Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification

PubMed Central

Sinclair, Robert M.; Ravantti, Janne J.

2017-01-01

ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979

[Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

2009-08-01

Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers rabies viruses were likely to be street virus that already circulating in wildlife.

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

Single nucleotide variants and indels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds

USDA-ARS?s Scientific Manuscript database

Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer ge...

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.

Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

PubMed

Wolf, P

1997-10-01

Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

Bioinformatic Analysis of Strawberry GSTF12 Gene

NASA Astrophysics Data System (ADS)

Wang, Xiran; Jiang, Leiyu; Tang, Haoru

2018-01-01

GSTF12 has always been known as a key factor of proanthocyanins accumulate in plant testa. Through bioinformatics analysis of the nucleotide and encoded protein sequence of GSTF12, it is more advantageous to the study of genes related to anthocyanin biosynthesis accumulation pathway. Therefore, we chosen GSTF12 gene of 11 kinds species, downloaded their nucleotide and protein sequence from NCBI as the research object, found strawberry GSTF12 gene via bioinformation analyse, constructed phylogenetic tree. At the same time, we analysed the strawberry GSTF12 gene of physical and chemical properties and its protein structure and so on. The phylogenetic tree showed that Strawberry and petunia were closest relative. By the protein prediction, we found that the protein owed one proper signal peptide without obvious transmembrane regions.

Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction

PubMed Central

Laehnemann, David; Borkhardt, Arndt

2016-01-01

Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Systematic asymmetric nucleotide exchanges produce human mitochondrial RNAs cryptically encoding for overlapping protein coding genes.

PubMed

Seligmann, Hervé

2013-05-07

GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

[A new variant of the simian T-lymphotropic retrovirus type I (STLV-IF) in the Sukhumi colony of hamadryas baboons].

PubMed

Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A

1993-01-01

Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.

Reference genotype and exome data from an Australian Aboriginal population for health-based research

PubMed Central

Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.

2016-01-01

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114

Reference genotype and exome data from an Australian Aboriginal population for health-based research.

PubMed

Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M

2016-04-12

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

Muju Virus, Harbored by Myodes regulus in Korea, Might Represent a Genetic Variant of Puumala Virus, the Prototype Arvicolid Rodent-Borne Hantavirus

PubMed Central

Lee, Jin Goo; Gu, Se Hun; Baek, Luck Ju; Shin, Ok Sarah; Park, Kwang Sook; Kim, Heung-Chul; Klein, Terry A.; Yanagihara, Richard; Song, Jin-Won

2014-01-01

The genome of Muju virus (MUJV), identified originally in the royal vole (Myodes regulus) in Korea, was fully sequenced to ascertain its genetic and phylogenetic relationship with Puumala virus (PUUV), harbored by the bank vole (My. glareolus), and a PUUV-like virus, named Hokkaido virus (HOKV), in the grey red-backed vole (My. rufocanus) in Japan. Whole genome sequence analysis of the 6544-nucleotide large (L), 3652-nucleotide medium (M) and 1831-nucleotide small (S) segments of MUJV, as well as the amino acid sequences of their gene products, indicated that MUJV strains from different capture sites might represent genetic variants of PUUV, the prototype arvicolid rodent-borne hantavirus in Europe. Distinct geographic-specific clustering of MUJV was found in different provinces in Korea, and phylogenetic analyses revealed that MUJV and HOKV share a common ancestry with PUUV. A better understanding of the taxonomic classification and pathogenic potential of MUJV must await its isolation in cell culture. PMID:24736214

Genetic analyses reveal unusually high diversity of infectious haematopoietic necrosis virus in rainbow trout aquaculture

USGS Publications Warehouse

Troyer, Ryan M.; LaPatra, Scott E.; Kurath, Gael

2000-01-01

Infectious haematopoietic necrosis virus (IHNV) is the most significant virus pathogen of salmon and trout in North America. Previous studies have shown relatively low genetic diversity of IHNV within large geographical regions. In this study, the genetic heterogeneity of 84 IHNV isolates sampled from rainbow trout (Oncorhynchus mykiss) over a 20 year period at four aquaculture facilities within a 12 mile stretch of the Snake River in Idaho, USA was investigated. The virus isolates were characterized using an RNase protection assay (RPA) and nucleotide sequence analyses. Among the 84 isolates analysed, 46 RPA haplotypes were found and analyses revealed a high level of genetic heterogeneity relative to that detected in other regions. Sequence analyses revealed up to 7·6% nucleotide divergence, which is the highest level of diversity reported for IHNV to date. Phylogenetic analyses identified four distinct monophyletic clades representing four virus lineages. These lineages were distributed across facilities, and individual facilities contained multiple lineages. These results suggest that co-circulating IHNV lineages of relatively high genetic diversity are present in the IHNV populations in this rainbow trout culture study site. Three of the four lineages exhibited temporal trends consistent with rapid evolution.

Application of the major capsid protein as a marker of the phylogenetic diversity of Emiliania huxleyi viruses.

PubMed

Rowe, Janet M; Fabre, Marie-Françoise; Gobena, Daniel; Wilson, William H; Wilhelm, Steven W

2011-05-01

Studies of the Phycodnaviridae have traditionally relied on the DNA polymerase (pol) gene as a biomarker. However, recent investigations have suggested that the major capsid protein (MCP) gene may be a reliable phylogenetic biomarker. We used MCP gene amplicons gathered across the North Atlantic to assess the diversity of Emiliania huxleyi-infecting Phycodnaviridae. Nucleotide sequences were examined across >6000 km of open ocean, with comparisons between concentrates of the virus-size fraction of seawater and of lysates generated by exposing host strains to these same virus concentrates. Analyses revealed that many sequences were only sampled once, while several were over-represented. Analyses also revealed nucleotide sequences distinct from previous coastal isolates. Examination of lysed cultures revealed a new richness in phylogeny, as MCP sequences previously unrepresented within the existing collection of E. huxleyi viruses (EhV) were associated with viruses lysing cultures. Sequences were compared with previously described EhV MCP sequences from the North Sea and a Norwegian Fjord, as well as from the Gulf of Maine. Principal component analysis indicates that location-specific distinctions exist despite the presence of sequences common across these environments. Overall, this investigation provides new sequence data and an assessment on the use of the MCP gene. © 2011 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved.

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

PubMed

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

PubMed Central

Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2018-01-01

Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

A set of tetra-nucleotide core motif SSR markers for efficient identification of potato (Solanum tuberosum) cultivars.

PubMed

Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi

2017-12-01

Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.

Complete genome sequences of four avian paramyxoviruses of serotype 10 isolated from Rockhopper Penguins on the Falkland Islands

USDA-ARS?s Scientific Manuscript database

The first complete genome sequences of four Avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from Rockhopper Penguins sampled in 2007 on the Falkland Islands. All four genomes are 15,456 nucleotides in length and phylogenetic analyses show them to be c...

Whole-genome characterization of a Peruvian alpaca rotavirus isolate expressing a novel VP4 genotype.

PubMed

Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma

2016-11-30

The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.

Choice of Reference Sequence and Assembler for Alignment of Listeria monocytogenes Short-Read Sequence Data Greatly Influences Rates of Error in SNP Analyses

PubMed Central

Pightling, Arthur W.; Petronella, Nicholas; Pagotto, Franco

2014-01-01

The wide availability of whole-genome sequencing (WGS) and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs) in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs) are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps) are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i) depth of sequencing coverage, ii) choice of reference-guided short-read sequence assembler, iii) choice of reference genome, and iv) whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT), using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming). We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers should test a variety of conditions to achieve optimal results. PMID:25144537

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

MaxAlign: maximizing usable data in an alignment.

PubMed

Gouveia-Oliveira, Rodrigo; Sackett, Peter W; Pedersen, Anders G

2007-08-28

The presence of gaps in an alignment of nucleotide or protein sequences is often an inconvenience for bioinformatical studies. In phylogenetic and other analyses, for instance, gapped columns are often discarded entirely from the alignment. MaxAlign is a program that optimizes the alignment prior to such analyses. Specifically, it maximizes the number of nucleotide (or amino acid) symbols that are present in gap-free columns - the alignment area - by selecting the optimal subset of sequences to exclude from the alignment. MaxAlign can be used prior to phylogenetic and bioinformatical analyses as well as in other situations where this form of alignment improvement is useful. In this work we test MaxAlign's performance in these tasks and compare the accuracy of phylogenetic estimates including and excluding gapped columns from the analysis, with and without processing with MaxAlign. In this paper we also introduce a new simple measure of tree similarity, Normalized Symmetric Similarity (NSS) that we consider useful for comparing tree topologies. We demonstrate how MaxAlign is helpful in detecting misaligned or defective sequences without requiring manual inspection. We also show that it is not advisable to exclude gapped columns from phylogenetic analyses unless MaxAlign is used first. Finally, we find that the sequences removed by MaxAlign from an alignment tend to be those that would otherwise be associated with low phylogenetic accuracy, and that the presence of gaps in any given sequence does not seem to disturb the phylogenetic estimates of other sequences. The MaxAlign web-server is freely available online at http://www.cbs.dtu.dk/services/MaxAlign where supplementary information can also be found. The program is also freely available as a Perl stand-alone package.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

PubMed

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions

PubMed Central

Nishizawa, Manami; Nishizawa, Kazuhisa

2000-01-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273

Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

1990-01-01

A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

Bifidobacterium aquikefiri sp. nov., isolated from water kefir.

PubMed

Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter

2016-03-01

A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T  = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.

Whole-genome analyses of DS-1-like human G2P[4] and G8P[4] rotavirus strains from Eastern, Western and Southern Africa

PubMed Central

Nyaga, Martin M.; Stucker, Karla M.; Esona, Mathew D.; Jere, Khuzwayo C.; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N.; Adolfine, Hokororo; Halpin, Rebecca A.; Roy, Sunando; Stockwell, Timothy B.; Berejena, Chipo; Seheri, Mapaseka L.; Mwenda, Jason M.; Steele, A. Duncan; Wentworth, David E.

2018-01-01

Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007–2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio’s clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7–100 % and 90.6–100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa. PMID:24952422

Phylogenomic analyses data of the avian phylogenomics project.

PubMed

Jarvis, Erich D; Mirarab, Siavash; Aberer, Andre J; Li, Bo; Houde, Peter; Li, Cai; Ho, Simon Y W; Faircloth, Brant C; Nabholz, Benoit; Howard, Jason T; Suh, Alexander; Weber, Claudia C; da Fonseca, Rute R; Alfaro-Núñez, Alonzo; Narula, Nitish; Liu, Liang; Burt, Dave; Ellegren, Hans; Edwards, Scott V; Stamatakis, Alexandros; Mindell, David P; Cracraft, Joel; Braun, Edward L; Warnow, Tandy; Jun, Wang; Gilbert, M Thomas Pius; Zhang, Guojie

2015-01-01

Determining the evolutionary relationships among the major lineages of extant birds has been one of the biggest challenges in systematic biology. To address this challenge, we assembled or collected the genomes of 48 avian species spanning most orders of birds, including all Neognathae and two of the five Palaeognathae orders. We used these genomes to construct a genome-scale avian phylogenetic tree and perform comparative genomic analyses. Here we present the datasets associated with the phylogenomic analyses, which include sequence alignment files consisting of nucleotides, amino acids, indels, and transposable elements, as well as tree files containing gene trees and species trees. Inferring an accurate phylogeny required generating: 1) A well annotated data set across species based on genome synteny; 2) Alignments with unaligned or incorrectly overaligned sequences filtered out; and 3) Diverse data sets, including genes and their inferred trees, indels, and transposable elements. Our total evidence nucleotide tree (TENT) data set (consisting of exons, introns, and UCEs) gave what we consider our most reliable species tree when using the concatenation-based ExaML algorithm or when using statistical binning with the coalescence-based MP-EST algorithm (which we refer to as MP-EST*). Other data sets, such as the coding sequence of some exons, revealed other properties of genome evolution, namely convergence. The Avian Phylogenomics Project is the largest vertebrate phylogenomics project to date that we are aware of. The sequence, alignment, and tree data are expected to accelerate analyses in phylogenomics and other related areas.

Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

PubMed Central

Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.

2017-01-01

ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related. PMID:28572332

Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

PubMed

Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

2018-03-01

Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

[Investigation of a Patient with Pre-vaccine-derived Poliovirus in Shandong Province, China].

PubMed

Lin, Xiaojuan; Liu, Yao; Wang, Suting; Zhang Xiao; Song, Lizhi; Tao, Zexin; Ji, Feng; Xiong, Ping; Xu, Aiqiang

2015-09-01

To analyze the genetic characteristics of a polio-I highly variant vaccine recombinant virus in Shandong Province (China) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (AFP) and 40 stool specimens from his contacts were collected for virus isolation. The complete genome of poliovirus and VP1 coding region of the non-polio enterovirus were sequenced. Homologous comparison and phylogenetic analyses based on VP1 sequences were undertaken among coxsackievirus (CV) B1, CV-B3 isolates, and those in GenBank. One poliovirus (P1/11186), CV-A4 and CV-A8 were isolated from the AFP patient; one CV-A2, Echovirus 3 (E-3), E-12 and E-14, ten CV-B1, and five CV-B3 strains were isolated from his contacts. These results led us to believe that there may be a human enterovirus epidemic in this area, and that surveillance must be enhanced. P1/11186 was a type-1 vaccine-related poliovirus; it combined with type-2 and type-3 polioviruses in 2A and 3A regions, respectively. There were 25 nucleotide mutations with 9 amino-acid alterations in the entire genome. There were 8 nucleotide mutations with 5 amino-acid alterations in the VP1 region compared with the corresponding Sabin strains. Homology analyses suggested that the ten CV-B1 isolates had 97.0%-100% nucleotide and 98.9%-100% amino-acid identities with each other, as well as 92.6%-100% nucleotide and 99.2%-100% amino-acid identities among the five CV-B3 isolates. Phylogenetic analyses on the complete sequences of VP1 among CV-B1 and CV-B3 isolates showed that Shandong strains, together with strains from other provinces in China, had a close relationship and belonged to the same group.

A novel flavivirus detected in two Aedes spp. collected near the demilitarized zone of the Republic of Korea.

PubMed

Korkusol, Achareeya; Takhampunya, Ratree; Hang, Jun; Jarman, Richard G; Tippayachai, Bousaraporn; Kim, Heung-Chul; Chong, Sung-Tae; Davidson, Silas A; Klein, Terry A

2017-05-01

Flaviviruses comprise a large and diverse group of positive-stranded RNA viruses, including tick-, mosquito- and unknown-vector-borne flaviviruses. A novel flavivirus was detected in pools of Aedes vexans nipponii (n=1) and Aedes esoensis (n=3) collected in 2012 and 2013 near the demilitarized zone (DMZ), Republic of Korea (ROK). Phylogenetic analyses of the NS5, E gene and complete polyprotein coding sequence (CDS) showed that the novel virus fell within the Aedes-borne flaviviruses (ABFVs), with nucleotide identity ranging from 57.8-75.1 %, 46.1-74.2 % and 51.1-76.2 %, respectively. While the novel ABFV was distant from other flaviviruses within the group, it formed a clade with Ilomantsi virus (ILOV). Sequence alignments of the partial NS5 gene, full-length E gene and polyprotein CDS between the novel virus and ILOV showed approximately 76.2 % nucleotide identity and 90 % amino acid identity, respectively. The ABFV identified in Aedes mosquitoes from the ROK is a novel ABFV based on the sequence analyses and is designated as Panmunjeom flavivirus (PANFV).

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

PubMed

Goggin, C L; Barker, S C

1993-07-01

Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

PubMed

Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

2016-08-05

This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

Phylogenetic and nucleotide sequence analysis of influenza A (H1N1) HA and NA genes of strains isolated from Saudi Arabia.

PubMed

Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N

2017-01-30

In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.

Characterizing novel endogenous retroviruses from genetic variation inferred from short sequence reads

PubMed Central

Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse; Hansen, Thomas Arn; Kjartansdóttir, Kristín Rós; Guldberg Frøslev, Tobias; Snogdal Boutrup, Torsten; Nielsen, Lars Peter; Willerslev, Eske; Hansen, Anders J.

2015-01-01

From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads are derived. First, we showed by simulations that we can robustly infer the level of genetic diversity from short sequence reads. Second, we find that the measures of nucleotide diversity inferred from our retroviral sequences significantly exceed the level observed from Human Immunodeficiency Virus infections, prompting us to conclude that the novel retroviruses are both of endogenous origin. Through further simulations, we rule out the possibility that the observed elevated levels of nucleotide diversity are the result of co-infection with two closely related exogenous retroviruses. PMID:26493184

Genomic organization and sequence of the Gus-s/sup a/ allele of the murine. beta. -glucuronidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Funkenstein, B.; Leary, S.L.; Stein, J.C.

1988-03-01

The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of themore » Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.« less

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

CLAST: CUDA implemented large-scale alignment search tool.

PubMed

Yano, Masahiro; Mori, Hiroshi; Akiyama, Yutaka; Yamada, Takuji; Kurokawa, Ken

2014-12-11

Metagenomics is a powerful methodology to study microbial communities, but it is highly dependent on nucleotide sequence similarity searching against sequence databases. Metagenomic analyses with next-generation sequencing technologies produce enormous numbers of reads from microbial communities, and many reads are derived from microbes whose genomes have not yet been sequenced, limiting the usefulness of existing sequence similarity search tools. Therefore, there is a clear need for a sequence similarity search tool that can rapidly detect weak similarity in large datasets. We developed a tool, which we named CLAST (CUDA implemented large-scale alignment search tool), that enables analyses of millions of reads and thousands of reference genome sequences, and runs on NVIDIA Fermi architecture graphics processing units. CLAST has four main advantages over existing alignment tools. First, CLAST was capable of identifying sequence similarities ~80.8 times faster than BLAST and 9.6 times faster than BLAT. Second, CLAST executes global alignment as the default (local alignment is also an option), enabling CLAST to assign reads to taxonomic and functional groups based on evolutionarily distant nucleotide sequences with high accuracy. Third, CLAST does not need a preprocessed sequence database like Burrows-Wheeler Transform-based tools, and this enables CLAST to incorporate large, frequently updated sequence databases. Fourth, CLAST requires <2 GB of main memory, making it possible to run CLAST on a standard desktop computer or server node. CLAST achieved very high speed (similar to the Burrows-Wheeler Transform-based Bowtie 2 for long reads) and sensitivity (equal to BLAST, BLAT, and FR-HIT) without the need for extensive database preprocessing or a specialized computing platform. Our results demonstrate that CLAST has the potential to be one of the most powerful and realistic approaches to analyze the massive amount of sequence data from next-generation sequencing technologies.

A HIV-1 heterosexual transmission chain in Guangzhou, China: a molecular epidemiological study.

PubMed

Han, Zhigang; Leung, Tommy W C; Zhao, Jinkou; Wang, Ming; Fan, Lirui; Li, Kai; Pang, Xinli; Liang, Zhenbo; Lim, Wilina W L; Xu, Huifang

2009-09-25

We conducted molecular analyses to confirm four clustering HIV-1 infections (Patient A, B, C & D) in Guangzhou, China. These cases were identified by epidemiological investigation and suspected to acquire the infection through a common heterosexual transmission chain. Env C2V3V4 region, gag p17/p24 junction and partial pol gene of HIV-1 genome from serum specimens of these infected cases were amplified by reverse transcription polymerase chain reaction (RT-PCR) and nucleotide sequenced. Phylogenetic analyses indicated that their viral nucleotide sequences were significantly clustered together (bootstrap value is 99%, 98% and 100% in env, gag and pol tree respectively). Evolutionary distance analysis indicated that their genetic diversities of env, gag and pol genes were significantly lower than non-clustered controls, as measured by unpaired t-test (env gene comparison: p < 0.005; gag gene comparison: p < 0.005; pol gene comparison: p < 0.005). Epidemiological results and molecular analyses consistently illustrated these four cases represented a transmission chain which dispersed in the locality through heterosexual contact involving commercial sex worker.

Single nucleotide polymorphism (SNP) discovery in rainbow trout using restriction site associated DNA (RAD) sequencing of doubled haploids and assessment of polymorphism in a population survey

USDA-ARS?s Scientific Manuscript database

Background: Our goal is to produce a high-throughput SNP genotyping platform for genomic analyses in rainbow trout that will enable fine mapping of QTL, whole genome association studies, genomic selection for improved aquaculture production traits, and genetic analyses of wild populations that aid ...

Variability and genetic structure of the population of watermelon mosaic virus infecting melon in Spain.

PubMed

Moreno, I M; Malpica, J M; Díaz-Pendón, J A; Moriones, E; Fraile, A; García-Arenal, F

2004-01-05

The genetic structure of the population of Watermelon mosaic virus (WMV) in Spain was analysed by the biological and molecular characterisation of isolates sampled from its main host plant, melon. The population was a highly homogeneous one, built of a single pathotype, and comprising isolates closely related genetically. There was indication of temporal replacement of genotypes, but not of spatial structure of the population. Analyses of nucleotide sequences in three genomic regions, that is, in the cistrons for the P1, cylindrical inclusion (CI) and capsid (CP) proteins, showed lower similar values of nucleotide diversity for the P1 than for the CI or CP cistrons. The CI protein and the CP were under tighter evolutionary constraints than the P1 protein. Also, for the CI and CP cistrons, but not for the P1 cistron, two groups of sequences, defining two genetic strains, were apparent. Thus, different genomic regions of WMV show different evolutionary dynamics. Interestingly, for the CI and CP cistrons, sequences were clustered into two regions of the sequence space, defining the two strains above, and no intermediary sequences were identified. Recombinant isolates were found, accounting for at least 7% of the population. These recombinants presented two interesting features: (i) crossover points were detected between the analysed regions in the CI and CP cistrons, but not between those in the P1 and CI cistrons, (ii) crossover points were not observed within the analysed coding regions for the P1, CI or CP proteins. This indicates strong selection against isolates with recombinant proteins, even when originated from closely related strains. Hence, data indicate that genotypes of WMV, generated by mutation or recombination, outside of acceptable, discrete, regions in the evolutionary space, are eliminated from the virus population by negative selection.

A comprehensive analysis of three Asiatic black bear mitochondrial genomes (subspecies ussuricus, formosanus and mupinensis), with emphasis on the complete mtDNA sequence of Ursus thibetanus ussuricus (Ursidae).

PubMed

Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong

2008-08-01

In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus

PubMed Central

Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.

2015-01-01

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus.

PubMed

Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W

2008-06-05

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

A review of bioinformatic methods for forensic DNA analyses.

PubMed

Liu, Yao-Yuan; Harbison, SallyAnn

2018-03-01

Short tandem repeats, single nucleotide polymorphisms, and whole mitochondrial analyses are three classes of markers which will play an important role in the future of forensic DNA typing. The arrival of massively parallel sequencing platforms in forensic science reveals new information such as insights into the complexity and variability of the markers that were previously unseen, along with amounts of data too immense for analyses by manual means. Along with the sequencing chemistries employed, bioinformatic methods are required to process and interpret this new and extensive data. As more is learnt about the use of these new technologies for forensic applications, development and standardization of efficient, favourable tools for each stage of data processing is being carried out, and faster, more accurate methods that improve on the original approaches have been developed. As forensic laboratories search for the optimal pipeline of tools, sequencer manufacturers have incorporated pipelines into sequencer software to make analyses convenient. This review explores the current state of bioinformatic methods and tools used for the analyses of forensic markers sequenced on the massively parallel sequencing (MPS) platforms currently most widely used. Copyright © 2017 Elsevier B.V. All rights reserved.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

2007-02-14

The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

First isolation of Actinobacillus genomospecies 2 in Japan.

PubMed

Murakami, Miyuki; Shimonishi, Yoshimasa; Hobo, Seiji; Niwa, Hidekazu; Ito, Hiroya

2016-05-03

We describe here the first isolation of Actinobacillus genomospecies 2 in Japan. The isolate was found in a septicemic foal and characterized by phenotypic and genetic analyses, with the latter consisting of 16S rDNA nucleotide sequence analysis plus multilocus sequence analysis using three housekeeping genes, recN, rpoA and thdF, that have been proposed for use as a genomic tool in place of DNA-DNA hybridization.

Molecular epidemiology demonstrated three emerging clusters of human immunodeficiency virus type 1 subtype B infection in Hong Kong.

PubMed

Leung, Tommy W C; Mak, Darwin; Wong, K H; Wang, Y; Song, Y H; Tsang, D N C; Wong, C; Shao, Y M; Lim, W L

2008-07-01

We conducted a molecular epidemiological study on newly diagnosed human immunodeficiency virus type 1 (HIV-1)-infected patients in Hong Kong to identify the epidemiological linkage of HIV-1 infection in the locality. Reverse transcription polymerase chain reaction (RT-PCR) for HIV-1 was performed on newly diagnosed HIV-1-positive sera collected from January 2002 to December 2006. PCR products correspond to the env C2V3V4 region and gag p17/p24 junction of the HIV-1 genome were nucleotide sequenced. Phylogenetic analyses performed on the acquired nucleotide sequences revealed that CRF01_AE and subtype B were the two dominant HIV-1 subtypes. Analyses also demonstrated the presence of three emerging HIV-1 clusters among the subtype B sequences in Hong Kong. Individual cluster possesses a unique cluster-specific amino acid signature for identification. Data show that one of the clusters (Cluster I) is rapidly expanding. In addition to the unique cluster-specific amino acid signature, the majority of sequences in Cluster I harbor a 6-amino acid insertion at the gag p17/p24 junction in a region that is thought to be closely associated with HIV-1 infectivity.

Phylogenetically marking the limits of the genus Fusarium for post-Article 59 usage

USDA-ARS?s Scientific Manuscript database

Fusarium (Hypocreales, Nectriaceae) is one of the most important and systematically challenging groups of mycotoxigenic, plant pathogenic, and human pathogenic fungi. We conducted maximum likelihood (ML), maximum parsimony (MP) and Bayesian (B) analyses on partial nucleotide sequences of genes encod...

Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

PubMed

Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

2004-08-01

Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

PubMed Central

Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

2013-01-01

In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

Molecular cloning and nucleotide sequences of the genes for two essential proteins constituting a novel enzyme system for heptaprenyl diphosphate synthesis.

PubMed

Koike-Takeshita, A; Koyama, T; Obata, S; Ogura, K

1995-08-04

The genes encoding two dissociable components essential for Bacillus stearothermophilus heptaprenyl diphosphate synthase (all-trans-hexparenyl-diphosphate:isopentenyl-diphosphate hexaprenyl-trans-transferase, EC 2.5.1.30) were cloned, and their nucleotide sequences were determined. Sequence analyses revealed the presence of three open reading frames within 2,350 base pairs, designated as ORF-1, ORF-2, and ORF-3 in order of nucleotide sequence, which encode proteins of 220, 234, and 323 amino acids, respectively. Deletion experiments have shown that expression of the enzymatic activity requires the presence of ORF-1 and ORF-3, but ORF-2 is not essential. As a result, this enzyme was proved genetically to consist of two different protein compounds with molecular masses of 25 kDa (Component I) and 36 kDa (Component II), encoded by two of the three tandem genes. The protein encoded by ORF-1 has no similarity to any protein so far registered. However, the protein encoded by ORF-3 shows a 32% similarity to the farnesyl diphosphate synthase of the same bacterium and has seven highly conserved regions that have been shown typical in prenyltransferases (Koyama, T., Obata, S., Osabe, M., Takeshita, A., Yokoyama, K., Uchida, M., Nishino, T., and Ogura, K. (1993) J. Biochem. (Tokyo) 113, 355-363).

The BaMM web server for de-novo motif discovery and regulatory sequence analysis.

PubMed

Kiesel, Anja; Roth, Christian; Ge, Wanwan; Wess, Maximilian; Meier, Markus; Söding, Johannes

2018-05-28

The BaMM web server offers four tools: (i) de-novo discovery of enriched motifs in a set of nucleotide sequences, (ii) scanning a set of nucleotide sequences with motifs to find motif occurrences, (iii) searching with an input motif for similar motifs in our BaMM database with motifs for >1000 transcription factors, trained from the GTRD ChIP-seq database and (iv) browsing and keyword searching the motif database. In contrast to most other servers, we represent sequence motifs not by position weight matrices (PWMs) but by Bayesian Markov Models (BaMMs) of order 4, which we showed previously to perform substantially better in ROC analyses than PWMs or first order models. To address the inadequacy of P- and E-values as measures of motif quality, we introduce the AvRec score, the average recall over the TP-to-FP ratio between 1 and 100. The BaMM server is freely accessible without registration at https://bammmotif.mpibpc.mpg.de.

Characterization of a Novel Polerovirus Infecting Maize in China

PubMed Central

Chen, Sha; Jiang, Guangzhuang; Wu, Jianxiang; Liu, Yong; Qian, Yajuan; Zhou, Xueping

2016-01-01

A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3′ half of P3–P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved. PMID:27136578

Characterization of a Novel Polerovirus Infecting Maize in China.

PubMed

Chen, Sha; Jiang, Guangzhuang; Wu, Jianxiang; Liu, Yong; Qian, Yajuan; Zhou, Xueping

2016-04-28

A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3' half of P3-P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

PubMed

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-02-23

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

PubMed Central

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-01-01

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

Comparative chloroplast genomics: Analyses including new sequencesfrom the angiosperms Nuphar advena and Ranunculus macranthus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raubeso, Linda A.; Peery, Rhiannon; Chumley, Timothy W.

2007-03-01

The number of completely sequenced plastid genomes available is growing rapidly. This new array of sequences presents new opportunities to perform comparative analyses. In comparative studies, it is most useful to compare across wide phylogenetic spans and, within angiosperms, to include representatives from basally diverging lineages such as the new genomes reported here: Nuphar advena (from a basal-most lineage) and Ranunculus macranthus (from the basal group of eudicots). We report these two new plastid genome sequences and make comparisons (within angiosperms, seed plants, or all photosynthetic lineages) to evaluate features such as the status of ycf15 and ycf68 as proteinmore » coding genes, the distribution of simple sequence repeats (SSRs) and longer dispersed repeats (SDR), and patterns of nucleotide composition.« less

Ancient diversity and geographical sub-structuring in African buffalo Theileria parva populations revealed through metagenetic analysis of antigen-encoding loci.

PubMed

Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William

2018-03-01

An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, G.; Korber, B.; Wain-Hobson, S.

1993-12-31

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

First isolation of Actinobacillus genomospecies 2 in Japan

PubMed Central

MURAKAMI, Miyuki; SHIMONISHI, Yoshimasa; HOBO, Seiji; NIWA, Hidekazu; ITO, Hiroya

2015-01-01

We describe here the first isolation of Actinobacillus genomospecies 2 in Japan. The isolate was found in a septicemic foal and characterized by phenotypic and genetic analyses, with the latter consisting of 16S rDNA nucleotide sequence analysis plus multilocus sequence analysis using three housekeeping genes, recN, rpoA and thdF, that have been proposed for use as a genomic tool in place of DNA-DNA hybridization. PMID:26668165

Molecular characterization of Giardia psittaci by multilocus sequence analysis.

PubMed

Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi

2012-12-01

Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

Generation of West Nile virus infectious clones containing amino acid insertions between capsid and capsid anchor.

PubMed

Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L

2014-04-09

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.

Generation of West Nile Virus Infectious Clones Containing Amino Acid Insertions Between Capsid and Capsid Anchor

PubMed Central

Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.

2014-01-01

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Human retroviruses and AIDS, 1991. [CONTAINS GLOSSARY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, G.; Korber, B.; Berzofsky, J.A.

1991-05-01

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses.The scope of the compendium and database is best summarized by the five parts that it comprises: (1) HIV and SIV Nucleotide Sequences; (2) Amino Acid Sequences; (3) Analyses; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

Complex structural behavior of oligopurine-oligopyrimidine sequence cloned within the supercoiled plasmid.

PubMed Central

Parniewski, P; Galazka, G; Wilk, A; Klysik, J

1989-01-01

Synthetic sequence GATCC(AG)7ATCG(AT)4CG(AG)7 was cloned into plasmid and its structural behavior under the influence of supercoiling was analysed by chemical modification at variety of experimental conditions. It was found that this sequence adopts at least two different non-B conformations depending on -delta and pH values. Moreover, 12 nucleotide long non-pur.pyr spacer region separating two identical (AG)7 blocks does not provide a significant energy barrier protecting against unusual structures formation. Images PMID:2644622

Molecular characterization and phylogenetic relationships of Desmodium leaf distortion virus (DeLDV): a new begomovirus infecting Desmodium glabrum in Yucatan, Mexico.

PubMed

Hernández-Zepeda, Cecilia; Argüello-Astorga, Gerardo; Idris, Ali M; Carnevali, Germán; Brown, Judith K; Moreno-Valenzuela, Oscar A

2009-12-01

The complete DNA-A component sequence of Desmodium leaf distortion virus (DeLDV, Begomovirus) isolated in Yucatan was determined to be 2569 nucleotides (nt) in length, and it was most closely related to Cotton leaf crumple virus-California (CLCrV-[Cal]), at 76%. The complete DNA-B component sequence was 2514 nt in length, and shared its highest nucleotide identity (60%) with Potato yellow mosaic Trinidad virus (PYMTV). Phylogenetic analyses group the DeLDV DNA-A component in the SLCV clade, whereas, the DeLDV DNA-B was grouped with the Abutilon mosaic virus clade, which also contains PYMV, suggesting that the DeLDV components have distinct evolutionary histories, possibly as the result of recombination and reassortment.

Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

PubMed

Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

2011-08-01

In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

PubMed

Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

2000-12-01

Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

PubMed

Murray, Vincent; Chen, Jon K; Tanaka, Mark M

2016-07-01

The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

Analysing grouping of nucleotides in DNA sequences using lumped processes constructed from Markov chains.

PubMed

Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude

2006-03-01

The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.

Emergence and localized circulation of a vaccine-derived poliovirus in an isolated mountain community in Guangxi, China.

PubMed

Yan, Dongmei; Li, Li; Zhu, Shuangli; Zhang, Yong; An, Junjing; Wang, Dongyan; Wen, Ning; Jorba, Jaume; Liu, Wei; Zhong, Ge; Huang, Lin; Kew, Olen; Liang, Xiaofeng; Xu, Wenbo

2010-09-01

From March to May 2006, type 1 circulating vaccine-derived poliovirus (cVDPV) was isolated from one case patient with acute flaccid paralysis (AFP) and six unimmunized healthy contacts in isolated mountain villages in Guangxi, China. We conducted epidemiological investigations in the affected communities and nucleotide sequence analyses of the cVDPV isolates. The results of the investigations showed that the AFP patient, an unimmunized 10-year-old boy, and five laboratory-confirmed contacts lived in the same village; one contact lived in a neighboring village. Only approximately 27% of children 5 to 10 years of age in the affected villages had received three or more doses of the trivalent oral poliovirus vaccine (OPV). Nucleotide sequence analyses revealed that the cVDPV isolates differed from the Sabin 1 (S1) isolate at 1.4 to 2.2% of VP1 nucleotide positions and shared 12 nucleotide substitutions within VP1. All isolates were S1/S2/S1/S3 recombinants sharing common recombination junctions. Key determinants of attenuation were replaced. Phylogenetic analysis suggested that the cVDPV circulated locally for approximately 12 months following the initiating OPV dose. No VDPVs were found after mass OPV immunizations, conducted from May to June 2006, that targeted all children <12 years of age. Our findings reinforce the point that VDPVs can emerge and spread in isolated communities with immunity gaps. Maintenance of sensitive AFP and poliovirus surveillance is essential to permit early detection and a rapid response to VDPV circulation.

EggLib: processing, analysis and simulation tools for population genetics and genomics

PubMed Central

2012-01-01

Background With the considerable growth of available nucleotide sequence data over the last decade, integrated and flexible analytical tools have become a necessity. In particular, in the field of population genetics, there is a strong need for automated and reliable procedures to conduct repeatable and rapid polymorphism analyses, coalescent simulations, data manipulation and estimation of demographic parameters under a variety of scenarios. Results In this context, we present EggLib (Evolutionary Genetics and Genomics Library), a flexible and powerful C++/Python software package providing efficient and easy to use computational tools for sequence data management and extensive population genetic analyses on nucleotide sequence data. EggLib is a multifaceted project involving several integrated modules: an underlying computationally efficient C++ library (which can be used independently in pure C++ applications); two C++ programs; a Python package providing, among other features, a high level Python interface to the C++ library; and the egglib script which provides direct access to pre-programmed Python applications. Conclusions EggLib has been designed aiming to be both efficient and easy to use. A wide array of methods are implemented, including file format conversion, sequence alignment edition, coalescent simulations, neutrality tests and estimation of demographic parameters by Approximate Bayesian Computation (ABC). Classes implementing different demographic scenarios for ABC analyses can easily be developed by the user and included to the package. EggLib source code is distributed freely under the GNU General Public License (GPL) from its website http://egglib.sourceforge.net/ where a full documentation and a manual can also be found and downloaded. PMID:22494792

EggLib: processing, analysis and simulation tools for population genetics and genomics.

PubMed

De Mita, Stéphane; Siol, Mathieu

2012-04-11

With the considerable growth of available nucleotide sequence data over the last decade, integrated and flexible analytical tools have become a necessity. In particular, in the field of population genetics, there is a strong need for automated and reliable procedures to conduct repeatable and rapid polymorphism analyses, coalescent simulations, data manipulation and estimation of demographic parameters under a variety of scenarios. In this context, we present EggLib (Evolutionary Genetics and Genomics Library), a flexible and powerful C++/Python software package providing efficient and easy to use computational tools for sequence data management and extensive population genetic analyses on nucleotide sequence data. EggLib is a multifaceted project involving several integrated modules: an underlying computationally efficient C++ library (which can be used independently in pure C++ applications); two C++ programs; a Python package providing, among other features, a high level Python interface to the C++ library; and the egglib script which provides direct access to pre-programmed Python applications. EggLib has been designed aiming to be both efficient and easy to use. A wide array of methods are implemented, including file format conversion, sequence alignment edition, coalescent simulations, neutrality tests and estimation of demographic parameters by Approximate Bayesian Computation (ABC). Classes implementing different demographic scenarios for ABC analyses can easily be developed by the user and included to the package. EggLib source code is distributed freely under the GNU General Public License (GPL) from its website http://egglib.sourceforge.net/ where a full documentation and a manual can also be found and downloaded.

Phylogenetic analyses indicate little variation among reticuloendotheliosis viruses infecting avian species, including the endangered Attwater's prairie chicken.

PubMed

Bohls, Ryan L; Linares, Jose A; Gross, Shannon L; Ferro, Pam J; Silvy, Nova J; Collisson, Ellen W

2006-08-01

Reticuloendotheliosis virus infection, which typically causes systemic lymphomas and high mortality in the endangered Attwater's prairie chicken, has been described as a major obstacle in repopulation efforts of captive breeding facilities in Texas. Although antigenic relationships among reticuloendotheliosis virus (REV) strains have been previously determined, phylogenetic relationships have not been reported. The pol and env of REV proviral DNA from prairie chickens (PC-R92 and PC-2404), from poxvirus lesions in domestic chickens, the prototype poultry derived REV-A and chick syncytial virus (CSV), and duck derived spleen necrosis virus (SNV) were PCR amplified and sequenced. The 5032bp, that included the pol and most of env genes, of the PC-R92 and REV-A were 98% identical, and nucleotide sequence identities of smaller regions within the pol and env from REV strains examined ranged from 95 to 99% and 93 to 99%, respectively. The putative amino acid sequences were 97-99% identical in the polymerase and 90-98% in the envelope. Phylogenetic analyses of the nucleotide and amino acid sequences indicated the closest relationship among the recent fowl pox-associated chicken isolates, the prairie chicken isolates and the prototype CSV while only the SNV appeared to be distinctly divergent. While the origin of the naturally occurring viruses is not known, the avian poxvirus may be a critical component of transmission of these ubiquitous oncogenic viruses.

Molecular Variability Among Isolates of Prunus Necrotic Ringspot Virus from Different Prunus spp.

PubMed

Aparicio, F; Myrta, A; Di Terlizzi, B; Pallás, V

1999-11-01

ABSTRACT Viral sequences amplified by polymerase chain reaction from 25 isolates of Prunus necrotic ringspot virus (PNRSV), varying in the symptomatology they cause in six different Prunus spp., were analyzed for restriction fragment polymorphisms. Most of the isolates could be discriminated by using a combination of three different restriction enzymes. The nucleotide sequences of the RNA 4 of 15 of these isolates were determined. Sequence comparisons and phylogenetic analyses of the RNA 4 and coat proteins (CPs) revealed that all of the isolates clustered into three different groups, represented by three previously sequenced PNRSV isolates: PV32, PE5, and PV96. The PE5-type group was characterized by a 5' untranslated region that was clearly different from that of the other two groups. The PV32-type group was characterized by an extra hexanucleotide consisting of a duplication of the six immediately preceding nucleotides. Although most of the variability was observed in the first third of the CP, the amino acid residues in this region, which were previously thought to be functionally important in the replication cycle of the virus, were strictly conserved. No clear correlation with the type of symptom or host specificity could be observed. The validity of this grouping was confirmed when other isolates recently characterized by other authors were included in these analyses.

Chimeric mitochondrial minichromosomes of the human body louse, Pediculus humanus: evidence for homologous and non-homologous recombination.

PubMed

Shao, Renfu; Barker, Stephen C

2011-02-15

The mitochondrial (mt) genome of the human body louse, Pediculus humanus, consists of 18 minichromosomes. Each minichromosome is 3 to 4 kb long and has 1 to 3 genes. There is unequivocal evidence for recombination between different mt minichromosomes in P. humanus. It is not known, however, how these minichromosomes recombine. Here, we report the discovery of eight chimeric mt minichromosomes in P. humanus. We classify these chimeric mt minichromosomes into two groups: Group I and Group II. Group I chimeric minichromosomes contain parts of two different protein-coding genes that are from different minichromosomes. The two parts of protein-coding genes in each Group I chimeric minichromosome are joined at a microhomologous nucleotide sequence; microhomologous nucleotide sequences are hallmarks of non-homologous recombination. Group II chimeric minichromosomes contain all of the genes and the non-coding regions of two different minichromosomes. The conserved sequence blocks in the non-coding regions of Group II chimeric minichromosomes resemble the "recombination repeats" in the non-coding regions of the mt genomes of higher plants. These repeats are essential to homologous recombination in higher plants. Our analyses of the nucleotide sequences of chimeric mt minichromosomes indicate both homologous and non-homologous recombination between minichromosomes in the mitochondria of the human body louse. Copyright © 2010 Elsevier B.V. All rights reserved.

A comprehensive bioinformatic analysis of hepatitis D virus full-length genomes.

PubMed

Delfino, C M; Cerrudo, C S; Biglione, M; Oubiña, J R; Ghiringhelli, P D; Mathet, V L

2018-02-06

In association with hepatitis B virus (HBV), hepatitis delta virus (HDV) is a subviral agent that may promote severe acute and chronic forms of liver disease. Based on the percentage of nucleotide identity of the genome, HDV was initially classified into three genotypes. However, since 2006, the original classification has been further expanded into eight clades/genotypes. The intergenotype divergence may be as high as 35%-40% over the entire RNA genome, whereas sequence heterogeneity among the isolates of a given genotype is <20%; furthermore, HDV recombinants have been clearly demonstrated. The genetic diversity of HDV is related to the geographic origin of the isolates. This study shows the first comprehensive bioinformatic analysis of the complete available set of HDV sequences, using both nucleotide and protein phylogenies (based on an evolutionary model selection, gamma distribution estimation, tree inference and phylogenetic distance estimation), protein composition analysis and comparison (based on the presence of invariant residues, molecular signatures, amino acid frequencies and mono- and di-amino acid compositional distances), as well as amino acid changes in sequence evolution. Taking into account the congruent and consistent results of both nucleotide and amino acid analyses of GenBank available sequences (recorded as of January, 2017), we propose that the eight hepatitis D virus genotypes may be grouped into three large genogroups fully supported by their shared characteristics. © 2018 John Wiley & Sons Ltd.

RNA expression in a cartilaginous fish cell line reveals ancient 3′ noncoding regions highly conserved in vertebrates

PubMed Central

Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J.; Barnes, David W.

2007-01-01

We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3′ UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3′ mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology. PMID:17227856

Error correction and diversity analysis of population mixtures determined by NGS

PubMed Central

Burroughs, Nigel J.; Evans, David J.; Ryabov, Eugene V.

2014-01-01

The impetus for this work was the need to analyse nucleotide diversity in a viral mix taken from honeybees. The paper has two findings. First, a method for correction of next generation sequencing error in the distribution of nucleotides at a site is developed. Second, a package of methods for assessment of nucleotide diversity is assembled. The error correction method is statistically based and works at the level of the nucleotide distribution rather than the level of individual nucleotides. The method relies on an error model and a sample of known viral genotypes that is used for model calibration. A compendium of existing and new diversity analysis tools is also presented, allowing hypotheses about diversity and mean diversity to be tested and associated confidence intervals to be calculated. The methods are illustrated using honeybee viral samples. Software in both Excel and Matlab and a guide are available at http://www2.warwick.ac.uk/fac/sci/systemsbiology/research/software/, the Warwick University Systems Biology Centre software download site. PMID:25405074

Improved nucleic acid descriptors for siRNA efficacy prediction.

PubMed

Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

2013-02-01

Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

PubMed

Kachhap, Sangita; Singh, Balvinder

2015-01-01

In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

Initial Detection and Molecular Characterization of Namaycush Herpesvirus (Salmonid Herpesvirus 5) in Lake Trout.

PubMed

Glenney, Gavin W; Barbash, Patricia A; Coll, John A

2016-03-01

A novel herpesvirus was found by molecular methods in samples of Lake Trout Salvelinus namaycush from Lake Erie, Pennsylvania, and Lake Ontario, Keuka Lake, and Lake Otsego, New York. Based on PCR amplification and partial sequencing of polymerase, terminase, and glycoprotein genes, a number of isolates were identified as a novel virus, which we have named Namaycush herpesvirus (NamHV) salmonid herpesvirus 5 (SalHV5). Phylogenetic analyses of three NamHV genes indicated strong clustering with other members of the genus Salmonivirus, placing these isolates into family Alloherpesviridae. The NamHV isolates were identical in the three partially sequenced genes; however, they varied from other salmonid herpesviruses in nucleotide sequence identity. In all three of the genes sequenced, NamHV shared the highest sequence identity with Atlantic Salmon papillomatosis virus (ASPV; SalHV4) isolated from Atlantic Salmon Salmo salar in northern Europe, including northwestern Russia. These results lead one to believe that NamHV and ASPV have a common ancestor that may have made a relatively recent host jump from Atlantic Salmon to Lake Trout or vice versa. Partial nucleotide sequence comparisons between NamHV and ASPV for the polymerase and glycoprotein genes differ by >5% and >10%, respectively. Additional nucleotide sequence comparisons between NamHV and epizootic epitheliotropic disease virus (EEDV/SalHV3) in the terminase, glycoprotein, and polymerase genes differ by >5%, >20%, and >10%, respectively. Thus, NamHV and EEDV may be occupying discrete ecological niches in Lake Trout. Even though NamHV shared the highest genetic identity with ASPV, each of these viruses has a separate host species, which also implies speciation. Additionally, NamHV has been detected over the last 4 years in four separate water bodies across two states, which suggests that NamHV is a distinct, naturally replicating lineage. This, in combination with a divergence in nucleotide sequence from EEDV, indicates that NamHV is a new species in the genus Salmonivirus. Received April 20, 2015; accepted October 11, 2015.

Complete genome sequences of two highly divergent Japanese isolates of Plantago asiatica mosaic virus.

PubMed

Komatsu, Ken; Yamashita, Kazuo; Sugawara, Kota; Verbeek, Martin; Fujita, Naoko; Hanada, Kaoru; Uehara-Ichiki, Tamaki; Fuji, Shin-Ichi

2017-02-01

Plantago asiatica mosaic virus (PlAMV) is a member of the genus Potexvirus and has an exceptionally wide host range. It causes severe damage to lilies. Here we report on the complete nucleotide sequences of two new Japanese PlAMV isolates, one from the eudicot weed Viola grypoceras (PlAMV-Vi), and the other from the eudicot shrub Nandina domestica Thunb. (PlAMV-NJ). Their genomes contain five open reading frames (ORFs), which is characteristic of potexviruses. Surprisingly, the isolates showed only 76.0-78.0 % sequence identity with each other and with other PlAMV isolates, including isolates from Japanese lily and American nandina. Amino acid alignments of the replicase coding region encoded by ORF1 showed that the regions between the methyltransferase and helicase domains were less conserved than other regions, with several insertions and/or deletions. Phylogenetic analyses of the full-length nucleotide sequences revealed a moderate correlation between phylogenetic clustering and the original host plants of the PlAMV isolates. This study revealed the presence of two highly divergent PlAMV isolates in Japan.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

New Hepatitis E Virus Genotype in Camels, the Middle East

PubMed Central

Lau, Susanna K.P.; Teng, Jade L.L.; Tsang, Alan K. L.; Joseph, Marina; Wong, Emily Y.M.; Tang, Ying; Sivakumar, Saritha; Xie, Jun; Bai, Ru; Wernery, Renate; Wernery, Ulrich; Yuen, Kwok-Yung

2014-01-01

In a molecular epidemiology study of hepatitis E virus (HEV) in dromedaries in Dubai, United Arab Emirates, HEV was detected in fecal samples from 3 camels. Complete genome sequencing of 2 strains showed >20% overall nucleotide difference to known HEVs. Comparative genomic and phylogenetic analyses revealed a previously unrecognized HEV genotype. PMID:24856611

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Mapping copy number variation by population-scale genome sequencing.

PubMed

Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O

2011-02-03

Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.

Phylogeny of North American Powassan virus.

PubMed

Ebel, G D; Spielman, A; Telford, S R

2001-07-01

To determine whether Powassan virus (POW) and deer tick virus (DTV) constitute distinct flaviviral populations transmitted by ixodid ticks in North America, we analysed diverse nucleotide sequences from 16 strains of these viruses. Two distinct genetic lineages are evident, which may be defined by geographical and host associations. The nucleotide and amino acid sequences of lineage one (comprising New York and Canadian POW isolates) are highly conserved across time and space, but those of lineage two (comprising isolates from deer ticks and a fox) are more variable. The divergence between lineages is much greater than the variation within either lineage, and lineage two appears to be more diverse genetically than is lineage one. Application of McDonald-Kreitman tests to the sequences of these strains indicates that adaptive evolution of the envelope protein separates lineage one from lineage two. The two POW lineages circulating in North America possess a pattern of genetic diversity suggesting that they comprise distinct subtypes that may perpetuate in separate enzootic cycles.

The nucleotide sequence of a segment of Trypanosoma brucei mitochondrial maxi-circle DNA that contains the gene for apocytochrome b and some unusual unassigned reading frames.

PubMed Central

Benne, R; De Vries, B F; Van den Burg, J; Klaver, B

1983-01-01

The nucleotide sequence of a 2.5-kb segment of the maxi-circle of Trypanosoma brucei mtDNA has been determined. The segment contains the gene for apocytochrome b, which displays about 25% homology at the amino acid level to the apocytochrome b gene from fungal and mammalian mtDNAs. Northern blot and S1 nuclease analyses have yielded accurate map positions of an RNA species in an area that coincides with the reading frame. The segment also contains two pairs of overlapping unassigned reading frames, which lack homology with any known mitochondrial gene or URF. The DNA sequence in these areas is AG-rich (70%), resulting in URFs with an unusually high level of glycine and charged amino acids (60%). They may not encode proteins, in spite of their size and the fact that abundant transcripts are mapped in these areas. Images PMID:6314266

Functional Analyses of a Novel Splice Variant in the CHD7 Gene, Found by Next Generation Sequencing, Confirm Its Pathogenicity in a Spanish Patient and Diagnose Him with CHARGE Syndrome.

PubMed

Villate, Olatz; Ibarluzea, Nekane; Fraile-Bethencourt, Eugenia; Valenzuela, Alberto; Velasco, Eladio A; Grozeva, Detelina; Raymond, F L; Botella, María P; Tejada, María-Isabel

2018-01-01

Mutations in CHD7 have been shown to be a major cause of CHARGE syndrome, which presents many symptoms and features common to other syndromes making its diagnosis difficult. Next generation sequencing (NGS) of a panel of intellectual disability related genes was performed in an adult patient without molecular diagnosis. A splice donor variant in CHD7 (c.5665 + 1G > T) was identified. To study its potential pathogenicity, exons and flanking intronic sequences were amplified from patient DNA and cloned into the pSAD ® splicing vector. HeLa cells were transfected with this construct and a wild-type minigene and functional analysis were performed. The construct with the c.5665 + 1G > T variant produced an aberrant transcript with an insert of 63 nucleotides of intron 28 creating a premature termination codon (TAG) 25 nucleotides downstream. This would lead to the insertion of 8 new amino acids and therefore a truncated 1896 amino acid protein. As a result of this, the patient was diagnosed with CHARGE syndrome. Functional analyses underline their usefulness for studying the pathogenicity of variants found by NGS and therefore its application to accurately diagnose patients.

Prevalence of Tobacco mosaic virus in Iran and Evolutionary Analyses of the Coat Protein Gene

PubMed Central

Alishiri, Athar; Rakhshandehroo, Farshad; Zamanizadeh, Hamid-Reza; Palukaitis, Peter

2013-01-01

The incidence and distribution of Tobacco mosaic virus (TMV) and related tobamoviruses was determined using an enzyme-linked immunosorbent assay on 1,926 symptomatic horticultural crops and 107 asymptomatic weed samples collected from 78 highly infected fields in the major horticultural crop-producing areas in 17 provinces throughout Iran. The results were confirmed by host range studies and reverse transcription-polymerase chain reaction. The overall incidence of infection by these viruses in symptomatic plants was 11.3%. The coat protein (CP) gene sequences of a number of isolates were determined and disclosed to be a high identity (up to 100%) among the Iranian isolates. Phylogenetic analysis of all known TMV CP genes showed three clades on the basis of nucleotide sequences with all Iranian isolates distinctly clustered in clade II. Analysis using the complete CP amino acid sequence showed one clade with two subgroups, IA and IB, with Iranian isolates in both subgroups. The nucleotide diversity within each sub-group was very low, but higher between the two clades. No correlation was found between genetic distance and geographical origin or host species of isolation. Statistical analyses suggested a negative selection and demonstrated the occurrence of gene flow from the isolates in other clades to the Iranian population. PMID:25288953

Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages

PubMed Central

Desai, Prerak T.; den Bakker, Henk C.; Mikoleit, Matthew; Tolar, Beth; Trees, Eija; Hendriksen, Rene S.; Frye, Jonathan G.; Porwollik, Steffen; Weimer, Bart C.; Wiedmann, Martin; Weinstock, George M.; Fields, Patricia I.; McClelland, Michael

2014-01-01

Salmonella enterica serotype Enteritidis is one of the most commonly reported causes of human salmonellosis. Its low genetic diversity, measured by fingerprinting methods, has made subtyping a challenge. We used whole-genome sequencing to characterize 125 S. enterica Enteritidis and 3 S. enterica serotype Nitra strains. Single-nucleotide polymorphisms were filtered to identify 4,887 reliable loci that distinguished all isolates from each other. Our whole-genome single-nucleotide polymorphism typing approach was robust for S. enterica Enteritidis subtyping with combined data for different strains from 2 different sequencing platforms. Five major genetic lineages were recognized, which revealed possible patterns of geographic and epidemiologic distribution. Analyses on the population dynamics and evolutionary history estimated that major lineages emerged during the 17th–18th centuries and diversified during the 1920s and 1950s. PMID:25147968

Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

PubMed Central

Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

2016-01-01

Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

PCR amplification and sequence analysis of the major capsid protein gene of megalocytiviruses isolated in Taiwan.

PubMed

Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H

2009-06-01

Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.

Bean common mosaic virus isolates causing different symptoms in asparagus bean in China differ greatly in the 5'-parts of their genomes.

PubMed

Zheng, Hongying; Chen, Jiong; Chen, Jianping; Adams, Michael J; Hou, Mingsheng

2002-06-01

Potyvirus isolates from asparagus bean ( Vigna sesquipedalis) plants in Zhejiang province, China, caused either rugose and vein banding mosaic symptoms (isolate R) or severe yellowing (isolate Y) in this host, but were otherwise similar in host range. Both isolates were completely sequenced and shown to be isolates of Bean common mosaic virus (BCMV). The complete sequences were 9992 (R) or 10062 (Y) nucleotides long and shared 91.7% identical nucleotides (93.2% identical amino acids) in their genomes and were more distantly related to the BCMV-Peanut stripe virus sequence (PStV). The isolates were much less similar to one another in the 5'-UTR and the N-terminal region of the P1 protein. In the P1, isolate Y was closer to PStV (76.1% identical amino acids) than to isolate R (64.8%). Phylogenetic analyses of the coat protein region showed that the new isolates grouped with other isolates from Vigna spp., forming the blackeye cowpea mosaic strain subgroup of BCMV with 94-98% nucleotides (96-99% amino acids) identical to one another and about 90% identity to other BCMV isolates. Other significant subgroupings amongst published BCMV isolates were detected.

Mechanisms generating long range correlation in nucleotide composition of the Borrelia Burgdorferi genome

NASA Astrophysics Data System (ADS)

Mackiewicz, P.; Gierlik, A.; Kowalczuk, M.; Szczepanik, D.; Dudek, M. R.; Cebrat, S.

1999-12-01

We have analysed protein coding and intergenic sequences in the Borrelia burgdorferi (the Lyme disease bacterium) genome using different kinds of DNA walks. Genes occupying the leading strand of DNA have significantly different nucleotide composition from genes occupying the lagging strand. Nucleotide compositional bias of the two DNA strands reflects the aminoacid composition of proteins. 96% of genes coding for ribosomal proteins lie on the leading DNA strand, which suggests that the positions of these as well as other genes are non-random. In the B. burgdorferi genome, the asymmetry in intergenic DNA sequences is lower than the asymmetry in the third positions in codons. All these characters of the B. burgdorferi genome suggest that both replication-associated mutational pressure and recombination mechanisms have established the specific structure of the genome and now any recombination leading to inversion of a gene in respect to the direction of replication is forbidden. This property of the genome allows us to assume that it is in a steady state, which enables us to fix some parameters for simulations of DNA evolution.

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

Case-based surveillance enhanced with measles virus detection/genotyping is essential to maintain measles elimination in Aichi Prefecture, Japan.

PubMed

Minagawa, Hiroko; Yasui, Yoshihiro; Adachi, Hirokazu; Ito, Miyabi; Hirose, Emi; Nakamura, Noriko; Hata, Mami; Kobayashi, Shinichi; Yamashita, Teruo

2015-11-09

Japan was verified as having achieved measles elimination by the Measles Regional Verification Commission in the Western Pacific Region in March 2015. Verification of measles elimination implies the absence of continuous endemic transmission. After the last epidemic in 2007 with an estimated 18,000 cases, Japan introduced nationwide case-based measles surveillance in January 2008. Laboratory diagnosis for all suspected measles cases is essentially required by law, and virus detection tests are mostly performed by municipal public health institutes. Despite relatively high vaccination coverage and vigorous response to every case by the local health center staff, outbreak of measles is repeatedly observed in Aichi Prefecture, Japan. Measles virus N and H gene detection by nested double RT-PCR was performed with all specimens collected from suspected cases and transferred to our institute. Genotyping and further molecular epidemiological analyses were performed with the direct nucleotide sequence data of appropriate PCR products. Between 2010 and 2014, specimens from 389 patients suspected for measles were tested in our institute. Genotypes D9, D8, H1 and B3 were detected. Further molecular epidemiological analyses were helpful to establish links between patients, and sometimes useful to discriminate one outbreak from another. All virus-positive cases, including 49 cases involved in three outbreaks without any obvious epidemiological link with importation, were considered as import-related based on the nucleotide sequence information. Chain of transmission in the latest outbreak in 2014 terminated after the third generations, much earlier than the 2010-11 outbreak (6th generations). Since 2010, almost all measles cases reported in Aichi Prefecture are either import or import-related, based primarily on genotypes and nucleotide sequences of measles virus detected. In addition, genotyping and molecular epidemiological analyses are indispensable to prove the interruption of endemic transmission when the importations of measles are repeatedly observed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Full-Genome Sequence Analysis of a Multirecombinant Echovirus 3 Strain Isolated from Sewage in Greece▿

PubMed Central

Kyriakopoulou, Zaharoula; Dedepsidis, Evaggelos; Pliaka, Vaia; Tsakogiannis, Dimitris; Pratti, Anastassia; Levidiotou-Stefanou, Stamatina; Markoulatos, Panayotis

2010-01-01

An echovirus 3 (Echo3) strain (strain LR31G7) was isolated from a sewage treatment plant in Greece in 2005. Full-genome molecular, phylogenetic, and SimPlot analyses were conducted in order to reveal the evolutionary pathways of the isolate. Nucleotide and phylogenetic analyses of part of the VP1 genomic region revealed that the isolated strain correlates with Echo3 strains isolated during the same year in France and Japan, implying that the same virus circulated in Europe and Asia. LR31G7 was found to be a recombinant that shares the 3′ part of its genome with an Echo25 strain isolated from asymptomatic infants in Norway in 2003. Nucleotide and SimPlot analyses of the VP1-2A junction, where the recombination was located, revealed the exact recombination breakpoint (nucleotides 3357 to 3364). Moreover, there is evidence that recombination events had occurred in 3B-3D region in the evolutionary history of the isolate. Our study indicates that recombination events play major roles in enterovirus evolution and that the circulation of multirecombinant strains with unknown properties could be potentially dangerous for public health. PMID:20129960

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Livebearing or egg-laying mammals: 27 decisive nucleotides of FAM168.

PubMed

Pramanik, Subrata; Kutzner, Arne; Heese, Klaus

2017-05-23

In the present study, we determine comprehensive molecular phylogenetic relationships of the novel myelin-associated neurite-outgrowth inhibitor (MANI) gene across the entire eukaryotic lineage. Combined computational genomic and proteomic sequence analyses revealed MANI as one of the two members of the novel family with sequence similarity 168 member (FAM168) genes, consisting of FAM168A and FAM168B, having distinct genetic differences that illustrate diversification in its biological function and genetic taxonomy across the phylogenetic tree. Phylogenetic analyses based on coding sequences of these FAM168 genes revealed that they are paralogs and that the earliest emergence of these genes occurred in jawed vertebrates such as Callorhinchus milii. Surprisingly, these two genes are absent in other chordates that have a notochord at some stage in their lives, such as branchiostoma and tunicates. In the context of phylogenetic relationships among eukaryotic species, our results demonstrate the presence of FAM168 orthologs in vertebrates ranging from Callorhinchus milii to Homo sapiens, displaying distinct taxonomic clusters, comprised of fish, amphibians, reptiles, birds, and mammals. Analyses of individual FAM168 exons in our sample provide new insights into the molecular relationships between FAM168A and FAM168B (MANI) on the one hand and livebearing and egg-laying mammals on the other hand, demonstrating that a distinctive intermediate exon 4, comprised of 27 nucleotides, appears suddenly only in FAM168A and there in the livebearing mammals only but is absent from all other species including the egg-laying mammals.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

PubMed Central

Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

2016-01-01

The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Intraspecific variation between the ITS sequences of Toxocara canis, Toxocara cati and Toxascaris leonina from different host species in south-western Poland.

PubMed

Fogt-Wyrwas, R; Mizgajska-Wiktor, H; Pacoń, J; Jarosz, W

2013-12-01

Some parasitic nematodes can inhabit different definitive hosts, which raises the question of the intraspecific variability of the nematode genotype affecting their preferences to choose particular species as hosts. Additionally, the issue of a possible intraspecific DNA microheterogeneity in specimens from different parts of the world seems to be interesting, especially from the evolutionary point of view. The problem was analysed in three related species - Toxocara canis, Toxocara cati and Toxascaris leonina - specimens originating from Central Europe (Poland). Using specific primers for species identification, internal transcribed spacer (ITS)-1 and ITS-2 regions were amplified and then sequenced. The sequences obtained were compared with sequences previously described for specimens originating from other geographical locations. No differences in nucleotide sequences were established in T. canis isolated from two different hosts (dogs and foxes). A comparison of ITS sequences of T. canis from Poland with sequences deposited in GenBank showed that the scope of intraspecific variability of the species did not exceed 0.4%, while in T. cati the differences did not exceed 2%. Significant differences were found in T. leonina, where ITS-1 differed by 3% and ITS-2 by as much as 7.4% in specimens collected from foxes in Poland and dogs in Australia. Such scope of differences in the nucleotide sequence seems to exceed the intraspecific variation of the species.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Molecular characterisation of Atlantic salmon paramyxovirus (ASPV): A novel paramyxovirus associated with proliferative gill inflammation

USGS Publications Warehouse

Falk, K.; Batts, W.N.; Kvellestad, A.; Kurath, G.; Wiik-Nielsen, J.; Winton, J.R.

2008-01-01

Atlantic salmon paramyxovirus (ASPV) was isolated in 1995 from gills of farmed Atlantic salmon suffering from proliferative gill inflammation. The complete genome sequence of ASPV was determined, revealing a genome 16,968 nucleotides in length consisting of six non-overlapping genes coding for the nucleo- (N), phospho- (P), matrix- (M), fusion- (F), haemagglutinin-neuraminidase- (HN) and large polymerase (L) proteins in the order 3???-N-P-M-F-HN-L-5???. The various conserved features related to virus replication found in most paramyxoviruses were also found in ASPV. These include: conserved and complementary leader and trailer sequences, tri-nucleotide intergenic regions and highly conserved transcription start and stop signal sequences. The P gene expression strategy of ASPV was like that of the respiro-, morbilli- and henipaviruses, which express the P and C proteins from the primary transcript and edit a portion of the mRNA to encode V and W proteins. Sequence similarities among various features related to virus replication, pairwise comparisons of all deduced ASPV protein sequences with homologous regions from other members of the family Paramyxoviridae, and phylogenetic analyses of these amino acid sequences suggested that ASPV was a novel member of the sub-family Paramyxovirinae, most closely related to the respiroviruses. ?? 2008 Elsevier B.V. All rights reserved.

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

PubMed

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the validated markers were associated with rainbow trout transcripts. The use of reduced representation libraries and pyrosequencing technology proved to be an effective strategy for the discovery of a high number of putative SNPs in rainbow trout; however, modifications to the technique to decrease the false discovery rate resulting from the evolutionary recent genome duplication would be desirable.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes.

PubMed

Crosslin, James M; Hamm, Philip B; Kirk, William W; Hammond, Rosemarie W

2010-04-01

Tobacco rattle virus (TRV) causes stem mottle on potato leaves and necrotic arcs and rings in potato tubers, known as corky ringspot disease. Recently, TRV was reported in Michigan potato tubers cv. FL1879 exhibiting corky ringspot disease. Sequence analysis of the RNA-1-encoded 16-kDa gene of the Michigan isolate, designated MI-1, revealed homology to TRV isolates from Florida and Washington. Here, we report the complete genomic sequence of RNA-1 (6,791 nt) and RNA-2 (3,685 nt) of TRV MI-1. RNA-1 is predicted to contain four open reading frames, and the genome structure and phylogenetic analyses of the RNA-1 nucleotide sequence revealed significant homologies to the known sequences of other TRV-1 isolates. The relationships based on the full-length nucleotide sequence were different from than those based on the 16-kDa gene encoded on genomic RNA-1 and reflect sequence variation within a 20-25-aa residue region of the 16-kDa protein. MI-1 RNA-2 is predicted to contain three ORFs, encoding the coat protein (CP), a 37.6-kDa protein (ORF 2b), and a 33.6-kDa protein (ORF 2c). In addition, it contains a region of similarity to the 3' terminus of RNA-1, including a truncated portion of the 16-kDa cistron. Phylogenetic analysis of RNA-2, based on a comparison of nucleotide sequences with other members of the genus Tobravirus, indicates that TRV MI-1 and other North American isolates cluster as a distinct group. TRV M1-1 is only the second North American isolate for which there is a complete sequence of the genome, and it is distinct from the North American isolate TRV ORY. The relationship of the TRV MI-1 isolate to other tobravirus isolates is discussed.

A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

PubMed

Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

2012-12-01

A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

USGS Publications Warehouse

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates.

PubMed

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David; Lagarrigue, Sandrine; Pitel, Frédérique

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome.

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates

PubMed Central

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome. PMID:26024316

Comparative Analyses of Single-Nucleotide Polymorphisms in the TNF Promoter Region Provide Further Validation for the Vervet Monkey Model of Obesity

PubMed Central

Gray, Stanton B; Howard, Timothy D; Langefeld, Carl D; Hawkins, Gregory A; Diallo, Abdoulaye F; Wagner, Janice D

2009-01-01

Tumor necrosis factor is a cytokine that plays critical roles in inflammation, the innate immune response, and a variety of other physiologic and pathophysiologic processes. In addition, TNF has recently been shown to mediate an intersection of chronic, low-grade inflammation and concurrent metabolic dysregulation associated with obesity and its comorbidities. As part of an ongoing initiative to further characterize vervet monkeys originating from St Kitts as an animal model of obesity and inflammation, we sequenced and genotyped the human ortholog vervet TNF gene and approximately 1 kb of the flanking 3′ and 5′ regions from 265 monkeys in a closed, pedigreed colony. This process revealed a total of 11 single-nucleotide polymorphisms (SNPs) and a single 4-bp insertion–deletion, with minor allele frequencies of 0.08 to 0.39. Many of these polymorphisms were in strong or complete linkage disequilibrium with each other, and all but 1 were contained within a single haplotype block, comprising 5 haplotypes with frequencies of 0.075 to 0.298. Using sequences from humans, chimpanzees, vervets, baboons, and rhesus macaques, phylogenetic shadowing of the TNF promoter region revealed that vervet SNPs, like the SNPs in related species, were clustered nonrandomly and nonuniformly around conserved transcription factor binding sites. These data, combined with previously defined heritable phenotypes, permit future association analyses in this nonhuman primate model and have great potential to help dissect the genetic and nongenetic contributions to complex diseases like obesity. More broadly, the sequence data and comparative analyses reported herein facilitates study of the evolution of regulatory sequences of inflammatory and immune-related genes. PMID:20034434

Characterization and Complete Nucleotide Sequence of an Unusual Reptilian Retrovirus Recovered from the Order Crocodylia

PubMed Central

Martin, Joanne; Kabat, Peter; Herniou, Elisabeth; Tristem, Michael

2002-01-01

A novel group of retroviruses found within the order Crocodylia are described. Phylogenetic analyses demonstrate that they are probably the most divergent members of the Retroviridae described to date; even the most conserved regions of Pol show an average of only 23% amino acid identity when compared to other retroviruses. PMID:11932432

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Genetic and physicochemical analyses of a novel ferret hepatitis E virus, and clinical signs of infection after birth.

PubMed

Li, Tian-Cheng; Yoshizaki, Sayaka; Kataoka, Michiyo; Ami, Yasushi; Suzaki, Yuriko; Doan, Yen Hai; Haga, Kei; Ishii, Koji; Takeda, Naokazu; Wakita, Takaji

2017-07-01

A novel cluster of five ferret hepatitis E virus (HEV) strains was detected from nine laboratory ferrets (Mustela putorius furo) imported from a ferret farm in the U.S. Our detection of ferret HEV RNA and anti-HEV antibodies, and alanine aminotransferase (ALT) value assessment indicated that all of the 9 ferrets were infected with ferret HEV, and that the infection exhibited three patterns: sub-clinical infection (n=2), acute hepatitis (n=6) and persistent infection (n=1). Next-generation sequence analyses of the entire genome sequences of the five strains revealed that their nucleotide sequence identities ranged from 99.5% to 99.9%, indicating that genetically similar ferret HEVs had been circulating at this the U.S. ferret farm. In contrast, the strains shared 82% and 89% nucleotide sequence identities with other ferret HEV that isolated from the Netherlands (JN998607) and the U.S. (AB890374), suggesting that these strains form a novel cluster of ferret HEV with diverse genomes depending on the region where their host. Particles with a diameter of ~35nm at a density of 1.201g/cm 3 were observed in the fecal specimens by electron microscopy. There was no evidence that the particles were associated with the cell membrane. The ferret HEV RNA was not constantly detected in urine, suggesting that the excretion of ferret HEV into urine is not a common feature of HEV infection. Copyright © 2017 Elsevier B.V. All rights reserved.

Genomic paradigms for food-borne enteric pathogen analysis at the USFDA: case studies highlighting method utility, integration and resolution.

PubMed

Elkins, C A; Kotewicz, M L; Jackson, S A; Lacher, D W; Abu-Ali, G S; Patel, I R

2013-01-01

Modern risk control and food safety practices involving food-borne bacterial pathogens are benefiting from new genomic technologies for rapid, yet highly specific, strain characterisations. Within the United States Food and Drug Administration (USFDA) Center for Food Safety and Applied Nutrition (CFSAN), optical genome mapping and DNA microarray genotyping have been used for several years to quickly assess genomic architecture and gene content, respectively, for outbreak strain subtyping and to enhance retrospective trace-back analyses. The application and relative utility of each method varies with outbreak scenario and the suspect pathogen, with comparative analytical power enhanced by database scale and depth. Integration of these two technologies allows high-resolution scrutiny of the genomic landscapes of enteric food-borne pathogens with notable examples including Shiga toxin-producing Escherichia coli (STEC) and Salmonella enterica serovars from a variety of food commodities. Moreover, the recent application of whole genome sequencing technologies to food-borne pathogen outbreaks and surveillance has enhanced resolution to the single nucleotide scale. This new wealth of sequence data will support more refined next-generation custom microarray designs, targeted re-sequencing and "genomic signature recognition" approaches involving a combination of genes and single nucleotide polymorphism detection to distil strain-specific fingerprinting to a minimised scale. This paper examines the utility of microarrays and optical mapping in analysing outbreaks, reviews best practices and the limits of these technologies for pathogen differentiation, and it considers future integration with whole genome sequencing efforts.

Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

PubMed

Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

2015-05-30

Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

PubMed

López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

2012-06-01

The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Substitution rate and natural selection in parvovirus B19

PubMed Central

Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.

2016-01-01

The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080

The genetic diversity and complete genome analysis of two novel porcine deltacoronavirus isolates in Thailand in 2015.

PubMed

Lorsirigool, Athip; Saeng-Chuto, Kepalee; Madapong, Adthakorn; Temeeyasen, Gun; Tripipat, Thitima; Kaewprommal, Pavita; Tantituvanont, Angkana; Piriyapongsa, Jittima; Nilubol, Dachrit

2017-04-01

Porcine deltacoronavirus (PDCoV) was identified in intestinal samples collected from piglets with diarrhea in Thailand in 2015. Two Thai PDCoV isolates, P23_15_TT_1115 and P24_15_NT1_1215, were isolated and identified. The full-length genome sequences of the P23_15_TT_1115 and P24_15_NT1_1215 isolates were 25,404 and 25,407 nucleotides in length, respectively, which were relatively shorter than that of US and China PDCoV. The phylogenetic analysis based on the full-length genome demonstrated that Thai PDCoV isolates form a new cluster separated from US and China PDCoV but relatively were more closely related to China PDCoV than US isolates. The genetic analyses demonstrated that Thai PDCoVs have 97.0-97.8 and 92.2-94.0% similarities with China PDCoV at nucleotide and amino acid levels, respectively, but share 97.1-97.3 and 92.5-93.0 similarity with US PDCoV at the nucleotide and amino acid levels, respectively. Thai PDCoV possesses two discontinuous deletions of five amino acids in ORF1a/b region. One additional deletion of one amino acid was identified in P23_15_TT_1115. The variation analyses demonstrated that six regions (nt 1317-1436, 2997-3096, 19,737-19,836, 20,277-20,376, 21,177-21,276, and 22,371-22,416) in ORF1a/b and spike genes exhibit high sequence variation between Thai and other PDCoV. The analyses of amino acid changes suggested that they could potentially be from different lineages.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Complete genomic sequence of an infectious pancreatic necrosis virus isolated from rainbow trout (Oncorhynchus mykiss) in China.

PubMed

Ji, Feng; Zhao, Jing-Zhuang; Liu, Miao; Lu, Tong-Yan; Liu, Hong-Bai; Yin, Jiasheng; Xu, Li-Ming

2017-04-01

Infectious pancreatic necrosis (IPN) is a significant disease of farmed salmonids resulting in direct economic losses due to high mortality in China. However, no gene sequence of any Chinese infectious pancreatic necrosis virus (IPNV) isolates was available. In the study, moribund rainbow trout fry samples were collected during an outbreak of IPN in Yunnan province of southwest China in 2013. An IPNV was isolated and tentatively named ChRtm213. We determined the full genome sequence of the IPNV ChRtm213 and compared it with previously identified IPNV sequences worldwide. The sequences of different structural and non-structural protein genes were compared to those of other aquatic birnaviruses sequenced to date. The results indicated that the complete genome sequence of ChRtm213 strain contains a segment A (3099 nucleotides) coding a polyprotein VP2-VP4-VP3, and a segment B (2789 nucleotides) coding a RNA-dependent RNA polymerase VP1. The phylogenetic analyses showed that ChRtm213 strain fell within genogroup 1, serotype A9 (Jasper), having similarities of 96.3% (segment A) and 97.3% (segment B) with the IPNV strain AM98 from Japan. The results suggest that the Chinese IPNV isolate has relative closer relationship with Japanese IPNV strains. The sequence of ChRtm213 was the first gene sequence of IPNV isolates in China. This study provided a robust reference for diagnosis and/or control of IPNV prevalent in China.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Using the TIGR gene index databases for biological discovery.

PubMed

Lee, Yuandan; Quackenbush, John

2003-11-01

The TIGR Gene Index web pages provide access to analyses of ESTs and gene sequences for nearly 60 species, as well as a number of resources derived from these. Each species-specific database is presented using a common format with a homepage. A variety of methods exist that allow users to search each species-specific database. Methods implemented currently include nucleotide or protein sequence queries using WU-BLAST, text-based searches using various sequence identifiers, searches by gene, tissue and library name, and searches using functional classes through Gene Ontology assignments. This protocol provides guidance for using the Gene Index Databases to extract information.

Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

PubMed Central

2012-01-01

Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411

Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli.

PubMed

Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada

2002-07-01

Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.

Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax

PubMed Central

Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

2018-01-01

Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes. PMID:29670636

Positive Selection Driving Cytoplasmic Genome Evolution of the Medicinally Important Ginseng Plant Genus Panax.

PubMed

Jiang, Peng; Shi, Feng-Xue; Li, Ming-Rui; Liu, Bao; Wen, Jun; Xiao, Hong-Xing; Li, Lin-Feng

2018-01-01

Panax L. (the ginseng genus) is a shade-demanding group within the family Araliaceae and all of its species are of crucial significance in traditional Chinese medicine. Phylogenetic and biogeographic analyses demonstrated that two rounds of whole genome duplications accompanying with geographic and ecological isolations promoted the diversification of Panax species. However, contributions of the cytoplasmic genomes to the adaptive evolution of Panax species remained largely uninvestigated. In this study, we sequenced the chloroplast and mitochondrial genomes of 11 accessions belonging to seven Panax species. Our results show that heterogeneity in nucleotide substitution rate is abundant in both of the two cytoplasmic genomes, with the mitochondrial genome possessing more variants at the total level but the chloroplast showing higher sequence polymorphisms at the genic regions. Genome-wide scanning of positive selection identified five and 12 genes from the chloroplast and mitochondrial genomes, respectively. Functional analyses further revealed that these selected genes play important roles in plant development, cellular metabolism and adaptation. We therefore conclude that positive selection might be one of the potential evolutionary forces that shaped nucleotide variation pattern of these Panax species. In particular, the mitochondrial genes evolved under stronger selective pressure compared to the chloroplast genes.

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

PubMed

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

A comparative analysis of exome capture.

PubMed

Parla, Jennifer S; Iossifov, Ivan; Grabill, Ian; Spector, Mona S; Kramer, Melissa; McCombie, W Richard

2011-09-29

Human exome resequencing using commercial target capture kits has been and is being used for sequencing large numbers of individuals to search for variants associated with various human diseases. We rigorously evaluated the capabilities of two solution exome capture kits. These analyses help clarify the strengths and limitations of those data as well as systematically identify variables that should be considered in the use of those data. Each exome kit performed well at capturing the targets they were designed to capture, which mainly corresponds to the consensus coding sequences (CCDS) annotations of the human genome. In addition, based on their respective targets, each capture kit coupled with high coverage Illumina sequencing produced highly accurate nucleotide calls. However, other databases, such as the Reference Sequence collection (RefSeq), define the exome more broadly, and so not surprisingly, the exome kits did not capture these additional regions. Commercial exome capture kits provide a very efficient way to sequence select areas of the genome at very high accuracy. Here we provide the data to help guide critical analyses of sequencing data derived from these products.

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Isolation and molecular identification of Sunshine virus, a novel paramyxovirus found in Australian snakes.

PubMed

Hyndman, Timothy H; Marschang, Rachel E; Wellehan, James F X; Nicholls, Philip K

2012-10-01

This paper describes the isolation and molecular identification of a novel paramyxovirus found during an investigation of an outbreak of neurorespiratory disease in a collection of Australian pythons. Using Illumina® high-throughput sequencing, a 17,187 nucleotide sequence was assembled from RNA extracts from infected viper heart cells (VH2) displaying widespread cytopathic effects in the form of multinucleate giant cells. The sequence appears to contain all the coding regions of the genome, including the following predicted paramyxoviral open reading frames (ORFs): 3'--Nucleocapsid (N)--putative Phosphoprotein (P)--Matrix (M)--Fusion (F)--putative attachment protein--Polymerase (L)--5'. There is also a 540 nucleotide ORF between the N and putative P genes that may be an additional coding region. Phylogenetic analyses of the complete N, M, F and L genes support the clustering of this virus within the family Paramyxoviridae but outside both of the current subfamilies: Paramyxovirinae and Pneumovirinae. We propose to name this new virus, Sunshine virus, after the geographic origin of the first isolate--the Sunshine Coast of Queensland, Australia. Copyright © 2012 Elsevier B.V. All rights reserved.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Phylogeny and evolution of plant cyclic nucleotide-gated ion channel (CNGC) gene family and functional analyses of tomato CNGCs

PubMed Central

Saand, Mumtaz Ali; Xu, You-Ping; Munyampundu, Jean-Pierre; Li, Wen; Zhang, Xuan-Rui; Cai, Xin-Zhong

2015-01-01

Cyclic nucleotide-gated ion channels (CNGCs) are calcium-permeable channels that are involved in various biological functions. Nevertheless, phylogeny and function of plant CNGCs are not well understood. In this study, 333 CNGC genes from 15 plant species were identified using comprehensive bioinformatics approaches. Extensive bioinformatics analyses demonstrated that CNGCs of Group IVa were distinct to those of other groups in gene structure and amino acid sequence of cyclic nucleotide-binding domain. A CNGC-specific motif that recognizes all identified plant CNGCs was generated. Phylogenetic analysis indicated that CNGC proteins of flowering plant species formed five groups. However, CNGCs of the non-vascular plant Physcomitrella patens clustered only in two groups (IVa and IVb), while those of the vascular non-flowering plant Selaginella moellendorffii gathered in four (IVa, IVb, I and II). These data suggest that Group IV CNGCs are most ancient and Group III CNGCs are most recently evolved in flowering plants. Furthermore, silencing analyses revealed that a set of CNGC genes might be involved in disease resistance and abiotic stress responses in tomato and function of SlCNGCs does not correlate with the group that they are belonging to. Our results indicate that Group IVa CNGCs are structurally but not functionally unique among plant CNGCs. PMID:26546226

Genetic structure and genealogy in the Sphagnum subsecundum complex (Sphagnaceae: Bryophyta).

PubMed

Shaw, A J; Pokorny, L; Shaw, B; Ricca, M; Boles, S; Szövényi, P

2008-10-01

Allopolyploidy is probably the most extensively studied mode of plant speciation and allopolyploid species appear to be common in the mosses (Bryophyta). The Sphagnum subsecundum complex includes species known to be gametophytically haploid or diploid, and it has been proposed that the diploids (i.e., with tetraploid sporophytes) are allopolyploids. Nucleotide sequence and microsatellite variation among haploids and diploids from Newfoundland and Scandinavia indicate that (1) the diploids exhibit fixed or nearly fixed heterozygosity at the majority of loci sampled, and are clearly allopolyploids, (2) diploids originated independently in North America and Europe, (3) the European diploids appear to have the haploid species, S. subsecundum, as the maternal parent based on shared chloroplast DNA haplotypes, (4) the North American diploids do not have the chloroplast DNA of any sampled haploid, (5) both North American and European diploids share nucleotide and microsatellite similarities with S. subsecundum, (6) the diploids harbor more nucleotide and microsatellite diversity than the haploids, and (7) diploids exhibit higher levels of linkage disequilibrium among microsatellite loci. An experiment demonstrates significant artifactual recombination between interspecific DNAs coamplified by PCR, which may be a complicating factor in the interpretation of sequence-based analyses of allopolyploids.

Molecular evidence of father-to-child transmission of hepatitis B virus.

PubMed

Tajiri, Hitoshi; Tanaka, Yasuhito; Kagimoto, Seiiti; Murakami, Jun; Tokuhara, Daisuke; Mizokami, Masashi

2007-07-01

At present in Japan, only high-risk infants born to chronic hepatitis B virus (HBV)-infected mothers are given HBV vaccine. However, children can contract the virus from other HBV-infected family members, including fathers. The aim of this study is to present substantial and unequivocal evidence of father-to-child transmission of HBV infection using techniques including homology analysis and phylogenetic analysis. Thirteen chronic HBV-infected members of five families that included eight children and their respective fathers were enrolled in this study. Homology analysis and phylogenetic analyses of 2 coding region, the S gene and X gene, from the HBV genome were performed comparing the 13 nucleotide sequences from the 13 subjects. The nucleotide homology among the five sets of fathers and children was quite high (99.3-100%). A phylogenetic tree constructed on the 13 nucleotide sequences showed that all 5 sets of fathers and children were grouped into the same cluster with high bootstrap values. These results strongly indicate that father-to-child transmission is an important route of HBV infection in Japan and it is recommend that universal vaccination against HBV infection be instituted immediately in Japan for all children, in accordance with the WHO recommendation of 1997.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Identification of novel microRNAs in Hevea brasiliensis and computational prediction of their targets

PubMed Central

2012-01-01

Background Plants respond to external stimuli through fine regulation of gene expression partially ensured by small RNAs. Of these, microRNAs (miRNAs) play a crucial role. They negatively regulate gene expression by targeting the cleavage or translational inhibition of target messenger RNAs (mRNAs). In Hevea brasiliensis, environmental and harvesting stresses are known to affect natural rubber production. This study set out to identify abiotic stress-related miRNAs in Hevea using next-generation sequencing and bioinformatic analysis. Results Deep sequencing of small RNAs was carried out on plantlets subjected to severe abiotic stress using the Solexa technique. By combining the LeARN pipeline, data from the Plant microRNA database (PMRD) and Hevea EST sequences, we identified 48 conserved miRNA families already characterized in other plant species, and 10 putatively novel miRNA families. The results showed the most abundant size for miRNAs to be 24 nucleotides, except for seven families. Several MIR genes produced both 20-22 nucleotides and 23-27 nucleotides. The two miRNA class sizes were detected for both conserved and putative novel miRNA families, suggesting their functional duality. The EST databases were scanned with conserved and novel miRNA sequences. MiRNA targets were computationally predicted and analysed. The predicted targets involved in "responses to stimuli" and to "antioxidant" and "transcription activities" are presented. Conclusions Deep sequencing of small RNAs combined with transcriptomic data is a powerful tool for identifying conserved and novel miRNAs when the complete genome is not yet available. Our study provided additional information for evolutionary studies and revealed potentially specific regulation of the control of redox status in Hevea. PMID:22330773

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.

PubMed

Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai

2018-01-09

Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of LDH as a therapeutic drug target.

Genome-wide-analyses of Listeria monocytogenes from food-processing plants reveal clonal diversity and date the emergence of persisting sequence types.

PubMed

Knudsen, Gitte M; Nielsen, Jesper Boye; Marvig, Rasmus L; Ng, Yin; Worning, Peder; Westh, Henrik; Gram, Lone

2017-08-01

Whole genome sequencing is increasing used in epidemiology, e.g. for tracing outbreaks of food-borne diseases. This requires in-depth understanding of pathogen emergence, persistence and genomic diversity along the food production chain including in food processing plants. We sequenced the genomes of 80 isolates of Listeria monocytogenes sampled from Danish food processing plants over a time-period of 20 years, and analysed the sequences together with 10 public available reference genomes to advance our understanding of interplant and intraplant genomic diversity of L. monocytogenes. Except for three persisting sequence types (ST) based on Multi Locus Sequence Typing being ST7, ST8 and ST121, long-term persistence of clonal groups was limited, and new clones were introduced continuously, potentially from raw materials. No particular gene could be linked to the persistence phenotype. Using time-based phylogenetic analyses of the persistent STs, we estimate the L. monocytogenes evolutionary rate to be 0.18-0.35 single nucleotide polymorphisms/year, suggesting that the persistent STs emerged approximately 100 years ago, which correlates with the onset of industrialization and globalization of the food market. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

The Neandertal genome and ancient DNA authenticity

PubMed Central

Green, Richard E; Briggs, Adrian W; Krause, Johannes; Prüfer, Kay; Burbano, Hernán A; Siebauer, Michael; Lachmann, Michael; Pääbo, Svante

2009-01-01

Recent advances in high-thoughput DNA sequencing have made genome-scale analyses of genomes of extinct organisms possible. With these new opportunities come new difficulties in assessing the authenticity of the DNA sequences retrieved. We discuss how these difficulties can be addressed, particularly with regard to analyses of the Neandertal genome. We argue that only direct assays of DNA sequence positions in which Neandertals differ from all contemporary humans can serve as a reliable means to estimate human contamination. Indirect measures, such as the extent of DNA fragmentation, nucleotide misincorporations, or comparison of derived allele frequencies in different fragment size classes, are unreliable. Fortunately, interim approaches based on mtDNA differences between Neandertals and current humans, detection of male contamination through Y chromosomal sequences, and repeated sequencing from the same fossil to detect autosomal contamination allow initial large-scale sequencing of Neandertal genomes. This will result in the discovery of fixed differences in the nuclear genome between Neandertals and current humans that can serve as future direct assays for contamination. For analyses of other fossil hominins, which may become possible in the future, we suggest a similar ‘boot-strap' approach in which interim approaches are applied until sufficient data for more definitive direct assays are acquired. PMID:19661919

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Hepatitis a virus genotypes and strains from an endemic area of Europe, Bulgaria 2012-2014.

PubMed

Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Cella, Eleonora; Lo Presti, Alessandra; Costantino, Angela; Chionne, Paola; Madonna, Elisabetta; Golkocheva-Markova, Elitsa; Bankova, Diljana; Ciccozzi, Massimo; Teoharov, Pavel; Ciccaglione, Anna Rita

2017-07-14

Hepatitis A virus (HAV) infection is endemic in Eastern European and Balkan region countries. In 2012, Bulgaria showed the highest rate (67.13 cases per 100,000) in Europe. Nevertheless, HAV genotypes and strains circulating in this country have never been described. The present study reports the molecular characterization of HAV from 105 patients from Bulgaria. Anti-HAV IgM positive serum samples collected in 2012-2014 from different towns and villages in Bulgaria were analysed by nested RT-PCR, sequencing of the VP1/2A region and phylogenetic analysis; the results were analysed together with patient and geographical data. Phylogenetic analysis revealed two main sequence groups corresponding to the IA (78/105, 74%) and IB (27/105, 26%) sub-genotypes. In the IA group, a major and a minor cluster were observed (62 and 16 sequences, respectively). Most sequences from the major cluster (44/62, 71%) belonged to either of two strains, termed "strain 1" and "strain 2", differing only for a single specific nucleotide; the remaining sequences (18/62, 29%) showed few (1 to 4) nucleotide variations respect to strain 1 and 2. Strain 2 is identical to the strain previously responsible for an outbreak in the Czech Republic in 2008 and a large multi-country European outbreak caused by contaminated mixed frozen berries in 2013. Most sequences of the IA minor cluster and the IB group were detected in large/medium centers (LMCs). Overall, sequences from the IA major cluster were more frequent in small centers (SCs), but strain 1 and strain 2 showed an opposite relative frequency in SCs and LMCs (strain 1 more frequent in SCs, strain 2 in LMCs). Genotype IA predominated in Bulgaria in 2012-2014 and phylogenetic analysis identified a major cluster of highly related or identical IA sequences, representing 59% of the analysed cases; these isolates were mostly detected in SCs, in which HAV shows higher endemicity than in LMCs. The distribution of viral sequences suggests the existence of some differences between the transmission routes in SCs and LMCs. Molecular characterization of an increased number of isolates from Bulgaria, regularly collected over time, will be useful to explore specific transmission routes and plan appropriate preventing measures.

Defining objective clusters for rabies virus sequences using affinity propagation clustering

PubMed Central

Fischer, Susanne; Freuling, Conrad M.; Pfaff, Florian; Bodenhofer, Ulrich; Höper, Dirk; Fischer, Mareike; Marston, Denise A.; Fooks, Anthony R.; Mettenleiter, Thomas C.; Conraths, Franz J.; Homeier-Bachmann, Timo

2018-01-01

Rabies is caused by lyssaviruses, and is one of the oldest known zoonoses. In recent years, more than 21,000 nucleotide sequences of rabies viruses (RABV), from the prototype species rabies lyssavirus, have been deposited in public databases. Subsequent phylogenetic analyses in combination with metadata suggest geographic distributions of RABV. However, these analyses somewhat experience technical difficulties in defining verifiable criteria for cluster allocations in phylogenetic trees inviting for a more rational approach. Therefore, we applied a relatively new mathematical clustering algorythm named ‘affinity propagation clustering’ (AP) to propose a standardized sub-species classification utilizing full-genome RABV sequences. Because AP has the advantage that it is computationally fast and works for any meaningful measure of similarity between data samples, it has previously been applied successfully in bioinformatics, for analysis of microarray and gene expression data, however, cluster analysis of sequences is still in its infancy. Existing (516) and original (46) full genome RABV sequences were used to demonstrate the application of AP for RABV clustering. On a global scale, AP proposed four clusters, i.e. New World cluster, Arctic/Arctic-like, Cosmopolitan, and Asian as previously assigned by phylogenetic studies. By combining AP with established phylogenetic analyses, it is possible to resolve phylogenetic relationships between verifiably determined clusters and sequences. This workflow will be useful in confirming cluster distributions in a uniform transparent manner, not only for RABV, but also for other comparative sequence analyses. PMID:29357361

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

PubMed

Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

2016-01-01

Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

Within-Host Variations of Human Papillomavirus Reveal APOBEC Signature Mutagenesis in the Viral Genome.

PubMed

Hirose, Yusuke; Onuki, Mamiko; Tenjimbayashi, Yuri; Mori, Seiichiro; Ishii, Yoshiyuki; Takeuchi, Takamasa; Tasaka, Nobutaka; Satoh, Toyomi; Morisada, Tohru; Iwata, Takashi; Miyamoto, Shingo; Matsumoto, Koji; Sekizawa, Akihiko; Kukimoto, Iwao

2018-06-15

Persistent infection with oncogenic human papillomaviruses (HPVs) causes cervical cancer, accompanied by the accumulation of somatic mutations into the host genome. There are concomitant genetic changes in the HPV genome during viral infection; however, their relevance to cervical carcinogenesis is poorly understood. Here, we explored within-host genetic diversity of HPV by performing deep-sequencing analyses of viral whole-genome sequences in clinical specimens. The whole genomes of HPV types 16, 52, and 58 were amplified by type-specific PCR from total cellular DNA of cervical exfoliated cells collected from patients with cervical intraepithelial neoplasia (CIN) and invasive cervical cancer (ICC) and were deep sequenced. After constructing a reference viral genome sequence for each specimen, nucleotide positions showing changes with >0.5% frequencies compared to the reference sequence were determined for individual samples. In total, 1,052 positions of nucleotide variations were detected in HPV genomes from 151 samples (CIN1, n = 56; CIN2/3, n = 68; ICC, n = 27), with various numbers per sample. Overall, C-to-T and C-to-A substitutions were the dominant changes observed across all histological grades. While C-to-T transitions were predominantly detected in CIN1, their prevalence was decreased in CIN2/3 and fell below that of C-to-A transversions in ICC. Analysis of the trinucleotide context encompassing substituted bases revealed that TpCpN, a preferred target sequence for cellular APOBEC cytosine deaminases, was a primary site for C-to-T substitutions in the HPV genome. These results strongly imply that the APOBEC proteins are drivers of HPV genome mutation, particularly in CIN1 lesions. IMPORTANCE HPVs exhibit surprisingly high levels of genetic diversity, including a large repertoire of minor genomic variants in each viral genotype. Here, by conducting deep-sequencing analyses, we show for the first time a comprehensive snapshot of the within-host genetic diversity of high-risk HPVs during cervical carcinogenesis. Quasispecies harboring minor nucleotide variations in viral whole-genome sequences were extensively observed across different grades of CIN and cervical cancer. Among the within-host variations, C-to-T transitions, a characteristic change mediated by cellular APOBEC cytosine deaminases, were predominantly detected throughout the whole viral genome, most strikingly in low-grade CIN lesions. The results strongly suggest that within-host variations of the HPV genome are primarily generated through the interaction with host cell DNA-editing enzymes and that such within-host variability is an evolutionary source of the genetic diversity of HPVs. Copyright © 2018 American Society for Microbiology.

The genetic landscape of paediatric de novo acute myeloid leukaemia as defined by single nucleotide polymorphism array and exon sequencing of 100 candidate genes.

PubMed

Olsson, Linda; Zettermark, Sofia; Biloglav, Andrea; Castor, Anders; Behrendtz, Mikael; Forestier, Erik; Paulsson, Kajsa; Johansson, Bertil

2016-07-01

Cytogenetic analyses of a consecutive series of 67 paediatric (median age 8 years; range 0-17) de novo acute myeloid leukaemia (AML) patients revealed aberrations in 55 (82%) cases. The most common subgroups were KMT2A rearrangement (29%), normal karyotype (15%), RUNX1-RUNX1T1 (10%), deletions of 5q, 7q and/or 17p (9%), myeloid leukaemia associated with Down syndrome (7%), PML-RARA (7%) and CBFB-MYH11 (5%). Single nucleotide polymorphism array (SNP-A) analysis and exon sequencing of 100 genes, performed in 52 and 40 cases, respectively (39 overlapping), revealed ≥1 aberration in 89%; when adding cytogenetic data, this frequency increased to 98%. Uniparental isodisomies (UPIDs) were detected in 13% and copy number aberrations (CNAs) in 63% (median 2/case); three UPIDs and 22 CNAs were recurrent. Twenty-two genes were targeted by focal CNAs, including AEBP2 and PHF6 deletions and genes involved in AML-associated gene fusions. Deep sequencing identified mutations in 65% of cases (median 1/case). In total, 60 mutations were found in 30 genes, primarily those encoding signalling proteins (47%), transcription factors (25%), or epigenetic modifiers (13%). Twelve genes (BCOR, CEBPA, FLT3, GATA1, KIT, KRAS, NOTCH1, NPM1, NRAS, PTPN11, SMC3 and TP53) were recurrently mutated. We conclude that SNP-A and deep sequencing analyses complement the cytogenetic diagnosis of paediatric AML. © 2016 John Wiley & Sons Ltd.

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

PubMed

Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

2003-10-01

The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China

PubMed Central

Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man

2017-01-01

Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Infection of Taenia asiatica in a Bai Person in Dali, China.

PubMed

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-02-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica.

Infection of Taenia asiatica in a Bai Person in Dali, China

PubMed Central

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-01-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica. PMID:26951981

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

PubMed Central

2014-01-01

Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of highly divergent lineages that are frequently distributed in South America and Asia and diversified rapidly. PMID:24472213

Co-circulation of a novel phlebovirus and Massilia virus in sandflies, Portugal.

PubMed

Amaro, Fátima; Zé-Zé, Líbia; Alves, Maria J; Börstler, Jessica; Clos, Joachim; Lorenzen, Stephan; Becker, Stefanie Christine; Schmidt-Chanasit, Jonas; Cadar, Daniel

2015-10-24

In Portugal, entomological surveys to detect phleboviruses in their natural vectors have not been performed so far. Thus, the aims of the present study were to detect, isolate and characterize phleboviruses in sandfly populations of Portugal. From May to October 2007-2008, 896 female sandflies were trapped in Arrábida region, located on the southwest coast of Portugal. Phlebovirus RNA was detected by using a pan-phlebovirus RT-PCR in 4 out of 34 Phlebotomus perniciosus pools. Direct sequencing of the amplicons showed that 2 samples exhibited 72 % nucleotide identity with Arbia virus, and two showed 96 % nucleotide identity with Massilia virus. The Arbia-like virus (named Alcube virus) was isolated in cell culture and complete genomic sequences of one Alcube and two Massila viruses were determined using next-generation sequencing technology. Phylogenetic analysis demonstrated that Alcube virus clustered with members of the Salehabad virus species complex. Within this clade, Alcube virus forms a monophyletic lineage with the Arbia, Salehabad and Adana viruses sharing a common ancestor. Arbia virus has been identified as the most closely related virus with 20-28 % nucleotide and 10-27 % amino acid divergences depending on the analysed segment. We have provided genetic evidence for the circulation of a novel phlebovirus species named Alcube virus in Ph. perniciosus and co-circulation of Massilia virus, in Arrábida region, southwest of Portugal. Further epidemiological investigations and surveillance for sandfly-borne phleboviruses in Portugal are needed to elucidate their medical importance.

RNA editing in the anticodon of tRNA Leu (CAA) occurs before group I intron splicing in plastids of a moss Takakia lepidozioides S. Hatt. & Inoue.

PubMed

Miyata, Y; Sugita, C; Maruyama, K; Sugita, M

2008-03-01

RNA editing of cytidine (C) to uridine (U) transitions occurs in plastids and mitochondria of most land plants. In this study, we amplified and sequenced the group I intron-containing tRNA Leu gene, trnL-CAA, from Takakia lepidozioides, a moss. DNA sequence analysis revealed that the T. lepidozioides tRNA Leu gene consisted of a 35-bp 5' exon, a 469-bp group I intron and a 50-bp 3' exon. The intron was inserted between the first and second position of the tRNA Leu anticodon. In general, plastid tRNA Leu genes with a group I intron code for a TAA anticodon in most land plants. This strongly suggests that the first nucleotide of the CAA anticodon could be edited in T. lepidozioides plastids. To investigate this possibility, we analysed cDNAs derived from the trnL-CAA transcripts. We demonstrated that the first nucleotide C of the anticodon was edited to create a canonical UAA anticodon in T. lepidozioides plastids. cDNA sequencing analyses of the spliced or unspliced tRNA Leu transcripts revealed that, while the spliced tRNA was completely edited, editing in the unspliced tRNAs were only partial. This is the first experimental evidence that the anticodon editing of tRNA occurs before RNA splicing in plastids. This suggests that this editing is a prerequisite to splicing of pre-tRNA Leu.

Comparative analyses of the mitochondrial genome of the sheep ked Melophagus ovinus (Diptera: Hippoboscidae) from different geographical origins in China.

PubMed

Tang, Jia-Min; Li, Fen; Cheng, Tian-Yin; Duan, De-Yong; Liu, Guo-Hua

2018-05-22

The sheep ked Melophagus ovinus is mainly found in Europe, Northwestern Africa, and Asia. Although M. ovinus is an important ectoparasite of sheep in many countries, the population genetics, molecular biology, and systematics of this ectoparasite remain poorly understood. Herein, we determined the mitochondrial (mt) genome of M. ovinus from Gansu Province, China (MOG) and compared with that of M. ovinus Xinjiang Uygur Autonomous Region, China (MOX). The mt genome sequence (15,044 bp) of M. ovinus MOG was significantly shorter (529 bp) than M. ovinus MOX. Nucleotide sequence difference in the whole mt genome except for non-coding region was 0.37% between M. ovinus MOG and MOX. For the 13 protein-coding genes, comparison revealed sequence divergences at both the nucleotide (0-1.1%) and amino acid (0-0.59%) levels between M. ovinus MOG and MOX, respectively. Interestingly, the cox1 gene of M. ovinus MOX is predicted to employ unusual mt start codons AAA, which has not been predicted previously for any parasite genome. Phylogenetic analyses showed that M. ovinus (Hippoboscoidea) is related to the superfamilies Oestroidea + Muscoidea. Our results have also indicated the paraphylies of the four families (Anthomyiidae, Calliphoridae, Muscidae, and Oestridae) and two superfamilies (Oestroidea and Muscoidea). This mt genome of M. ovinus provides useful molecular markers for studies into the population genetics, molecular biology, and systematics of this ectoparasite.

The GC-rich mitochondrial and plastid genomes of the green alga Coccomyxa give insight into the evolution of organelle DNA nucleotide landscape

DOE PAGES

Smith, David Roy; Burki, Fabien; Yamada, Takashi; ...

2011-08-26

Here, most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features ofmore » this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.« less

Structure of yeast Argonaute with guide RNA

PubMed Central

Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

2012-01-01

The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

Geographic Distribution of Hantaviruses Associated with Neotomine and Sigmodontine Rodents, Mexico

PubMed Central

Milazzo, Mary L.; Cajimat, Maria N.B.; Romo, Hannah E.; Estrada-Franco, Jose G.; Iñiguez-Dávalos, L. Ignacio; Bradley, Robert D.

2012-01-01

To increase our knowledge of the geographic distribution of hantaviruses associated with neotomine or sigmodontine rodents in Mexico, we tested 876 cricetid rodents captured in 18 Mexican states (representing at least 44 species in the subfamily Neotominae and 10 species in the subfamily Sigmodontinae) for anti-hantavirus IgG. We found antibodies against hantavirus in 35 (4.0%) rodents. Nucleotide sequence data from 5 antibody-positive rodents indicated that Sin Nombre virus (the major cause of hantavirus pulmonary syndrome [HPS] in the United States) is enzootic in the Mexican states of Nuevo León, San Luis Potosí, Tamaulipas, and Veracruz. However, HPS has not been reported from these states, which suggests that in northeastern Mexico, HPS has been confused with other rapidly progressive, life-threatening respiratory diseases. Analyses of nucleotide sequence data from 19 other antibody-positive rodents indicated that El Moro Canyon virus and Limestone Canyon virus are geographically widely distributed in Mexico. PMID:22469569

The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, David Roy; Burki, Fabien; Yamada, Takashi

2011-05-13

Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of thismore » species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.« less

An analytical framework for whole-genome sequence association studies and its implications for autism spectrum disorder.

PubMed

Werling, Donna M; Brand, Harrison; An, Joon-Yong; Stone, Matthew R; Zhu, Lingxue; Glessner, Joseph T; Collins, Ryan L; Dong, Shan; Layer, Ryan M; Markenscoff-Papadimitriou, Eirene; Farrell, Andrew; Schwartz, Grace B; Wang, Harold Z; Currall, Benjamin B; Zhao, Xuefang; Dea, Jeanselle; Duhn, Clif; Erdman, Carolyn A; Gilson, Michael C; Yadav, Rachita; Handsaker, Robert E; Kashin, Seva; Klei, Lambertus; Mandell, Jeffrey D; Nowakowski, Tomasz J; Liu, Yuwen; Pochareddy, Sirisha; Smith, Louw; Walker, Michael F; Waterman, Matthew J; He, Xin; Kriegstein, Arnold R; Rubenstein, John L; Sestan, Nenad; McCarroll, Steven A; Neale, Benjamin M; Coon, Hilary; Willsey, A Jeremy; Buxbaum, Joseph D; Daly, Mark J; State, Matthew W; Quinlan, Aaron R; Marth, Gabor T; Roeder, Kathryn; Devlin, Bernie; Talkowski, Michael E; Sanders, Stephan J

2018-05-01

Genomic association studies of common or rare protein-coding variation have established robust statistical approaches to account for multiple testing. Here we present a comparable framework to evaluate rare and de novo noncoding single-nucleotide variants, insertion/deletions, and all classes of structural variation from whole-genome sequencing (WGS). Integrating genomic annotations at the level of nucleotides, genes, and regulatory regions, we define 51,801 annotation categories. Analyses of 519 autism spectrum disorder families did not identify association with any categories after correction for 4,123 effective tests. Without appropriate correction, biologically plausible associations are observed in both cases and controls. Despite excluding previously identified gene-disrupting mutations, coding regions still exhibited the strongest associations. Thus, in autism, the contribution of de novo noncoding variation is probably modest in comparison to that of de novo coding variants. Robust results from future WGS studies will require large cohorts and comprehensive analytical strategies that consider the substantial multiple-testing burden.

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease

PubMed Central

Zhang, Peipei; Liu, Yan; Liu, Wenwen; Cao, Mengji; Massart, Sebastien; Wang, Xifeng

2017-01-01

To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV) (most likely pathogens) using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV). The full genome of WLYaV corresponds to 5,772 nucleotides (nt), with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV), but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP) were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90%) in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat. PMID:28932215

Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease.

PubMed

Zhang, Peipei; Liu, Yan; Liu, Wenwen; Cao, Mengji; Massart, Sebastien; Wang, Xifeng

2017-01-01

To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV) (most likely pathogens) using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV). The full genome of WLYaV corresponds to 5,772 nucleotides (nt), with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae . Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV), but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP) were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90%) in the family Luteoviridae . Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

Infectious hematopoietic necrosis virus: monophyletic origin of European isolates from North American genogroup M.

PubMed

Enzmann, P J; Kurath, G; Fichtner, D; Bergmann, S M

2005-09-23

Infectious hematopoietic necrosis virus (IHNV) was first detected in Europe in 1987 in France and Italy, and later, in 1992, in Germany. The source of the virus and the route of introduction are unknown. The present study investigates the molecular epidemiology of IHNV outbreaks in Germany since its first introduction. The complete nucleotide sequences of the glycoprotein (G) and non-virion (NV) genes from 9 IHNV isolates from Germany have been determined, and this has allowed the identification of characteristic differences between these isolates. Phylogenetic analysis of partial G gene sequences (mid-G, 303 nucleotides) from North American IHNV isolates (Kurath et al. 2003) has revealed 3 major genogroups, designated U, M and L. Using this gene region with 2 different North American IHNV data sets, it was possible to group the European IHNV strains within the M genogroup, but not in any previously defined subgroup. Analysis of the full length G gene sequences indicated that an independent evolution of IHN viruses had occurred in Europe. IHN viruses in Europe seem to be of a monophyletic origin, again most closely related to North American isolates in the M genogroup. Analysis of the NV gene sequences also showed the European isolates to be monophyletic, but resolution of the 3 genogroups was poor with this gene region. As a result of comparative sequence analyses, several different genotypes have been identified circulating in Europe.

Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

PubMed Central

Song, Wen Jun; Qin, Qi Wei; Qiu, Jin; Huang, Can Hua; Wang, Fan; Hew, Choy Leong

2004-01-01

Here we report the complete genome sequence of Singapore grouper iridovirus (SGIV). Sequencing of the random shotgun and restriction endonuclease genomic libraries showed that the entire SGIV genome consists of 140,131 nucleotide bp. One hundred sixty-two open reading frames (ORFs) from the sense and antisense DNA strands, coding for lengths varying from 41 to 1,268 amino acids, were identified. Computer-assisted analyses of the deduced amino acid sequences revealed that 77 of the ORFs exhibited homologies to known virus genes, 23 of which matched functional iridovirus proteins. Forty-two putative conserved domains or signatures were detected in the National Center for Biotechnology Information CD-Search database and PROSITE database. An assortment of enzyme activities involved in DNA replication, transcription, nucleotide metabolism, cell signaling, etc., were identified. Viruses were cultured on a cell line derived from the embryonated egg of the grouper Epinephelus tauvina, isolated, and purified by sucrose gradient ultracentrifugation. The protein extract from the purified virions was analyzed by polyacrylamide gel electrophoresis followed by in-gel digestion of protein bands. Matrix-assisted laser desorption ionization-time of flight mass spectrometry and database searching led to identification of 26 proteins. Twenty of these represented novel or previously unidentified genes, which were further confirmed by reverse transcription-PCR (RT-PCR) and DNA sequencing of their respective RT-PCR products. PMID:15507645

DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria

PubMed Central

Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho

2016-01-01

DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256

Rabbit haemorrhagic disease virus 2 (RHDV2) outbreak in Azores: Disclosure of common genetic markers and phylogenetic segregation within the European strains.

PubMed

Duarte, Margarida; Carvalho, Carina; Bernardo, Susana; Barros, Sílvia Vanessa; Benevides, Sandra; Flor, Lídia; Monteiro, Madalena; Marques, Isabel; Henriques, Margarida; Barros, Sílvia C; Fagulha, Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

2015-10-01

Rabbit haemorrhagic disease virus 2 (RHDV2) is widespread in several countries of Western Europe, but it has not been introduced to other continents. However, between late 2014 and early 2015, the presence of RHDV2 was confirmed outside of the European continent, in the Azores, initially in the islands of Graciosa, Flores, S. Jorge and Terceira. In this study we report the subsequent detection of RHDV2 in wild rabbits from the islands of Faial, St. Maria and S. Miguel, and display the necropsy and microscopic examination data obtained, which showed lesions similar to those induced by classical strains of RHDV, with severe affection of lungs and liver. We also disclose the result of a genetic investigation carried out with RHDV2 positive samples from wild rabbits found dead in the seven islands. Partial vp60 sequences were amplified from 27 tissue samples. Nucleotide analysis showed that the Azorean strains are closely related to each other, sharing a high genetic identity (>99.15%). None of the obtained sequences were identical to any RHDV2 sequence publically known, hampering a clue for the source of the outbreaks. However, Bayesian and maximum likelihood phylogenetic analyses disclosed that Azorean strains are more closely related to a few strains from Southern Portugal than with any others presently known. In the analysed region comprising the terminal 942 nucleotides of the vp60 gene, four new single nucleotide polymorphisms (SNP) were identified. Based on the present data, these four SNPs, which are unique in the strains from Azores, may constitute putative molecular geographic markers for Azorean RHDV2 strains, if they persist in the future. One of these variations is a non-synonymous substitution that involves the replacement of one amino acid in a hypervariable region of the capsid protein. Copyright © 2015 Elsevier B.V. All rights reserved.

Primary and secondary structural analyses of glutathione S-transferase pi from human placenta.

PubMed

Ahmad, H; Wilson, D E; Fritz, R R; Singh, S V; Medh, R D; Nagle, G T; Awasthi, Y C; Kurosky, A

1990-05-01

The primary structure of glutathione S-transferase (GST) pi from a single human placenta was determined. The structure was established by chemical characterization of tryptic and cyanogen bromide peptides as well as automated sequence analysis of the intact enzyme. The structural analysis indicated that the protein is comprised of 209 amino acid residues and gave no evidence of post-translational modifications. The amino acid sequence differed from that of the deduced amino acid sequence determined by nucleotide sequence analysis of a cDNA clone (Kano, T., Sakai, M., and Muramatsu, M., 1987, Cancer Res. 47, 5626-5630) at position 104 which contained both valine and isoleucine whereas the deduced sequence from nucleotide sequence analysis identified only isoleucine at this position. These results demonstrated that in the one individual placenta studied at least two GST pi genes are coexpressed, probably as a result of allelomorphism. Computer assisted consensus sequence evaluation identified a hydrophobic region in GST pi (residues 155-181) that was predicted to be either a buried transmembrane helical region or a signal sequence region. The significance of this hydrophobic region was interpreted in relation to the mode of action of the enzyme especially in regard to the potential involvement of a histidine in the active site mechanism. A comparison of the chemical similarity of five known human GST complete enzyme structures, one of pi, one of mu, two of alpha, and one microsomal, gave evidence that all five enzymes have evolved by a divergent evolutionary process after gene duplication, with the microsomal enzyme representing the most divergent form.

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

PubMed

Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

2016-10-21

An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.

PubMed

Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A

2016-06-01

Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.

Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

PubMed

Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

2016-06-01

Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

Diagnosis of skin cancer by correlation and complexity analyses of damaged DNA

PubMed Central

Namazi, Hamidreza; Kulish, Vladimir V.; Delaviz, Fatemeh; Delaviz, Ali

2015-01-01

Skin cancer is a common, low-grade cancerous (malignant) growth of the skin. It starts from cells that begin as normal skin cells and transform into those with the potential to reproduce in an out-of-control manner. Cancer develops when DNA, the molecule found in cells that encodes genetic information, becomes damaged and the body cannot repair the damage. A DNA walk of a genome represents how the frequency of each nucleotide of a pairing nucleotide couple changes locally. In this research in order to diagnose the skin cancer, first DNA walk plots of genomes of patients with skin cancer were generated. Then, the data so obtained was checked for complexity by computing the fractal dimension. Furthermore, the Hurst exponent has been employed in order to study the correlation of damaged DNA. By analysing different samples it has been found that the damaged DNA sequences are exhibiting higher degree of complexity and less correlation compared to normal DNA sequences. This investigation confirms that this method can be used for diagnosis of skin cancer. The method discussed in this research is useful not only for diagnosis of skin cancer but can be applied for diagnosis and growth analysis of different types of cancers. PMID:26497203

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis

PubMed Central

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611

The diploid genome sequence of an Asian individual

PubMed Central

Wang, Jun; Wang, Wei; Li, Ruiqiang; Li, Yingrui; Tian, Geng; Goodman, Laurie; Fan, Wei; Zhang, Junqing; Li, Jun; Zhang, Juanbin; Guo, Yiran; Feng, Binxiao; Li, Heng; Lu, Yao; Fang, Xiaodong; Liang, Huiqing; Du, Zhenglin; Li, Dong; Zhao, Yiqing; Hu, Yujie; Yang, Zhenzhen; Zheng, Hancheng; Hellmann, Ines; Inouye, Michael; Pool, John; Yi, Xin; Zhao, Jing; Duan, Jinjie; Zhou, Yan; Qin, Junjie; Ma, Lijia; Li, Guoqing; Yang, Zhentao; Zhang, Guojie; Yang, Bin; Yu, Chang; Liang, Fang; Li, Wenjie; Li, Shaochuan; Li, Dawei; Ni, Peixiang; Ruan, Jue; Li, Qibin; Zhu, Hongmei; Liu, Dongyuan; Lu, Zhike; Li, Ning; Guo, Guangwu; Zhang, Jianguo; Ye, Jia; Fang, Lin; Hao, Qin; Chen, Quan; Liang, Yu; Su, Yeyang; san, A.; Ping, Cuo; Yang, Shuang; Chen, Fang; Li, Li; Zhou, Ke; Zheng, Hongkun; Ren, Yuanyuan; Yang, Ling; Gao, Yang; Yang, Guohua; Li, Zhuo; Feng, Xiaoli; Kristiansen, Karsten; Wong, Gane Ka-Shu; Nielsen, Rasmus; Durbin, Richard; Bolund, Lars; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian

2009-01-01

Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J. D. Watson and J. C. Venter), and structural variation identification. These variations were considered for their potential biological impact. Our sequence data and analyses demonstrate the potential usefulness of next-generation sequencing technologies for personal genomics. PMID:18987735

Outbreak of poliomyelitis in Finland in 1984-85 - Re-analysis of viral sequences using the current standard approach.

PubMed

Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani

2010-01-01

In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.

A large outbreak of acute gastroenteritis in Shippensburg, Pennsylvania, 1972 revisited: evidence for common source exposure to a recombinant GII.Pg/GII.3 norovirus.

PubMed

Johnson, J A; Parra, G I; Levenson, E A; Green, K Y

2017-06-01

Historical outbreaks can be an important source of information in the understanding of norovirus evolution and epidemiology. Here, we revisit an outbreak of undiagnosed gastroenteritis that occurred in Shippensburg, Pennsylvania in 1972. Nearly 5000 people fell ill over the course of 10 days. Symptoms included diarrhea, vomiting, stomach cramps, and fever, lasting for a median of 24 h. Using current techniques, including next-generation sequencing of full-length viral genomic amplicons, we identified an unusual norovirus recombinant (GII.Pg/GII.3) in nine of 15 available stool samples from the outbreak. This particular recombinant virus has not been reported in recent decades, although GII.3 and GII.Pg genotypes have been detected individually in current epidemic strains. The consensus nucleotide sequences were nearly identical among the four viral genomes analysed, although each strain had three to seven positions in the genome with heterogenous non-synonymous nucleotide subpopulations. Two of these resulting amino acid polymorphisms were conserved in frequency among all four cases, consistent with common source exposure and successful transmission of a mixed viral population. Continued investigation of variant nucleotide populations and recombination events among ancestral norovirus strains such as the Shippensburg virus may provide unique insight into the origin of contemporary strains.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

Integrated analyses using RNA-Seq data reveal viral genomes, single nucleotide variations, the phylogenetic relationship, and recombination for Apple stem grooving virus.

PubMed

Jo, Yeonhwa; Choi, Hoseong; Kim, Sang-Min; Kim, Sun-Lim; Lee, Bong Choon; Cho, Won Kyong

2016-08-09

Next-generation sequencing (NGS) provides many possibilities for plant virology research. In this study, we performed integrated analyses using plant transcriptome data for plant virus identification using Apple stem grooving virus (ASGV) as an exemplar virus. We used 15 publicly available transcriptome libraries from three different studies, two mRNA-Seq studies and a small RNA-Seq study. We de novo assembled nearly complete genomes of ASGV isolates Fuji and Cuiguan from apple and pear transcriptomes, respectively, and identified single nucleotide variations (SNVs) of ASGV within the transcriptomes. We demonstrated the application of NGS raw data to confirm viral infections in the plant transcriptomes. In addition, we compared the usability of two de novo assemblers, Trinity and Velvet, for virus identification and genome assembly. A phylogenetic tree revealed that ASGV and Citrus tatter leaf virus (CTLV) are the same virus, which was divided into two clades. Recombination analyses identified six recombination events from 21 viral genomes. Taken together, our in silico analyses using NGS data provide a successful application of plant transcriptomes to reveal extensive information associated with viral genome assembly, SNVs, phylogenetic relationships, and genetic recombination.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

PubMed

Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

2011-10-17

The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

PubMed Central

2011-01-01

Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences

PubMed Central

Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

2016-01-01

The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species’ genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

Sequencing and comparative analyses of the genomes of zoysiagrasses

PubMed Central

Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei

2016-01-01

Zoysia is a warm-season turfgrass, which comprises 11 allotetraploid species (2n = 4x = 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession ‘Nagirizaki’ (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella ‘Wakaba’ and Z. pacifica ‘Zanpa’ were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica ‘Kyoto’, Z. japonica ‘Miyagi’ and Z. matrella ‘Chiba Fair Green’, were accumulated, and aligned against the reference genome of ‘Nagirizaki’ along with those from ‘Wakaba’ and ‘Zanpa’. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the ‘Zoysia Genome Database’ at http://zoysia.kazusa.or.jp. PMID:26975196

Sequencing and comparative analyses of the genomes of zoysiagrasses.

PubMed

Tanaka, Hidenori; Hirakawa, Hideki; Kosugi, Shunichi; Nakayama, Shinobu; Ono, Akiko; Watanabe, Akiko; Hashiguchi, Masatsugu; Gondo, Takahiro; Ishigaki, Genki; Muguerza, Melody; Shimizu, Katsuya; Sawamura, Noriko; Inoue, Takayasu; Shigeki, Yuichi; Ohno, Naoki; Tabata, Satoshi; Akashi, Ryo; Sato, Shusei

2016-04-01

Zoysiais a warm-season turfgrass, which comprises 11 allotetraploid species (2n= 4x= 40), each possessing different morphological and physiological traits. To characterize the genetic systems of Zoysia plants and to analyse their structural and functional differences in individual species and accessions, we sequenced the genomes of Zoysia species using HiSeq and MiSeq platforms. As a reference sequence of Zoysia species, we generated a high-quality draft sequence of the genome of Z. japonica accession 'Nagirizaki' (334 Mb) in which 59,271 protein-coding genes were predicted. In parallel, draft genome sequences of Z. matrella 'Wakaba' and Z. pacifica 'Zanpa' were also generated for comparative analyses. To investigate the genetic diversity among the Zoysia species, genome sequence reads of three additional accessions, Z. japonica'Kyoto', Z. japonica'Miyagi' and Z. matrella'Chiba Fair Green', were accumulated, and aligned against the reference genome of 'Nagirizaki' along with those from 'Wakaba' and 'Zanpa'. As a result, we detected 7,424,163 single-nucleotide polymorphisms and 852,488 short indels among these species. The information obtained in this study will be valuable for basic studies on zoysiagrass evolution and genetics as well as for the breeding of zoysiagrasses, and is made available in the 'Zoysia Genome Database' at http://zoysia.kazusa.or.jp. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Developmentally programmed DNA splicing in Paramecium reveals short-distance crosstalk between DNA cleavage sites

PubMed Central

Gratias, Ariane; Lepère, Gersende; Garnier, Olivier; Rosa, Sarah; Duharcourt, Sandra; Malinsky, Sophie; Meyer, Eric; Bétermier, Mireille

2008-01-01

Somatic genome assembly in the ciliate Paramecium involves the precise excision of thousands of short internal eliminated sequences (IESs) that are scattered throughout the germline genome and often interrupt open reading frames. Excision is initiated by double-strand breaks centered on the TA dinucleotides that are conserved at each IES boundary, but the factors that drive cleavage site recognition remain unknown. A degenerate consensus was identified previously at IES ends and genetic analyses confirmed the participation of their nucleotide sequence in efficient excision. Even for wild-type IESs, however, variant excision patterns (excised or nonexcised) may be inherited maternally through sexual events, in a homology-dependent manner. We show here that this maternal epigenetic control interferes with the targeting of DNA breaks at IES ends. Furthermore, we demonstrate that a mutation in the TA at one end of an IES impairs DNA cleavage not only at the mutant end but also at the wild-type end. We conclude that crosstalk between both ends takes place prior to their cleavage and propose that the ability of an IES to adopt an excision-prone conformation depends on the combination of its nucleotide sequence and of additional determinants. PMID:18420657

The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister-group to protostomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Helfenbein, Kevin G.; Fourcade, H. Matthew; Vanjani, Rohit G.

2004-05-01

We report the first complete mitochondrial (mt) DNA sequence from a member of the phylum Chaetognatha (arrow worms). The Paraspadella gotoi mtDNA is highly unusual, missing 23 of the genes commonly found in animal mtDNAs, including atp6, which has otherwise been found universally to be present. Its 14 genes are unusually arranged into two groups, one on each strand. One group is punctuated by numerous non-coding intergenic nucleotides, while the other group is tightly packed, having no non-coding nucleotides, leading to speculation that there are two transcription units with differing modes of expression. The phylogenetic position of the Chaetognatha withinmore » the Metazoa has long been uncertain, with conflicting or equivocal results from various morphological analyses and rRNA sequence comparisons. Comparisons here of amino acid sequences from mitochondrially encoded proteins gives a single most parsimonious tree that supports a position of Chaetognatha as sister to the protostomes studied here. From this, one can more clearly interpret the patterns of evolution of various developmental features, especially regarding the embryological fate of the blastopore.« less

Isolation of Chandipura virus (Vesiculovirus: Rhabdoviridae) from Sergentomyia species of sandflies from Nagpur, Maharashtra, India.

PubMed

Sudeep, A B; Bondre, V P; Gurav, Y K; Gokhale, M D; Sapkal, G N; Mavale, M S; George, R P; Mishra, A C

2014-05-01

An outbreak of acute encephalitis syndrome was reported from Vidarbha region of Maharashtra s0 tate, India, during July 2012. Anti-IgM antibodies against Chandipura virus (CHPV) were detected in clinical samples. Sandfly collections were done to determine their role in CHPV transmission. Twenty nine pools of Sergentomyia spp. comprising 625 specimens were processed for virus isolation in Vero E6 cell line. Diagnostic RT-PCR targeting N-gene was carried out with the sample that showed cytopathic effects (CPE). The PCR product was sequenced, analysed and the sequences were deposited in Genbank database. CPE in Vero E6 cell line infected with three pools was detected at 48 h post infection. However, virus could be isolated only from one pool. RT-PCR studies demonstrated 527 nucleotide product that confirmed the agent as CHPV. Sequence analysis of the new isolate showed difference in 10-12 nucleotides in comparison to earlier isolates. This is perhaps the first isolation of CHPV from Sergentomyia spp. in India and virus isolation during transmission season suggests their probable role in CHPV transmission. Further studies need to be done to confirm the precise role of Sargentomyia spp. in CHPV transmission.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Sequence diversity among badnavirus isolates infecting black pepper and related species in India.

PubMed

Bhat, A I; Sasi, Shina; Revathy, K A; Deeshma, K P; Saji, K V

2014-01-01

The badnavirus, piper yellow mottle virus (PYMoV) is known to infect black pepper (Piper nigrum), betelvine (P. betle) and Indian long pepper (P. longum) in India and other parts of the world. Occurrence of PYMoV or other badnaviruses in other species of Piper and its variability is not reported so far. We have analysed sequence variability in the conserved putative reverse transcriptase (RT)/ribonuclease H (RNase H) coding region of the virus using specific badnavirus primers from 13 virus isolates of black pepper collected from different cultivars and regions and one isolate each from 23 other species of Piper. Of these, four species failed to produce expected amplicon while amplicon from four other species showed more similarities to plant sequences than to badnaviruses. Of the remaining, isolates from black pepper, P. argyrophyllum, P. attenuatum, P. barberi, P. betle, P. colubrinum, P. galeatum, P. longum, P. ornatum, P. sarmentosum and P. trichostachyon showed an identity of >85 % at the nucleotide and >90 % at the amino acid level with PYMoV indicating that they are isolates of PYMoV. On the other hand high sequence variability of 21-43 % at nucleotide and 17-46 % at amino acid level compared to PYMoV was found among isolates infecting P. bababudani, P. chaba, P. peepuloides, P. mullesua and P. thomsonii suggesting the presence of new badnaviruses. Phylogenetic analyses showed close clustering of all PYMoV isolates that were well separated from other known badnaviruses. This is the first report of occurrence of PYMoV in eight Piper spp and likely occurrence of four new species in five Piper spp.

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

PubMed

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are complex, with internal promoters and terminators generating multiple transcription units and allowing differential gene expression within these operons. We discovered extensive antisense transcription that results from more than 500 operons, which fully overlap or extensively overlap adjacent divergent or convergent operons. The genomic regions corresponding to these antisense transcripts are highly conserved in E. coli (including Shigella species), although it remains to be proven whether or not they are functional. Our observations of features unearthed by single-nucleotide transcriptome mapping suggest that deeper layers of transcriptional regulation in bacteria are likely to be revealed in the future. Copyright © 2014 Conway et al.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

Genetic variation and dynamics of infections of equid herpesvirus 5 in individual horses.

PubMed

Back, Helena; Ullman, Karin; Leijon, Mikael; Söderlund, Robert; Penell, Johanna; Ståhl, Karl; Pringle, John; Valarcher, Jean-François

2016-01-01

Equid herpesvirus 5 (EHV-5) is related to the human Epstein-Barr virus (human herpesvirus 4) and has frequently been observed in equine populations worldwide. EHV-5 was previously assumed to be low to non-pathogenic; however, studies have also related the virus to the severe lung disease equine multinodular pulmonary fibrosis (EMPF). Genetic information of EHV-5 is scanty: the whole genome was recently described and only limited nucleotide sequences are available. In this study, samples were taken twice 1 year apart from eight healthy horses at the same professional training yard and samples from a ninth horse that was diagnosed with EMPF with samples taken pre- and post-mortem to analyse partial glycoprotein B (gB) gene of EHV-5 by using next-generation sequencing. The analysis resulted in 27 partial gB gene sequences, 11 unique sequence types and five amino acid sequences. These sequences could be classified within four genotypes (I-IV) of the EHV-5 gB gene based on the degree of similarity of the nucleotide and amino acid sequences, and in this work horses were shown to be identified with up to three different genotypes simultaneously. The observations showed a range of interactions between EHV-5 and the host over time, where the same virus persists in some horses, whereas others have a more dynamic infection pattern including strains from different genotypes. This study provides insight into the genetic variation and dynamics of EHV-5, and highlights that further work is needed to understand the EHV-5 interaction with its host.

[Analysis of chloroplast rpS16 intron sequences in Lemnaceae].

PubMed

Martirosian, E V; Ryzhova, N N; Kochieva, E Z; Skriabin, K G

2009-01-01

Chloroplast rpS16 gene intron sequences were determined and characterized for twenty-five Lemnaceae accessions representing nine duckweed species. For each Lemnaceae species nucleotide substitutions and for Lemna minor, Lemna aequinoctialis, Wolffia arrhiza different indels were detected. Most of indels were found for Wolffia arrhiza and Lemna aequinoctialis. The analyses of intraspecific polymorphism resulted in identification of several gaplotypes in L. gibba and L. trisulca. Lemnaceae phylogenetic relationship based on rpS16 intron variability data has revealed significant differences between L. aequinoctialis and other Lemna species. Genetic distance values corroborated competence of Landoltia punctata separations from Spirodela into an independent generic taxon. The acceptability of rpS16 intron sequences for phylogenetic studies in Lemnaceae was shown.

The (in)complete organelle genome: exploring the use and nonuse of available technologies for characterizing mitochondrial and plastid chromosomes.

PubMed

Sanitá Lima, Matheus; Woods, Laura C; Cartwright, Matthew W; Smith, David Roy

2016-11-01

Not long ago, scientists paid dearly in time, money and skill for every nucleotide that they sequenced. Today, DNA sequencing technologies epitomize the slogan 'faster, easier, cheaper and more', and in many ways, sequencing an entire genome has become routine, even for the smallest laboratory groups. This is especially true for mitochondrial and plastid genomes. Given their relatively small sizes and high copy numbers per cell, organelle DNAs are currently among the most highly sequenced kind of chromosome. But accurately characterizing an organelle genome and the information it encodes can require much more than DNA sequencing and bioinformatics analyses. Organelle genomes can be surprisingly complex and can exhibit convoluted and unconventional modes of gene expression. Unravelling this complexity can demand a wide assortment of experiments, from pulsed-field gel electrophoresis to Southern and Northern blots to RNA analyses. Here, we show that it is exactly these types of 'complementary' analyses that are often lacking from contemporary organelle genome papers, particularly short 'genome announcement' articles. Consequently, crucial and interesting features of organelle chromosomes are going undescribed, which could ultimately lead to a poor understanding and even a misrepresentation of these genomes and the genes they express. High-throughput sequencing and bioinformatics have made it easy to sequence and assemble entire chromosomes, but they should not be used as a substitute for or at the expense of other types of genomic characterization methods. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

Whole-Genome Sequencing Reveals Genetic Variation in the Asian House Rat.

PubMed

Teng, Huajing; Zhang, Yaohua; Shi, Chengmin; Mao, Fengbiao; Hou, Lingling; Guo, Hongling; Sun, Zhongsheng; Zhang, Jianxu

2016-07-07

Whole-genome sequencing of wild-derived rat species can provide novel genomic resources, which may help decipher the genetics underlying complex phenotypes. As a notorious pest, reservoir of human pathogens, and colonizer, the Asian house rat, Rattus tanezumi, is successfully adapted to its habitat. However, little is known regarding genetic variation in this species. In this study, we identified over 41,000,000 single-nucleotide polymorphisms, plus insertions and deletions, through whole-genome sequencing and bioinformatics analyses. Moreover, we identified over 12,000 structural variants, including 143 chromosomal inversions. Further functional analyses revealed several fixed nonsense mutations associated with infection and immunity-related adaptations, and a number of fixed missense mutations that may be related to anticoagulant resistance. A genome-wide scan for loci under selection identified various genes related to neural activity. Our whole-genome sequencing data provide a genomic resource for future genetic studies of the Asian house rat species and have the potential to facilitate understanding of the molecular adaptations of rats to their ecological niches. Copyright © 2016 Teng et al.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

From algae to angiosperms–inferring the phylogeny of green plants (Viridiplantae) from 360 plastid genomes

PubMed Central

2014-01-01

Background Next-generation sequencing has provided a wealth of plastid genome sequence data from an increasingly diverse set of green plants (Viridiplantae). Although these data have helped resolve the phylogeny of numerous clades (e.g., green algae, angiosperms, and gymnosperms), their utility for inferring relationships across all green plants is uncertain. Viridiplantae originated 700-1500 million years ago and may comprise as many as 500,000 species. This clade represents a major source of photosynthetic carbon and contains an immense diversity of life forms, including some of the smallest and largest eukaryotes. Here we explore the limits and challenges of inferring a comprehensive green plant phylogeny from available complete or nearly complete plastid genome sequence data. Results We assembled protein-coding sequence data for 78 genes from 360 diverse green plant taxa with complete or nearly complete plastid genome sequences available from GenBank. Phylogenetic analyses of the plastid data recovered well-supported backbone relationships and strong support for relationships that were not observed in previous analyses of major subclades within Viridiplantae. However, there also is evidence of systematic error in some analyses. In several instances we obtained strongly supported but conflicting topologies from analyses of nucleotides versus amino acid characters, and the considerable variation in GC content among lineages and within single genomes affected the phylogenetic placement of several taxa. Conclusions Analyses of the plastid sequence data recovered a strongly supported framework of relationships for green plants. This framework includes: i) the placement of Zygnematophyceace as sister to land plants (Embryophyta), ii) a clade of extant gymnosperms (Acrogymnospermae) with cycads + Ginkgo sister to remaining extant gymnosperms and with gnetophytes (Gnetophyta) sister to non-Pinaceae conifers (Gnecup trees), and iii) within the monilophyte clade (Monilophyta), Equisetales + Psilotales are sister to Marattiales + leptosporangiate ferns. Our analyses also highlight the challenges of using plastid genome sequences in deep-level phylogenomic analyses, and we provide suggestions for future analyses that will likely incorporate plastid genome sequence data for thousands of species. We particularly emphasize the importance of exploring the effects of different partitioning and character coding strategies. PMID:24533922

Reference genome sequence of the model plant Setaria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao

We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ~400-Mb assembly covers ~80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species thatmore » demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).« less

Reference genome sequence of the model plant Setaria.

PubMed

Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao; Percifield, Ryan; Hawkins, Jennifer; Pontaroli, Ana C; Estep, Matt; Feng, Liang; Vaughn, Justin N; Grimwood, Jane; Jenkins, Jerry; Barry, Kerrie; Lindquist, Erika; Hellsten, Uffe; Deshpande, Shweta; Wang, Xuewen; Wu, Xiaomei; Mitros, Therese; Triplett, Jimmy; Yang, Xiaohan; Ye, Chu-Yu; Mauro-Herrera, Margarita; Wang, Lin; Li, Pinghua; Sharma, Manoj; Sharma, Rita; Ronald, Pamela C; Panaud, Olivier; Kellogg, Elizabeth A; Brutnell, Thomas P; Doust, Andrew N; Tuskan, Gerald A; Rokhsar, Daniel; Devos, Katrien M

2012-05-13

We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ∼400-Mb assembly covers ∼80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).

High-resolution single-nucleotide polymorphism array-profiling in myeloproliferative neoplasms identifies novel genomic aberrations

PubMed Central

Stegelmann, Frank; Bullinger, Lars; Griesshammer, Martin; Holzmann, Karlheinz; Habdank, Marianne; Kuhn, Susanne; Maile, Carmen; Schauer, Stefanie; Döhner, Hartmut; Döhner, Konstanze

2010-01-01

Single-nucleotide polymorphism arrays allow for genome-wide profiling of copy-number alterations and copy-neutral runs of homozygosity at high resolution. To identify novel genetic lesions in myeloproliferative neoplasms, a large series of 151 clinically well characterized patients was analyzed in our study. Copy-number alterations were rare in essential thrombocythemia and polycythemia vera. In contrast, approximately one third of myelofibrosis patients exhibited small genomic losses (less than 5 Mb). In 2 secondary myelofibrosis cases the tumor suppressor gene NF1 in 17q11.2 was affected. Sequencing analyses revealed a mutation in the remaining NF1 allele of one patient. In terms of copy-neutral aberrations, no chromosomes other than 9p were recurrently affected. In conclusion, novel genomic aberrations were identified in our study, in particular in patients with myelofibrosis. Further analyses on single-gene level are necessary to uncover the mechanisms that are involved in the pathogenesis of myeloproliferative neoplasms. PMID:20015882

Genome-wide comparison and taxonomic relatedness of multiple Xylella fastidiosa strains reveal the occurrence of three subspecies and a new Xylella species.

PubMed

Marcelletti, Simone; Scortichini, Marco

2016-10-01

A total of 21 Xylella fastidiosa strains were assessed by comparing their genomes to infer their taxonomic relationships. The whole-genome-based average nucleotide identity and tetranucleotide frequency correlation coefficient analyses were performed. In addition, a consensus tree based on comparisons of 956 core gene families, and a genome-wide phylogenetic tree and a Neighbor-net network were constructed with 820,088 nucleotides (i.e., approximately 30-33 % of the entire X. fastidiosa genome). All approaches revealed the occurrence of three well-demarcated genetic clusters that represent X. fastidiosa subspecies fastidiosa, multiplex and pauca, with the latter appeared to diverge. We suggest that the proposed but never formally described subspecies 'sandyi' and 'morus' are instead members of the subspecies fastidiosa. These analyses support the view that the Xylella strain isolated from Pyrus pyrifolia in Taiwan is likely to be a new species. A widely used multilocus sequence typing analysis yielded conflicting results.

Inferring interactions in complex microbial communities from nucleotide sequence data and environmental parameters

PubMed Central

Shang, Yu; Sikorski, Johannes; Bonkowski, Michael; Fiore-Donno, Anna-Maria; Kandeler, Ellen; Marhan, Sven; Boeddinghaus, Runa S.; Solly, Emily F.; Schrumpf, Marion; Schöning, Ingo; Wubet, Tesfaye; Buscot, Francois; Overmann, Jörg

2017-01-01

Interactions occur between two or more organisms affecting each other. Interactions are decisive for the ecology of the organisms. Without direct experimental evidence the analysis of interactions is difficult. Correlation analyses that are based on co-occurrences are often used to approximate interaction. Here, we present a new mathematical model to estimate the interaction strengths between taxa, based on changes in their relative abundances across environmental gradients. PMID:28288199

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

CPm gene diversity in field isolates of Citrus tristeza virus from Colombia.

PubMed

Oliveros-Garay, Oscar Arturo; Martinez-Salazar, Natalhie; Torres-Ruiz, Yanneth; Acosta, Orlando

2009-01-01

The nucleotide sequence diversity of the CPm gene from 28 field isolates of Citrus tristeza virus (CTV) was assessed by SSCP and sequence analyses. These isolates showed two major shared haplotypes, which differed in distribution: A1 was the major haplotype in 23 isolates from different geographic regions, whereas R1 was found in isolates from a discrete region. Phylogenetic reconstruction clustered A1 within an independent group, while R1 was grouped with mild isolates T30 from Florida and T385 from Spain. Some isolates contained several minor haplotypes, which were very similar to, and associated with, the major haplotype.

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China.

PubMed

Sun, Qiang; Zhao, Qiumin; An, Xiaoping; Guo, Xiaofang; Zuo, Shuqing; Zhang, Xianglilan; Pei, Guangqian; Liu, Wenli; Cheng, Shi; Wang, Yunfei; Shu, Peng; Mi, Zhiqiang; Huang, Yong; Zhang, Zhiyi; Tong, Yigang; Zhou, Hongning; Zhang, Jiusong

2017-04-01

Menghai rhabdovirus (MRV) was isolated from Aedes albopictus in Menghai county of Yunnan Province, China, in August 2010. Whole-genome sequencing of MRV was performed using an Ion PGM™ Sequencer. We found that MRV is a single-stranded, negative-sense RNA virus. The complete genome of MRV has 10,744 nt, with short inverted repeat termini, encoding five typical rhabdovirus proteins (N, P, M, G, and L) and an additional small hypothetical protein. Nucleotide BLAST analysis using the BLASTn method showed that the genome sequence most similar to that of MRV is that of Arboretum virus (NC_025393.1), with a Max score of 322, query coverage of 14%, and 66% identity. Genomic and phylogenetic analyses both demonstrated that MRV should be considered a member of a novel species of the family Rhabdoviridae.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Evaluation of the reliability of maize reference assays for GMO quantification.

PubMed

Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

2010-03-01

A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.

PubMed

El Houmami, Nawal; Seligmann, Hervé

2017-01-01

We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.

N-Glycomic and Microscopic Subcellular Localization Analyses of NPP1, 2 and 6 Strongly Indicate that trans-Golgi Compartments Participate in the Golgi to Plastid Traffic of Nucleotide Pyrophosphatase/Phosphodiesterases in Rice

PubMed Central

Kaneko, Kentaro; Takamatsu, Takeshi; Inomata, Takuya; Oikawa, Kazusato; Itoh, Kimiko; Hirose, Kazuko; Amano, Maho; Nishimura, Shin-Ichiro; Toyooka, Kiminori; Matsuoka, Ken; Pozueta-Romero, Javier; Mitsui, Toshiaki

2016-01-01

Nucleotide pyrophosphatase/phosphodiesterases (NPPs) are widely distributed N-glycosylated enzymes that catalyze the hydrolytic breakdown of numerous nucleotides and nucleotide sugars. In many plant species, NPPs are encoded by a small multigene family, which in rice are referred to NPP1–NPP6. Although recent investigations showed that N-glycosylated NPP1 is transported from the endoplasmic reticulum (ER)–Golgi system to the chloroplast through the secretory pathway in rice cells, information on N-glycan composition and subcellular localization of other NPPs is still lacking. Computer-assisted analyses of the amino acid sequences deduced from different Oryza sativa NPP-encoding cDNAs predicted all NPPs to be secretory glycoproteins. Confocal fluorescence microscopy observation of cells expressing NPP2 and NPP6 fused with green fluorescent protein (GFP) revealed that NPP2 and NPP6 are plastidial proteins. Plastid targeting of NPP2–GFP and NPP6–GFP was prevented by brefeldin A and by the expression of ARF1(Q71L), a dominant negative mutant of ADP-ribosylation factor 1 that arrests the ER to Golgi traffic, indicating that NPP2 and NPP6 are transported from the ER–Golgi to the plastidial compartment. Confocal laser scanning microscopy and high-pressure frozen/freeze-substituted electron microscopy analyses of transgenic rice cells ectopically expressing the trans-Golgi marker sialyltransferase fused with GFP showed the occurrence of contact of Golgi-derived membrane vesicles with cargo and subsequent absorption into plastids. Sensitive and high-throughput glycoblotting/mass spectrometric analyses showed that complex-type and paucimannosidic-type glycans with fucose and xylose residues occupy approximately 80% of total glycans of NPP1, NPP2 and NPP6. The overall data strongly indicate that the trans-Golgi compartments participate in the Golgi to plastid trafficking and targeting mechanism of NPPs. PMID:27335351

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

PubMed

McAllister, Christine A; Miller, Allison J

2016-07-01

Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Draft genome sequence of Cicer reticulatum L., the wild progenitor of chickpea provides a resource for agronomic trait improvement.

PubMed

Gupta, Sonal; Nawaz, Kashif; Parween, Sabiha; Roy, Riti; Sahu, Kamlesh; Kumar Pole, Anil; Khandal, Hitaishi; Srivastava, Rishi; Kumar Parida, Swarup; Chattopadhyay, Debasis

2017-02-01

Cicer reticulatum L. is the wild progenitor of the fourth most important legume crop chickpea (C. arietinum L.). We assembled short-read sequences into 416 Mb draft genome of C. reticulatum and anchored 78% (327 Mb) of this assembly to eight linkage groups. Genome annotation predicted 25,680 protein-coding genes covering more than 90% of predicted gene space. The genome assembly shared a substantial synteny and conservation of gene orders with the genome of the model legume Medicago truncatula. Resistance gene homologs of wild and domesticated chickpeas showed high sequence homology and conserved synteny. Comparison of gene sequences and nucleotide diversity using 66 wild and domesticated chickpea accessions suggested that the desi type chickpea was genetically closer to the wild species than the kabuli type. Comparative analyses predicted gene flow between the wild and the cultivated species during domestication. Molecular diversity and population genetic structure determination using 15,096 genome-wide single nucleotide polymorphisms revealed an admixed domestication pattern among cultivated (desi and kabuli) and wild chickpea accessions belonging to three population groups reflecting significant influence of parentage or geographical origin for their cultivar-specific population classification. The assembly and the polymorphic sequence resources presented here would facilitate the study of chickpea domestication and targeted use of wild Cicer germplasms for agronomic trait improvement in chickpea. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

De novo transcriptome analysis of an imminent biofuel crop, Camelina sativa L. using Illumina GAIIX sequencing platform and identification of SSR markers.

PubMed

Mudalkar, Shalini; Golla, Ramesh; Ghatty, Sreenivas; Reddy, Attipalli Ramachandra

2014-01-01

Camelina sativa L. is an emerging biofuel crop with potential applications in industry, medicine, cosmetics and human nutrition. The crop is unexploited owing to very limited availability of transcriptome and genomic data. In order to analyse the various metabolic pathways, we performed de novo assembly of the transcriptome on Illumina GAIIX platform with paired end sequencing for obtaining short reads. The sequencing output generated a FastQ file size of 2.97 GB with 10.83 million reads having a maximum read length of 101 nucleotides. The number of contigs generated was 53,854 with maximum and minimum lengths of 10,086 and 200 nucleotides respectively. These trancripts were annotated using BLAST search against the Aracyc, Swiss-Prot, TrEMBL, gene ontology and clusters of orthologous groups (KOG) databases. The genes involved in lipid metabolism were studied and the transcription factors were identified. Sequence similarity studies of Camelina with the other related organisms indicated the close relatedness of Camelina with Arabidopsis. In addition, bioinformatics analysis revealed the presence of a total of 19,379 simple sequence repeats. This is the first report on Camelina sativa L., where the transcriptome of the entire plant, including seedlings, seed, root, leaves and stem was done. Our data established an excellent resource for gene discovery and provide useful information for functional and comparative genomic studies in this promising biofuel crop.

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

Infectious hematopoietic necrosis virus: Monophyletic origin of European isolates from North American Genogroup M

USGS Publications Warehouse

Enzmann, P.-J.; Kurath, G.; Fichtner, D.; Bergmann, S.M.

2005-01-01

Infectious hematopoietic necrosis virus (IHNV) was first detected in Europe in 1987 in France and Italy, and later, in 1992, in Germany. The source of the virus and the route of introduction are unknown. The present study investigates the molecular epidemiology of IHNV outbreaks in Germany since its first introduction. The complete nucleotide sequences of the glycoprotein (G) and non-virion (NV) genes from 9 IHNV isolates from Germany have been determined, and this has allowed the identification of characteristic differences between these isolates. Phylogenetic analysis of partial G gene sequences (mid-G, 303 nucleotides) from North American IHNV isolates (Kurath et al. 2003) has revealed 3 major genogroups, designated U, M and L. Using this gene region with 2 different North American IHNV data sets, it was possible to group the European IHNV strains within the M genogroup, but not in any previously defined subgroup. Analysis of the full length G gene sequences indicated that an independent evolution of IHN viruses had occurred in Europe. IHN viruses in Europe seem to be of a monophyletic origin, again most closely related to North American isolates in the M genogroup. Analysis of the NV gene sequences also showed the European isolates to be monophyletic, but resolution of the 3 genogroups was poor with this gene region. As a result of comparative sequence analyses, several different genotypes have been identified circulating in Europe. ?? Inter-Research 2005.

Complete mitochondrial genome sequences of three bats species and whole genome mitochondrial analyses reveal patterns of codon bias and lend support to a basal split in Chiroptera.

PubMed

Meganathan, P R; Pagan, Heidi J T; McCulloch, Eve S; Stevens, Richard D; Ray, David A

2012-01-15

Order Chiroptera is a unique group of mammals whose members have attained self-powered flight as their main mode of locomotion. Much speculation persists regarding bat evolution; however, lack of sufficient molecular data hampers evolutionary and conservation studies. Of ~1200 species, complete mitochondrial genome sequences are available for only eleven. Additional sequences should be generated if we are to resolve many questions concerning these fascinating mammals. Herein, we describe the complete mitochondrial genomes of three bats: Corynorhinus rafinesquii, Lasiurus borealis and Artibeus lituratus. We also compare the currently available mitochondrial genomes and analyze codon usage in Chiroptera. C. rafinesquii, L. borealis and A. lituratus mitochondrial genomes are 16438 bp, 17048 bp and 16709 bp, respectively. Genome organization and gene arrangements are similar to other bats. Phylogenetic analyses using complete mitochondrial genome sequences support previously established phylogenetic relationships and suggest utility in future studies focusing on the evolutionary aspects of these species. Comprehensive analyses of available bat mitochondrial genomes reveal distinct nucleotide patterns and synonymous codon preferences corresponding to different chiropteran families. These patterns suggest that mutational and selection forces are acting to different extents within Chiroptera and shape their mitochondrial genomes. Copyright © 2011 Elsevier B.V. All rights reserved.

Analyses of Mitogenome Sequences Revealed that Asian Citrus Psyllids (Diaphorina citri) from California Were Related to Those from Florida.

PubMed

Wu, Fengnian; Kumagai, Luci; Cen, Yijing; Chen, Jianchi; Wallis, Christopher M; Polek, MaryLou; Jiang, Hongyan; Zheng, Zheng; Liang, Guangwen; Deng, Xiaoling

2017-08-31

Asian citrus psyllid (ACP, Diaphorina citri Kuwayama) transmits "Candidatus Liberibacter asiaticus" (CLas), an unculturable alpha-proteobacterium associated with citrus Huanglongbing (HLB). CLas has recently been found in California. Understanding ACP population diversity is necessary for HLB regulatory practices aimed at reducing CLas spread. In this study, two circular ACP mitogenome sequences from California (mt-CApsy, ~15,027 bp) and Florida (mt-FLpsy, ~15,012 bp), USA, were acquired. Each mitogenome contained 13 protein coding genes, 2 ribosomal RNA and 22 transfer RNA genes, and a control region varying in sizes. The Californian mt-CApsy was identical to the Floridian mt-FLpsy, but different from the mitogenome (mt-GDpsy) of Guangdong, China, in 50 single nucleotide polymorphisms (SNPs). Further analyses were performed on sequences in cox1 and trnAsn regions with 100 ACPs, SNPs in nad1-nad4-nad5 locus through PCR with 252 ACP samples. All results showed the presence of a Chinese ACP cluster (CAC) and an American ACP cluster (AAC). We proposed that ACP in California was likely not introduced from China based on our current ACP collection but somewhere in America. However, more studies with ACP samples from around the world are needed. ACP mitogenome sequence analyses will facilitate ACP population research.

Occurrence of Cucumber mosaic virus on vanilla (Vanilla planifolia Andrews) in India.

PubMed

Madhubala, R; Bhadramurthy, V; Bhat, A I; Hareesh, P S; Retheesh, S T; Bhai, R S

2005-06-01

Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, Cucurbitaceae, Fabaceae and Solanaceae. Nicotiana benthamiana was found to be a suitable host for the propagation of CMV. The virus was purified from inoculated N. benthamiana plants and negatively stained purified preparations contained isometric particles of about 28 nm in diameter. The molecular weight of the viral coat protein subunits was found to be 25.0 kDa. Polyclonal antiserum was produced in New Zealand white rabbit, immunoglobulin G (IgG) was purified and conjugated with alkaline phosphatase enzyme. Double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) method was standardized for the detection of CMV infection in vanilla plants. CP gene of the virus was amplified using reverse transcriptase-polymerase chain reaction (RT-PCR), cloned and sequenced. Sequenced region contained a single open reading frame of 657 nucleotides potentially coding for 218 amino acids. Sequence analyses with other CMV isolates revealed the greatest identity with black pepper isolate of CMV (99%) and the phylogram clearly showed that CMV infecting vanilla belongs to subgroup IB. This is the first report of occurrence of CMV on V. planifolia from India.

Genetic diversity and host specificity varies across three genera of blood parasites in ducks of the Pacific Americas Flyway

USGS Publications Warehouse

Reeves, Andrew B.; Smith, Matthew M.; Meixell, Brandt W.; Fleskes, Joseph P.; Ramey, Andrew M.

2015-01-01

Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus andLeucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodiumparasites infecting North American waterfowl as compared to those of the generaHaemoproteus and Leucocytozoon.

Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene.

PubMed

Wang, Wenbing; Zhu, Shanying; Wang, Liqun; Yu, Feng; Shen, Weide

2005-12-01

Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1,530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

Genetic Diversity and Host Specificity Varies across Three Genera of Blood Parasites in Ducks of the Pacific Americas Flyway

PubMed Central

Reeves, Andrew B.; Smith, Mathew M.; Meixell, Brandt W.; Fleskes, Joseph P; Ramey, Andrew M.

2015-01-01

Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus and Leucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodium parasites infecting North American waterfowl as compared to those of the genera Haemoproteus and Leucocytozoon. PMID:25710468

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Comparative genomic analyses reveal a vast, novel network of nucleotide-centric systems in biological conflicts, immunity and signaling

PubMed Central

Burroughs, A. Maxwell; Zhang, Dapeng; Schäffer, Daniel E.; Iyer, Lakshminarayan M.; Aravind, L.

2015-01-01

Cyclic di- and linear oligo-nucleotide signals activate defenses against invasive nucleic acids in animal immunity; however, their evolutionary antecedents are poorly understood. Using comparative genomics, sequence and structure analysis, we uncovered a vast network of systems defined by conserved prokaryotic gene-neighborhoods, which encode enzymes generating such nucleotides or alternatively processing them to yield potential signaling molecules. The nucleotide-generating enzymes include several clades of the DNA-polymerase β-like superfamily (including Vibrio cholerae DncV), a minimal version of the CRISPR polymerase and DisA-like cyclic-di-AMP synthetases. Nucleotide-binding/processing domains include TIR domains and members of a superfamily prototyped by Smf/DprA proteins and base (cytokinin)-releasing LOG enzymes. They are combined in conserved gene-neighborhoods with genes for a plethora of protein superfamilies, which we predict to function as nucleotide-sensors and effectors targeting nucleic acids, proteins or membranes (pore-forming agents). These systems are sometimes combined with other biological conflict-systems such as restriction-modification and CRISPR/Cas. Interestingly, several are coupled in mutually exclusive neighborhoods with either a prokaryotic ubiquitin-system or a HORMA domain-PCH2-like AAA+ ATPase dyad. The latter are potential precursors of equivalent proteins in eukaryotic chromosome dynamics. Further, components from these nucleotide-centric systems have been utilized in several other systems including a novel diversity-generating system with a reverse transcriptase. We also found the Smf/DprA/LOG domain from these systems to be recruited as a predicted nucleotide-binding domain in eukaryotic TRPM channels. These findings point to evolutionary and mechanistic links, which bring together CRISPR/Cas, animal interferon-induced immunity, and several other systems that combine nucleic-acid-sensing and nucleotide-dependent signaling. PMID:26590262

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

PubMed Central

Ryynänen, Heikki J; Primmer, Craig R

2006-01-01

Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

Duplicates, redundancies and inconsistencies in the primary nucleotide databases: a descriptive study.

PubMed

Chen, Qingyu; Zobel, Justin; Verspoor, Karin

2017-01-01

GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC-a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases - in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases.Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w. © The Author(s) 2017. Published by Oxford University Press.

Duplicates, redundancies and inconsistencies in the primary nucleotide databases: a descriptive study

PubMed Central

Chen, Qingyu; Zobel, Justin; Verspoor, Karin

2017-01-01

GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC—a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases – in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases. Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w PMID:28077566

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

A population genetics analysis in clinical isolates of Sporothrix schenckii based on calmodulin and calcium/calmodulin-dependent kinase partial gene sequences.

PubMed

Rangel-Gamboa, Lucia; Martinez-Hernandez, Fernando; Maravilla, Pablo; Flisser, Ana

2018-02-02

Sporotrichosis is a subcutaneous mycosis that is caused by diverse species of Sporothrix. High levels of genetic diversity in Sporothrix isolates have been reported, but few population genetics analyses have been documented. To analyse the genetic variability and population genetics relations of Sporothrix schenckii Mexican clinical isolates and to compare them with other reported isolates. We studied the partial sequences of calmodulin and calcium/calmodulin-dependent kinase genes in 24 isolates; 22 from Mexico, one from Colombia, and one ATCC ® 6331™; the latter was used as a positive control. In total, 24 isolates were analysed. Phylogenetic, haplotype and population genetic analyses were performed with 24 sequences obtained by us and 345 sequences obtained from GenBank. The frequency of S. schenckii sensu stricto was 81% in the 22 Mexican isolates, while the remaining 19% were Sporothrix globosa. Mexican S. schenckii sensu stricto had high genetic diversity and was related to isolates from South America. In contrast, S. globosa showed one haplotype related to isolates from Asia, Brazil, Spain and the USA. In S. schenckii sensu stricto, S. brasiliensis and S. globosa, haplotype polymorphism (θ) values were higher than the nucleotide diversity data (π). In addition, Tajima's D plus Fu and Li's tests analyses displayed negative values, suggesting directional selection and arguing against the model of neutral evolution in these populations. In addition, analyses showed that calcium/calmodulin-dependent kinase was a suitable genetic marker to discriminate between common Sporothrix species. © 2018 Blackwell Verlag GmbH.

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

Distribution and molecular diversity of three cucurbit-infecting poleroviruses in China.

PubMed

Shang, Qiao-xia; Xiang, Hai-ying; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2009-11-01

Cucurbit aphid-borne yellows virus (CABYV) and Melon aphid-borne yellows virus (MABYV) have been found to be associated with cucurbit yellowing disease in China. Our report identifies for the first time a third distinct polerovirus, tentatively named Suakwa aphid-borne yellows virus (SABYV), infecting Suakwa vegetable sponge. To better understand the distribution and molecular diversity of these three poleroviruses infecting cucurbits, a total of 214 cucurbitaceous crop samples were collected from 25 provinces in China, and were investigated by RT-PCR and sequencing. Of these, 108 samples tested positive for CABYV, while 40 samples from five provinces were positive for MABYV, and SABYV was detected in only 4 samples which were collected in the southern part of China. Forty-one PCR-amplified fragments containing a portion of the RdRp gene, intergenic NCR and CP gene were cloned and sequenced. Sequence comparisons showed that CABYV isolates shared 78.0-79.2% nucleotide sequence identity with MABYV isolates, and 69.7-70.8% with SABYV. Sequence identity between MABYV and SABYV was 73.3-76.5%. In contrast, the nucleotide identities within each species were 93.2-98.7% (CABYV), 98.1-99.9% (MABYV), and 96.1-98.6% (SABYV). Phylogenetic analyses revealed that the polerovirus isolates fit into three distinct groups, corresponding to the three species. The CABYV group could be further divided into two subgroups: the Asia subgroup and the Mediterranean subgroup, based on CP gene and partial RdRp gene sequences. Recombination analysis suggested that MABYV may be a recombinant virus.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Characterization of the first complete genome sequence of an Impatiens necrotic spot orthotospovirus isolate from the United States and worldwide phylogenetic analyses of INSV isolates.

PubMed

Zhao, Kaixi; Margaria, Paolo; Rosa, Cristina

2018-05-10

Impatiens necrotic spot orthotospovirus (INSV) can impact economically important ornamental plants and vegetables worldwide. Characterization studies on INSV are limited. For most INSV isolates, there are no complete genome sequences available. This lack of genomic information has a negative impact on the understanding of the INSV genetic diversity and evolution. Here we report the first complete nucleotide sequence of a US INSV isolate. INSV-UP01 was isolated from an impatiens in Pennsylvania, US. RT-PCR was used to clone its full-length genome and Vector NTI to assemble overlapping sequences. Phylogenetic trees were constructed by using MEGA7 software to show the phylogenetic relationships with other available INSV sequences worldwide. This US isolate has genome and biological features classical of INSV species and clusters in the Western Hemisphere clade, but its origin appears to be recent. Furthermore, INSV-UP01 might have been involved in a recombination event with an Italian isolate belonging to the Asian clade. Our analyses support that INSV isolates infect a broad plant-host range they group by geographic origin and not by host, and are subjected to frequent recombination events. These results justify the need to generate and analyze complete genome sequences of orthotospoviruses in general and INSV in particular.

Development of a reference material of a single DNA molecule for the quality control of PCR testing.

PubMed

Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

2014-09-02

We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Analysis of the nucleoprotein gene identifies three distinct lineages of viral haemorrhagic septicemia virus (VHSV) within the European marine environment

USGS Publications Warehouse

Snow, M.; Cunningham, C.O.; Melvin, W.T.; Kurath, G.

1999-01-01

A ribonuclease (RNase) protection assay (RPA) has been used to detect nucleotide sequence variation within the nucleoprotein gene of 39 viral haemorrhagic septicaemia virus (VHSV) isolates of European marine origin. The classification of VHSV isolates based on RPA cleavage patterns permitted the identification of ten distinct groups of viruses based on differences at the molecular level. The nucleotide sequence of representatives of each of these groupings was determined and subjected to phylogenetic analysis. This revealed grouping of the European marine isolates of VHSV into three genotypes circulating within distinct geographic areas. A fourth genotype was identified comprising isolates originating from North America. Phylogenetic analyses indicated that VHSV isolates recovered from wild caught fish around the British Isles were genetically related to isolates responsible for losses in farmed turbot. Furthermore, a relationship between naturally occurring marine isolates and VHSV isolates causing mortality among rainbow trout in continental Europe was demonstrated. Analysis of the nucleoprotein gene identifies distinct lineages of viral haemorrhagic septicaemia virus within the European marine environment. Virus Res. 63, 35-44. Available from: 

MAX mutations status in Swedish patients with pheochromocytoma and paraganglioma tumours.

PubMed

Crona, Joakim; Maharjan, Rajani; Delgado Verdugo, Alberto; Stålberg, Peter; Granberg, Dan; Hellman, Per; Björklund, Peyman

2014-03-01

Pheochromocytoma (PCC) and Paraganglioma are rare tumours originating from neuroendocrine cells. Up to 60% of cases have either germline or somatic mutation in one of eleven described susceptibility loci, SDHA, SDHB, SDHC, SDHD, SDHAF2, VHL, EPAS1, RET, NF1, TMEM127 and MYC associated factor-X (MAX). Recently, germline mutations in MAX were found to confer susceptibility to PCC and paraganglioma (PGL). A subsequent multicentre study found about 1% of PCCs and PGLs to have germline or somatic mutations in MAX. However, there has been no study investigating the frequency of MAX mutations in a Scandinavian cohort. We analysed tumour specimens from 63 patients with PCC and PGL treated at Uppsala University hospital, Sweden, for re-sequencing of MAX using automated Sanger sequencing. Our results show that 0% (0/63) of tumours had mutations in MAX. Allele frequencies of known single nucleotide polymorphisms rs4902359, rs45440292, rs1957948 and rs1957949 corresponded to those available in the Single Nucleotide Polymorphism Database. We conclude that MAX mutations remain unusual events and targeted genetic screening should be considered after more common genetic events have been excluded.

Complete mitochondrial genome of the stonefly Cryptoperla stilifera Sivec (Plecoptera: Peltoperlidae) and the phylogeny of Polyneopteran insects.

PubMed

Wu, Hai-Yan; Ji, Xiao-Yu; Yu, Wei-Wei; Du, Yu-Zhou

2014-03-10

We present the complete mitogenome of a stonefly, Cryptoperla stilifera Sivec (Plecoptera; Peltoperlidae). The mitogenome was a circular molecule consisting of 15,633 nucleotides, 37 genes and a A+T-rich region. C. stilifera mitogenome was similar to Pteronarcys princeps mitogenome (Plecoptera; Pteronarcyidae). All transfer RNA genes (tRNAs) had typical cloverleaf secondary structures except for trnSer (AGN), where the stem-loop structure of the dihydrouridine (DHU) arm was missing. The A+T-rich region of C. stilifera had two stem-loops and each had two interlink. Three conserved sequence blocks (CSBs) were present in the A+T-rich regions of C. stilifera, Peltoperla tarteri and Peltoperla arcuata. Moreover, many polynucleotide stretches (Poly N, N=A, T and C) in the A+T-rich region of C. stilifera Phylogenetic relationships of Polyneopteran species were constructed based on the nucleotide sequences of 13 protein coding genes (PCGs). Both maximum likelihood (ML) and Bayesian inference (BI) analyses supported Grylloblattodea as the sister group to Plecoptera+Dermaptera and Embiidina and Phasmatodea as sister groups. Copyright © 2014 Elsevier B.V. All rights reserved.

Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

PubMed

Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

2010-12-01

Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

Occurrence and genetic diversity of the Plasmopara halstedii virus in sunflower downy mildew populations of the world.

PubMed

Grasse, Wolfgang; Spring, Otmar

2015-03-01

Plasmopara halstedii virus (PhV) is a ss(+)RNA virus that exclusively occurs in the sunflower downy mildew pathogen Plasmopara halstedii, a biotrophic oomycete of severe economic impact. The virus origin and its genomic variability are unknown. A PCR-based screening of 128 samples of P. halstedii from five continents and up to 40 y old was conducted. PhV RNA was found in over 90 % of the isolates with no correlation to geographic origin or pathotype of its host. Sequence analyses of the two open reading frames (ORFs) revealed only 18 single nucleotide polymorphisms (SNPs) in 3873 nucleotides. The SNPs had no recognizable effect on the two encoded virus proteins. In 398 nucleotides of the untranslated regions (UTRs) of the RNA 2 strand eight additional SNPs and one short deletion was found. Modelling experiments revealed no effects of these variations on the secondary structure of the RNA. The results showed the presence of PhV in P. halstedii isolates of global origin and the existence of the virus since more than 40 y. The virus genome revealed a surprisingly low variation in both coding and noncoding parts. No sequence differences were correlated with host pathotype or geographic populations of the oomycete. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

In silico analysis of β-mannanases and β-mannosidase from Aspergillus flavus and Trichoderma virens UKM1

NASA Astrophysics Data System (ADS)

Yee, Chai Sin; Murad, Abdul Munir Abdul; Bakar, Farah Diba Abu

2013-11-01

A gene encoding an endo-β-1,4-mannanase from Trichoderma virens UKM1 (manTV) and Aspergillus flavus UKM1 (manAF) was analysed with bioinformatic tools. In addition, A. flavus NRRL 3357 genome database was screened for a β-mannosidase gene and analysed (mndA-AF). These three genes were analysed to understand their gene properties. manTV and manAF both consists of 1,332-bp and 1,386-bp nucleotides encoding 443 and 461 amino acid residues, respectively. Both the endo-β-1,4-mannanases belong to the glycosyl hydrolase family 5 and contain a carbohydrate-binding module family 1 (CBM1). On the other hand, mndA-AF which is a 2,745-bp gene encodes a protein sequence of 914 amino acid residues. This β-mannosidase belongs to the glycosyl hydrolase family 2. Predicted molecular weight of manTV, manAF and mndA-AF are 47.74 kDa, 49.71 kDa and 103 kDa, respectively. All three predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal β-mannanases and β-mannosidases.

Bioinformatics Pipelines for Targeted Resequencing and Whole-Exome Sequencing of Human and Mouse Genomes: A Virtual Appliance Approach for Instant Deployment

PubMed Central

Saeed, Isaam; Wong, Stephen Q.; Mar, Victoria; Goode, David L.; Caramia, Franco; Doig, Ken; Ryland, Georgina L.; Thompson, Ella R.; Hunter, Sally M.; Halgamuge, Saman K.; Ellul, Jason; Dobrovic, Alexander; Campbell, Ian G.; Papenfuss, Anthony T.; McArthur, Grant A.; Tothill, Richard W.

2014-01-01

Targeted resequencing by massively parallel sequencing has become an effective and affordable way to survey small to large portions of the genome for genetic variation. Despite the rapid development in open source software for analysis of such data, the practical implementation of these tools through construction of sequencing analysis pipelines still remains a challenging and laborious activity, and a major hurdle for many small research and clinical laboratories. We developed TREVA (Targeted REsequencing Virtual Appliance), making pre-built pipelines immediately available as a virtual appliance. Based on virtual machine technologies, TREVA is a solution for rapid and efficient deployment of complex bioinformatics pipelines to laboratories of all sizes, enabling reproducible results. The analyses that are supported in TREVA include: somatic and germline single-nucleotide and insertion/deletion variant calling, copy number analysis, and cohort-based analyses such as pathway and significantly mutated genes analyses. TREVA is flexible and easy to use, and can be customised by Linux-based extensions if required. TREVA can also be deployed on the cloud (cloud computing), enabling instant access without investment overheads for additional hardware. TREVA is available at http://bioinformatics.petermac.org/treva/. PMID:24752294

Reassessment of the taxonomic position of Burkholderia andropogonis and description of Robbsia andropogonis gen. nov., comb. nov.

PubMed

Lopes-Santos, Lucilene; Castro, Daniel Bedo Assumpção; Ferreira-Tonin, Mariana; Corrêa, Daniele Bussioli Alves; Weir, Bevan Simon; Park, Duckchul; Ottoboni, Laura Maria Mariscal; Neto, Júlio Rodrigues; Destéfano, Suzete Aparecida Lanza

2017-06-01

The phylogenetic classification of the species Burkholderia andropogonis within the Burkholderia genus was reassessed using 16S rRNA gene phylogenetic analysis and multilocus sequence analysis (MLSA). Both phylogenetic trees revealed two main groups, named A and B, strongly supported by high bootstrap values (100%). Group A encompassed all of the Burkholderia species complex, whi.le Group B only comprised B. andropogonis species, with low percentage similarities with other species of the genus, from 92 to 95% for 16S rRNA gene sequences and 83% for conserved gene sequences. Average nucleotide identity (ANI), tetranucleotide signature frequency, and percentage of conserved proteins POCP analyses were also carried out, and in the three analyses B. andropogonis showed lower values when compared to the other Burkholderia species complex, near 71% for ANI, from 0.484 to 0.724 for tetranucleotide signature frequency, and around 50% for POCP, reinforcing the distance observed in the phylogenetic analyses. Our findings provide an important insight into the taxonomy of B. andropogonis. It is clear from the results that this bacterial species exhibits genotypic differences and represents a new genus described herein as Robbsia andropogonis gen. nov., comb. nov.

SINEBase: a database and tool for SINE analysis.

PubMed

Vassetzky, Nikita S; Kramerov, Dmitri A

2013-01-01

SINEBase (http://sines.eimb.ru) integrates the revisited body of knowledge about short interspersed elements (SINEs). A set of formal definitions concerning SINEs was introduced. All available sequence data were screened through these definitions and the genetic elements misidentified as SINEs were discarded. As a result, 175 SINE families have been recognized in animals, flowering plants and green algae. These families were classified by the modular structure of their nucleotide sequences and the frequencies of different patterns were evaluated. These data formed the basis for the database of SINEs. The SINEBase website can be used in two ways: first, to explore the database of SINE families, and second, to analyse candidate SINE sequences using specifically developed tools. This article presents an overview of the database and the process of SINE identification and analysis.

SINEBase: a database and tool for SINE analysis

PubMed Central

Vassetzky, Nikita S.; Kramerov, Dmitri A.

2013-01-01

SINEBase (http://sines.eimb.ru) integrates the revisited body of knowledge about short interspersed elements (SINEs). A set of formal definitions concerning SINEs was introduced. All available sequence data were screened through these definitions and the genetic elements misidentified as SINEs were discarded. As a result, 175 SINE families have been recognized in animals, flowering plants and green algae. These families were classified by the modular structure of their nucleotide sequences and the frequencies of different patterns were evaluated. These data formed the basis for the database of SINEs. The SINEBase website can be used in two ways: first, to explore the database of SINE families, and second, to analyse candidate SINE sequences using specifically developed tools. This article presents an overview of the database and the process of SINE identification and analysis. PMID:23203982

PigGIS: Pig Genomic Informatics System

PubMed Central

Ruan, Jue; Guo, Yiran; Li, Heng; Hu, Yafeng; Song, Fei; Huang, Xin; Kristiensen, Karsten; Bolund, Lars; Wang, Jun

2007-01-01

Pig Genomic Information System (PigGIS) is a web-based depository of pig (Sus scrofa) genomic learning mainly engineered for biomedical research to locate pig genes from their human homologs and position single nucleotide polymorphisms (SNPs) in different pig populations. It utilizes a variety of sequence data, including whole genome shotgun (WGS) reads and expressed sequence tags (ESTs), and achieves a successful mapping solution to the low-coverage genome problem. With the data presently available, we have identified a total of 15 700 pig consensus sequences covering 18.5 Mb of the homologous human exons. We have also recovered 18 700 SNPs and 20 800 unique 60mer oligonucleotide probes for future pig genome analyses. PigGIS can be freely accessed via the web at and . PMID:17090590

Molecular epidemiology of Plum pox virus in Japan.

PubMed

Maejima, Kensaku; Himeno, Misako; Komatsu, Ken; Takinami, Yusuke; Hashimoto, Masayoshi; Takahashi, Shuichiro; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

2011-05-01

For a molecular epidemiological study based on complete genome sequences, 37 Plum pox virus (PPV) isolates were collected from the Kanto region in Japan. Pair-wise analyses revealed that all 37 Japanese isolates belong to the PPV-D strain, with low genetic diversity (less than 0.8%). In phylogenetic analysis of the PPV-D strain based on complete nucleotide sequences, the relationships of the PPV-D strain were reconstructed with high resolution: at the global level, the American, Canadian, and Japanese isolates formed their own distinct monophyletic clusters, suggesting that the routes of viral entry into these countries were independent; at the local level, the actual transmission histories of PPV were precisely reconstructed with high bootstrap support. This is the first description of the molecular epidemiology of PPV based on complete genome sequences.

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

Clonal architecture of secondary acute myeloid leukemia defined by single-cell sequencing.

PubMed

Hughes, Andrew E O; Magrini, Vincent; Demeter, Ryan; Miller, Christopher A; Fulton, Robert; Fulton, Lucinda L; Eades, William C; Elliott, Kevin; Heath, Sharon; Westervelt, Peter; Ding, Li; Conrad, Donald F; White, Brian S; Shao, Jin; Link, Daniel C; DiPersio, John F; Mardis, Elaine R; Wilson, Richard K; Ley, Timothy J; Walter, Matthew J; Graubert, Timothy A

2014-07-01

Next-generation sequencing has been used to infer the clonality of heterogeneous tumor samples. These analyses yield specific predictions-the population frequency of individual clones, their genetic composition, and their evolutionary relationships-which we set out to test by sequencing individual cells from three subjects diagnosed with secondary acute myeloid leukemia, each of whom had been previously characterized by whole genome sequencing of unfractionated tumor samples. Single-cell mutation profiling strongly supported the clonal architecture implied by the analysis of bulk material. In addition, it resolved the clonal assignment of single nucleotide variants that had been initially ambiguous and identified areas of previously unappreciated complexity. Accordingly, we find that many of the key assumptions underlying the analysis of tumor clonality by deep sequencing of unfractionated material are valid. Furthermore, we illustrate a single-cell sequencing strategy for interrogating the clonal relationships among known variants that is cost-effective, scalable, and adaptable to the analysis of both hematopoietic and solid tumors, or any heterogeneous population of cells.

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

Molecular Tracing of Hepatitis C Virus Genotype 1 Isolates in Iran: A NS5B Phylogenetic Analysis with Systematic Review.

PubMed

Hesamizadeh, Khashayar; Alavian, Seyed Moayed; Najafi Tireh Shabankareh, Azar; Sharafi, Heidar

2016-12-01

Hepatitis C virus (HCV) is characterized by a high degree of genetic heterogeneity and classified into 7 genotypes and different subtypes. It heterogeneously distributed through various risk groups and geographical regions. A well-established phylogenetic relationship can simplify the tracing of HCV hierarchical strata into geographical regions. The current study aimed to find genetic phylogeny of subtypes 1a and 1b of HCV isolates based on NS5B nucleotide sequences in Iran and other members of Eastern Mediterranean regional office of world health organization, as well as other Middle Eastern countries, with a systematic review of available published and unpublished studies. The phylogenetic analyses were performed based on the nucleotide sequences of NS5B gene of HCV genotype 1 (HCV-1), which were registered in the GenBank database. The literature review was performed in two steps: 1) searching studies evaluating the NS5B sequences of HCV-1, on PubMed, Scopus, and Web of Science, and 2) Searching sequences of unpublished studies registered in the GenBank database. In this study, 442 sequences from HCV-1a and 232 from HCV-1b underwent phylogenetic analysis. Phylogenetic analysis of all sequences revealed different clusters in the phylogenetic trees. The results showed that the proportion of HCV-1a and -1b isolates from Iranian patients probably originated from domestic sources. Moreover, the HCV-1b isolates from Iranian patients may have similarities with the European ones. In this study, phylogenetic reconstruction of HCV-1 sequences clearly indicated for molecular tracing and ancestral relationships of the HCV genotypes in Iran, and showed the likelihood of domestic origin for HCV-1a and various origin for HCV-1b.

Molecular Evolution of a Type 1 Wild-Vaccine Poliovirus Recombinant during Widespread Circulation in China

PubMed Central

Liu, Hong-Mei; Zheng, Du-Ping; Zhang, Li-Bi; Oberste, M. Steven; Pallansch, Mark A.; Kew, Olen M.

2000-01-01

Type 1 wild-vaccine recombinant polioviruses were isolated from poliomyelitis patients in China from 1991 to 1993. We compared the sequences of 34 recombinant isolates over the 1,353-nucleotide (nt) genomic interval (nt 2480 to 3832) encoding the major capsid protein, VP1, and the protease, 2A. All recombinants had a 367-nt block of sequence (nt 3271 to 3637) derived from the Sabin 1 oral poliovirus vaccine strain spanning the 3′-terminal sequences of VP1 (115 nt) and the 5′ half of 2A (252 nt). The remaining VP1 sequences were closely (up to 99.5%) related to those of a major genotype of wild type 1 poliovirus endemic to China up to 1994. In contrast, the non-vaccine-derived sequences at the 3′ half of 2A were more distantly related (<90% nucleotide sequence match) to those of other contemporary wild polioviruses from China. The vaccine-derived sequences of the earliest (April 1991) isolates completely matched those of Sabin 1. Later isolates diverged from the early isolates primarily by accumulation of synonymous base substitutions (at a rate of ∼3.7 × 10−2 substitutions per synonymous site per year) over the entire VP1-2A interval. Distinct evolutionary lineages were found in different Chinese provinces. From the combined epidemiologic and evolutionary analyses, we propose that the recombinant virus arose during mixed infection of a single individual in northern China in early 1991 and that its progeny spread by multiple independent chains of transmission into some of the most populous areas of China within a year of the initiating infection. PMID:11070012

A combination of PhP typing and β-d-glucuronidase gene sequence variation analysis for differentiation of Escherichia coli from humans and animals.

PubMed

Masters, N; Christie, M; Katouli, M; Stratton, H

2015-06-01

We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Mitochondrial DNA Evidence Supports the Hypothesis that Triodontophorus Species Belong to Cyathostominae

PubMed Central

Gao, Yuan; Zhang, Yan; Yang, Xin; Qiu, Jian-Hua; Duan, Hong; Xu, Wen-Wen; Chang, Qiao-Cheng; Wang, Chun-Ren

2017-01-01

Equine strongyles, the significant nematode pathogens of horses, are characterized by high quantities and species abundance, but classification of this group of parasitic nematodes is debated. Mitochondrial (mt) genome DNA data are often used to address classification controversies. Thus, the objectives of this study were to determine the complete mt genomes of three Cyathostominae nematode species (Cyathostomum catinatum, Cylicostephanus minutus, and Poteriostomum imparidentatum) of horses and reconstruct the phylogenetic relationship of Strongylidae with other nematodes in Strongyloidea to test the hypothesis that Triodontophorus spp. belong to Cyathostominae using the mt genomes. The mt genomes of Cy. catinatum, Cs. minutus, and P. imparidentatum were 13,838, 13,826, and 13,817 bp in length, respectively. Complete mt nucleotide sequence comparison of all Strongylidae nematodes revealed that sequence identity ranged from 77.8 to 91.6%. The mt genome sequences of Triodontophorus species had relatively high identity with Cyathostominae nematodes, rather than Strongylus species of the same subfamily (Strongylinae). Comparative analyses of mt genome organization for Strongyloidea nematodes sequenced to date revealed that members of this superfamily possess identical gene arrangements. Phylogenetic analyses using mtDNA data indicated that the Triodontophorus species clustered with Cyathostominae species instead of Strongylus species. The present study first determined the complete mt genome sequences of Cy. catinatum, Cs. minutus, and P. imparidentatum, which will provide novel genetic markers for further studies of Strongylidae taxonomy, population genetics, and systematics. Importantly, sequence comparison and phylogenetic analyses based on mtDNA sequences supported the hypothesis that Triodontophorus belongs to Cyathostominae. PMID:28824575

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes

PubMed Central

Dey, Avishek; Samanta, Milan Kumar; Gayen, Srimonta; Sen, Soumitra K.; Maiti, Mrinal K.

2016-01-01

Drought is one of the major limiting factors for productivity of crops including rice (Oryza sativa L.). Understanding the role of allelic variations of key regulatory genes involved in stress-tolerance is essential for developing an effective strategy to combat drought. The bZIP transcription factors play a crucial role in abiotic-stress adaptation in plants via abscisic acid (ABA) signaling pathway. The present study aimed to search for allelic polymorphism in the OsbZIP23 gene across selected drought-tolerant and drought-sensitive rice genotypes, and to characterize the new allele through overexpression (OE) and gene-silencing (RNAi). Analyses of the coding DNA sequence (CDS) of the cloned OsbZIP23 gene revealed single nucleotide polymorphism at four places and a 15-nucleotide deletion at one place. The single-copy OsbZIP23 gene is expressed at relatively higher level in leaf tissues of drought-tolerant genotypes, and its abundance is more in reproductive stage. Cloning and sequence analyses of the OsbZIP23-promoter from drought-tolerant O. rufipogon and drought-sensitive IR20 cultivar showed variation in the number of stress-responsive cis-elements and a 35-nucleotide deletion at 5’-UTR in IR20. Analysis of the GFP reporter gene function revealed that the promoter activity of O. rufipogon is comparatively higher than that of IR20. The overexpression of any of the two polymorphic forms (1083 bp and 1068 bp CDS) of OsbZIP23 improved drought tolerance and yield-related traits significantly by retaining higher content of cellular water, soluble sugar and proline; and exhibited decrease in membrane lipid peroxidation in comparison to RNAi lines and non-transgenic plants. The OE lines showed higher expression of target genes-OsRab16B, OsRab21 and OsLEA3-1 and increased ABA sensitivity; indicating that OsbZIP23 is a positive transcriptional-regulator of the ABA-signaling pathway. Taken together, the present study concludes that the enhanced gene expression rather than natural polymorphism in coding sequence of OsbZIP23 is accountable for improved drought tolerance and yield performance in rice genotypes. PMID:26959651

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Manipulation of lignin composition in plants using a tissue-specific promoter

DOEpatents

Chapple, Clinton C. S.

2003-08-26

The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bennetzen, Jeffrey L; Yang, Xiaohan; Ye, Chuyu

We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The {approx}400-Mb assembly covers {approx}80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species thatmore » demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).« less

The sequence and de novo assembly of the giant panda genome

PubMed Central

Li, Ruiqiang; Fan, Wei; Tian, Geng; Zhu, Hongmei; He, Lin; Cai, Jing; Huang, Quanfei; Cai, Qingle; Li, Bo; Bai, Yinqi; Zhang, Zhihe; Zhang, Yaping; Wang, Wen; Li, Jun; Wei, Fuwen; Li, Heng; Jian, Min; Li, Jianwen; Zhang, Zhaolei; Nielsen, Rasmus; Li, Dawei; Gu, Wanjun; Yang, Zhentao; Xuan, Zhaoling; Ryder, Oliver A.; Leung, Frederick Chi-Ching; Zhou, Yan; Cao, Jianjun; Sun, Xiao; Fu, Yonggui; Fang, Xiaodong; Guo, Xiaosen; Wang, Bo; Hou, Rong; Shen, Fujun; Mu, Bo; Ni, Peixiang; Lin, Runmao; Qian, Wubin; Wang, Guodong; Yu, Chang; Nie, Wenhui; Wang, Jinhuan; Wu, Zhigang; Liang, Huiqing; Min, Jiumeng; Wu, Qi; Cheng, Shifeng; Ruan, Jue; Wang, Mingwei; Shi, Zhongbin; Wen, Ming; Liu, Binghang; Ren, Xiaoli; Zheng, Huisong; Dong, Dong; Cook, Kathleen; Shan, Gao; Zhang, Hao; Kosiol, Carolin; Xie, Xueying; Lu, Zuhong; Zheng, Hancheng; Li, Yingrui; Steiner, Cynthia C.; Lam, Tommy Tsan-Yuk; Lin, Siyuan; Zhang, Qinghui; Li, Guoqing; Tian, Jing; Gong, Timing; Liu, Hongde; Zhang, Dejin; Fang, Lin; Ye, Chen; Zhang, Juanbin; Hu, Wenbo; Xu, Anlong; Ren, Yuanyuan; Zhang, Guojie; Bruford, Michael W.; Li, Qibin; Ma, Lijia; Guo, Yiran; An, Na; Hu, Yujie; Zheng, Yang; Shi, Yongyong; Li, Zhiqiang; Liu, Qing; Chen, Yanling; Zhao, Jing; Qu, Ning; Zhao, Shancen; Tian, Feng; Wang, Xiaoling; Wang, Haiyin; Xu, Lizhi; Liu, Xiao; Vinar, Tomas; Wang, Yajun; Lam, Tak-Wah; Yiu, Siu-Ming; Liu, Shiping; Zhang, Hemin; Li, Desheng; Huang, Yan; Wang, Xia; Yang, Guohua; Jiang, Zhi; Wang, Junyi; Qin, Nan; Li, Li; Li, Jingxiang; Bolund, Lars; Kristiansen, Karsten; Wong, Gane Ka-Shu; Olson, Maynard; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian; Wang, Jun

2013-01-01

Using next-generation sequencing technology alone, we have successfully generated and assembled a draft sequence of the giant panda genome. The assembled contigs (2.25 gigabases (Gb)) cover approximately 94% of the whole genome, and the remaining gaps (0.05 Gb) seem to contain carnivore-specific repeats and tandem repeats. Comparisons with the dog and human showed that the panda genome has a lower divergence rate. The assessment of panda genes potentially underlying some of its unique traits indicated that its bamboo diet might be more dependent on its gut microbiome than its own genetic composition. We also identified more than 2.7 million heterozygous single nucleotide polymorphisms in the diploid genome. Our data and analyses provide a foundation for promoting mammalian genetic research, and demonstrate the feasibility for using next-generation sequencing technologies for accurate, cost-effective and rapid de novo assembly of large eukaryotic genomes. PMID:20010809

New Measles Genotype, Uganda

PubMed Central

Muwonge, Apollo; Nanyunja, Miriam; Bwogi, Josephine; Lowe, Luis; Liffick, Stephanie L.; Bellini, William J.; Sylvester, Sempala

2005-01-01

We report the first genetic characterization of wildtype measles viruses from Uganda. Thirty-six virus isolates from outbreaks in 6 districts were analyzed from 2000 to 2002. Analyses of sequences of the nucleoprotein (N) and hemagglutinin (H) genes showed that the Ugandan isolates were all closely related, and phylogenetic analysis indicated that these viruses were members of a unique group within clade D. Sequences of the Ugandan viruses were not closely related to any of the World Health Organization reference sequences representing the 22 currently recognized genotypes. The minimum nucleotide divergence between the Ugandan viruses and the most closely related reference strain, genotype D2, was 3.1% for the N gene and 2.6% for the H gene. Therefore, Ugandan viruses should be considered a new, proposed genotype (d10). This new sequence information will expand the utility of molecular epidemiologic techniques for describing measles transmission patterns in eastern Africa. PMID:16318690

Alfalfa virus S, a new species in the family Alphaflexiviridae

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Molecular Characterization of an Avian Astrovirus

PubMed Central

Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

2000-01-01

Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Quasispecies Analyses of the HIV-1 Near-full-length Genome With Illumina MiSeq

PubMed Central

Ode, Hirotaka; Matsuda, Masakazu; Matsuoka, Kazuhiro; Hachiya, Atsuko; Hattori, Junko; Kito, Yumiko; Yokomaku, Yoshiyuki; Iwatani, Yasumasa; Sugiura, Wataru

2015-01-01

Human immunodeficiency virus type-1 (HIV-1) exhibits high between-host genetic diversity and within-host heterogeneity, recognized as quasispecies. Because HIV-1 quasispecies fluctuate in terms of multiple factors, such as antiretroviral exposure and host immunity, analyzing the HIV-1 genome is critical for selecting effective antiretroviral therapy and understanding within-host viral coevolution mechanisms. Here, to obtain HIV-1 genome sequence information that includes minority variants, we sought to develop a method for evaluating quasispecies throughout the HIV-1 near-full-length genome using the Illumina MiSeq benchtop deep sequencer. To ensure the reliability of minority mutation detection, we applied an analysis method of sequence read mapping onto a consensus sequence derived from de novo assembly followed by iterative mapping and subsequent unique error correction. Deep sequencing analyses of aHIV-1 clone showed that the analysis method reduced erroneous base prevalence below 1% in each sequence position and discarded only < 1% of all collected nucleotides, maximizing the usage of the collected genome sequences. Further, we designed primer sets to amplify the HIV-1 near-full-length genome from clinical plasma samples. Deep sequencing of 92 samples in combination with the primer sets and our analysis method provided sufficient coverage to identify >1%-frequency sequences throughout the genome. When we evaluated sequences of pol genes from 18 treatment-naïve patients' samples, the deep sequencing results were in agreement with Sanger sequencing and identified numerous additional minority mutations. The results suggest that our deep sequencing method would be suitable for identifying within-host viral population dynamics throughout the genome. PMID:26617593

A field ornithologist’s guide to genomics: Practical considerations for ecology and conservation

USGS Publications Warehouse

Oyler-McCance, Sara J.; Oh, Kevin; Langin, Kathryn; Aldridge, Cameron L.

2016-01-01

Vast improvements in sequencing technology have made it practical to simultaneously sequence millions of nucleotides distributed across the genome, opening the door for genomic studies in virtually any species. Ornithological research stands to benefit in three substantial ways. First, genomic methods enhance our ability to parse and simultaneously analyze both neutral and non-neutral genomic regions, thus providing insight into adaptive evolution and divergence. Second, the sheer quantity of sequence data generated by current sequencing platforms allows increased precision and resolution in analyses. Third, high-throughput sequencing can benefit applications that focus on a small number of loci that are otherwise prohibitively expensive, time-consuming, and technically difficult using traditional sequencing methods. These advances have improved our ability to understand evolutionary processes like speciation and local adaptation, but they also offer many practical applications in the fields of population ecology, migration tracking, conservation planning, diet analyses, and disease ecology. This review provides a guide for field ornithologists interested in incorporating genomic approaches into their research program, with an emphasis on techniques related to ecology and conservation. We present a general overview of contemporary genomic approaches and methods, as well as important considerations when selecting a genomic technique. We also discuss research questions that are likely to benefit from utilizing high-throughput sequencing instruments, highlighting select examples from recent avian studies.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

Catalytic analysis of APOBEC3G involving real-time NMR spectroscopy reveals nucleic acid determinants for deamination.

PubMed

Kamba, Keisuke; Nagata, Takashi; Katahira, Masato

2015-01-01

APOBEC3G (A3G) is a single-stranded DNA-specific cytidine deaminase that preferentially converts cytidine to uridine at the third position of triplet cytosine (CCC) hotspots. A3G restricts the infectivity of viruses, such as HIV-1, by targeting CCC hotspots scattered through minus DNA strands, reverse-transcribed from genomic RNA. Previously, we developed a real-time NMR method and elucidated the origin of the 3'→5' polarity of deamination of DNA by the C-terminal domain of A3G (CD2), which is a phenomenon by which a hotspot located closer to the 5'-end is deaminated more effectively than one less close to the 5'-end, through quantitative analysis involving nonspecific binding to and sliding along DNA. In the present study we applied the real-time NMR method to analyze the catalytic activity of CD2 toward DNA oligonucleotides containing a nucleotide analog at a single or multiple positions. Analyses revealed the importance of the sugar and base moieties throughout the consecutive 5 nucleotides, the CCC hotspot being positioned at the center. It was also shown that the sugar or base moieties of the nucleotides outside this 5 nucleotide recognition sequence are also relevant as to CD2's activity. Analyses involving DNA oligonucleotides having two CCC hotspots linked by a long sequence of either deoxyribonucleotides, ribonucleotides or abasic deoxyribonucleotides suggested that the phosphate backbone is required for CD2 to slide along the DNA strand and to exert the 3'→5' polarity. Examination of the effects of different salt concentrations on the 3'→5' polarity indicated that the higher the salt concentration, the less prominent the 3'→5' polarity. This is most likely the result of alleviation of sliding due to a decrease in the affinity of CD2 with the phosphate backbone at high salt concentrations. We also investigated the reactivity of substrates containing 5-methylcytidine (5mC) or 5-hydroxymethylcytidine, and found that A3G exhibited low activity toward 5mC.

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

Host switch during evolution of a genetically distinct hantavirus in the American shrew mole (Neurotrichus gibbsii)

PubMed Central

Kang, Hae Ji; Bennett, Shannon N.; Dizney, Laurie; Sumibcay, Laarni; Arai, Satoru; Ruedas, Luis A.; Song, Jin-Won; Yanagihara, Richard

2009-01-01

A genetically distinct hantavirus, designated Oxbow virus (OXBV), was detected in tissues of an American shrew mole (Neurotrichus gibbsii), captured in Gresham, Oregon, in September 2003. Pairwise analysis of full-length S- and M- and partial L-segment nucleotide and amino acid sequences of OXBV indicated low sequence similarity with rodent-borne hantaviruses. Phylogenetic analyses using maximum-likelihood and Bayesian methods, and host-parasite evolutionary comparisons, showed that OXBV and Asama virus, a hantavirus recently identified from the Japanese shrew mole (Urotrichus talpoides), were related to soricine shrew-borne hantaviruses from North America and Eurasia, respectively, suggesting parallel evolution associated with cross-species transmission. PMID:19394994

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

PubMed Central

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

PubMed

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

Detailed phylogenetic analysis of primate T-lymphotropic virus type 1 (PTLV-1) sequences from orangutans (Pongo pygmaeus) reveals new insights into the evolutionary history of PTLV-1 in Asia.

PubMed

Reid, Michael J C; Switzer, William M; Schillaci, Michael A; Ragonnet-Cronin, Manon; Joanisse, Isabelle; Caminiti, Kyna; Lowenberger, Carl A; Galdikas, Birute Mary F; Sandstrom, Paul A; Brooks, James I

2016-09-01

While human T-lymphotropic virus type 1 (HTLV-1) originates from ancient cross-species transmission of simian T-lymphotropic virus type 1 (STLV-1) from infected nonhuman primates, much debate exists on whether the first HTLV-1 occurred in Africa, or in Asia during early human evolution and migration. This topic is complicated by a lack of representative Asian STLV-1 to infer PTLV-1 evolutionary histories. In this study we obtained new STLV-1 LTR and tax sequences from a wild-born Bornean orangutan (Pongo pygmaeus) and performed detailed phylogenetic analyses using both maximum likelihood and Bayesian inference of available Asian PTLV-1 and African STLV-1 sequences. Phylogenies, divergence dates and nucleotide substitution rates were co-inferred and compared using six different molecular clock calibrations in a Bayesian framework, including both archaeological and/or nucleotide substitution rate calibrations. We then combined our molecular results with paleobiogeographical and ecological data to infer the most likely evolutionary history of PTLV-1. Based on the preferred models our analyses robustly inferred an Asian source for PTLV-1 with cross-species transmission of STLV-1 likely from a macaque (Macaca sp.) to an orangutan about 37.9-48.9kya, and to humans between 20.3-25.5kya. An orangutan diversification of STLV-1 commenced approximately 6.4-7.3kya. Our analyses also inferred that HTLV-1 was first introduced into Australia ~3.1-3.7kya, corresponding to both genetic and archaeological changes occurring in Australia at that time. Finally, HTLV-1 appears in Melanesia at ~2.3-2.7kya corresponding to the migration of the Lapita peoples into the region. Our results also provide an important future reference for calibrating information essential for PTLV evolutionary timescale inference. Longer sequence data, or full genomes from a greater representation of Asian primates, including gibbons, leaf monkeys, and Sumatran orangutans are needed to fully elucidate these evolutionary dates and relationships using the model criteria suggested herein. Copyright © 2016 Elsevier B.V. All rights reserved.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Clonal Relatedness of Enterotoxigenic Escherichia coli (ETEC) Strains Expressing LT and CS17 Isolated from Children with Diarrhoea in La Paz, Bolivia

PubMed Central

Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa

2011-01-01

Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423

Clonal relatedness of enterotoxigenic Escherichia coli (ETEC) strains expressing LT and CS17 isolated from children with diarrhoea in La Paz, Bolivia.

PubMed

Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

Molecular phylogenetic and evolutionary analyses of Muar strain of Japanese encephalitis virus reveal it is the missing fifth genotype.

PubMed

Mohammed, Manal A F; Galbraith, Sareen E; Radford, Alan D; Dove, Winifred; Takasaki, Tomohiko; Kurane, Ichiro; Solomon, Tom

2011-07-01

Japanese encephalitis virus (JEV) is the most important cause of epidemic encephalitis worldwide but its origin is unknown. Epidemics of encephalitis suggestive of Japanese encephalitis (JE) were described in Japan from the 1870s onwards. Four genotypes of JEV have been characterised and representatives of each genotype have been fully sequenced. Based on limited information, a single isolate from Malaysia is thought to represent a putative fifth genotype. We have determined the complete nucleotide and amino acid sequence of Muar strain and compared it with other fully sequenced JEV genomes. Muar was the least similar, with nucleotide divergence ranging from 20.2 to 21.2% and amino acid divergence ranging from 8.5 to 9.9%. Phylogenetic analysis of Muar strain revealed that it does represent a distinct fifth genotype of JEV. We elucidated Muar signature amino acids in the envelope (E) protein, including E327 Glu on the exposed lateral surface of the putative receptor binding domain which distinguishes Muar strain from the other four genotypes. Evolutionary analysis of full-length JEV genomes revealed that the mean evolutionary rate is 4.35 × 10(-4) (3.4906 × 10(-4) to 5.303 × 10(-4)) nucleotides substitutions per site per year and suggests JEV originated from its ancestral virus in the mid 1500s in the Indonesia-Malaysia region and evolved there into different genotypes, which then spread across Asia. No strong evidence for positive selection was found between JEV strains of the five genotypes and the E gene has generally been subjected to strong purifying selection. Copyright © 2011 Elsevier B.V. All rights reserved.

Inferring Multiple Refugia and Phylogeographical Patterns in Pinus massoniana Based on Nucleotide Sequence Variation and DNA Fingerprinting

PubMed Central

Lin, Chung-Jian; Huang, Chi-Chung; Huang, Chao-Ching; Chiang, Yu-Chung; Chiang, Tzen-Yuh

2012-01-01

Background Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central–marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. Methodology/Principal Findings We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central–marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. Conclusions/Significance The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record. PMID:22952747

Leishmania tropica isolates from non-healed and healed patients in Iran: A molecular typing and phylogenetic analysis.

PubMed

Bamorovat, Mehdi; Sharifi, Iraj; Mohammadi, Mohammad Ali; Eybpoosh, Sana; Nasibi, Saeid; Aflatoonian, Mohammad Reza; Khosravi, Ahmad

2018-03-01

The precise identification of the parasite species causing leishmaniasis is essential for selecting proper treatment modality. The present study aims to compare the nucleotide variations of the ITS1, 7SL RNA, and Hsp70 sequences between non-healed and healed anthroponotic cutaneous leishmaniasis (ACL) patients in major foci in Iran. A case-control study was carried out from September 2015 to October 2016 in the cities of Kerman and Bam, in the southeast of Iran. Randomly selected skin-scraping lesions of 40 patients (20 non-healed and 20 healed) were examined and the organisms were grown in a culture medium. Promastigotes were collected by centrifugation and kept for further molecular examinations. The extracted DNA was amplified and sequenced. After global sequence alignment with BioEdit software, maximum likelihood phylogenetic analysis was performed in PhyML for typing of Leishmania isolates. Nucleotide composition of each genetic region was also compared between non-healed and healed patients. Our results showed that all isolates belonged to the Leishmania tropica complex, with their genetic composition in the ITS1 region being different among non-healed and healed patients. 7SL RNA and Hsp70 regions were genetically identical between both groups. Variability in nucleotide patterns observed between both groups in the ITS1 region may serve to encourage future research on the function of these polymorphisms and may improve our understanding of the role of parasite genome properties on patients' response to Leishmania treatment. Our results also do not support future use of 7SL RNA and Hsp70 regions of the parasite for comparative genomic analyses. Copyright © 2018 Elsevier Ltd. All rights reserved.

The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods.

PubMed

McGowen, Michael R; Clark, Clay; Gatesy, John

2008-08-01

The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully resolved, consistently supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (> 5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are used.

Climate change and oceanic barriers: genetic differentiation in Pomatomus saltatrix (Pisces: Pomatomidae) in the North Atlantic Ocean and the Mediterranean Sea.

PubMed

Pardiñas, A F; Campo, D; Pola, I G; Miralles, L; Juanes, F; Garcia-Vazquez, E

2010-11-01

Nucleotide variation of partial cytochrome b sequences was analysed in the bluefish Pomatomus saltatrix to investigate the population-structuring roles of climate change and oceanic barriers. Western and eastern North Atlantic Ocean populations appeared to be totally isolated, with the latter connected to the Mediterranean Sea within which further structuring occurred. © 2010 The Authors. Journal of Fish Biology © 2010 The Fisheries Society of the British Isles.

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

[Genetic Characteristics of Type 2 Vaccine-derived Poliovirus in Shanxi Province (China) in 2014].

PubMed

Yan, Dongrei; Li, Xiaolei; Zhang, Yong; Yang, Jianfang; Zhu, Shuangli; Wang, Dongyan; Zhang, Chuangye; Zhu, Hui; Xu, Wenbo

2015-03-01

The World Health Organization redefined the type 2 vaccine-derived poliovirus (VDPV) in 2010. To study the genetic characteristics and evolution of type 2 VDPV under this new definition, we conducted genome sequencing and analyses of type 2 VDPVs isolated from one patient with acute flaccid paralysis in Shanxi province (China) in 2014. Nucleotide sequencing revealed that the full-length of type 2 VDPV is 7439 bases encoding 2207 amino acids with no insertion or deletion of nucleotides compared with Sabin2. One nucleotide substitution identified as a key determinant of the attenuated phenotype of the Sabin 2 strain (A-G reversion at nucleotide nt 481 in the 5-end of the untranslated region) had reverted in the Shanxi type 2 VDPV. The other known key determinant of the attenuated phenotype of the Sabin 2 strain (U-->C reversion at nt2909 in the VP1 coding region that caused a Ile143Thr substitution in VP1) had not reverted in the Shanxi VDPV. The Shanxi type 2 VDPV was S2/S1 recombinant, the crossover site of which mapped to the 3-end of the 3D region (between nt 6247 and nt 6281). A phylogentic tree based on the VP1 coding region showed that evolution of the Shanxi type 2 VDPV was independent of other type 2 VDPVs detected worldwide. We estimated that the strain circulated for approximately = 11 months in the population according to the known evolution rate. The present study confirmed that the Chinese Polio Laboratory Network could discover the VDPV promptly and that it played an important part in maintenance of a polio-free China.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

Chloroplast Phylogenomics Indicates that Ginkgo biloba Is Sister to Cycads

PubMed Central

Wu, Chung-Shien; Chaw, Shu-Miaw; Huang, Ya-Yi

2013-01-01

Molecular phylogenetic studies have not yet reached a consensus on the placement of Ginkgoales, which is represented by the only living species, Ginkgo biloba (common name: ginkgo). At least six discrepant placements of ginkgo have been proposed. This study aimed to use the chloroplast phylogenomic approach to examine possible factors that lead to such disagreeing placements. We found the sequence types used in the analyses as the most critical factor in the conflicting placements of ginkgo. In addition, the placement of ginkgo varied in the trees inferred from nucleotide (NU) sequences, which notably depended on breadth of taxon sampling, tree-building methods, codon positions, positions of Gnetopsida (common name: gnetophytes), and including or excluding gnetophytes in data sets. In contrast, the trees inferred from amino acid (AA) sequences congruently supported the monophyly of a ginkgo and Cycadales (common name: cycads) clade, regardless of which factors were examined. Our site-stripping analysis further revealed that the high substitution saturation of NU sequences mainly derived from the third codon positions and contributed to the variable placements of ginkgo. In summary, the factors we surveyed did not affect results inferred from analyses of AA sequences. Congruent topologies in our AA trees give more confidence in supporting the ginkgo–cycad sister-group hypothesis. PMID:23315384

Molecular Epidemiology of a novel re-assorted epidemic strain of equine influenza virus in Pakistan in 2015-16.

PubMed

Khan, Amjad; Mushtaq, Muhammad Hassan; Ahmad, Mansur Ud Din; Nazir, Jawad; Farooqi, Shahid Hussain; Khan, Asghar

2017-08-15

A widespread epidemic of equine influenza (EI) occurred in nonvaccinated equine population across multiple districts in Khyber Pakhtunkhwa Province of Pakistan during 2015-2016. An epidemiological surveillance study was conducted from Oct 2015 to April 2016 to investigate the outbreak. EI virus strains were isolated in embryonated eggs from suspected equines swab samples and were subjected to genome sequencing using M13 tagged segment specific primers. Phylogenetic analyses of the nucleotide sequences were concluded using Geneious. Haemagglutinin (HA), Neuraminidase (NA), Matrix (M) and nucleoprotein (NP) genes nucleotide and amino acid sequences of the isolated viruses were aligned with those of OIE recommended, FC-1, FC-2, and contemporary isolates of influenza A viruses from other species. HA and NA genes amino acid sequences were very similar to Tennessee/14 and Malaysia/15 of FC-1 and clustered with the contemporary isolates recently reported in the USA. Phylogenetic analysis showed that these viruses were mostly identical (with 99.6% and 97.4% nucleotide homology) to, and were reassortants containing chicken/Pakistan/14 (H7N3) and Canine/Beijing/10 (H3N2) like M and NP genes. Genetic analysis indicated that A/equine/Pakistan/16 viruses were most probably the result of several re-assortments between the co-circulating avian and equine viruses, and were genetically unlike the other equine viruses due to the presence of H7N3 or H3N2 like M and NP genes. Epidemiological data analysis indicated the potential chance of mixed, and management such as mixed farming system by keeping equine, canine and backyard poultry together in confined premises as the greater risk factors responsible for the re-assortments. Other factors might have contributed to the spread of the epidemic, including low awareness level, poor control of equine movements, and absence of border control disease strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

Multigene Phylogeography of Bactrocera caudata (Insecta: Tephritidae): Distinct Genetic Lineages in Northern and Southern Hemispheres

PubMed Central

Yong, Hoi-Sen; Lim, Phaik-Eem; Tan, Ji; Song, Sze-Looi; Suana, I Wayan; Eamsobhana, Praphathip

2015-01-01

Bactrocera caudata is a pest of pumpkin flower. Specimens of B. caudata from the northern hemisphere (mainland Asia) and southern hemisphere (Indonesia) were analysed using the partial DNA sequences of the nuclear 28S rRNA and internal transcribed spacer region 2 (ITS-2) genes, and the mitochondrial cytochrome c oxidase subunit I (COI), cytochrome c oxidase subunit II (COII) and 16S rRNA genes. The COI, COII, 16S rDNA and concatenated COI+COII+16S and COI+COII+16S+28S+ITS-2 nucleotide sequences revealed that B. caudata from the northern hemisphere (Peninsular Malaysia, East Malaysia, Thailand) was distinctly different from the southern hemisphere (Indonesia: Java, Bali and Lombok), without common haplotype between them. Phylogenetic analysis revealed two distinct clades (northern and southern hemispheres), indicating distinct genetic lineage. The uncorrected ‘p’ distance for the concatenated COI+COII+16S nucleotide sequences between the taxa from the northern and southern hemispheres (‘p’ = 4.46-4.94%) was several folds higher than the ‘p’ distance for the taxa in the northern hemisphere (‘p’ = 0.00-0.77%) and the southern hemisphere (‘p’ = 0.00%). This distinct difference was also reflected by concatenated COI+COII+16S+28S+ITS-2 nucleotide sequences with an uncorrected 'p' distance of 2.34-2.69% between the taxa of northern and southern hemispheres. In accordance with the type locality the Indonesian taxa belong to the nominal species. Thus the taxa from the northern hemisphere, if they were to constitute a cryptic species of the B. caudata species complex based on molecular data, need to be formally described as a new species. The Thailand and Malaysian B. caudata populations in the northern hemisphere showed distinct genetic structure and phylogeographic pattern. PMID:26090853

Molecular characterization of the 17D-204 yellow fever vaccine.

PubMed

Salmona, Maud; Gazaignes, Sandrine; Mercier-Delarue, Severine; Garnier, Fabienne; Korimbocus, Jehanara; Colin de Verdière, Nathalie; LeGoff, Jerome; Roques, Pierre; Simon, François

2015-10-05

The worldwide use of yellow fever (YF) live attenuated vaccines came recently under close scrutiny as rare but serious adverse events have been reported. The population identified at major risk for these safety issues were extreme ages and immunocompromised subjects. Study NCT01426243 conducted by the French National Agency for AIDS research is an ongoing interventional study to evaluate the safety of the vaccine and the specific immune responses in HIV-infected patients following 17D-204 vaccination. As a preliminary study, we characterized the molecular diversity from E gene of the single 17D-204 vaccine batch used in this clinical study. Eight vials of lyophilized 17D-204 vaccine (Stamaril, Sanofi-Pasteur, Lyon, France) of the E5499 batch were reconstituted for viral quantification, cloning and sequencing of C/prM/E region. The average rate of virions per vial was 8.68 ± 0.07 log₁₀ genome equivalents with a low coefficient of variation (0.81%). 246 sequences of the C/prM/E region (29-33 per vials) were generated and analyzed for the eight vials, 25 (10%) being defective and excluded from analyses. 95% of sequences had at least one nucleotide mutation. The mutations were observed on 662 variant sites distributed through all over the 1995 nucleotides sequence and were mainly non-synonymous (66%). Genome variability between vaccine vials was highly homogeneous with a nucleotide distance ranging from 0.29% to 0.41%. Average p-distances observed for each vial were also homogeneous, ranging from 0.15% to 0.31%. This study showed a homogenous YF virus RNA quantity in vaccine vials within a single lot and a low clonal diversity inter and intra vaccine vials. These results are consistent with a recent study showing that the main mechanism of attenuation resulted in the loss of diversity in the YF virus quasi-species. Copyright © 2015 Elsevier Ltd. All rights reserved.

Phylogenetic analysis of the true water bugs (Insecta: Hemiptera: Heteroptera: Nepomorpha): evidence from mitochondrial genomes

PubMed Central

Hua, Jimeng; Li, Ming; Dong, Pengzhi; Cui, Ying; Xie, Qiang; Bu, Wenjun

2009-01-01

Background The true water bugs are grouped in infraorder Nepomorpha (Insecta: Hemiptera: Heteroptera) and are of great economic importance. The phylogenetic relationships within Nepomorpha and the taxonomic hierarchies of Pleoidea and Aphelocheiroidea are uncertain. Most of the previous studies were based on morphological characters without algorithmic assessment. In the latest study, the molecular markers employed in phylogenetic analyses were partial sequences of 16S rDNA and 18S rDNA with a total length about 1 kb. Up to now, no mitochondrial genome of the true water bugs has been sequenced, which is one of the largest data sets that could be compared across animal taxa. In this study we analyzed the unresolved problems in Nepomorpha using evidence from mitochondrial genomes. Results Nine mitochondrial genomes of Nepomorpha and five of other hemipterans were sequenced. These mitochondrial genomes contain the commonly found 37 genes without gene rearrangements. Based on the nucleotide sequences of mt-genomes, Pleoidea is not a member of the Nepomorpha and Aphelocheiroidea should be grouped back into Naucoroidea. Phylogenetic relationships among the superfamilies of Nepomorpha were resolved robustly. Conclusion The mt-genome is an effective data source for resolving intraordinal phylogenetic problems at the superfamily level within Heteroptera. The mitochondrial genomes of the true water bugs are typical insect mt-genomes. Based on the nucleotide sequences of the mt-genomes, we propose the Pleoidea to be a separate heteropteran infraorder. The infraorder Nepomorpha consists of five superfamilies with the relationships (Corixoidea + ((Naucoroidea + Notonectoidea) + (Ochteroidea + Nepoidea))). PMID:19523246

Shifts in the evolutionary rate and intensity of purifying selection between two Brassica genomes revealed by analyses of orthologous transposons and relics of a whole genome triplication.

PubMed

Zhao, Meixia; Du, Jianchang; Lin, Feng; Tong, Chaobo; Yu, Jingyin; Huang, Shunmou; Wang, Xiaowu; Liu, Shengyi; Ma, Jianxin

2013-10-01

Recent sequencing of the Brassica rapa and Brassica oleracea genomes revealed extremely contrasting genomic features such as the abundance and distribution of transposable elements between the two genomes. However, whether and how these structural differentiations may have influenced the evolutionary rates of the two genomes since their split from a common ancestor are unknown. Here, we investigated and compared the rates of nucleotide substitution between two long terminal repeats (LTRs) of individual orthologous LTR-retrotransposons, the rates of synonymous and non-synonymous substitution among triplicated genes retained in both genomes from a shared whole genome triplication event, and the rates of genetic recombination estimated/deduced by the comparison of physical and genetic distances along chromosomes and ratios of solo LTRs to intact elements. Overall, LTR sequences and genic sequences showed more rapid nucleotide substitution in B. rapa than in B. oleracea. Synonymous substitution of triplicated genes retained from a shared whole genome triplication was detected at higher rates in B. rapa than in B. oleracea. Interestingly, non-synonymous substitution was observed at lower rates in the former than in the latter, indicating shifted densities of purifying selection between the two genomes. In addition to evolutionary asymmetry, orthologous genes differentially regulated and/or disrupted by transposable elements between the two genomes were also characterized. Our analyses suggest that local genomic and epigenomic features, such as recombination rates and chromatin dynamics reshaped by independent proliferation of transposable elements and elimination between the two genomes, are perhaps partially the causes and partially the outcomes of the observed inter-specific asymmetric evolution. © 2013 Purdue University The Plant Journal © 2013 John Wiley & Sons Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahn, Anne-Catherine; Meier-Kolthoff, Jan P.; Overmars, Lex

Thioalkalivibrio is a genus of obligate chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacteria. Their habitat are soda lakes which are dual extreme environments with a pH range from 9.5 to 11 and salt concentrations up to saturation. More than 100 strains of this genus have been isolated from various soda lakes all over the world, but only ten species have been effectively described yet. Therefore, the assignment of the remaining strains to either existing or novel species is important and will further elucidate their genomic diversity as well as give a better general understanding of this genus. Recently, the genomes of 76 Thioalkalivibriomore » strains were sequenced. On these, we applied different methods including (i) 16S rRNA gene sequence analysis, (ii) Multilocus Sequence Analysis (MLSA) based on eight housekeeping genes, (iii) Average Nucleotide Identity based on BLAST (ANI b) and MUMmer (ANI m ), (iv) Tetranucleotide frequency correlation coefficients (TETRA), (v) digital DNA:DNA hybridization (dDDH) as well as (vi) nucleotide- and amino acid-based Genome BLAST Distance Phylogeny (GBDP) analyses. We detected a high genomic diversity by revealing 15 new "genomic" species and 16 new "genomic" subspecies in addition to the ten already described species. Phylogenetic and phylogenomic analyses showed that the genus is not monophyletic, because four strains were clearly separated from the other Thioalkalivibrio by type strains from other genera. Therefore, it is recommended to classify the latter group as a novel genus. The biogeographic distribution of Thioalkalivibrio suggested that the different "genomic" species can be classified as candidate disjunct or candidate endemic species. This study is a detailed genome-based classification and identification of members within the genus Thioalkalivibrio. However, future phenotypical and chemotaxonomical studies will be needed for a full species description of this genus.« less

Genomic profiling of plastid DNA variation in the Mediterranean olive tree

PubMed Central

2011-01-01

Background Characterisation of plastid genome (or cpDNA) polymorphisms is commonly used for phylogeographic, population genetic and forensic analyses in plants, but detecting cpDNA variation is sometimes challenging, limiting the applications of such an approach. In the present study, we screened cpDNA polymorphism in the olive tree (Olea europaea L.) by sequencing the complete plastid genome of trees with a distinct cpDNA lineage. Our objective was to develop new markers for a rapid genomic profiling (by Multiplex PCRs) of cpDNA haplotypes in the Mediterranean olive tree. Results Eight complete cpDNA genomes of Olea were sequenced de novo. The nucleotide divergence between olive cpDNA lineages was low and not exceeding 0.07%. Based on these sequences, markers were developed for studying two single nucleotide substitutions and length polymorphism of 62 regions (with variable microsatellite motifs or other indels). They were then used to genotype the cpDNA variation in cultivated and wild Mediterranean olive trees (315 individuals). Forty polymorphic loci were detected on this sample, allowing the distinction of 22 haplotypes belonging to the three Mediterranean cpDNA lineages known as E1, E2 and E3. The discriminating power of cpDNA variation was particularly low for the cultivated olive tree with one predominating haplotype, but more diversity was detected in wild populations. Conclusions We propose a method for a rapid characterisation of the Mediterranean olive germplasm. The low variation in the cultivated olive tree indicated that the utility of cpDNA variation for forensic analyses is limited to rare haplotypes. In contrast, the high cpDNA variation in wild populations demonstrated that our markers may be useful for phylogeographic and populations genetic studies in O. europaea. PMID:21569271

Genomic diversity within the haloalkaliphilic genus Thioalkalivibrio

DOE PAGES

Ahn, Anne-Catherine; Meier-Kolthoff, Jan P.; Overmars, Lex; ...

2017-03-10

Thioalkalivibrio is a genus of obligate chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacteria. Their habitat are soda lakes which are dual extreme environments with a pH range from 9.5 to 11 and salt concentrations up to saturation. More than 100 strains of this genus have been isolated from various soda lakes all over the world, but only ten species have been effectively described yet. Therefore, the assignment of the remaining strains to either existing or novel species is important and will further elucidate their genomic diversity as well as give a better general understanding of this genus. Recently, the genomes of 76 Thioalkalivibriomore » strains were sequenced. On these, we applied different methods including (i) 16S rRNA gene sequence analysis, (ii) Multilocus Sequence Analysis (MLSA) based on eight housekeeping genes, (iii) Average Nucleotide Identity based on BLAST (ANI b) and MUMmer (ANI m ), (iv) Tetranucleotide frequency correlation coefficients (TETRA), (v) digital DNA:DNA hybridization (dDDH) as well as (vi) nucleotide- and amino acid-based Genome BLAST Distance Phylogeny (GBDP) analyses. We detected a high genomic diversity by revealing 15 new "genomic" species and 16 new "genomic" subspecies in addition to the ten already described species. Phylogenetic and phylogenomic analyses showed that the genus is not monophyletic, because four strains were clearly separated from the other Thioalkalivibrio by type strains from other genera. Therefore, it is recommended to classify the latter group as a novel genus. The biogeographic distribution of Thioalkalivibrio suggested that the different "genomic" species can be classified as candidate disjunct or candidate endemic species. This study is a detailed genome-based classification and identification of members within the genus Thioalkalivibrio. However, future phenotypical and chemotaxonomical studies will be needed for a full species description of this genus.« less

Two distinct phylogenetic clades of infectious hematopoietic necrosis virus overlap within the Columbia River basin

USGS Publications Warehouse

Garver, K.A.; Troyer, R.M.; Kurath, G.

2003-01-01

Infectious hematopoietic necrosis virus (IHNV), an aquatic rhabdovirus, causes a highly lethal disease of salmonid fish in North America. To evaluate the genetic diversity of IHNV from throughout the Columbia River basin, excluding the Hagerman Valley, Idaho, the sequences of a 303 nt region of the glycoprotein gene (mid-G) of 120 virus isolates were determined. Sequence comparisons revealed 30 different sequence types, with a maximum nucleotide diversity of 7.3% (22 mismatches) and an intrapopulational nucleotide diversity of 0.018. This indicates that the genetic diversity of IHNV within the Columbia River basin is 3-fold higher than in Alaska, but 2-fold lower than in the Hagerman Valley, Idaho. Phylogenetic analyses separated the Columbia River basin IHNV isolates into 2 major clades, designated U and M. The 2 clades geographically overlapped within the lower Columbia River basin and in the lower Snake River and tributaries, while the upper Columbia River basin had only U clade and the upper Snake River basin had only M clade virus types. These results suggest that there are co-circulating lineages of IHNV present within specific areas of the Columbia River basin. The epidemiological significance of these findings provided insight into viral traffic patterns exhibited by IHNV in the Columbia River basin, with specific relevance to how the Columbia River basin IHNV types were related to those in the Hagerman Valley. These analyses indicate that there have likely been 2 historical events in which Hagerman Valley IHNV types were introduced and became established in the lower Columbia River basin. However, the data also clearly indicates that the Hagerman Valley is not a continuous source of waterborne virus infecting salmonid stocks downstream.

Complete cpDNA genome sequence of Smilax china and phylogenetic placement of Liliales--influences of gene partitions and taxon sampling.

PubMed

Liu, Juan; Qi, Zhe-Chen; Zhao, Yun-Peng; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

2012-09-01

The complete nucleotide sequence of the chloroplast genome (cpDNA) of Smilax china L. (Smilacaceae) is reported. It is the first complete cp genome sequence in Liliales. Genomic analyses were conducted to examine the rate and pattern of cpDNA genome evolution in Smilax relative to other major lineages of monocots. The cpDNA genomic sequences were combined with those available for Lilium to evaluate the phylogenetic position of Liliales and to investigate the influence of taxon sampling, gene sampling, gene function, natural selection, and substitution rate on phylogenetic inference in monocots. Phylogenetic analyses using sequence data of gene groups partitioned according to gene function, selection force, and total substitution rate demonstrated evident impacts of these factors on phylogenetic inference of monocots and the placement of Liliales, suggesting potential evolutionary convergence or adaptation of some cpDNA genes in monocots. Our study also demonstrated that reduced taxon sampling reduced the bootstrap support for the placement of Liliales in the cpDNA phylogenomic analysis. Analyses of sequences of 77 protein genes with some missing data and sequences of 81 genes (all protein genes plus the rRNA genes) support a sister relationship of Liliales to the commelinids-Asparagales clade, consistent with the APG III system. Analyses of 63 cpDNA protein genes for 32 taxa with few missing data, however, support a sister relationship of Liliales (represented by Smilax and Lilium) to Dioscoreales-Pandanales. Topology tests indicated that these two alignments do not significantly differ given any of these three cpDNA genomic sequence data sets. Furthermore, we found no saturation effect of the data, suggesting that the cpDNA genomic sequence data used in the study are appropriate for monocot phylogenetic study and long-branch attraction is unlikely to be the cause to explain the result of two well-supported, conflict placements of Liliales. Further analyses using sufficient nuclear data remain necessary to evaluate these two phylogenetic hypotheses regarding the position of Liliales and to address the causes of signal conflict among genes and partitions. Copyright © 2012 Elsevier Inc. All rights reserved.

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Finding similar nucleotide sequences using network BLAST searches.

PubMed

Ladunga, Istvan

2009-06-01

The Basic Local Alignment Search Tool (BLAST) is a keystone of bioinformatics due to its performance and user-friendliness. Beginner and intermediate users will learn how to design and submit blastn and Megablast searches on the Web pages at the National Center for Biotechnology Information. We map nucleic acid sequences to genomes, find identical or similar mRNA, expressed sequence tag, and noncoding RNA sequences, and run Megablast searches, which are much faster than blastn. Understanding results is assisted by taxonomy reports, genomic views, and multiple alignments. We interpret expected frequency thresholds, biological significance, and statistical significance. Weak hits provide no evidence, but hints for further analyses. We find genes that may code for homologous proteins by translated BLAST. We reduce false positives by filtering out low-complexity regions. Parsed BLAST results can be integrated into analysis pipelines. Links in the output connect to Entrez, PUBMED, structural, sequence, interaction, and expression databases. This facilitates integration with a wide spectrum of biological knowledge.

Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades

PubMed Central

2009-01-01

Background Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. Results To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Conclusion Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences. PMID:19821996

Tardigrade workbench: comparing stress-related proteins, sequence-similar and functional protein clusters as well as RNA elements in tardigrades.

PubMed

Förster, Frank; Liang, Chunguang; Shkumatov, Alexander; Beisser, Daniela; Engelmann, Julia C; Schnölzer, Martina; Frohme, Marcus; Müller, Tobias; Schill, Ralph O; Dandekar, Thomas

2009-10-12

Tardigrades represent an animal phylum with extraordinary resistance to environmental stress. To gain insights into their stress-specific adaptation potential, major clusters of related and similar proteins are identified, as well as specific functional clusters delineated comparing all tardigrades and individual species (Milnesium tardigradum, Hypsibius dujardini, Echiniscus testudo, Tulinus stephaniae, Richtersius coronifer) and functional elements in tardigrade mRNAs are analysed. We find that 39.3% of the total sequences clustered in 58 clusters of more than 20 proteins. Among these are ten tardigrade specific as well as a number of stress-specific protein clusters. Tardigrade-specific functional adaptations include strong protein, DNA- and redox protection, maintenance and protein recycling. Specific regulatory elements regulate tardigrade mRNA stability such as lox P DICE elements whereas 14 other RNA elements of higher eukaryotes are not found. Further features of tardigrade specific adaption are rapidly identified by sequence and/or pattern search on the web-tool tardigrade analyzer http://waterbear.bioapps.biozentrum.uni-wuerzburg.de. The work-bench offers nucleotide pattern analysis for promotor and regulatory element detection (tardigrade specific; nrdb) as well as rapid COG search for function assignments including species-specific repositories of all analysed data. Different protein clusters and regulatory elements implicated in tardigrade stress adaptations are analysed including unpublished tardigrade sequences.

Cloning and molecular characterization of the betaine aldehyde dehydrogenase involved in the biosynthesis of glycine betaine in white shrimp (Litopenaeus vannamei).

PubMed

Delgado-Gaytán, María F; Rosas-Rodríguez, Jesús A; Yepiz-Plascencia, Gloria; Figueroa-Soto, Ciria G; Valenzuela-Soto, Elisa M

2017-10-01

The enzyme betaine aldehyde dehydrogenase (BADH) catalyzes the irreversible oxidation of betaine aldehyde to glycine betaine (GB), a very efficient osmolyte accumulated during osmotic stress. In this study, we determined the nucleotide sequence of the cDNA for the BADH from the white shrimp Litopenaeus vannamei (LvBADH). The cDNA was 1882 bp long, with a complete open reading frame of 1524 bp, encoding 507 amino acids with a predicted molecular mass of 54.15 kDa and a pI of 5.4. The predicted LvBADH amino acid sequence shares a high degree of identity with marine invertebrate BADHs. Catalytic residues (C-298, E-264 and N-167) and the decapeptide VTLELGGKSP involved in nucleotide binding and highly conserved in BADHs were identified in the amino acid sequence. Phylogenetic analyses classified LvBADH in a clade that includes ALDH9 sequences from marine invertebrates. Molecular modeling of LvBADH revealed that the protein has amino acid residues and sequence motifs essential for the function of the ALDH9 family of enzymes. LvBADH modeling showed three potential monovalent cation binding sites, one site is located in an intra-subunit cavity; other in an inter-subunit cavity and a third in a central-cavity of the protein. The results show that LvBADH shares a high degree of identity with BADH sequences from marine invertebrates and enzymes that belong to the ALDH9 family. Our findings suggest that the LvBADH has molecular mechanisms of regulation similar to those of other BADHs belonging to the ALDH9 family, and that BADH might be playing a role in the osmoregulation capacity of L. vannamei. Copyright © 2017 Elsevier B.V. All rights reserved.

Mining biological databases for candidate disease genes

NASA Astrophysics Data System (ADS)

Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

2001-07-01

The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

PubMed

Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

2006-07-01

To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

RNAi-mediated endogene silencing in strawberry fruit: detection of primary and secondary siRNAs by deep sequencing.

PubMed

Härtl, Katja; Kalinowski, Gregor; Hoffmann, Thomas; Preuss, Anja; Schwab, Wilfried

2017-05-01

RNA interference (RNAi) has been exploited as a reverse genetic tool for functional genomics in the nonmodel species strawberry (Fragaria × ananassa) since 2006. Here, we analysed for the first time different but overlapping nucleotide sections (>200 nt) of two endogenous genes, FaCHS (chalcone synthase) and FaOMT (O-methyltransferase), as inducer sequences and a transitive vector system to compare their gene silencing efficiencies. In total, ten vectors were assembled each containing the nucleotide sequence of one fragment in sense and corresponding antisense orientation separated by an intron (inverted hairpin construct, ihp). All sequence fragments along the full lengths of both target genes resulted in a significant down-regulation of the respective gene expression and related metabolite levels. Quantitative PCR data and successful application of a transitive vector system coinciding with a phenotypic change suggested propagation of the silencing signal. The spreading of the signal in strawberry fruit in the 3' direction was shown for the first time by the detection of secondary small interfering RNAs (siRNAs) outside of the primary targets by deep sequencing. Down-regulation of endogenes by the transitive method was less effective than silencing by ihp constructs probably because the numbers of primary siRNAs exceeded the quantity of secondary siRNAs by three orders of magnitude. Besides, we observed consistent hotspots of primary and secondary siRNA formation along the target sequence which fall within a distance of less than 200 nt. Thus, ihp vectors seem to be superior over the transitive vector system for functional genomics in strawberry fruit. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

USGS Publications Warehouse

Bjorklund, H.V.; Higman, K.H.; Kurath, G.

1996-01-01

The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2–33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

USGS Publications Warehouse

Bjorklund, H.V.; Higman, K.H.; Kurath, G.

1996-01-01

The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2-33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

Transcriptome and target DNA enrichment sequence data provide new insights into the phylogeny of vespid wasps (Hymenoptera: Aculeata: Vespidae).

PubMed

Bank, Sarah; Sann, Manuela; Mayer, Christoph; Meusemann, Karen; Donath, Alexander; Podsiadlowski, Lars; Kozlov, Alexey; Petersen, Malte; Krogmann, Lars; Meier, Rudolf; Rosa, Paolo; Schmitt, Thomas; Wurdack, Mareike; Liu, Shanlin; Zhou, Xin; Misof, Bernhard; Peters, Ralph S; Niehuis, Oliver

2017-11-01

The wasp family Vespidae comprises more than 5000 described species which represent life history strategies ranging from solitary and presocial to eusocial and socially parasitic. The phylogenetic relationships of the major vespid wasp lineages (i.e., subfamilies and tribes) have been investigated repeatedly by analyzing behavioral and morphological traits as well as nucleotide sequences of few selected genes with largely incongruent results. Here we reconstruct their phylogenetic relationships using a phylogenomic approach. We sequenced the transcriptomes of 24 vespid wasp and eight outgroup species and exploited the transcript sequences for design of probes for enriching 913 single-copy protein-coding genes to complement the transcriptome data with nucleotide sequence data from additional 25 ethanol-preserved vespid species. Results from phylogenetic analyses of the combined sequence data revealed the eusocial subfamily Stenogastrinae to be the sister group of all remaining Vespidae, while the subfamily Eumeninae turned out to be paraphyletic. Of the three currently recognized eumenine tribes, Odynerini is paraphyletic with respect to Eumenini, and Zethini is paraphyletic with respect to Polistinae and Vespinae. Our results are in conflict with the current tribal subdivision of Eumeninae and thus, we suggest granting subfamily rank to the two major clades of "Zethini": Raphiglossinae and Zethinae. Overall, our findings corroborate the hypothesis of two independent origins of eusociality in vespid wasps and suggest a single origin of using masticated and salivated plant material for building nests by Raphiglossinae, Zethinae, Polistinae, and Vespinae. The inferred phylogenetic relationships and the open access vespid wasp target DNA enrichment probes will provide a valuable tool for future comparative studies on species of the family Vespidae, including their genomes, life styles, evolution of sociality, and co-evolution with other organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA sequence-based comparative studies between non-extremophile and extremophile organisms with implications in exobiology

NASA Astrophysics Data System (ADS)

Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.

2008-08-01

We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

PubMed

Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

2014-07-01

Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Inter- and intraspecific mitochondrial DNA variation in North American bears (Ursus)

USGS Publications Warehouse

Cronin, Matthew A.; Amstrup, Steven C.; Garner, Gerald W.; Vyse, Ernest R.

1991-01-01

We assessed mitochondrial DNA variation in North American black bears (Ursus americanus), brown bears (Ursus arctos), and polar bears (Ursus maritimus). Divergent mitochondrial DNA haplotypes (0.05 base substitutions per nucleotide) were identified in populations of black bears from Montana and Oregon. In contrast, very similar haplotypes occur in black bears across North America. This discordance of haplotype phylogeny and geographic distribution indicates that there has been maintenance of polymorphism and considerable gene flow throughout the history of the species. Intraspecific mitochondrial DNA sequence divergence in brown bears and polar bears is lower than in black bears. The two morphological forms of U. arctos, grizzly and coastal brown bears, are not in distinct mtDNA lineages. Interspecific comparisons indicate that brown bears and polar bears share similar mitochondrial DNA (0.023 base substitutions per nucleotide) which is quite divergent (0.078 base substitutions per nucleotide) from that of black bears. High mitochondrial DNA divergence within black bears and paraphyletic relationships of brown and polar bear mitochondrial DNA indicate that intraspecific variation across species' ranges should be considered in phylogenetic analyses of mitochondrial DNA.

Preparation, purification and analyses of thirteen alkali-stable dinucleotides from ribonucleic acid

PubMed Central

Trim, A. R.; Parker, Janet E.

1970-01-01

Of the 16 alkali-stable dinucleotides known to be obtained by hydrolysis of commercial yeast RNA with alkali, 13 were prepared in quantities of the order of 10mg or more. The samples, with only one exception, contain at least 90% of dinucleotide, and spectroscopic constants and nucleotide-sequence determinations, although not conclusive, indicate a high degree of purity of these products. The small dinucleotide fraction in 150g of RNA hydrolysed with alkali (1–2% of the total nucleotides) was separated from the mononucleotides by stepwise ion-exchange chromatography on DEAE-cellulose columns and resolved into seven fractions containing from one to four different dinucleotides by electrophoresis on paper at pH3.0. These fractions were resolved into their constituent dinucleotides by chromatography in ammonium sulphate. Contamination of the products by impurities from the paper was minimized by washing it before using it for chromatography or electrophoresis and, by using a thick grade of paper (Whatman no. 17), it was possible to handle and purify relatively large quantities of nucleotides. PMID:5435489

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Software for optimization of SNP and PCR-RFLP genotyping to discriminate many genomes with the fewest assays

PubMed Central

Gardner, Shea N; Wagner, Mark C

2005-01-01

Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization) software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed) are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As more sequence data becomes available for multiple strains and isolates of a species, automated, computational approaches such as those described here will be essential to make sense of large amounts of information, and to guide and optimize efforts in the laboratory. The software and source code for SPR Opt is publicly available and free for non-profit use at . PMID:15904493

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

PubMed Central

Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

2013-01-01

The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

In-cell RNA structure probing with SHAPE-MaP.

PubMed

Smola, Matthew J; Weeks, Kevin M

2018-06-01

This protocol is an extension to: Nat. Protoc. 10, 1643-1669 (2015); doi:10.1038/nprot.2015.103; published online 01 October 2015RNAs play key roles in many cellular processes. The underlying structure of RNA is an important determinant of how transcripts function, are processed, and interact with RNA-binding proteins and ligands. RNA structure analysis by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) takes advantage of the reactivity of small electrophilic chemical probes that react with the 2'-hydroxyl group to assess RNA structure at nucleotide resolution. When coupled with mutational profiling (MaP), in which modified nucleotides are detected as internal miscodings during reverse transcription and then read out by massively parallel sequencing, SHAPE yields quantitative per-nucleotide measurements of RNA structure. Here, we provide an extension to our previous in vitro SHAPE-MaP protocol with detailed guidance for undertaking and analyzing SHAPE-MaP probing experiments in live cells. The MaP strategy works for both abundant-transcriptome experiments and for cellular RNAs of low to moderate abundance, which are not well examined by whole-transcriptome methods. In-cell SHAPE-MaP, performed in roughly 3 d, can be applied in cell types ranging from bacteria to cultured mammalian cells and is compatible with a variety of structure-probing reagents. We detail several strategies by which in-cell SHAPE-MaP can inform new biological hypotheses and emphasize downstream analyses that reveal sequence or structure motifs important for RNA interactions in cells.

Genetic analysis of paramyxovirus isolates from pacific salmon reveals two independently co-circulating lineages

USGS Publications Warehouse

Batts, W.N.; Falk, K.; Winton, J.R.

2008-01-01

Viruses with the morphological and biochemical characteristics of the family Paramyxoviridae (paramyxoviruses) have been isolated from adult salmon returning to rivers along the Pacific coast of North America since 1982. These Pacific salmon paramyxoviruses (PSPV), which have mainly been isolated from Chinook salmon Oncorhynchus tshawytscha, grow slowly in established fish cell lines and have not been associated with disease. Genetic analysis of a 505-base-pair region of the polymerase gene from 47 PsPV isolates produced 17 nucleotide sequence types that could be grouped into two major sublineages, designated A and B. The two independently co-circulating sublineages differed by 12.1-13.9% at the nucleotide level but by only 1.2% at the amino acid level. Isolates of PSPV from adult Pacific salmon returning to rivers from Alaska to California over a 25-year period showed little evidence of geographic or temporal grouping. Phylogenetic analyses revealed that these paramyxoviruses of Pacific salmon were most closely related to the Atlantic salmon paramyxovirus (ASPV) from Norway, having a maximum nucleotide diversity of 26.1 % and an amino acid diversity of 19.0%. When compared with homologous sequences of other paramyxoviruses, PSPV and ASPV were sufficiently distinct to suggest that they are not clearly members of any of the established genera in the family Paramyxoviridae. in the course of this study, a polymerase chain reaction assay was developed that can be used for confirmatory identification of PSPV. ?? Copyright by the American Fisheries Society 2008.

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Association of DGAT2 gene polymorphisms with carcass and meat quality traits in domestic pigeons (Columba livia).

PubMed

Mao, H G; Dong, X Y; Cao, H Y; Xu, N Y; Yin, Z Z

2018-04-01

1. Diacylglycerol acyltransferase (DGAT) plays an important role in the synthesis of triacylglycerol, but its effects on meat quality and carcass composition in pigeons are unclear. In this study, single-nucleotide polymorphisms (SNPs) in the exons of the DGAT2 gene were identified and analysed by using DNA sequencing methods in 200 domestic pigeons (Columba livia). The associations between DGAT2 polymorphisms and carcass and meat quality traits were also analysed. 2. Sequencing results showed that 5 nucleotide mutations were detected in exons 3, 4, 5 and 6 of the DGAT2 gene. The analysis revealed three genotypes (AA, AB and BB) in G18398T and G22484C, in which the AA genotype and A allele had the highest frequency. 3. In the SNP of G18398T located in exon 5, individuals with genotype BB had significantly higher meat quality and lower abdominal fat content than those with AA or AB genotype. In the SNP of G22484C located in exon 6, the genotype AA showed highest carcass trait values, while the genotype BB represented better meat quality, compared to AA and AB genotypes. 4. The results imply that DGAT2 gene has a close relationship with carcass and meat quality traits in pigeons, and the SNPs of G18398T and G22484C can be used as genetic markers for marker-assisted breeding in pigeon.

Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-04-20

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

Population Genomics of Fungal and Oomycete Pathogens.

PubMed

Grünwald, Niklaus J; McDonald, Bruce A; Milgroom, Michael G

2016-08-04

We are entering a new era in plant pathology in which whole-genome sequences of many individuals of a pathogen species are becoming readily available. Population genomics aims to discover genetic mechanisms underlying phenotypes associated with adaptive traits such as pathogenicity, virulence, fungicide resistance, and host specialization, as genome sequences or large numbers of single nucleotide polymorphisms become readily available from multiple individuals of the same species. This emerging field encompasses detailed genetic analyses of natural populations, comparative genomic analyses of closely related species, identification of genes under selection, and linkage analyses involving association studies in natural populations or segregating populations resulting from crosses. The era of pathogen population genomics will provide new opportunities and challenges, requiring new computational and analytical tools. This review focuses on conceptual and methodological issues as well as the approaches to answering questions in population genomics. The major steps start with defining relevant biological and evolutionary questions, followed by sampling, genotyping, and phenotyping, and ending in analytical methods and interpretations. We provide examples of recent applications of population genomics to fungal and oomycete plant pathogens.

Phylogenetic relationships in Taxodiaceae and Cupressaceae sensu stricto based on matK gene, chlL gene, trnL-trnF IGS region, and trnL intron sequences.

PubMed

Kusumi, J; Tsumura, Y; Yoshimaru, H; Tachida, H

2000-10-01

Nucleotide sequences from four chloroplast genes, the matK, chlL, intergenic spacer (IGS) region between trnL and trnF, and an intron of trnL, were determined from all species of Taxodiaceae and five species of Cupressaceae sensu stricto (s.s.). Phylogenetic trees were constructed using the maximum parsimony and the neighbor-joining methods with Cunninghamia as an outgroup. These analyses provided greater resolution of relationships among genera and higher bootstrap supports for clades compared to previous analyses. Results indicate that Taiwania diverged first, and then Athrotaxis diverged from the remaining genera. Metasequoia, Sequoia, and Sequoiadendron form a clade. Taxodium and Glyptostrobus form a clade, which is the sister to Cryptomeria. Cupressaceae s.s. are derived from within Taxodiaceae, being the most closely related to the Cryptomeria/Taxodium/Glyptostrobus clade. These relationships are consistent with previous morphological groupings and the analyses of molecular data. In addition, we found acceleration of evolutionary rates in Cupressaceae s.s. Possible causes for the acceleration are discussed.

Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

PubMed

Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

2015-10-01

Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA.

PubMed

Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C

2015-01-01

Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

SparkSeq: fast, scalable and cloud-ready tool for the interactive genomic data analysis with nucleotide precision.

PubMed

Wiewiórka, Marek S; Messina, Antonio; Pacholewska, Alicja; Maffioletti, Sergio; Gawrysiak, Piotr; Okoniewski, Michał J

2014-09-15

Many time-consuming analyses of next -: generation sequencing data can be addressed with modern cloud computing. The Apache Hadoop-based solutions have become popular in genomics BECAUSE OF: their scalability in a cloud infrastructure. So far, most of these tools have been used for batch data processing rather than interactive data querying. The SparkSeq software has been created to take advantage of a new MapReduce framework, Apache Spark, for next-generation sequencing data. SparkSeq is a general-purpose, flexible and easily extendable library for genomic cloud computing. It can be used to build genomic analysis pipelines in Scala and run them in an interactive way. SparkSeq opens up the possibility of customized ad hoc secondary analyses and iterative machine learning algorithms. This article demonstrates its scalability and overall fast performance by running the analyses of sequencing datasets. Tests of SparkSeq also prove that the use of cache and HDFS block size can be tuned for the optimal performance on multiple worker nodes. Available under open source Apache 2.0 license: https://bitbucket.org/mwiewiorka/sparkseq/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Integrated databanks access and sequence/structure analysis services at the PBIL.

PubMed

Perrière, Guy; Combet, Christophe; Penel, Simon; Blanchet, Christophe; Thioulouse, Jean; Geourjon, Christophe; Grassot, Julien; Charavay, Céline; Gouy, Manolo; Duret, Laurent; Deléage, Gilbert

2003-07-01

The World Wide Web server of the PBIL (Pôle Bioinformatique Lyonnais) provides on-line access to sequence databanks and to many tools of nucleic acid and protein sequence analyses. This server allows to query nucleotide sequence banks in the EMBL and GenBank formats and protein sequence banks in the SWISS-PROT and PIR formats. The query engine on which our data bank access is based is the ACNUC system. It allows the possibility to build complex queries to access functional zones of biological interest and to retrieve large sequence sets. Of special interest are the unique features provided by this system to query the data banks of gene families developed at the PBIL. The server also provides access to a wide range of sequence analysis methods: similarity search programs, multiple alignments, protein structure prediction and multivariate statistics. An originality of this server is the integration of these two aspects: sequence retrieval and sequence analysis. Indeed, thanks to the introduction of re-usable lists, it is possible to perform treatments on large sets of data. The PBIL server can be reached at: http://pbil.univ-lyon1.fr.