Moradinejad, M H; Rezaei, A; Zoghi, S; Sadr, M; Aghighi, Y; Rezaei, N

    2016-12-01

    Juvenile idiopathic arthritis (JIA) is a heterogeneous autoimmune disorder of unknown origin. As proinflammatory cytokines are known to contribute towards the pathogenesis of JIA, this case-control study was performed to examine the associations of certain single nucleotide polymorphisms (SNPs) of tumour necrosis factor-α (TNF-α) gene. Fifty-three patients with JIA participated in this study as patients group and compared with 137 healthy unrelated controls. Genotyping was performed for TNF-α gene at positions -308 and -238, using polymerase chain reaction with sequence-specific primers method. Results of the analysed data revealed a significant positive association for TNF-α gene at positions -308 and -238 for A allele in patients group compared with controls (P < 0.01). At the genotypic level, the frequency of TNF-α gene at positions -308 and -238 for GG genotype was discovered to be higher in the patients with JIA compared to the healthy controls (P < 0.01), while GA genotype at the same positions was observed to be less frequent in the case group than the controls (P < 0.01). At the haplotypic level, a significant positive association for TNF-α GG haplotype (positions -308, -238) together with a notable negative association for TNF-α AG and GA haplotypes at the same positions were detected in the patients group in comparison with the healthy individuals (P < 0.01). Cytokine gene polymorphisms might affect the development of JIA. Particular TNF-α gene variants could render individuals more susceptible to JIA.. © 2016 John Wiley & Sons Ltd.

  12. Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome

    PubMed Central

    Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark

    2016-01-01

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779

  13. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    USDA-ARS?s Scientific Manuscript database

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  14. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    USDA-ARS?s Scientific Manuscript database

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  15. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Treesearch

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  16. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    ERIC Educational Resources Information Center

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  17. Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

    PubMed Central

    Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

    2007-01-01

    A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

  18. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  19. Association of HTRA1 polymorphism and bilaterality in advanced age-related macular degeneration.

    PubMed

    Chen, Haoyu; Yang, Zhenglin; Gibbs, Daniel; Yang, Xian; Hau, Vincent; Zhao, Peiquan; Ma, Xiang; Zeng, Jiexi; Luo, Ling; Pearson, Erik; Constantine, Ryan; Kaminoh, Yuuki; Harmon, Jennifer; Tong, Zongzhong; Stratton, Charity A; Cameron, D Joshua; Tang, Shibo; Zhang, Kang

    2008-02-01

    Single nucleotide polymorphism (SNP), rs11200638, in the promoter of HTRA1 has recently been shown to increase the risk for AMD. In order to investigate the association of this HTRA1 polymorphism and the bilaterality of AMD, we genotyped rs11200638 in control, unilateral, and bilateral advanced AMD patients. The A allele for SNP rs11200638 in HTRA1, was significantly more prevalent in bilateral wet AMD and GA patients than in unilateral groups (p=.02 and p=.03, respectively). The homozygote odds ratios of bilateral wet AMD and GA are significantly greater than those seen in unilateral groups (twofold and threefold increase, respectively). This finding is consistent with the role of HTRA1 in AMD pathogenesis and will help aid in the clinical management and prognosis of AMD patients.

  20. Association of TCF7L2 Gene Polymorphisms with Reduced Acute Insulin Response in Hispanic Americans

    PubMed Central

    Palmer, Nicholette D.; Lehtinen, Allison B.; Langefeld, Carl D.; Campbell, Joel K.; Haffner, Steven M.; Norris, Jill M.; Bergman, Richard N.; Goodarzi, Mark O.; Rotter, Jerome I.; Bowden, Donald W.

    2008-01-01

    Context: Genetic variation at the transcription factor 7-like 2 locus has been linked to type 2 diabetes in predominantly European-derived populations. The biological basis of these associations remains to be determined. Objective: The objective of this study was to evaluate previously associated variants for association with measures of glucose homeostasis in Hispanic-Americans and African-Americans and determine the biological mechanism(s) through which these variants exert their effect. Design: This study was the Insulin Resistance Atherosclerosis Family Study (IRAS-FS). Setting: The IRAS-FS is a community-based study of Hispanic-Americans (San Antonio, TX, and San Luis Valley, CO) and African-Americans (Los Angeles, CA). Participants: A total of 1040 Hispanic-American and 500 African-American individuals from the IRAS-FS formed the basis of this study. Main Outcomes Measures(s): The primary glucose homeostasis phenotypes of interest in this study were derived from the frequently sampled iv glucose tolerance test and include insulin sensitivity, acute insulin response, and disposition index. Results: In Hispanic-Americans, significant evidence of association was observed between single-nucleotide polymorphisms rs7903146 and rs112255372 with reduced insulin secretion as measured by acute insulin response and adjusted for the degree of insulin sensitivity (P = 0.032 and 0.036, respectively). Other quantitative measures, e.g. insulin sensitivity or disposition index, were not associated with the single nucleotide polymorphisms examined. In African-Americans there was no evidence of association observed. Conclusions: These results suggest that transcription factor 7-like 2 variants could play a role in the pathogenesis of type 2 diabetes in the Hispanic-American population through a mechanism involving insulin secretion. PMID:17971425

  1. Association of TCF7L2 gene polymorphisms with reduced acute insulin response in Hispanic Americans.

    PubMed

    Palmer, Nicholette D; Lehtinen, Allison B; Langefeld, Carl D; Campbell, Joel K; Haffner, Steven M; Norris, Jill M; Bergman, Richard N; Goodarzi, Mark O; Rotter, Jerome I; Bowden, Donald W

    2008-01-01

    Genetic variation at the transcription factor 7-like 2 locus has been linked to type 2 diabetes in predominantly European-derived populations. The biological basis of these associations remains to be determined. The objective of this study was to evaluate previously associated variants for association with measures of glucose homeostasis in Hispanic-Americans and African-Americans and determine the biological mechanism(s) through which these variants exert their effect. This study was the Insulin Resistance Atherosclerosis Family Study (IRAS-FS). The IRAS-FS is a community-based study of Hispanic-Americans (San Antonio, TX, and San Luis Valley, CO) and African-Americans (Los Angeles, CA). A total of 1040 Hispanic-American and 500 African-American individuals from the IRAS-FS formed the basis of this study. MAIN OUTCOMES MEASURES(S): The primary glucose homeostasis phenotypes of interest in this study were derived from the frequently sampled iv glucose tolerance test and include insulin sensitivity, acute insulin response, and disposition index. In Hispanic-Americans, significant evidence of association was observed between single-nucleotide polymorphisms rs7903146 and rs112255372 with reduced insulin secretion as measured by acute insulin response and adjusted for the degree of insulin sensitivity (P = 0.032 and 0.036, respectively). Other quantitative measures, e.g. insulin sensitivity or disposition index, were not associated with the single nucleotide polymorphisms examined. In African-Americans there was no evidence of association observed. These results suggest that transcription factor 7-like 2 variants could play a role in the pathogenesis of type 2 diabetes in the Hispanic-American population through a mechanism involving insulin secretion.

  2. Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

    PubMed

    Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

    2010-01-01

    Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

  3. Polymorphisms in the circadian expressed genes PER3 and ARNTL2 are associated with diurnal preference and GNβ3 with sleep measures

    PubMed Central

    Parsons, Michael J; Lester, Kathryn J; Barclay, Nicola L; Archer, Simon N; Nolan, Patrick M; Eley, Thalia C; Gregory, Alice M

    2014-01-01

    Sleep and circadian rhythms are intrinsically linked, with several sleep traits, including sleep timing and duration, influenced by both sleep homeostasis and the circadian phase. Genetic variation in several circadian genes has been associated with diurnal preference (preference in timing of sleep), although there has been limited research on whether they are associated with other sleep measurements. We investigated whether these genetic variations were associated with diurnal preference (Morningness–Eveningness Questionnaire) and various sleep measures, including: the global Pittsburgh Sleep Quality index score; sleep duration; and sleep latency and sleep quality. We genotyped 10 polymorphisms in genes with circadian expression in participants from the G1219 sample (n = 966), a British longitudinal population sample of young adults. We conducted linear regressions using dominant, additive and recessive models of inheritance to test for associations between these polymorphisms and the sleep measures. We found a significant association between diurnal preference and a polymorphism in period homologue 3 (PER3) (P < 0.005, recessive model) and a novel nominally significant association between diurnal preference and a polymorphism in aryl hydrocarbon receptor nuclear translocator-like 2 (ARNTL2) (P < 0.05, additive model). We found that a polymorphism in guanine nucleotide binding protein beta 3 (GNβ3) was associated significantly with global sleep quality (P < 0.005, recessive model), and that a rare polymorphism in period homologue 2 (PER2) was associated significantly with both sleep duration and quality (P < 0.0005, recessive model). These findings suggest that genes with circadian expression may play a role in regulating both the circadian clock and sleep homeostasis, and highlight the importance of further studies aimed at dissecting the specific roles that circadian genes play in these two interrelated but unique behaviours. PMID:24635757

  4. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

    PubMed Central

    Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

  5. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

    PubMed

    Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

  6. Association between the TRAIL single nucleotide polymorphism rs1131580 and type 2 diabetes mellitus in a Han Chinese population.

    PubMed

    Yu, M Y; Zhao, P Q; Yan, X H; Liu, B; Zhang, Q Q; Wang, R; Ma, C H; Liang, X H; Zhu, F L; Gao, L F

    2013-09-10

    Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is expressed in different tissues and cells, including the pancreas and lymphocytes, and it can selectively induce apoptosis in tumor cells but not in most normal cells. TRAIL plays critical roles in type 1 diabetes mellitus, and is involved in type 2 diabetes mellitus (T2DM). We recently discovered the association of nonalcoholic fatty liver disease, a risk factor for T2DM, with a single nucleotide polymorphism (SNP) in the TRAIL (TNFSF10) gene at site 1595C/T (rs1131580), indicating the possible association of T2DM with this TRAIL polymorphism. The aim of this study was to investigate the relationship of the TRAIL SNP at site 1595C/T (rs1131580) with T2DM susceptibility and the biometabolic parameters of T2DM in a Han Chinese population. The polymerase chain reaction-restriction fragment length polymorphism method was used to genotype SNP rs1131580 in 292 patients with T2DM and 266 healthy controls. We found that the frequency of the CC genotype and that of the C allele of rs1131580 were significantly higher in T2DM patients than in the control group. Additionally, the triglyceride and serum creatinine levels of T2DM patients with the CC genotype were significantly higher than those of patients with the TT genotype. Thus, the CC genotype of the TRAIL SNP at 1595C/T (rs1131580) confers increased susceptible to T2DM in a Han Chinese population from Shandong Province. These data suggest that the CC genotype at this SNP is related to diabetic severity and it might be a candidate for the prognostic assessment of T2DM.

  7. A novel single nucleotide polymorphism in exon 7 of LPL gene and its association with carcass traits and visceral fat deposition in yak (Bos grunniens) steers.

    PubMed

    Ding, X Z; Liang, C N; Guo, X; Xing, C F; Bao, P J; Chu, M; Pei, J; Zhu, X S; Yan, P

    2012-01-01

    Lipoprotein lipase (LPL) is considered as a key enzyme in the lipid deposition and metabolism in tissues. It is assumed to be a major candidate gene for genetic markers in lipid deposition. Therefore, the polymorphisms of the LPL gene and associations with carcass traits and viscera fat content were examined in 398 individuals from five yak (Bos grunniens) breeds using PCR-SSCP analysis and DNA sequencing. A novel nucleotide polymorphism (SNP)-C→T (nt19913) was identified located in exon 7 in the coding region of the LPL gene, which replacement was responsible for a Phe-to-Ser substitution at amino acid. Two alleles (A and B) and three genotypes designed as AA, AB and BB were detected in the PCR products. The frequencies of allele A were 0.7928, 0.7421, 0.7357, 0.6900 and 0.7083 for Tianzhu white yak (WY), Gannan yak (GY), Qinghai-Plateau yak (PY), Xinjiang yak (XY) and Datong yak (DY), respectively. The SNP loci was in Hardy-Weinberg equilibrium in five yak populations (P>0.05). Polymorphism of LPL gene was shown to be associated with carcass traits and lipid deposition. Least squares analysis revealed that there was a significant effect on live-weight (LW) (P<0.01), average daily weight gain (ADG) and carcass weight (P<0.05). Individuals with genotype BB had lower mean values than those with genotype AA and AB for loin eye area and viscera fat weight (% of LW) in 25-36 months (P<0.05). The results indicated that LPL gene is a strong candidate gene that affects carcass traits and fat deposition in yak.

  8. PERB11 (MIC): a polymorphic MHC gene is expressed in skin and single nucleotide polymorphisms are associated with psoriasis

    PubMed Central

    Tay, G K; Hui, J; Gaudieri, S; Schmitt-Egenolf, M; Martinez, O P; Leelayuwat, C; Williamson, J F; Eiermann, T H; Dawkins, R L

    2000-01-01

    The susceptibility genes for psoriasis remain to be identified. At least one of these must be in the major histocompatibility complex (MHC) to explain associations with alleles at human leucocyte antigen (HLA)-A, -B, -C, -DR, -DQ and C4. In fact, most of these alleles are components of just two ancestral haplotypes (AHs) designated 13.1 and 57.1. Although relevant MHC gene(s) could be within a region of at least 4 Mb, most studies have favoured the area near HLA-B and -C. This region contains a large number of non-HLA genes, many of which are duplicated and polymorphic. Members of one such gene family, PERB11.1 and PERB11.2, are expressed in the skin and are encoded in the region between tumour necrosis factor and HLA-B. To investigate the relationship of PERB11.1 alleles to psoriasis, sequence based typing was performed on 97 patients classified according to age of onset and family history. The frequency of the PERB11.1*06 allele is 44% in type I psoriasis but only 7% in controls (Pc = 0.003 by Fisher's exact test, two-tailed). The major determinant of this association is a single nucleotide polymorphism (SNP) within intron 4. In normal and affected skin, expression of PERB11 is mainly in the basal layer of the epidermis including ducts and follicles. PERB11 is also present in the upper keratin layers but there is relative deficiency in the intermediate layers. These findings suggest a possible role for PERB11 and other MHC genes in the pathogenesis of psoriasis. PMID:10691930

  9. Single nucleotide polymorphisms in the growth hormone - insulin like growth factor axis in straight bred and crossbred Angus, Brahman, and Romosinuano heifers: population genetic analyses and association of genotypes

    USDA-ARS?s Scientific Manuscript database

    The growth endocrine axis influences reproduction. Objectives of this study were to evaluate population genetic characteristics of SNP genotypes within genes of the GH and IGF axis in straightbred and diallel-crossed Angus, Brahman and Romosinuano heifers (n = 650) and to test the associations of th...

  10. Novel genetic approach to investigate the role of plasma secretory phospholipase A2 (sPLA2)-V isoenzyme in coronary heart disease: modified Mendelian randomization analysis using PLA2G5 expression levels.

    PubMed

    Holmes, Michael V; Exeter, Holly J; Folkersen, Lasse; Nelson, Christopher P; Guardiola, Montse; Cooper, Jackie A; Sofat, Reecha; Boekholdt, S Matthijs; Khaw, Kay-Tee; Li, Ka-Wah; Smith, Andrew J P; Van't Hooft, Ferdinand; Eriksson, Per; Franco-Cereceda, Anders; Asselbergs, Folkert W; Boer, Jolanda M A; Onland-Moret, N Charlotte; Hofker, Marten; Erdmann, Jeanette; Kivimaki, Mika; Kumari, Meena; Reiner, Alex P; Keating, Brendan J; Humphries, Steve E; Hingorani, Aroon D; Mallat, Ziad; Samani, Nilesh J; Talmud, Philippa J

    2014-04-01

    Secretory phospholipase A2 (sPLA2) enzymes are considered to play a role in atherosclerosis. sPLA2 activity encompasses several sPLA2 isoenzymes, including sPLA2-V. Although observational studies show a strong association between elevated sPLA2 activity and CHD, no assay to measure sPLA2-V levels exists, and the only evidence linking the sPLA2-V isoform to atherosclerosis progression comes from animal studies. In the absence of an assay that directly quantifies sPLA2-V levels, we used PLA2G5 mRNA levels in a novel, modified Mendelian randomization approach to investigate the hypothesized causal role of sPLA2-V in coronary heart disease (CHD) pathogenesis. Using data from the Advanced Study of Aortic Pathology, we identified the single-nucleotide polymorphism in PLA2G5 showing the strongest association with PLA2G5 mRNA expression levels as a proxy for sPLA2-V levels. We tested the association of this SNP with sPLA2 activity and CHD events in 4 prospective and 14 case-control studies with 27 230 events and 70 500 controls. rs525380C>A showed the strongest association with PLA2G5 mRNA expression (P=5.1×10(-6)). There was no association of rs525380C>A with plasma sPLA2 activity (difference in geometric mean of sPLA2 activity per rs525380 A-allele 0.4% (95% confidence intervals [-0.9%, 1.6%]; P=0.56). In meta-analyses, the odds ratio for CHD per A-allele was 1.02 (95% confidence intervals [0.99, 1.04]; P=0.20). This novel approach for single-nucleotide polymorphism selection for this modified Mendelian randomization analysis showed no association between rs525380 (the lead single-nucleotide polymorphism for PLA2G5 expression, a surrogate for sPLA2-V levels) and CHD events. The evidence does not support a causal role for sPLA2-V in CHD.

  11. A genome wide association study for backfat thickness in Italian Large White pigs highlights new regions affecting fat deposition including neuronal genes

    PubMed Central

    2012-01-01

    Background Carcass fatness is an important trait in most pig breeding programs. Following market requests, breeding plans for fresh pork consumption are usually designed to reduce carcass fat content and increase lean meat deposition. However, the Italian pig industry is mainly devoted to the production of Protected Designation of Origin dry cured hams: pigs are slaughtered at around 160 kg of live weight and the breeding goal aims at maintaining fat coverage, measured as backfat thickness to avoid excessive desiccation of the hams. This objective has shaped the genetic pool of Italian heavy pig breeds for a few decades. In this study we applied a selective genotyping approach within a population of ~ 12,000 performance tested Italian Large White pigs. Within this population, we selectively genotyped 304 pigs with extreme and divergent backfat thickness estimated breeding value by the Illumina PorcineSNP60 BeadChip and performed a genome wide association study to identify loci associated to this trait. Results We identified 4 single nucleotide polymorphisms with P≤5.0E-07 and additional 119 ones with 5.0E-07

  12. HOTAIR gene polymorphisms contribute to increased neuroblastoma susceptibility in Chinese children.

    PubMed

    Yang, Xu; He, Jing; Chang, Yitian; Luo, Annie; Luo, Ailing; Zhang, Jiao; Zhang, Ruizhong; Xia, Huimin; Xu, Ling

    2018-06-15

    Neuroblastoma is the most frequently diagnosed extracranial solid tumor in children. Previous studies have shown that single-nucleotide polymorphisms in some genes are associated with the risk of multiple cancers, including neuroblastoma. Although Hox transcript antisense intergenic RNA (HOTAIR) gene polymorphisms have been investigated in a variety of cancers, to the authors' knowledge the relationships between HOTAIR gene polymorphisms and neuroblastoma susceptibility have not been reported to date. The objective of the current study was to evaluate the correlation between HOTAIR gene polymorphisms and neuroblastoma risk in Chinese children. The authors genotyped 6 polymorphisms (rs920778 A>G, rs12826786 C>T, rs4759314 A>G, rs7958904 G>C, rs874945 C>T, and rs1899663 C>A) of the HOTAIR gene in 2 Chinese populations including 393 neuroblastoma cases and 812 healthy controls. The strength of the associations was evaluated using odds ratios and 95% confidence intervals. Further stratification analyses were conducted to explore the association between the HOTAIR gene polymorphisms rs12826786 C>T, rs874945 C>T, and rs1899663 C>A with neuroblastoma susceptibility in terms of age, sex, clinical stage of disease, and sites of origin. The authors found that the rs12826786 C>T (P =.013), rs874945 C>T (P =.020), and rs1899663 C>A (P =.029) polymorphisms were significantly associated with increased neuroblastoma risk. In stratification analyses, these associations were more predominant in females and among patients with tumor in the retroperitoneal region or mediastinum. The remaining 3 polymorphisms were not found to be related to neuroblastoma susceptibility. The results of the current study verified that HOTAIR gene polymorphisms are associated with increased neuroblastoma risk and suggest that HOTAIR gene polymorphisms might be a potential biomarker for neuroblastoma susceptibility. Cancer 2018;124:2599-606. © 2018 American Cancer Society. © 2018 American Cancer Society.

  13. First High-Density Linkage Map and Single Nucleotide Polymorphisms Significantly Associated With Traits of Economic Importance in Yellowtail Kingfish Seriola lalandi.

    PubMed

    Nguyen, Nguyen H; Rastas, Pasi M A; Premachandra, H K A; Knibb, Wayne

    2018-01-01

    The genetic resources available for the commercially important fish species Yellowtail kingfish (YTK) ( Seriola lalandi) are relative sparse. To overcome this, we aimed (1) to develop a linkage map for this species, and (2) to identify markers/variants associated with economically important traits in kingfish (with an emphasis on body weight). Genetic and genomic analyses were conducted using 13,898 single nucleotide polymorphisms (SNPs) generated from a new high-throughput genotyping by sequencing platform, Diversity Arrays Technology (DArTseq TM ) in a pedigreed population comprising 752 animals. The linkage analysis enabled to map about 4,000 markers to 24 linkage groups (LGs), with an average density of 3.4 SNPs per cM. The linkage map was integrated into a genome-wide association study (GWAS) and identified six variants/SNPs associated with body weight ( P < 5e -8 ) when a multi-locus mixed model was used. Two out of the six significant markers were mapped to LGs 17 and 23, and collectively they explained 5.8% of the total genetic variance. It is concluded that the newly developed linkage map and the significantly associated markers with body weight provide fundamental information to characterize genetic architecture of growth-related traits in this population of YTK S. lalandi .

  14. The common single-nucleotide polymorphism rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women.

    PubMed

    Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang

    2014-11-01

    Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.

  15. Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

    PubMed

    Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

    2018-05-03

    Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

  16. Replication of CLU, CR1, and PICALM associations with alzheimer disease.

    PubMed

    Carrasquillo, Minerva M; Belbin, Olivia; Hunter, Talisha A; Ma, Li; Bisceglio, Gina D; Zou, Fanggeng; Crook, Julia E; Pankratz, V Shane; Dickson, Dennis W; Graff-Radford, Neill R; Petersen, Ronald C; Morgan, Kevin; Younkin, Steven G

    2010-08-01

    To test for replication of the association between variants in the CLU, CR1, and PICALM genes with Alzheimer disease. Follow-up case-control association study. The Mayo Clinics at Jacksonville, Florida, and Rochester, Minnesota. Community-based patients of European descent with late-onset Alzheimer disease (LOAD) and controls without dementia who were seen at the Mayo clinics, and autopsy-confirmed cases and controls whose pathology was evaluated at the Mayo Clinic in Jacksonville. Additional samples were obtained from the National Cell Repository for Alzheimer Disease (NCRAD). A total of 1829 LOAD cases and 2576 controls were analyzed. The most significant single-nucleotide polymorphisms in CLU (rs11136000), CR1 (rs3818361), and PICALM (rs3851179) were tested for allelic association with LOAD. Main Outcome Measure Clinical or pathology-confirmed diagnosis of LOAD. Odds ratios for CLU, CR1, and PICALM were 0.82, 1.15, and 0.80, respectively, comparable in direction and magnitude with those originally reported. P values were 8.6 x 10(-5), .014, and 1.3 x 10(-5), respectively; they remain significant even after Bonferroni correction for the 3 single-nucleotide polymorphisms tested. These results show near-perfect replication and provide the first additional evidence that CLU, CR1, and PICALM are associated with the risk of LOAD.

  17. Genetic Comparison of Symptomatic and Asymptomatic Persons With Alzheimer Disease Neuropathology.

    PubMed

    Monsell, Sarah E; Mock, Charles; Fardo, David W; Bertelsen, Sarah; Cairns, Nigel J; Roe, Catherine M; Ellingson, Sally R; Morris, John C; Goate, Alison M; Kukull, Walter A

    2017-01-01

    The objective was to determine whether symptomatic and asymptomatic persons with Alzheimer disease (AD) neuropathology have different allele counts for single-nucleotide polymorphisms that have been associated with clinical late-onset AD. Data came from the National Alzheimer's Coordinating Center Uniform Data Set and Neuropathology Data Set, and the Alzheimer's Disease Genetics Consortium (ADGC). Participants had low to high AD neuropathologic change. The 22 known/suspected genes associated with late-onset AD were considered. "Symptomatic" was defined as Clinical Dementia Rating global score >0. Sixty-eight asymptomatic and 521 symptomatic participants met inclusion criteria. Single-nucleotide polymorphisms associated with ABCA7 [odds ratio (OR)=1.66; 95% confidence interval (CI), 1.03-2.85] and MAPT (OR=2.18; CI, 1.26-3.77) were associated with symptomatic status. In stratified analyses, loci containing CD2AP (OR=0.35; 95% CI, 0.16-0.74), ZCWPW1 (OR=2.98; 95% CI, 1.34-6.86), and MAPT (OR=3.73, 95% CI, 1.30-11.76) were associated with symptomatic status in APOE e4 carriers. These findings potentially explain some of the variation in whether a person with AD neuropathology expresses symptoms. Understanding why some people remain cognitively normal despite having AD neuropathology could identify pathways to disease heterogeneity and guide treatment trials.

  18. Association of Mitochondrial DNA 10398 Polymorphism in Invasive Breast Cancer in Malay Population of Peninsular Malaysia

    PubMed Central

    Tengku Baharudin, Nadiah; Jaafar, Hasnan; Zainuddin, Zafarina

    2012-01-01

    Background: The mitochondrial DNA (mtDNA) 10398 polymorphism is hypothesised to alter a mitochondrial subunit of the electron transfer chain and is associated with several neurodegenerative disorders and cancers. Methods: In this study, an mtDNA polymorphism at nucleotide position 10398 was screened in 101 Malay female patients with invasive breast cancer and 90 age-matched healthy female controls using minisequencing analysis. Results: The Malay women with the 10398G variant showed a significantly increased risk of invasive breast cancer (OR = 2.29, 95% CI 1.25–4.20, P = 0.007). Immunohistochemistry analysis was conducted to investigate the effect of this polymorphism on the levels of apoptosis in breast cancer cells. The level of Bax (a pro-apoptotic protein) expression was significantly higher than that of Bcl-2 (an anti-apoptotic protein) in patients carrying the G allele (P = 0.016) but not in those carrying the A allele (P = 0.48). Conclusion: Based on these findings, we propose that the mtDNA 10398 polymorphism may be a potential risk marker for breast cancer susceptibility in the Malay population. PMID:22977373

  19. Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

    PubMed

    Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

    2018-04-19

    ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  20. C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population

    PubMed Central

    Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

    2015-01-01

    Introduction: Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. Objective: To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Methods: Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics®). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Results: Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Conclusions: Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies. PMID:26309343

  1. ABCB1 polymorphism as prognostic factor in breast cancer patients treated with docetaxel and doxorubicin neoadjuvant chemotherapy

    PubMed Central

    Kim, Hee-Jun; Im, Seock-Ah; Keam, Bhumsuk; Ham, Hye Seon; Lee, Kyung Hun; Kim, Tae Yong; Kim, Yu Jung; Oh, Do-Youn; Kim, Jee Hyun; Han, Wonshik; Jang, In-Jin; Kim, Tae-You; Park, In Ae; Noh, Dong Young

    2015-01-01

    Expression of the adenosine triphosphate-binding cassette B1 (ABCB1) transporter and P-glycoprotein are associated with resistance to anticancer drugs. The purpose of this study was to investigate the role of single nucleotide polymorphism in the ABCB1 and CYP3A genes in breast cancer patients who were treated with neoadjuvant chemotherapy. Stage II/III breast cancer patients were treated with three cycles of neoadjuvant, after which the patients received curative surgery and adjuvant chemotherapy. The polymorphisms of ABCB1 and CYP3A were genotyped. The correlation of polymorphism of ABCB1, CYP3A, and clinical outcomes was analyzed. Among the 216 patients, ABCB1 3435TT genotype had a longer overall survival (OS). than CC/CT. Multivariate analyses demonstrated that good PS, invasive ductal carcinoma, non-triple negative phenotype and initial operable stage were significantly associated with a lower death risk. ABCB1 3435TT genotype had a higher AUC than CC/CT for docetaxel. These higher AUCs in the C3435TT was associated with increased toxicities of neutropenia and diarrhea. This study showed that the genetic polymorphism of ABCB1 C3435T might be associated with a longer OS. Our results also suggest that the prediction of docetaxel toxicity might be possible for C3435T polymorphism. This study results provides valuable information on individualized therapy according to genotypes. PMID:25410489

  2. Association of the Serotonin Receptor 3E Gene as a Functional Variant in the MicroRNA-510 Target Site with Diarrhea Predominant Irritable Bowel Syndrome in Chinese Women.

    PubMed

    Zhang, Yu; Li, Yaoyao; Hao, Zhenfeng; Li, Xiangming; Bo, Ping; Gong, Weijuan

    2016-04-30

    The functional variant (rs56109847) in the 3'-untranslated regions (3'-UTR) of the serotonin receptor 3E (HTR3E) gene is associated with female diarrhea predominant irritable bowel syndrome (IBS-D) in British populations. However, the relationship of the polymorphism both to HTR3E expression in the intestine and to the occurrence of Chinese functional gastrointestinal disorders has yet to be examined. Polymerase chain reaction amplification and restriction fragment length polymorphism analyses were employed to detect polymorphisms among Chinese Han women, particularly 107 patients with IBS-D, 99 patients with functional dyspepsia (FD), 115 patients with mixed IBS and 69 patients with IBS-D + FD. We also assessed microRNA-510 (miR-510) and HTR3Eexpression in human colonic mucosal tissues with immunohistochemistry and other methods. Dual-luciferase reporter assays were conducted to examine the binding ability of miR-510 and HTR3E 3'-UTR. Genotyping data showed the variant rs56109847 was significantly associated with IBS-D, but not with FD, mixed-IBS, or FD + IBS-D. HTR3E was abundantly expressed around the colonic mucosal glands but less expressed in the stroma. miR-510 expression decreased, whereas HTR3E expression increased in the colonic mucosal tissue of patients with IBS-D compared with those in controls. HTR3E expression was significantly higher in patients with the GA genotype than that in patients with the GG genotype. The single-nucleotide polymorphisms disrupted the binding site of miR-510 and significantly upregulated luciferase expression in HEK293 and HT-29 cells. The single-nucleotide polymorphisms rs56109847 led to reduced microRNA binding and overexpression of the target gene in intestinal cells, thereby increasing IBS-D risk in the Chinese Han population. The decreased expression of miR-510 might contribute to IBS-D.

  3. Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

    PubMed

    Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

    2016-11-20

    BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

  4. Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

    PubMed Central

    Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

    2016-01-01

    Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

  5. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

    PubMed

    Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

    2010-11-26

    Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

  6. Clinical Significance of the Single Nucleotide Polymorphism TLR2 R753Q in Heart Transplant Recipients at Risk for Cytomegalovirus Disease

    PubMed Central

    Schneider, Martina; Matiqi, Teresa; Kundi, Michael; Rieder, Franz JJ; Andreas, Martin; Strassl, Robert; Zuckermann, Andreas; Jungbauer, Christof; Steininger, Christoph

    2017-01-01

    Background The Toll-like receptor 2 (TLR2) is a significant component of innate immunity against cytomegalovirus (CMV) infection but information on the clinical significance of the most common single nucleotide polymorphism (SNP) (R753Q) is conflicting. Objectives The inconsistent observations of the immunological and clinical significance of the TLR2 R753Q polymorphism for CMV infection indicates the influence of confounders. Study design The presence of the TLR2 polymorphism was determined by a genotyping assay of 175 HTX patients and 281 healthy blood donors and evaluated in relation to selected virological and clinical parameters. Results Relative frequency of TLR2 polymorphism was similar in HTX patients and blood donors (homozygous wild-type, 94.3% vs. 94.0%; heterozygous, 5.1% vs. 5.7%; homozygous mutated, <1%). CMV viremia was detectable in 108 (61.7%) of HTX patients. The TLR2 polymorphism was neither associated with occurrence or level of CMV infection nor with survival, graft failure or rejection, or CMV serostatus of patient before transplantation. Nevertheless, CMV viremia occurred in 83.1% of R+/D+, 77.1% of R+/D-, and 64.3% of R-/D+ patients. Time of first CMV viremia was in R-/D+ patients later than in CMV-seropositive patients (median, 182 days versus 23 days; P<0.001) corresponding to the duration of antiviral prophylaxis in R-/D+ patients. Conclusions The TLR2 R753Q polymorphism is extremely rare in the general population and HTX patients. Screening for this risk factor of CMV disease may not be cost-effective in contrast to testing for CMV viremia. PMID:27723526

  7. Methylenetetrahydrofolate reductase C677T polymorphism and Factor V Leiden variant in Mexican women with preeclampsia/eclampsia.

    PubMed

    Dávalos, I P; Moran, M C; Martínez-Abundis, E; González-Ortiz, M; Flores-Martínez, S E; Machorro, V; Sandoval, L; Figuera, L E; Mena, J P; Oliva, J M; Tlacuilo-Parra, J A; Sánchez-Corona, J; Salazar-Páramo, M

    2005-01-01

    The etiology of preeclampsia is still a matter of controversy. An association between hyperhomocysteinemia and preeclamptic patients has been described. A common missense mutation in the methylenetetrahydrofolate reductase (MTHFR) gene is associated with increased plasma homocysteine concentrations. In addition, the polymorphism of gene encoding for Factor V Leiden G1691A is associated with a prothrombotic state in heterozygous subjects. Both mutations in these thrombophilic proteins appear to have different prevalence in the general population and in patients with preeclampsia/eclampsia (PE/E). We studied single nucleotide polymorphisms for MTHFR C677T and coagulation Factor V Leiden in 33 Mexican patients with PE/E as a genetic risk factor for these diseases, comparing with a normotensive pregnant control group. The genotype and allele frequencies of MTHFR C677T and Factor V Leiden mutations between Mexican women with PE/E and healthy controls were not different. We conclude that these polymorphisms do not contribute in the etiology of PE/E as it has been reported in other populations.

  8. The BDNF Val66Met polymorphism does not moderate the effect of self-reported physical activity on depressive symptoms in midlife

    PubMed Central

    Gujral, Swathi; Manuck, Stephen B.; Ferrell, Robert E.; Flory, Janine D.; Erickson, Kirk I.

    2014-01-01

    Background The brain-derived neurotrophic factor (BDNF) Val66Met single nucleotide polymorphism may be associated with clinical and subsyndromal depression, but physical activity improves mood and increases BDNF expression. Aims To examine whether the BDNF polymorphism moderates an effect of physical activity on depressive symptoms. Methods BDNF genotype, physical activity measured by the Paffenbarger Questionnaire, and depressive symptoms using the Center for Epidemiology Depression Scale (CES-D) were collected on 1072 participants (Mean Age=44). Multiple linear regression was used to examine the association between BDNF genotype, physical activity, and depressive symptoms. Results After adjusting for family income, age, and education, depressive symptoms were higher in Met carriers compared to Val homozygotes (p=0.03), but this was only significant in men. Physical activity was associated with fewer depressive symptoms, but only in women (p=0.01). BDNF genotype did not moderate the effect of physical activity on depressive symptoms (p= 0.94). Conclusions In midlife, the BDNF Val66Met polymorphism neither attenuates nor magnifies the effect of physical activity on depressive symptoms. PMID:24745471

  9. NLRC5 polymorphism is associated with susceptibility to chronic periodontitis.

    PubMed

    Zupin, Luisa; Navarra, Chiara Ottavia; Robino, Antonietta; Bevilacqua, Lorenzo; Di Lenarda, Roberto; Gasparini, Paolo; Crovella, Sergio

    2017-05-01

    Periodontitis is a chronic oral pathology caused by impaired immune response against oral bacteria resulting in tissue inflammation and damage. Among the members of innate immune response, the first line of defence against pathogens, inflammasomes are macro-molecular protein complexes that can be activated by different stimuli, comprised bacteria infections. Different proteins are involved in inflammasoma formation; the most important are molecules belonging from the family of nucleotide-binding and oligomerization domain (NOD)-like receptors (NLRs). In this study, polymorphisms within 20 NLRs related genes were analysed in order to investigate their possible association with periodontitis susceptibility in a population from North-East Italy. One polymorphism, namely rs289723, in NLRC5 gene resulted associated with chronic slight and chronic localized periodontitis susceptibility, specifically A/A genotype was correlated with increased risk of disease development. Our study, for the first time, identified the possible involvement of a polymorphism within NLRC5 gene as a possible biomarker for periodontitis condition susceptibility among Italian individuals from genetic isolates. Copyright © 2017 Elsevier GmbH. All rights reserved.

  10. Association of the AA genotype of the BCL2 (-938C>A) promoter polymorphism with better survival in ovarian cancer.

    PubMed

    Heubner, Martin; Wimberger, Pauline; Otterbach, Friedrich; Kasimir-Bauer, Sabine; Siffert, Winfried; Kimmig, Rainer; Nückel, Holger

    2009-01-01

    Bcl-2 plays a key role in the regulation of apoptosis. Recently, a novel regulatory single nucleotide polymorphism (-938C>A) in the inhibitory P2 BCL2 promoter was described. In this study we investigated its potential association with survival in epithelial ovarian cancer. Patients (n=110) with primary epithelial ovarian cancer were retrospectively genotyped by pyrosequencing. Genotype distribution was not significantly different between 110 ovarian cancer patients and 120 healthy controls, suggesting that genotypes of this polymorphism do not increase the susceptibility to ovarian cancer. Kaplan-Meier curves showed a significant association of the AA genotype with increased survival (p=0.002). Multivariate analysis revealed that the BCL2-938AC/CC genotype (hazard ratio 4.5; p=0.003) was an independent prognostic factor compared to other prognostic factors such as age, histological grade or tumor stage. The results suggest a role for the BCL2-938C>A polymorphism as a marker for survival in patients with epithelial ovarian cancer.

  11. One novel SNP of growth hormone gene and its associations with growth and carcass traits in ducks.

    PubMed

    Wu, Y; Pan, A L; Pi, J S; Pu, Y J; Du, J P; Liang, Z H; Shen, J

    2012-08-01

    In this study, the growth hormone (GH) gene was studied as a candidate gene for growth and carcass traits of three duck populations (Cherry Valley duck, Muscovy duck and Jingjiang duck). Three pairs of primers were designed to detect single nucleotide polymorphisms of introns 2, 3 and 4 of the GH gene by polymerase chain reaction-restriction fragment length polymorphism and sequencing methods. Only the products amplified from intron 2 displayed polymorphism. The results showed one novel polymorphism: a variation in intron 2 of GH gene (C172T, JN408701 and JN408702). It was associated with some growth and carcass traits in three duck populations including birth weight, 8-week weight, carcass weight, breast muscle weight, leg muscle weight, eviscerated weight, lean meat rate, dressing percentage, etc. And the TT and CT genotypes were associated with superior growth and carcass traits in carcass weight, dressing percentage and percentage of eviscerated weight. Therefore, the variation in intron 2 of GH may be a molecular marker for superior growth and carcass traits in above duck populations.

  12. Filaggrin gene polymorphism associated with Epstein-Barr virus-associated tumors in China.

    PubMed

    Yang, Yang; Liu, Wen; Zhao, Zhenzhen; Zhang, Yan; Xiao, Hua; Luo, Bing

    2017-08-01

    Mutations of filaggrin gene (FLG) have been identified as the cause of ichthyosis vulgaris, while recently FLG mutations were found to be associated with gastric cancer. This study aimed to investigate the association of filaggrin polymorphism with Epstein-Barr virus-associated tumors in China. A total of 200 patients with three types of tumors and 117 normal control samples were genotyped at three common FLG mutation loci (rs3126085, K4671X, R501X) by using Sequenom MassARRAY technique. The χ 2 test was used to evaluate the relationship between the mutation and the three kinds of tumors. A two-sided P value of <0.05 was considered statistically significant. The results showed that two single-nucleotide polymorphism (SNP) loci (rs3126085, K4671X) were significantly associated with nasopharyngeal carcinoma in genetic model. In addition, the two SNPs K4671X and rs3126085 were related to Epstein-Barr virus (EBV)-associated gastric carcinoma (EBVaGC) and EBV-negative gastric carcinoma (EBVnGC), respectively. Furthermore, allele distributions in EBVaGC and EBVnGC were verified to be different in both SNP loci.

  13. Rapid molecular pathotyping of major salmonella enterica serotypes based on single-nucleotide polymorphisms (SNPs) in the adenylate cyclase (cyaA) gene

    USDA-ARS?s Scientific Manuscript database

    Introduction: Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific...

  14. Toward understanding the genetics of regulatory T cells in ovarian cancer.

    PubMed

    Derycke, Melissa S; Charbonneau, Bridget; Preston, Claudia C; Kalli, Kimberly R; Knutson, Keith L; Rider, David N; Goode, Ellen L

    2013-06-01

    Tumor-infiltrating regulatory T cells (Tregs) promote immune evasion and are associated with poor disease outcome in patients affected by various malignancies. We have recently demonstrated that several, inherited single nucleotide polymorphisms affecting Treg-related genes influence the survival of ovarian cancer patients, providing novel insights into possible mechanisms of immune escape.

  15. Parenting Moderates a Genetic Vulnerability Factor in Longitudinal Increases in Youths' Substance Use

    ERIC Educational Resources Information Center

    Brody, Gene H.; Beach, Steven R. H.; Philibert, Robert A.; Chen, Yi-fu; Lei, Man-Kit; Murry, Velma McBride; Brown, Anita C.

    2009-01-01

    The authors used a longitudinal, prospective design to investigate a moderation effect in the association between a genetic vulnerability factor, a variable nucleotide repeat polymorphism in the promoter region of "5HTT" (5-HTTLPR), and increases in youths' substance use. The primary study hypothesis predicted that involved-supportive…

  16. Identification of QTL associated with resistance to leafhopper species Empoasca fabae and Empoasca kraemeri in common bean

    USDA-ARS?s Scientific Manuscript database

    Empoasca species leafhoppers are a major insect pest of common bean, Phaseolus vulgaris that cause significant economic losses in both tropical (E. kraemeri) and temperate (E. fabae) regions of the Americas. The objective of this study was to use Indel and single nucleotide polymorphism (SNP) marker...

  17. Genome Wide Scan for Loci influencing Warner Bratzler Shear Force in Five Bos taurus Breeds

    USDA-ARS?s Scientific Manuscript database

    Genetic tests for beef tenderness are currently limited to single nucleotide polymorphisms (SNPs) within µ-calpain (CAPN1) and calpastatin (CAST) and explain little of the phenotypic variation in Warner-Bratzler shear force (WBSF). We performed a genome-wide association study for WBSF by genotyping...

  18. Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

  19. Functional genomics analysis of big data identifies novel peroxisome proliferator–activated receptor gamma target single nucleotide polymorphisms showing association with cardiometabolic outcomes

    USDA-ARS?s Scientific Manuscript database

    Background Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator–activated receptor gamma (PPARgamma) that is involve...

  20. A Laboratory Exercise to Determine Human ABO Blood Type by Noninvasive Methods

    ERIC Educational Resources Information Center

    Martin, Michael P.; Detzel, Stephen M.

    2008-01-01

    Analysis of single-nucleotide polymorphisms and their association with diseases and nondisease phenotypes is of growing importance in human biology studies. In this laboratory exercise, students determine the genetic basis for their ABO blood type; however, no blood is drawn. Students isolate genomic DNA from buccal mucosa cells that are present…

Top