[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Mosaic organization of DNA nucleotides

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

1994-01-01

Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

PubMed

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

PubMed Central

Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro

2014-01-01

The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

PubMed Central

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-01-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

PubMed

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

PubMed Central

O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

2006-01-01

Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Complete genome analysis of dengue virus type 3 isolated from the 2013 dengue outbreak in Yunnan, China.

PubMed

Wang, Xiaodan; Ma, Dehong; Huang, Xinwei; Li, Lihua; Li, Duo; Zhao, Yujiao; Qiu, Lijuan; Pan, Yue; Chen, Junying; Xi, Juemin; Shan, Xiyun; Sun, Qiangming

2017-06-15

In the past few decades, dengue has spread rapidly and is an emerging disease in China. An unexpected dengue outbreak occurred in Xishuangbanna, Yunnan, China, resulting in 1331 patients in 2013. In order to obtain the complete genome information and perform mutation and evolutionary analysis of causative agent related to this largest outbreak of dengue fever. The viruses were isolated by cell culture and evaluated by genome sequence analysis. Phylogenetic trees were then constructed by Neighbor-Joining methods (MEGA6.0), followed by analysis of nucleotide mutation and amino acid substitution. The analysis of the diversity of secondary structure for E and NS1 protein were also performed. Then selection pressures acting on the coding sequences were estimated by PAML software. The complete genome sequences of two isolated strains (YNSW1, YNSW2) were 10,710 and 10,702 nucleotides in length, respectively. Phylogenetic analysis revealed both strain were classified as genotype II of DENV-3. The results indicated that both isolated strains of Xishuangbanna in 2013 and Laos 2013 stains (KF816161.1, KF816158.1, LC147061.1, LC147059.1, KF816162.1) were most similar to Bangladesh (AY496873.2) in 2002. After comparing with the DENV-3SS (H87) 62 amino acid substitutions were identified in translated regions, and 38 amino acid substitutions were identified in translated regions compared with DENV-3 genotype II stains Bangladesh (AY496873.2). 27(YNSW1) or 28(YNSW2) single nucleotide changes were observed in structural protein sequences with 7(YNSW1) or 8(YNSW2) non-synonymous mutations compared with AY496873.2. Of them, 4 non-synonymous mutations were identified in E protein sequences with (2 in the β-sheet, 2 in the coil). Meanwhile, 117(YNSW1) or 115 (YNSW2) single nucleotide changes were observed in non-structural protein sequences with 31(YNSW1) or 30 (YNSW2) non-synonymous mutations. Particularly, 14 single nucleotide changes were observed in NS1 sequences with 4/14 non-synonymous substitutions (4 in the coil). Selection pressure analysis revealed no positive selection in the amino acid sites of the genes encoding for structural and non-structural proteins. This study may help understand the intrinsic geographical relatedness of dengue virus 3 and contributes further to research on their infectivity, pathogenicity and vaccine development. Copyright © 2017 Elsevier B.V. All rights reserved.

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

PubMed Central

Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

2006-01-01

A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Complete Genome Sequence of Porcine Parvovirus 2 Recovered from Swine Sera

PubMed Central

Kluge, M.; Franco, A. C.; Giongo, A.; Valdez, F. P.; Saddi, T. M.; Brito, W. M. E. D.; Roehe, P. M.

2016-01-01

A complete genomic sequence of porcine parvovirus 2 (PPV-2) was detected by viral metagenome analysis on swine sera. A phylogenetic analysis of this genome reveals that it is highly similar to previously reported North American PPV-2 genomes. The complete PPV-2 sequence is 5,426 nucleotides long. PMID:26823583

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Reference genotype and exome data from an Australian Aboriginal population for health-based research

PubMed Central

Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.

2016-01-01

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114

Reference genotype and exome data from an Australian Aboriginal population for health-based research.

PubMed

Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M

2016-04-12

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

PubMed

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer.

PubMed

Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji

2010-07-01

We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular characterization of a novel Nucleorhabdovirus from black currant identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence similarities to several nucleorhabdoviruses were identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genomic sequence of this new nucleorhabdovirus is 14,432 nucleotides. Its genomic organization is typical of nucleorh...

SNP discovery through de novo deep sequencing using the next generation of DNA sequencers

USDA-ARS?s Scientific Manuscript database

The production of high volumes of DNA sequence data using new technologies has permitted more efficient identification of single nucleotide polymorphisms in vertebrate genomes. This chapter presented practical methodology for production and analysis of DNA sequence data for SNP discovery....

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Asystasia mosaic Madagascar virus: a novel bipartite begomovirus infecting the weed Asystasia gangetica in Madagascar.

PubMed

De Bruyn, Alexandre; Harimalala, Mireille; Hoareau, Murielle; Ranomenjanahary, Sahondramalala; Reynaud, Bernard; Lefeuvre, Pierre; Lett, Jean-Michel

2015-06-01

Here, we describe for the first time the complete genome sequence of a new bipartite begomovirus in Madagascar isolated from the weed Asystasia gangetica (Acanthaceae), for which we propose the tentative name asystasia mosaic Madagascar virus (AMMGV). DNA-A and -B nucleotide sequences of AMMGV were only distantly related to known begomovirus sequence and shared highest nucleotide sequence identity of 72.9 % (DNA-A) and 66.9 % (DNA-B) with a recently described bipartite begomovirus infecting Asystasia sp. in West Africa. Phylogenetic analysis demonstrated that this novel virus from Madagascar belongs to a new lineage of Old World bipartite begomoviruses.

Molecular variability analysis of five new complete cacao swollen shoot virus genomic sequences.

PubMed

Muller, E; Sackey, S

2005-01-01

Cacao swollen shoot virus (CSSV), a member of the family Caulimovi-ridae, genus Badnavirus occurs in all the main cacao-growing areas of West Africa. We amplified, cloned and sequenced complete genomes of five new isolates, two originating from Togo and three originating from Ghana. The genome of these five newly sequenced isolates all contain the five putative open reading frames I, II, III, X and Y described for the first sequenced CSSV isolate, Agou1 originating from Togo. Their genomes have been aligned with the genome of Agou1. The nucleotide and amino acid sequence identities between isolates have been calculated and a phylogenetic analysis has been made including other pararetroviruses. Maximum nucleotide sequence variability between complete genomes of CSSV isolates was 29.4%. Geographical differentiation between isolates appears more important than differentiation between mild and severe isolates. ORF X differs greatly in size and sequence between the Togolese isolates Nyongbo2 and Agou1, and the four other isolates, its functional role is therefore clearly questionable.

Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

PubMed Central

Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

2011-01-01

We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Complete Genome Sequence of Porcine Parvovirus 2 Recovered from Swine Sera.

PubMed

Campos, F S; Kluge, M; Franco, A C; Giongo, A; Valdez, F P; Saddi, T M; Brito, W M E D; Roehe, P M

2016-01-28

A complete genomic sequence of porcine parvovirus 2 (PPV-2) was detected by viral metagenome analysis on swine sera. A phylogenetic analysis of this genome reveals that it is highly similar to previously reported North American PPV-2 genomes. The complete PPV-2 sequence is 5,426 nucleotides long. Copyright © 2016 Campos et al.

Molecular characterization of a novel Luteovirus from peach identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence homologies to Cherry-associated luteovirus were identified by high-throughput sequencing analysis of two peach accessions undergoing quarantine testing. The complete genomic sequences of the two isolates of this virus are 5,819 and 5,814 nucleotides. Their genome organization i...

Detection and characterization of hepatitis A virus circulating in Egypt.

PubMed

Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam

2017-07-01

Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

PubMed

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Prediction and phylogenetic analysis of mammalian short interspersed elements (SINEs).

PubMed

Rogozin, I B; Mayorov, V I; Lavrentieva, M V; Milanesi, L; Adkison, L R

2000-09-01

The presence of repetitive elements can create serious problems for sequence analysis, especially in the case of homology searches in nucleotide sequence databases. Repetitive elements should be treated carefully by using special programs and databases. In this paper, various aspects of SINE (short interspersed repetitive element) identification, analysis and evolution are discussed.

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

Translational genomics for analysis of complex traits in peanut and sorghum

USDA-ARS?s Scientific Manuscript database

The integration of sequencing and genotype data from natural variation studies (by whole genome resequencing [wgs] or genotype by sequencing [gbs]), transcriptome (RNA-seq) and mutant analysis (also by wgs) facilitated the development of DNA markers in the form of single nucleotide polymorphic (SNP)...

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

PubMed Central

Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

1996-01-01

Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

Molecular Characterization of Bombyx mori Cytoplasmic Polyhedrosis Virus Genome Segment 4

PubMed Central

Ikeda, Keiko; Nagaoka, Sumiharu; Winkler, Stefan; Kotani, Kumiko; Yagi, Hiroaki; Nakanishi, Kae; Miyajima, Shigetoshi; Kobayashi, Jun; Mori, Hajime

2001-01-01

The complete nucleotide sequence of the genome segment 4 (S4) of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) was determined. The 3,259-nucleotide sequence contains a single long open reading frame which spans nucleotides 14 to 3187 and which is predicted to encode a protein with a molecular mass of about 130 kDa. Western blot analysis showed that S4 encodes BmCPV protein VP3, which is one of the outer components of the BmCPV virion. Sequence analysis of the deduced amino acid sequence of BmCPV VP3 revealed possible sequence homology with proteins from rice ragged stunt virus (RRSV) S2, Nilaparvata lugens reovirus S4, and Fiji disease fijivirus S4. This may suggest that plant reoviruses originated from insect viruses and that RRSV emerged more recently than other plant reoviruses. A chimeric protein consisting of BmCPV VP3 and green fluorescent protein (GFP) was constructed and expressed with BmCPV polyhedrin using a baculovirus expression vector. The VP3-GFP chimera was incorporated into BmCPV polyhedra and released under alkaline conditions. The results indicate that specific interactions occur between BmCPV polyhedrin and VP3 which might facilitate BmCPV virion occlusion into the polyhedra. PMID:11134312

Comparing the normalization methods for the differential analysis of Illumina high-throughput RNA-Seq data.

PubMed

Li, Peipei; Piao, Yongjun; Shon, Ho Sun; Ryu, Keun Ho

2015-10-28

Recently, rapid improvements in technology and decrease in sequencing costs have made RNA-Seq a widely used technique to quantify gene expression levels. Various normalization approaches have been proposed, owing to the importance of normalization in the analysis of RNA-Seq data. A comparison of recently proposed normalization methods is required to generate suitable guidelines for the selection of the most appropriate approach for future experiments. In this paper, we compared eight non-abundance (RC, UQ, Med, TMM, DESeq, Q, RPKM, and ERPKM) and two abundance estimation normalization methods (RSEM and Sailfish). The experiments were based on real Illumina high-throughput RNA-Seq of 35- and 76-nucleotide sequences produced in the MAQC project and simulation reads. Reads were mapped with human genome obtained from UCSC Genome Browser Database. For precise evaluation, we investigated Spearman correlation between the normalization results from RNA-Seq and MAQC qRT-PCR values for 996 genes. Based on this work, we showed that out of the eight non-abundance estimation normalization methods, RC, UQ, Med, TMM, DESeq, and Q gave similar normalization results for all data sets. For RNA-Seq of a 35-nucleotide sequence, RPKM showed the highest correlation results, but for RNA-Seq of a 76-nucleotide sequence, least correlation was observed than the other methods. ERPKM did not improve results than RPKM. Between two abundance estimation normalization methods, for RNA-Seq of a 35-nucleotide sequence, higher correlation was obtained with Sailfish than that with RSEM, which was better than without using abundance estimation methods. However, for RNA-Seq of a 76-nucleotide sequence, the results achieved by RSEM were similar to without applying abundance estimation methods, and were much better than with Sailfish. Furthermore, we found that adding a poly-A tail increased alignment numbers, but did not improve normalization results. Spearman correlation analysis revealed that RC, UQ, Med, TMM, DESeq, and Q did not noticeably improve gene expression normalization, regardless of read length. Other normalization methods were more efficient when alignment accuracy was low; Sailfish with RPKM gave the best normalization results. When alignment accuracy was high, RC was sufficient for gene expression calculation. And we suggest ignoring poly-A tail during differential gene expression analysis.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Molecular detection of kobuviruses in European roe deer (Capreolus capreolus) in Italy.

PubMed

Di Martino, Barbara; Di Profio, Federica; Melegari, Irene; Di Felice, Elisabetta; Robetto, Serena; Guidetti, Cristina; Orusa, Riccardo; Martella, Vito; Marsilio, Fulvio

2015-08-01

Kobuvirus RNA was found in 6.6 % (13/198) of stool specimens from roe deer (Capreolus capreolus) captured during the regular hunting season. Upon sequence analysis of a fragment of the 3D gene, nine strains displayed the highest nucleotide sequence identity (91.2-97.4 %) to bovine kobuviruses previously detected in either diarrhoeic or asymptomatic calves. Interestingly, four strains were genetically related to the newly discovered caprine kobuviruses (84.2-87.6 % nucleotide identity) identified in black goats in Korea.

Major soybean maturity gene haplotypes revealed by SNPViz analysis of 72 sequenced soybean genomes

USDA-ARS?s Scientific Manuscript database

In this Genomics Era, vast amounts of next generation sequencing data have become publicly-available for multiple genomes across hundreds of species. Analysis of these large-scale datasets can become cumbersome, especially when comparing nucleotide polymorphisms across many samples within a dataset...

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Systematic and stochastic influences on the performance of the MinION nanopore sequencer across a range of nucleotide bias

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.

Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less

Systematic and stochastic influences on the performance of the MinION nanopore sequencer across a range of nucleotide bias

DOE PAGES

Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.; ...

2018-02-16

Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

Comprehensive analysis of the T-cell receptor beta chain gene in rhesus monkey by high throughput sequencing

PubMed Central

Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui

2015-01-01

Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Genetic discovery in Xylella fastidiosa through sequence analysis of selected randomly amplified polymorphic DNAs.

PubMed

Chen, Jianchi; Civerolo, Edwin L; Jarret, Robert L; Van Sluys, Marie-Anne; de Oliveira, Mariana C

2005-02-01

Xylella fastidiosa causes many important plant diseases including Pierce's disease (PD) in grape and almond leaf scorch disease (ALSD). DNA-based methodologies, such as randomly amplified polymorphic DNA (RAPD) analysis, have been playing key roles in genetic information collection of the bacterium. This study further analyzed the nucleotide sequences of selected RAPDs from X. fastidiosa strains in conjunction with the available genome sequence databases and unveiled several previously unknown novel genetic traits. These include a sequence highly similar to those in the phage family of Podoviridae. Genome comparisons among X. fastidiosa strains suggested that the "phage" is currently active. Two other RAPDs were also related to horizontal gene transfer: one was part of a broadly distributed cryptic plasmid and the other was associated with conjugal transfer. One RAPD inferred a genomic rearrangement event among X. fastidiosa PD strains and another identified a single nucleotide polymorphism of evolutionary value.

Bifidobacterium aquikefiri sp. nov., isolated from water kefir.

PubMed

Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter

2016-03-01

A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T  = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

PubMed

M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

2007-12-01

Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.

3D RNA and functional interactions from evolutionary couplings

PubMed Central

Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.

2016-01-01

Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444

Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human.

PubMed

Magness, Charles L; Fellin, P Campion; Thomas, Matthew J; Korth, Marcus J; Agy, Michael B; Proll, Sean C; Fitzgibbon, Matthew; Scherer, Christina A; Miner, Douglas G; Katze, Michael G; Iadonato, Shawn P

2005-01-01

We report the initial sequencing and comparative analysis of the Macaca mulatta transcriptome. Cloned sequences from 11 tissues, nine animals, and three species (M. mulatta, M. fascicularis, and M. nemestrina) were sampled, resulting in the generation of 48,642 sequence reads. These data represent an initial sampling of the putative rhesus orthologs for 6,216 human genes. Mean nucleotide diversity within M. mulatta and sequence divergence among M. fascicularis, M. nemestrina, and M. mulatta are also reported.

Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

PubMed

Rurek, M; Oczkowski, M; Augustyniak, H

1998-01-01

A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Complete genome analysis of jasmine virus T from Jasminum sambac in China.

PubMed

Tang, Yajun; Gao, Fangluan; Yang, Zhen; Wu, Zujian; Yang, Liang

2016-07-01

The genome of a potyvirus (isolate JaVT_FZ) recovered from jasmine (Jasminum sambac L.) showing yellow ringspot symptoms in Fuzhou, China, was sequenced. JaVT_FZ is closely related to seven other potyviruses with completely sequenced genomes, with which it shares 66-70 % nucleotide and 52-56 % amino acid sequence identity. However, the coat protein (CP) gene shares 82-92 % nucleotide and 90-97 % amino acid sequence identity with those of two partially sequenced potyviruses, named jasmine potyvirus T (JaVT-jasmine) and jasmine yellow mosaic potyvirus (JaYMV-India), respectively. This suggests that JaVT_FZ, JaVT-jasmine and JaYMV-India should be regarded as members of a single potyvirus species, for which the name "Jasmine virus T" has priority.

The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

PubMed

Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

2010-11-01

Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus

PubMed Central

Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.

2015-01-01

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus.

PubMed

Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W

2008-06-05

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.

DNA Sequence Polymorphism of the Lactate Dehydrogenase Genefrom Iranian Plasmodium vivax and Plasmodium falciparum Isolates.

PubMed

Getacher Feleke, Daniel; Nateghpour, Mehdi; Motevalli Haghi, Afsaneh; Hajjaran, Homa; Farivar, Leila; Mohebali, Mehdi; Raoofian, Reza

2015-01-01

Parasite lactate dehydrogenase (pLDH) is extensively employed as malaria rapid diagnostic tests (RDTs). Moreover, it is a well-known drug target candidate. However, the genetic diversity of this gene might influence performance of RDT kits and its drug target candidacy. This study aimed to determine polymorphism of pLDH gene from Iranian isolates of P. vivax and P. falciparum. Genomic DNA was extracted from whole blood of microscopically confirmed P. vivax and P. falciparum infected patients. pLDH gene of P. falciparum and P. vivax was amplified using conventional PCR from 43 symptomatic malaria patients from Sistan and Baluchistan Province, Southeast Iran from 2012 to 2013. Sequence analysis of 15 P. vivax LDH showed fourteen had 100% identity with P. vivax Sal-1 and Belem strains. Two nucleotide substitutions were detected with only one resulted in amino acid change. Analysis of P. falciparum LDH sequences showed six of the seven sequences had 100% homology with P. falciparum 3D7 and Mzr-1. Moreover, PfLDH displayed three nucleotide changes that resulted in changing only one amino acid. PvLDH and PfLDH showed 75%-76% nucleotide and 90.4%-90.76% amino acid homology. pLDH gene from Iranian P. falciparum and P. vivax isolates displayed 98.8-100% homology with 1-3 nucleotide substitutions. This indicated this gene was relatively conserved. Additional studies can be done weather this genetic variation can influence the performance of pLDH based RDTs or not.

The complete genome sequence and genetic analysis of ΦCA82 a novel uncultured microphage from the turkey gastrointestinal system

PubMed Central

2011-01-01

The genomic DNA sequence of a novel enteric uncultured microphage, ΦCA82 from a turkey gastrointestinal system was determined utilizing metagenomics techniques. The entire circular, single-stranded nucleotide sequence of the genome was 5,514 nucleotides. The ΦCA82 genome is quite different from other microviruses as indicated by comparisons of nucleotide similarity, predicted protein similarity, and functional classifications. Only three genes showed significant similarity to microviral proteins as determined by local alignments using BLAST analysis. ORF1 encoded a predicted phage F capsid protein that was phylogenetically most similar to the Microviridae ΦMH2K member's major coat protein. The ΦCA82 genome also encoded a predicted minor capsid protein (ORF2) and putative replication initiation protein (ORF3) most similar to the microviral bacteriophage SpV4. The distant evolutionary relationship of ΦCA82 suggests that the divergence of this novel turkey microvirus from other microviruses may reflect unique evolutionary pressures encountered within the turkey gastrointestinal system. PMID:21714899

Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peters, J.; Peters, M.; Lottspeich, F.

1987-11-01

The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%)more » of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.« less

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Homology and the optimization of DNA sequence data

NASA Technical Reports Server (NTRS)

Wheeler, W.

2001-01-01

Three methods of nucleotide character analysis are discussed. Their implications for molecular sequence homology and phylogenetic analysis are compared. The criterion of inter-data set congruence, both character based and topological, are applied to two data sets to elucidate and potentially discriminate among these parsimony-based ideas. c2001 The Willi Hennig Society.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Routine HLA-B genotyping with PCR-sequence-specific oligonucleotides detects a B*52 variant (B*5206).

PubMed

Hoelsch, K; Lenggeler, I; Pfannes, W; Knabe, H; Klein, H-G; Woelpl, A

2005-05-01

A new human leukocyte antigen (HLA)-B allele was found during routine typing of samples for a German unrelated bone marrow donor registry, the "Aktion Knochenmarkspende Bayern". After first interpretation of data of two independent low-resolution sequence-specific oligonucleotide typing tests, a B*51 variant was suggested. Further analysis via sequence-based typing identified the sequence as new B*52 allele. This new allele officially assigned as B*5206 differs from HLA-B*520102 by one nucleotide exchange in exon 2. The mutation is located at nucleotide position 274, at which a cytosine is substituted by a thymine leading to an amino acid change at protein position 67 from serine (TCC) to phenylalanine (TTC).

Identification and characterization of Theileria ovis surface protein (ToSp) resembled TaSp in Theileria annulata.

PubMed

Shayan, P; Jafari, S; Fattahi, R; Ebrahimzade, E; Amininia, N; Changizi, E

2016-05-01

Ovine theileriosis is an important hemoprotozoal disease of sheep and goats in tropical and subtropical regions which caused high economic loses in the livestock industry. Theileria annulata surface protein (TaSp) was used previously as a tool for serological analysis in livestock. Since the amino acid sequences of TaSp is, at least, in part very conserved in T. annulata, Theileria lestoquardi and Theileria china I and II, it is very important to determine the amino acid sequence of this protein in Theileria ovis as well, to avoid false interpretation of serological data based on this protein in small animal. In the present study, the nucleotide sequence and amino acid sequence of T. ovis surface protein (ToSp) were determined. The comparison of the nucleotide sequence of ToSp showed 96, 96, 99, and 86 % homology to the corresponding nucleotide sequence of TaSp genes by T. annulata, T. China I, T. China II and T. lestoquardi, previously registered in GenBank under accession nos. AJ316260.1, AY274329.1, DQ120058.1, and EF092924.1 respectively. The amino acid sequence analysis showed 95, 81, 98 and 70 % homology to the corresponding amino acid sequence of T. annulata, T chinaI, T china II and T. lestoquardi, registered in GenBank under accession nos. CAC87478.1, AAP36993.1, AAZ30365.1 and AAP36999.11, respectively. Interestingly, in contrast to the C terminus, a significant difference in amino acid sequence in the N teminus of the ToSp protein could be determined compared to the other known corresponding TaSp sequences, which make this region attractive for designing of a suitable tool for serological diagnosis.

Begomoviruses infecting weeds in Cuba: increased host range and a novel virus infecting Sida rhombifolia.

PubMed

Fiallo-Olivé, Elvira; Navas-Castillo, Jesús; Moriones, Enrique; Martínez-Zubiaur, Yamila

2012-01-01

As a result of surveys conducted during the last few years to search for wild reservoirs of begomoviruses in Cuba, we detected a novel bipartite begomovirus, sida yellow mottle virus (SiYMoV), infecting Sida rhombifolia plants. The complete genome sequence was obtained, showing that DNA-A was 2622 nucleotides (nt) in length and that it was most closely related (87.6% nucleotide identity) to DNA-A of an isolate of sida golden mosaic virus (SiGMV) that infects snap beans (Phaseolus vulgaris) in Florida. The DNA-B sequence was 2600 nt in length and shared the highest nucleotide identity (75.1%) with corchorus yellow spot virus (CoYSV). Phylogenetic relationship analysis showed that both DNA components of SiYMoV were grouped in the Abutilon clade, along with begomoviruses from Florida and the Caribbean islands. We also present here the complete nucleotide sequence of a novel strain of sida yellow vein virus found infecting Malvastrum coromandelianum and an isolate of euphorbia mosaic virus that was found for the first time infecting Euphorbia heterophylla in Cuba.

A comprehensive bioinformatic analysis of hepatitis D virus full-length genomes.

PubMed

Delfino, C M; Cerrudo, C S; Biglione, M; Oubiña, J R; Ghiringhelli, P D; Mathet, V L

2018-02-06

In association with hepatitis B virus (HBV), hepatitis delta virus (HDV) is a subviral agent that may promote severe acute and chronic forms of liver disease. Based on the percentage of nucleotide identity of the genome, HDV was initially classified into three genotypes. However, since 2006, the original classification has been further expanded into eight clades/genotypes. The intergenotype divergence may be as high as 35%-40% over the entire RNA genome, whereas sequence heterogeneity among the isolates of a given genotype is <20%; furthermore, HDV recombinants have been clearly demonstrated. The genetic diversity of HDV is related to the geographic origin of the isolates. This study shows the first comprehensive bioinformatic analysis of the complete available set of HDV sequences, using both nucleotide and protein phylogenies (based on an evolutionary model selection, gamma distribution estimation, tree inference and phylogenetic distance estimation), protein composition analysis and comparison (based on the presence of invariant residues, molecular signatures, amino acid frequencies and mono- and di-amino acid compositional distances), as well as amino acid changes in sequence evolution. Taking into account the congruent and consistent results of both nucleotide and amino acid analyses of GenBank available sequences (recorded as of January, 2017), we propose that the eight hepatitis D virus genotypes may be grouped into three large genogroups fully supported by their shared characteristics. © 2018 John Wiley & Sons Ltd.

Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

PubMed Central

Anwar, R; Booth, A; Churchill, A J; Markham, A F

1996-01-01

The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5'-Untranslated Region among Cases of the Same Outbreak from a Single Source

PubMed Central

Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

2014-01-01

Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287

Rapid differentiation of citrus Hop stunt viroid variants by real-time RT-PCR and high resolution melting analysis.

PubMed

Loconsole, Giuliana; Onelge, Nuket; Yokomi, Raymond K; Kubaa, Raied Abou; Savino, Vito; Saponari, Maria

2013-01-01

The RNA genome of pathogenic and non-pathogenic variants of citrus Hop stunt viroid (HSVd) differ by five to six nucleotides located within the variable (V) domain referred to as the "cachexia expression motif". Sensitive hosts such as mandarin and its hybrids are seriously affected by cachexia disease. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological indexing on Parson's Special mandarin and/or direct nucleotide sequence analysis of amplicons from RT-PCR of HSVd-infected plants. Two independent high throughput assays to segregate HSVd variants by real-time RT-PCR and High-Resolution Melting Temperature (HRM) analysis were developed: one based on EVAGreen dye; the other based on TaqMan probes. Primers for both assays targeted three differentiating nucleotides in the V domain which separated HSVd variants into three clusters by distinct melting temperatures with a confidence level higher than 98%. The accuracy of the HRM assays were validated by nucleotide sequencing of representative samples within each HRM cluster and by testing 45 HSVd-infected field trees from California, Italy, Spain, Syria and Turkey. To our knowledge, this is the first report of a rapid and sensitive approach to detect and differentiate HSVd variants associated with different biological behaviors. Although, HSVd is found in several crops including citrus, cachexia variants are restricted to some citrus-growing areas, particularly the Mediterranean Region. Rapid diagnosis for cachexia and non-cachexia variants is, thus, important for the management of HSVd in citrus and reduces the need for bioindexing and sequencing analysis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

PubMed

González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

2018-05-21

To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

Open reading frames in a 4556 nucleotide sequence within MDV-1 BamHI-D DNA fragment: evidence for splicing of mRNA from a new viral glycoprotein gene.

PubMed

Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M

1994-01-01

A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.

Ancient diversity and geographical sub-structuring in African buffalo Theileria parva populations revealed through metagenetic analysis of antigen-encoding loci.

PubMed

Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William

2018-03-01

An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

A novel model for DNA sequence similarity analysis based on graph theory.

PubMed

Qi, Xingqin; Wu, Qin; Zhang, Yusen; Fuller, Eddie; Zhang, Cun-Quan

2011-01-01

Determination of sequence similarity is one of the major steps in computational phylogenetic studies. As we know, during evolutionary history, not only DNA mutations for individual nucleotide but also subsequent rearrangements occurred. It has been one of major tasks of computational biologists to develop novel mathematical descriptors for similarity analysis such that various mutation phenomena information would be involved simultaneously. In this paper, different from traditional methods (eg, nucleotide frequency, geometric representations) as bases for construction of mathematical descriptors, we construct novel mathematical descriptors based on graph theory. In particular, for each DNA sequence, we will set up a weighted directed graph. The adjacency matrix of the directed graph will be used to induce a representative vector for DNA sequence. This new approach measures similarity based on both ordering and frequency of nucleotides so that much more information is involved. As an application, the method is tested on a set of 0.9-kb mtDNA sequences of twelve different primate species. All output phylogenetic trees with various distance estimations have the same topology, and are generally consistent with the reported results from early studies, which proves the new method's efficiency; we also test the new method on a simulated data set, which shows our new method performs better than traditional global alignment method when subsequent rearrangements happen frequently during evolutionary history.

dbWGFP: a database and web server of human whole-genome single nucleotide variants and their functional predictions.

PubMed

Wu, Jiaxin; Wu, Mengmeng; Li, Lianshuo; Liu, Zhuo; Zeng, Wanwen; Jiang, Rui

2016-01-01

The recent advancement of the next generation sequencing technology has enabled the fast and low-cost detection of all genetic variants spreading across the entire human genome, making the application of whole-genome sequencing a tendency in the study of disease-causing genetic variants. Nevertheless, there still lacks a repository that collects predictions of functionally damaging effects of human genetic variants, though it has been well recognized that such predictions play a central role in the analysis of whole-genome sequencing data. To fill this gap, we developed a database named dbWGFP (a database and web server of human whole-genome single nucleotide variants and their functional predictions) that contains functional predictions and annotations of nearly 8.58 billion possible human whole-genome single nucleotide variants. Specifically, this database integrates 48 functional predictions calculated by 17 popular computational methods and 44 valuable annotations obtained from various data sources. Standalone software, user-friendly query services and free downloads of this database are available at http://bioinfo.au.tsinghua.edu.cn/dbwgfp. dbWGFP provides a valuable resource for the analysis of whole-genome sequencing, exome sequencing and SNP array data, thereby complementing existing data sources and computational resources in deciphering genetic bases of human inherited diseases. © The Author(s) 2016. Published by Oxford University Press.

Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

PubMed

Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

2004-08-01

Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

Development and application of a PCR assay to detect chicken and turkey parvoviruses in commercial poultry flocks in the United States.

USDA-ARS?s Scientific Manuscript database

Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

PubMed

Dunn, Joshua G; Weissman, Jonathan S

2016-11-22

Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily adapted to novel NGS assays. Examples, tutorials, and extensive documentation can be found at https://plastid.readthedocs.io .

[Molecular epidemiological analysis of rubella virus isolates from 2001 to 2011 in Shanghai, China].

PubMed

Li, Chong-Shan; Yang, Yu-Ying; Wang, Jian-Guo; Zhu, Zhen; Tang, Wei; Li, Zhi; Sun, Xiao-Dong; Xu, Wen-Bo

2012-03-01

Throat swabs collected from patients whose serum was measles IgM negative and rubella IgM positive during 2001-2011 were used to conduct cell culture for rubella virus. After identification of cell culture with RT-PCR, nucleotide of gene E1 of rubella virus was amplified and sequenced, followed by molecular epidemiological analysis. A total of 31 rubella viruses were isolated from 60 throat swabs. Compared 27 isolates with the WHO reference strains of all genotypes, phylogenetic tree was constructed based on the amplified 739 nucleotide fragment. These isolates belonged to two different genotypes respectively. Isolates 11009, 11052 and 11106 in 2011 belonged to genotype 2B, and others belonged to genotype 1E. Most of mutations were nonsense mutation, and sequence of amino acid was highly conserved. Amino acid sequence of most isolates of genotype 1E was identical, which suggested rubella viruses from same transmission chain might be transmitted continually since 2001. Rubella virus genotype 2B was found to be popular for the first time in Shanghai in 2011. The nucleotide sequences of these genotype 2B isolates showed 99% identity compared with that of isolates recently from Vietnam, Japan and Argentina. The resources of these strains were not confirmed due to the absence of rubella virus surveillance before.

[Genetic characterization analysis on the first imported measles virus of genotype D8 in Chinese mainland].

PubMed

Sun, Xiao-Dong; Li, Chong-Shan; Tang, Xian; Li, Zhi; Zhang, Yan; Tang, Wei; Wang, Jing; Wang, Hui-Ling; Yang, Yan-Ji; Li, Jia; Yuan, Zheng-An; Xu, Wen-Bo

2013-11-01

This study analyzed the genetic characterization on first imported measles virus of genotype D8 in Chinese mainland. Serums were collected from the suspicious MV patients to detect IgM antibody in ELISA. Throat swabs were cultured in Vero/SLAM cell line to get measles virus isolates. Part of the nucleotide sequence of the 3' terminus of nucleoprotein (N) gene of these isolates were amplified by RT-PCR, and the amplicons were directly sequenced. The phylogenetic analysis was based on the nucleotide sequence about 456 base pairs of the 3' terminus of nucleoprotein (N) gene. Results showed that it reported 1 105 suspicious measles cases in shanghai, 2012, including 590 confirmed cases and 2 clinical case. The reported morbidity was 2.52 per one hundred thousand. 247 measles viruses were isolated from 984 throat swabs specimen. Most of them belonged to sub-genotype H1a except Shanghai12-239 was genotype D8. The homology of nucleotide and amino acid sequences were 97.8% and 98.6% respectively between Shanghai12-239 and WHO reference strain (Manchester. UNK30.94(D8)AF280803). Those were 89.6%-94.5% and 88.7%-95.3% between Shanghai12-239 and WHO reference strains of other genotypes.

Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease

PubMed Central

2012-01-01

The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645

[Identification and phylogenetic application of unique nucleotide sequence of nad7 intron2 in Rhodiola (Crassulaceae) species].

PubMed

Deng, Ke-Jun; Yang, Zu-Jun; Liu, Cheng; Zhao, Wei; Liu, Chang; Feng, Juan; Ren, Zheng-Long

2007-03-01

Genetic characterization of 9 populations of Rhodiola crenulata, R. fastigiata and R. sachalinensis (Crassulaceae) species from Sichuan and Jilin Provinces of China, was investigated using the conserved primer of nad7 intron 2. All PCR products about 800 bp long were shorter than other Crassulaceae plants, which were used as molecular markers to identify the Rhodiola species. The sequence of the products indicated that total exon of 53 bp and intron of 738 bp exhibit only 9 nucleotide variations. Blasting the nad7 sequences to GenBank and the phylogenetic analysis showed that the sequence of Rhodiola species was clusted independently, and the length was smaller than all the registered sequences of higher plants. The result suggests that the Rhiodola species had a unique sequence in this gene region, which might be related to the special growth condition.

“Shovel-ready” Sequences as a Stimulus for the Next Generation of Life Scientists

PubMed Central

Boyle, Michael D.

2010-01-01

Genomics and bioinformatics are dynamic fields well-suited for capturing the imagination of undergraduates in both research laboratories and classrooms. Currently, raw nucleotide sequence is being provided, as part of several genomics research initiatives, for undergraduate research and teaching. These initiatives could be easily extended and much more effective if the source of the sequenced material and the subsequent focus of the data analysis were aligned with the research interests of individual faculty at undergraduate institutions. By judicious use of surplus capacity in existing nucleotide sequencing cores, raw sequence data could be generated to support ongoing research efforts involving undergraduates. This would allow these students to participate actively in discovery research, with a goal of making novel contributions to their field through original research while nurturing the next generation of talented research scientists. PMID:23653696

"Shovel-ready" Sequences as a Stimulus for the Next Generation of Life Scientists.

PubMed

Boyle, Michael D

2010-01-01

Genomics and bioinformatics are dynamic fields well-suited for capturing the imagination of undergraduates in both research laboratories and classrooms. Currently, raw nucleotide sequence is being provided, as part of several genomics research initiatives, for undergraduate research and teaching. These initiatives could be easily extended and much more effective if the source of the sequenced material and the subsequent focus of the data analysis were aligned with the research interests of individual faculty at undergraduate institutions. By judicious use of surplus capacity in existing nucleotide sequencing cores, raw sequence data could be generated to support ongoing research efforts involving undergraduates. This would allow these students to participate actively in discovery research, with a goal of making novel contributions to their field through original research while nurturing the next generation of talented research scientists.

RY-Coding and Non-Homogeneous Models Can Ameliorate the Maximum-Likelihood Inferences From Nucleotide Sequence Data with Parallel Compositional Heterogeneity.

PubMed

Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo

2012-01-01

In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

PubMed

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of a DNA region involved in capsular polysaccharide biosynthesis reveals the molecular basis of the nontypeability of two Actinobacillus pleuropneumoniae isolates.

PubMed

Ito, Hiroya; Ogawa, Torata; Fukamizu, Dai; Morinaga, Yuiko; Kusumoto, Masahiro

2016-11-01

The aim of our study was to reveal the molecular basis of the serologic nontypeability of 2 Actinobacillus pleuropneumoniae field isolates. Nine field strains of A. pleuropneumoniae, the causative agent of porcine pleuropneumonia, were isolated from pigs raised on the same farm and sent to our diagnostic laboratory for serotyping. Seven of the 9 strains were identified as serovar 15 strains by immunodiffusion tests. However, 2 strains, designated FH24-2 and FH24-5, could not be serotyped with antiserum prepared against serovars 1-15. Strain FH24-5 showed positive results in 2 serovar 15-specific PCR tests, whereas strain FH24-2 was only positive in 1 of the 2 PCR tests. The nucleotide sequence analysis of gene clusters involved in capsular polysaccharide biosynthesis of the 2 nontypeable strains revealed that both had been rendered nontypeable by the action of ISApl1, a transposable element of A. pleuropneumoniae belonging to the IS30 family. The results showed that ISApl1 of A. pleuropneumoniae can interfere with both the serologic and molecular typing methods, and that nucleotide sequence analysis across the capsular gene clusters is the best means of determining the cause of serologic nontypeability in A. pleuropneumoniae. © 2016 The Author(s).

Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

PubMed

Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

1997-05-01

The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.

PubMed

Modolo, Laurent; Lerat, Emmanuelle

2015-04-29

Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .

Quantitative trait nucleotide analysis using Bayesian model selection.

PubMed

Blangero, John; Goring, Harald H H; Kent, Jack W; Williams, Jeff T; Peterson, Charles P; Almasy, Laura; Dyer, Thomas D

2005-10-01

Although much attention has been given to statistical genetic methods for the initial localization and fine mapping of quantitative trait loci (QTLs), little methodological work has been done to date on the problem of statistically identifying the most likely functional polymorphisms using sequence data. In this paper we provide a general statistical genetic framework, called Bayesian quantitative trait nucleotide (BQTN) analysis, for assessing the likely functional status of genetic variants. The approach requires the initial enumeration of all genetic variants in a set of resequenced individuals. These polymorphisms are then typed in a large number of individuals (potentially in families), and marker variation is related to quantitative phenotypic variation using Bayesian model selection and averaging. For each sequence variant a posterior probability of effect is obtained and can be used to prioritize additional molecular functional experiments. An example of this quantitative nucleotide analysis is provided using the GAW12 simulated data. The results show that the BQTN method may be useful for choosing the most likely functional variants within a gene (or set of genes). We also include instructions on how to use our computer program, SOLAR, for association analysis and BQTN analysis.

Complete genome sequence of maize yellow striate virus, a new cytorhabdovirus infecting maize and wheat crops in Argentina.

PubMed

Maurino, Fernanda; Dumón, Analía D; Llauger, Gabriela; Alemandri, Vanina; de Haro, Luis A; Mattio, M Fernanda; Del Vas, Mariana; Laguna, Irma Graciela; Giménez Pecci, María de la Paz

2018-01-01

A rhabdovirus infecting maize and wheat crops in Argentina was molecularly characterized. Through next-generation sequencing (NGS) of symptomatic leaf samples, the complete genome was obtained of two isolates of maize yellow striate virus (MYSV), a putative new rhabdovirus, differing by only 0.4% at the nucleotide level. The MYSV genome consists of 12,654 nucleotides for maize and wheat virus isolates, and shares 71% nucleotide sequence identity with the complete genome of barley yellow striate mosaic virus (BYSMV, NC028244). Ten open reading frames (ORFs) were predicted in the MYSV genome from the antigenomic strand and were compared with their BYSMV counterparts. The highest amino acid sequence identity of the MYSV and BYSMV proteins was 80% between the L proteins, and the lowest was 37% between the proteins 4. Phylogenetic analysis suggested that the MYSV isolates are new members of the genus Cytorhabdovirus, family Rhabdoviridae. Yellow striate, affecting maize and wheat crops in Argentina, is an emergent disease that presents a potential economic risk for these widely distributed crops.

Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

PubMed

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

2016-09-01

Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

Complete genome sequence of a new begomovirus associated with yellow mosaic disease of Hemidesmus indicus in India.

PubMed

Reddy, M Sreekanth; Kanakala, S; Srinivas, K P; Hema, M; Malathi, V G; Sreenivasulu, P

2014-05-01

The complete DNA A genome of a virus isolate associated with yellow mosaic disease of a medicinal plant, Hemidesmus indicus, from India was cloned and sequenced. The length of DNA A was 2825 nucleotides, 35 nucleotides longer than the unit genome of monopartite begomoviruses. Comparison of the nucleotide sequence of DNA A of the virus isolate with those of other begomoviruses showed maximum sequence identity of 69 % to DNA A of ageratum yellow vein China virus (AYVCNV; AJ558120) and 68 % with tomato yellow leaf curl virus- LBa4 (TYLCV; EF185318), and it formed a distinct clade in phylogenetic analysis. The genome organization of the present virus isolate was found to be similar to that of Old World monopartite begomoviruses. The genome was considered to be monopartite, because association of DNA B and β satellite DNA components was not detected. Based on its sequence identity (<70 %) to all other begomoviruses known to date and ICTV (International Committee on Taxonomy of Viruses) species demarcating criteria (<89 % identity), it is considered a member of a novel begomovirus species, and the tentative name "Hemidesmus yellow mosaic virus" (HeYMV) is proposed.

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Phylogenetic analysis of the envelope protein (domain lll) of dengue 4 viruses

PubMed Central

Mota, Javier; Ramos-Castañeda, José; Rico-Hesse, Rebeca; Ramos, Celso

2011-01-01

Objective To evaluate the genetic variability of domain III of envelope (E) protein and to estimate phylogenetic relationships of dengue 4 (Den-4) viruses isolated in Mexico and from other endemic areas of the world. Material and Methods A phylogenetic study of domain III of envelope (E) protein of Den-4 viruses was conducted in 1998 using virus strains from Mexico and other parts of the world, isolated in different years. Specific primers were used to amplify by RT-PCR the domain III and to obtain nucleotide sequence. Based on nucleotide and deduced aminoacid sequence, genetic variability was estimated and a phylogenetic tree was generated. To make an easy genetic analysis of domain III region, a Restriction Fragment Length Polymorphism (RFLP) assay was performed, using six restriction enzymes. Results Study results demonstrate that nucleotide and aminoacid sequence analysis of domain III are similar to those reported from the complete E protein gene. Based on the RFLP analysis of domain III using the restriction enzymes Nla III, Dde I and Cfo I, Den-4 viruses included in this study were clustered into genotypes 1 and 2 previously reported. Conclusions Study results suggest that domain III may be used as a genetic marker for phylogenetic and molecular epidemiology studies of dengue viruses. The English version of this paper is available too at: http://www.insp.mx/salud/index.html PMID:12132320

Complete Nucleotide Sequence of Watermelon Chlorotic Stunt Virus Originating from Oman

PubMed Central

Khan, Akhtar J.; Akhtar, Sohail; Briddon, Rob W.; Ammara, Um; Al-Matrooshi, Abdulrahman M.; Mansoor, Shahid

2012-01-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6–99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93–98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed. PMID:22852046

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Direct bisulfite sequencing for examination of DNA methylation with gene and nucleotide resolution from brain tissues.

PubMed

Parrish, R Ryley; Day, Jeremy J; Lubin, Farah D

2012-07-01

DNA methylation is an epigenetic modification that is essential for the development and mature function of the central nervous system. Due to the relevance of this modification to the transcriptional control of gene expression, it is often necessary to examine changes in DNA methylation patterns with both gene and single-nucleotide resolution. Here, we describe an in-depth basic protocol for direct bisulfite sequencing of DNA isolated from brain tissue, which will permit direct assessment of methylation status at individual genes as well as individual cytosine molecules/nucleotides within a genomic region. This method yields analysis of DNA methylation patterns that is robust, accurate, and reproducible, thereby allowing insights into the role of alterations in DNA methylation in brain tissue.

Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

PubMed Central

Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

1984-01-01

The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran

PubMed Central

Chinikar, Sadegh; Bouzari, Saeid; Shokrgozar, Mohammad Ali; Mostafavi, Ehsan; Jalali, Tahmineh; Khakifirouz, Sahar; Nowotny, Norbert; Fooks, Anthony R.; Shah-Hosseini, Nariman

2016-01-01

Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were analyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Iranian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either association with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we propose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. PMID:27308271

Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

PubMed Central

Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

2015-01-01

Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

Short-Read Sequencing for Genomic Analysis of the Brown Rot Fungus Fibroporia radiculosa

Treesearch

J. D. Tang; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; S. C. Burgess; S. V. Diehl

2012-01-01

The feasibility of short-read sequencing for genomic analysis was demonstrated for Fibroporia radiculosa, a copper-tolerant fungus that causes brown rot decay of wood. The effect of read quality on genomic assembly was assessed by filtering Illumina GAIIx reads from a single run of a paired-end library (75-nucleotide read length and 300-bp fragment...

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency.

PubMed

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua

2016-09-22

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.

Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

PubMed

Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

2016-03-01

The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.

PubMed

Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima

2017-10-16

Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Investigation of Outbreaks of Salmonella enterica Serovar Typhimurium and Its Monophasic Variants Using Whole-Genome Sequencing, Denmark

PubMed Central

Gymoese, Pernille; Sørensen, Gitte; Litrup, Eva; Olsen, John Elmerdal; Nielsen, Eva Møller

2017-01-01

Whole-genome sequencing is rapidly replacing current molecular typing methods for surveillance purposes. Our study evaluates core-genome single-nucleotide polymorphism analysis for outbreak detection and linking of sources of Salmonella enterica serovar Typhimurium and its monophasic variants during a 7-month surveillance period in Denmark. We reanalyzed and defined 8 previously characterized outbreaks from the phylogenetic relatedness of the isolates, epidemiologic data, and food traceback investigations. All outbreaks were identified, and we were able to exclude unrelated and include additional related human cases. We were furthermore able to link possible food and veterinary sources to the outbreaks. Isolates clustered according to sequence types (STs) 19, 34, and 36. Our study shows that core-genome single-nucleotide polymorphism analysis is suitable for surveillance and outbreak investigation for Salmonella Typhimurium (ST19 and ST36), but whole genome–wide analysis may be required for the tight genetic clone of monophasic variants (ST34). PMID:28930002

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Sequence analysis of a few species of termites (Order: Isoptera) on the basis of partial characterization of COII gene.

PubMed

Sobti, Ranbir Chander; Kumari, Mamtesh; Sharma, Vijay Lakshmi; Sodhi, Monika; Mukesh, Manishi; Shouche, Yogesh

2009-11-01

The present study was aimed to get the nucleotide sequences of a part of COII mitochondrial gene amplified from individuals of five species of Termites (Isoptera: Termitidae: Macrotermitinae). Four of them belonged to the genus Odontotermes (O. obesus, O. horni, O. bhagwatii and Odontotermes sp.) and one to Microtermes (M. obesi). Partial COII gene fragments were amplified by using specific primers. The sequences so obtained were characterized to calculate the frequencies of each nucleotide bases and a high A + T content was observed. The interspecific pairwise sequence divergence in Odontotermes species ranged from 6.5% to 17.1% across COII fragment. M. obesi sequence diversity ranged from 2.5 with Odontotermes sp. to 19.0% with O. bhagwatii. Phylogenetic trees drawn on the basis of distance neighbour-joining method revealed three main clades clustering all the individuals according to their genera and families.

Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

PubMed

Winterhagen, Patrick; Wünsche, Jens-Norbert

2016-05-01

Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

Muju Virus, Harbored by Myodes regulus in Korea, Might Represent a Genetic Variant of Puumala Virus, the Prototype Arvicolid Rodent-Borne Hantavirus

PubMed Central

Lee, Jin Goo; Gu, Se Hun; Baek, Luck Ju; Shin, Ok Sarah; Park, Kwang Sook; Kim, Heung-Chul; Klein, Terry A.; Yanagihara, Richard; Song, Jin-Won

2014-01-01

The genome of Muju virus (MUJV), identified originally in the royal vole (Myodes regulus) in Korea, was fully sequenced to ascertain its genetic and phylogenetic relationship with Puumala virus (PUUV), harbored by the bank vole (My. glareolus), and a PUUV-like virus, named Hokkaido virus (HOKV), in the grey red-backed vole (My. rufocanus) in Japan. Whole genome sequence analysis of the 6544-nucleotide large (L), 3652-nucleotide medium (M) and 1831-nucleotide small (S) segments of MUJV, as well as the amino acid sequences of their gene products, indicated that MUJV strains from different capture sites might represent genetic variants of PUUV, the prototype arvicolid rodent-borne hantavirus in Europe. Distinct geographic-specific clustering of MUJV was found in different provinces in Korea, and phylogenetic analyses revealed that MUJV and HOKV share a common ancestry with PUUV. A better understanding of the taxonomic classification and pathogenic potential of MUJV must await its isolation in cell culture. PMID:24736214

Analysis of genetic diversity using SNP markers in oat

USDA-ARS?s Scientific Manuscript database

A large-scale single nucleotide polymorphism (SNP) discovery was carried out in cultivated oat using Roche 454 sequencing methods. DNA sequences were generated from cDNAs originating from a panel of 20 diverse oat cultivars, and from Diversity Array Technology (DArT) genomic complexity reductions fr...

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Study of mitochondria D-loop gene to detect the heterogeneity of gemak in Turnicidae family

NASA Astrophysics Data System (ADS)

Setiati, N.; Partaya

2018-03-01

As a part of life biodiversity, birds in Turnicidae family should be preserved from the extinction and its type heterogeneity decline. One effort for giving the strategic base of plasma nutfah conservation is through genetic heterogeneity study. The aim of the research is to analyze D-loop gen from DNA mitochondria of gemak bird in Turnicidae family molecularly. From the result of the analysis, it may be known the genetic heterogeneity of gemak bird based on the sequence of D-loop gen. The collection of both types of gemak of Turnicidae family is still easy since we can find them in ricefield area after harvest particularly for Gemakloreng (Turnix sylvatica), it means while gemak tegalan (Turnixsusciator) is getting difficult to find. Based on the above DNA quantification standard, the blood sample of Gemak in this research is mostly grouped into pure blood (ranges from 1,63 – 1,90), and it deserves to be used for PCR analysis. The sequencing analysis has not detected the sequence of nucleotide completely. However, it indicates sequence polymorphism of base as the arranger of D-loop gen. D-loop gen may identify genetic heterogeneity of gemak bird of Turnicidae family, but it is necessary to perform further sequencing analysis with PCR-RFLP technique. This complete nucleotide sequence is obtained and easy to detect after being cut restriction enzyme.

Benzofurazane as a new redox label for electrochemical detection of DNA: towards multipotential redox coding of DNA bases.

PubMed

Balintová, Jana; Plucnara, Medard; Vidláková, Pavlína; Pohl, Radek; Havran, Luděk; Fojta, Miroslav; Hocek, Michal

2013-09-16

Benzofurazane has been attached to nucleosides and dNTPs, either directly or through an acetylene linker, as a new redox label for electrochemical analysis of nucleotide sequences. Primer extension incorporation of the benzofurazane-modified dNTPs by polymerases has been developed for the construction of labeled oligonucleotide probes. In combination with nitrophenyl and aminophenyl labels, we have successfully developed a three-potential coding of DNA bases and have explored the relevant electrochemical potentials. The combination of benzofurazane and nitrophenyl reducible labels has proved to be excellent for ratiometric analysis of nucleotide sequences and is suitable for bioanalytical applications. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Molecular cloning and characterization in silico of phospholipase A(2) transcript isolated from Lachesis muta peruvian snake venom].

PubMed

Jimenez, Karim L; Zavaleta, Amparo I; Izaguirre, Victor; Yarleque, Armando; Inga, Rosio R

2010-01-01

Isolate and characterize in silico gene phospholipase A(2) (PLA(2)) isolated from Lachesis muta venom of the Peruvian Amazon. Technique RT-PCR from total RNA was using specific primers, the amplified DNA product was inserted into the pGEM vector for subsequent sequencing. By bioinformatic analysis identified an open reading frame of 414 nucleotides that encoded 138 amino acids including a signal peptide of 16 aminoacids, molecular weight and pI were 13,976 kDa and 5.66 respectively. The aminoacid sequence was called Lm-PLA(2)-Peru, contains an aspartate at position 49, this aminoacid in conjunction with other conserved residues such as Tyr-28, Gly-30, Gly-32, His-48, Tyr52, Asp99 are important for enzymatic activity. The comparison with the amino acid sequence data banks showed of similarity between PLA(2) from Lachesis stenophrys (93%) and other PLA(2) snake venoms and over 80% of other sPLA(2) family Viperidae venoms. A phylogenetic analysis showed that Lm-PLA(2)-Peru grouped with other acidic [Asp(49)] sPLA(2) previously isolated from Bothriechis schlegelii venom showing 89 % nucleotide sequence identity. Finally, the computer modeling indicated that enzyme had the characteristic structure of sPLA(2) group II that consisted of three α-helices, a β-wing, a short helix and a calcium-binding loop. The nucleotide sequence corresponding to the first transcript of gene from PLA(2) cloned of Lachesis muta venom, snake from the Peruvian rainforest.

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

PubMed

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

Substantial Regional Variation in Substitution Rates in the Human Genome: Importance of GC Content, Gene Density, and Telomere-Specific Effects

NASA Astrophysics Data System (ADS)

Arndt, Peter F.; Hwa, Terence; Petrov, Dmitri A.

2005-06-01

This study presents the first global, 1 Mbp level analysis of patterns of nucleotide substitutions along the human lineage. The study is based on the analysis of a large amount of repetitive elements deposited into the human genome since the mammalian radiation, yielding a number of results that would have been difficult to obtain using the more conventional comparative method of analysis. This analysis revealed substantial and consistent variability of rates of substitution, with the variability ranging up to 2-fold among different regions. The rates of substitutions of C or G nucleotides with A or T nucleotides vary much more sharply than the reverse rates suggesting that much of that variation is due to differences in mutation rates rather than in the probabilities of fixation of C/G vs. A/T nucleotides across the genome. For all types of substitution we observe substantially more hotspots than coldspots, with hotspots showing substantial clustering over tens of Mbp's. Our analysis revealed that GC-content of surrounding sequences is the best predictor of the rates of substitution. The pattern of substitution appears very different near telomeres compared to the rest of the genome and cannot be explained by the genome-wide correlations of the substitution rates with GC content or exon density. The telomere pattern of substitution is consistent with natural selection or biased gene conversion acting to increase the GC-content of the sequences that are within 10-15 Mbp away from the telomere.

Pervasive sequence patents cover the entire human genome.

PubMed

Rosenfeld, Jeffrey A; Mason, Christopher E

2013-01-01

The scope and eligibility of patents for genetic sequences have been debated for decades, but a critical case regarding gene patents (Association of Molecular Pathologists v. Myriad Genetics) is now reaching the US Supreme Court. Recent court rulings have supported the assertion that such patents can provide intellectual property rights on sequences as small as 15 nucleotides (15mers), but an analysis of all current US patent claims and the human genome presented here shows that 15mer sequences from all human genes match at least one other gene. The average gene matches 364 other genes as 15mers; the breast-cancer-associated gene BRCA1 has 15mers matching at least 689 other genes. Longer sequences (1,000 bp) still showed extensive cross-gene matches. Furthermore, 15mer-length claims from bovine and other animal patents could also claim as much as 84% of the genes in the human genome. In addition, when we expanded our analysis to full-length patent claims on DNA from all US patents to date, we found that 41% of the genes in the human genome have been claimed. Thus, current patents for both short and long nucleotide sequences are extraordinarily non-specific and create an uncertain, problematic liability for genomic medicine, especially in regard to targeted re-sequencing and other sequence diagnostic assays.

Sequence analysis of Jembrana disease virus strains reveals a genetically stable lentivirus.

PubMed

Desport, Moira; Stewart, Meredith E; Mikosza, Andrew S; Sheridan, Carol A; Peterson, Shane E; Chavand, Olivier; Hartaningsih, Nining; Wilcox, Graham E

2007-06-01

Jembrana disease virus (JDV) is a lentivirus associated with an acute disease syndrome with a 20% case fatality rate in Bos javanicus (Bali cattle) in Indonesia, occurring after a short incubation period and with no recurrence of the disease after recovery. Partial regions of gag and pol and the entire env were examined for sequence variation in DNA samples from cases of Jembrana disease obtained from Bali, Sumatra and South Kalimantan in Indonesian Borneo. A high level of nucleotide conservation (97-100%) was observed in gag sequences from samples taken in Bali and Sumatra, indicating that the source of JDV in Sumatra was most likely to have originated from Bali. The pol sequences and, unexpectedly, the env sequences from Bali samples were also well conserved with low nucleotide (96-99%) and amino acid substitutions (95-99%). However, the sample from South Kalimantan (JDV(KAL/01)) contained more divergent sequences, particularly in env (88% identity). Phylogenetic analysis revealed that the JDV(KAL/01)env sequences clustered with the sequence from the Pulukan sample (Bali) from 2001. JDV appears to be remarkably stable genetically and has undergone minor genetic changes over a period of nearly 20 years in Bali despite becoming endemic in the cattle population of the island.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Affordable Hands-On DNA Sequencing and Genotyping: An Exercise for Teaching DNA Analysis to Undergraduates

ERIC Educational Resources Information Center

Shah, Kushani; Thomas, Shelby; Stein, Arnold

2013-01-01

In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C…

NABIC: A New Access Portal to Search, Visualize, and Share Agricultural Genomics Data.

PubMed

Seol, Young-Joo; Lee, Tae-Ho; Park, Dong-Suk; Kim, Chang-Kug

2016-01-01

The National Agricultural Biotechnology Information Center developed an access portal to search, visualize, and share agricultural genomics data with a focus on South Korean information and resources. The portal features an agricultural biotechnology database containing a wide range of omics data from public and proprietary sources. We collected 28.4 TB of data from 162 agricultural organisms, with 10 types of omics data comprising next-generation sequencing sequence read archive, genome, gene, nucleotide, DNA chip, expressed sequence tag, interactome, protein structure, molecular marker, and single-nucleotide polymorphism datasets. Our genomic resources contain information on five animals, seven plants, and one fungus, which is accessed through a genome browser. We also developed a data submission and analysis system as a web service, with easy-to-use functions and cutting-edge algorithms, including those for handling next-generation sequencing data.

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

PubMed

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Identification of phylogenetic position in the Chlamydiaceae family for Chlamydia strains released from monkeys and humans with chlamydial pathology.

PubMed

Karaulov, Alexander; Aleshkin, Vladimir; Slobodenyuk, Vladimir; Grechishnikova, Olga; Afanasyev, Stanislav; Lapin, Boris; Dzhikidze, Eteri; Nesvizhsky, Yuriy; Evsegneeva, Irina; Voropayeva, Elena; Afanasyev, Maxim; Aleshkin, Andrei; Metelskaya, Valeria; Yegorova, Ekaterina; Bayrakova, Alexandra

2010-01-01

Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S-23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S-23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga) have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration.

The Complete Nucleotide Sequence of the Mitochondrial Genome of Bactrocera minax (Diptera: Tephritidae)

PubMed Central

Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

2014-01-01

The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the poly(T) stretch among the ten tephritid species and two tandem repeats were present in the CR. PMID:24964138

Methods of automatic nucleotide-sequence analysis. Multicomponent spectrophotometric analysis of mixtures of nucleic acid components by a least-squares procedure

PubMed Central

Lee, Sheila; McMullen, D.; Brown, G. L.; Stokes, A. R.

1965-01-01

1. A theoretical analysis of the errors in multicomponent spectrophotometric analysis of nucleoside mixtures, by a least-squares procedure, has been made to obtain an expression for the error coefficient, relating the error in calculated concentration to the error in extinction measurements. 2. The error coefficients, which depend only on the `library' of spectra used to fit the experimental curves, have been computed for a number of `libraries' containing the following nucleosides found in s-RNA: adenosine, guanosine, cytidine, uridine, 5-ribosyluracil, 7-methylguanosine, 6-dimethylaminopurine riboside, 6-methylaminopurine riboside and thymine riboside. 3. The error coefficients have been used to determine the best conditions for maximum accuracy in the determination of the compositions of nucleoside mixtures. 4. Experimental determinations of the compositions of nucleoside mixtures have been made and the errors found to be consistent with those predicted by the theoretical analysis. 5. It has been demonstrated that, with certain precautions, the multicomponent spectrophotometric method described is suitable as a basis for automatic nucleotide-composition analysis of oligonucleotides containing nine nucleotides. Used in conjunction with continuous chromatography and flow chemical techniques, this method can be applied to the study of the sequence of s-RNA. PMID:14346087

From Mosquitos to Humans: Genetic Evolution of Zika Virus

PubMed Central

Wang, Lulan; Valderramos, Stephanie G.; Wu, Aiping; Ouyang, Songying; Li, Chunfeng; Brasil, Patricia; Bonaldo, Myrna; Coates, Thomas; Nielsen-Saines, Karin; Jiang, Taijiao; Aliyari, Roghiyh; Cheng, Genhong

2017-01-01

Initially isolated in 1947, Zika virus (ZIKV) has recently emerged as significant public health concern. Sequence analysis of all 41 known ZIKV RNA open reading frames to date indicates that ZIKV has undergone significant changes in both protein and nucleotide sequences during the past half century. PMID:27091703

Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

PubMed

Kachhap, Sangita; Singh, Balvinder

2015-01-01

In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

Automated sequence analysis and editing software for HIV drug resistance testing.

PubMed

Struck, Daniel; Wallis, Carole L; Denisov, Gennady; Lambert, Christine; Servais, Jean-Yves; Viana, Raquel V; Letsoalo, Esrom; Bronze, Michelle; Aitken, Sue C; Schuurman, Rob; Stevens, Wendy; Schmit, Jean Claude; Rinke de Wit, Tobias; Perez Bercoff, Danielle

2012-05-01

Access to antiretroviral treatment in resource-limited-settings is inevitably paralleled by the emergence of HIV drug resistance. Monitoring treatment efficacy and HIV drugs resistance testing are therefore of increasing importance in resource-limited settings. Yet low-cost technologies and procedures suited to the particular context and constraints of such settings are still lacking. The ART-A (Affordable Resistance Testing for Africa) consortium brought together public and private partners to address this issue. To develop an automated sequence analysis and editing software to support high throughput automated sequencing. The ART-A Software was designed to automatically process and edit ABI chromatograms or FASTA files from HIV-1 isolates. The ART-A Software performs the basecalling, assigns quality values, aligns query sequences against a set reference, infers a consensus sequence, identifies the HIV type and subtype, translates the nucleotide sequence to amino acids and reports insertions/deletions, premature stop codons, ambiguities and mixed calls. The results can be automatically exported to Excel to identify mutations. Automated analysis was compared to manual analysis using a panel of 1624 PR-RT sequences generated in 3 different laboratories. Discrepancies between manual and automated sequence analysis were 0.69% at the nucleotide level and 0.57% at the amino acid level (668,047 AA analyzed), and discordances at major resistance mutations were recorded in 62 cases (4.83% of differences, 0.04% of all AA) for PR and 171 (6.18% of differences, 0.03% of all AA) cases for RT. The ART-A Software is a time-sparing tool for pre-analyzing HIV and viral quasispecies sequences in high throughput laboratories and highlighting positions requiring attention. Copyright © 2012 Elsevier B.V. All rights reserved.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

PubMed

Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

2016-08-05

This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

Optimized Next-Generation Sequencing Genotype-Haplotype Calling for Genome Variability Analysis

PubMed Central

Navarro, Javier; Nevado, Bruno; Hernández, Porfidio; Vera, Gonzalo; Ramos-Onsins, Sebastián E

2017-01-01

The accurate estimation of nucleotide variability using next-generation sequencing data is challenged by the high number of sequencing errors produced by new sequencing technologies, especially for nonmodel species, where reference sequences may not be available and the read depth may be low due to limited budgets. The most popular single-nucleotide polymorphism (SNP) callers are designed to obtain a high SNP recovery and low false discovery rate but are not designed to account appropriately the frequency of the variants. Instead, algorithms designed to account for the frequency of SNPs give precise results for estimating the levels and the patterns of variability. These algorithms are focused on the unbiased estimation of the variability and not on the high recovery of SNPs. Here, we implemented a fast and optimized parallel algorithm that includes the method developed by Roesti et al and Lynch, which estimates the genotype of each individual at each site, considering the possibility to call both bases from the genotype, a single one or none. This algorithm does not consider the reference and therefore is independent of biases related to the reference nucleotide specified. The pipeline starts from a BAM file converted to pileup or mpileup format and the software outputs a FASTA file. The new program not only reduces the running times but also, given the improved use of resources, it allows its usage with smaller computers and large parallel computers, expanding its benefits to a wider range of researchers. The output file can be analyzed using software for population genetics analysis, such as the R library PopGenome, the software VariScan, and the program mstatspop for analysis considering positions with missing data. PMID:28894353

Molecular Detection, Isolation, and Physiological Characterization of Functionally Dominant Phenol-Degrading Bacteria in Activated Sludge

PubMed Central

Watanabe, Kazuya; Teramoto, Maki; Futamata, Hiroyuki; Harayama, Shigeaki

1998-01-01

DNA was isolated from phenol-digesting activated sludge, and partial fragments of the 16S ribosomal DNA (rDNA) and the gene encoding the largest subunit of multicomponent phenol hydroxylase (LmPH) were amplified by PCR. An analysis of the amplified fragments by temperature gradient gel electrophoresis (TGGE) demonstrated that two major 16S rDNA bands (bands R2 and R3) and two major LmPH gene bands (bands P2 and P3) appeared after the activated sludge became acclimated to phenol. The nucleotide sequences of these major bands were determined. In parallel, bacteria were isolated from the activated sludge by direct plating or by plating after enrichment either in batch cultures or in a chemostat culture. The bacteria isolated were classified into 27 distinct groups by a repetitive extragenic palindromic sequence PCR analysis. The partial nucleotide sequences of 16S rDNAs and LmPH genes of members of these 27 groups were then determined. A comparison of these nucleotide sequences with the sequences of the major TGGE bands indicated that the major bacterial populations, R2 and R3, possessed major LmPH genes P2 and P3, respectively. The dominant populations could be isolated either by direct plating or by chemostat culture enrichment but not by batch culture enrichment. One of the dominant strains (R3) which contained a novel type of LmPH (P3), was closely related to Valivorax paradoxus, and the result of a kinetic analysis of its phenol-oxygenating activity suggested that this strain was the principal phenol digester in the activated sludge. PMID:9797297

Pan-genome multilocus sequence typing and outbreak-specific reference-based single nucleotide polymorphism analysis to resolve two concurrent Staphylococcus aureus outbreaks in neonatal services.

PubMed

Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P

2016-06-01

We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Wheeler, David L

2008-01-01

GenBank (R) is a comprehensive database that contains publicly available nucleotide sequences for more than 260 000 named organisms, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through NCBI's retrieval system, Entrez, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.

GenBank

PubMed Central

Benson, Dennis A.; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Wheeler, David L.

2008-01-01

GenBank (R) is a comprehensive database that contains publicly available nucleotide sequences for more than 260 000 named organisms, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through NCBI's retrieval system, Entrez, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov PMID:18073190

Comparison of the nucleotide and amino acid sequences of the RsrI and EcoRI restriction endonucleases.

PubMed

Stephenson, F H; Ballard, B T; Boyer, H W; Rosenberg, J M; Greene, P J

1989-12-21

The RsrI endonuclease, a type-II restriction endonuclease (ENase) found in Rhodobacter sphaeroides, is an isoschizomer of the EcoRI ENase. A clone containing an 11-kb BamHI fragment was isolated from an R. sphaeroides genomic DNA library by hybridization with synthetic oligodeoxyribonucleotide probes based on the N-terminal amino acid (aa) sequence of RsrI. Extracts of E. coli containing a subclone of the 11-kb fragment display RsrI activity. Nucleotide sequence analysis reveals an 831-bp open reading frame encoding a polypeptide of 277 aa. A 50% identity exists within a 266-aa overlap between the deduced aa sequences of RsrI and EcoRI. Regions of 75-100% aa sequence identity correspond to key structural and functional regions of EcoRI. The type-II ENases have many common properties, and a common origin might have been expected. Nevertheless, this is the first demonstration of aa sequence similarity between ENases produced by different organisms.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

PubMed

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Primary and secondary structural analyses of glutathione S-transferase pi from human placenta.

PubMed

Ahmad, H; Wilson, D E; Fritz, R R; Singh, S V; Medh, R D; Nagle, G T; Awasthi, Y C; Kurosky, A

1990-05-01

The primary structure of glutathione S-transferase (GST) pi from a single human placenta was determined. The structure was established by chemical characterization of tryptic and cyanogen bromide peptides as well as automated sequence analysis of the intact enzyme. The structural analysis indicated that the protein is comprised of 209 amino acid residues and gave no evidence of post-translational modifications. The amino acid sequence differed from that of the deduced amino acid sequence determined by nucleotide sequence analysis of a cDNA clone (Kano, T., Sakai, M., and Muramatsu, M., 1987, Cancer Res. 47, 5626-5630) at position 104 which contained both valine and isoleucine whereas the deduced sequence from nucleotide sequence analysis identified only isoleucine at this position. These results demonstrated that in the one individual placenta studied at least two GST pi genes are coexpressed, probably as a result of allelomorphism. Computer assisted consensus sequence evaluation identified a hydrophobic region in GST pi (residues 155-181) that was predicted to be either a buried transmembrane helical region or a signal sequence region. The significance of this hydrophobic region was interpreted in relation to the mode of action of the enzyme especially in regard to the potential involvement of a histidine in the active site mechanism. A comparison of the chemical similarity of five known human GST complete enzyme structures, one of pi, one of mu, two of alpha, and one microsomal, gave evidence that all five enzymes have evolved by a divergent evolutionary process after gene duplication, with the microsomal enzyme representing the most divergent form.

Isolation and Genomic Characterization of a Duck-Origin GPV-Related Parvovirus from Cherry Valley Ducklings in China.

PubMed

Chen, Hao; Dou, Yanguo; Tang, Yi; Zhang, Zhenjie; Zheng, Xiaoqiang; Niu, Xiaoyu; Yang, Jing; Yu, Xianglong; Diao, Youxiang

2015-01-01

A newly emerged duck parvovirus, which causes beak atrophy and dwarfism syndrome (BADS) in Cherry Valley ducks, has appeared in Northern China since March 2015. To explore the genetic diversity among waterfowl parvovirus isolates, the complete genome of an identified isolate designated SDLC01 was sequenced and analyzed in the present study. Genomic sequence analysis showed that SDLC01 shared 90.8%-94.6% of nucleotide identity with goose parvovirus (GPV) isolates and 78.6%-81.6% of nucleotide identity with classical Muscovy duck parvovirus (MDPV) isolates. Phylogenetic analysis of 443 nucleotides (nt) of the fragment A showed that SDLC01 was highly similar to a mule duck isolate (strain D146/02) and close to European GPV isolates but separate from Asian GPV isolates. Analysis of the left inverted terminal repeat regions revealed that SDLC01 had two major segments deleted between positions 160-176 and 306-322 nt compared with field GPV and MDPV isolates. Phylogenetic analysis of Rep and VP1 encoded by two major open reading frames of parvoviruses revealed that SDLC01 was distinct from all GPV and MDPV isolates. The viral pathogenicity and genome characterization of SDLC01 suggest that the novel GPV (N-GPV) is the causative agent of BADS and belongs to a distinct GPV-related subgroup. Furthermore, N-GPV sequences were detected in diseased ducks by polymerase chain reaction and viral proliferation was demonstrated in duck embryos and duck embryo fibroblast cells.

Completion of full length genome sequence of novel avian paramyxovirus strain APMV/Shimane67 isolated from migratory wild geese in Japan.

PubMed

Yamamoto, Eiji; Ito, Toshihiro; Ito, Hiroshi

2016-11-01

The nucleotide sequences of nucleocapsid protein (N); phosphoprotein (P); matrix protein (M); hemagglutinin-neuraminidase (HN); and large polymerase protein (L) genes, 3'-end leader, 5'-end trailer and intergenic regions of the avian paramyxovirus (APMV) strain goose/Shimane/67/2000 (APMV/Shimane67) were determined. Together with previously reported data on fusion protein (F) gene sequence [46], the determination of the genome sequence of APMV/Shimane67 has been completed in this study. The genome of APMV/Shimane67 comprised 16,146 nucleotides in length and contains six genes in the order of 3'-N-P-M-F-HN-L-5'. The features of the APMV/Shimane67 genome (e.g., nucleotide length of whole genome and each of the six genes, and predicted amino acid length of each of the six genes) were distinct from those of other APMV serotypes. Phylogenetic analysis indicated that although APMV/Shimane67 was grouped with APMV-1, -9 and -12, the evolutionary distance between APMV/Shimane67 and these viruses was longer than that observed between intra-serotype viruses. These results show that the genome sequence of APMV/Shimane67 contains specific characteristics and is distinguishable from other types of APMV.

Functional analysis of regulatory single-nucleotide polymorphisms.

PubMed

Pampín, Sandra; Rodríguez-Rey, José C

2007-04-01

The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis.

PubMed

Smola, Matthew J; Rice, Greggory M; Busan, Steven; Siegfried, Nathan A; Weeks, Kevin M

2015-11-01

Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistries exploit small electrophilic reagents that react with 2'-hydroxyl groups to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues by using reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as can be done for simple model RNAs. This protocol describes the experimental steps, implemented over 3 d, that are required to perform SHAPE probing and to construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots and provides useful troubleshooting information. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures and visualize probable and alternative helices, often in under 1 d. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles and entire transcriptomes.

Deletion within the metallothionein locus of cadmium-tolerant Synechococcus PCC 6301 involving a highly iterated palindrome (HIP1).

PubMed

Gupta, A; Morby, A P; Turner, J S; Whitton, B A; Robinson, N J

1993-01-01

Genomic rearrangements involving amplification of metallothionein (MT) genes have been reported in metal-tolerant eukaryotes. Similarly, we have recently observed amplification and rearrangement of a prokaryotic MT locus, smt, in cells of Synechococcus PCC 6301 selected for Cd tolerance. Following the characterization of this locus, the altered smt region has now been isolated from a Cd-tolerant cell line, C3.2, and its nucleotide sequence determined. This has identified a deletion within smtB, which encodes a trans-acting repressor of smt transcription. Two identical palindromic octanucleotides (5'-GCGATC-GC-3') traverse both borders of the excised element. This palindromic sequence is highly represented in the smt locus (7 occurrences in 1326 nucleotides) and analysis of the GenBank/EMBL/DDBJ DNA Nucleotide Sequence Data Libraries reveals that this is a highly iterated palindrome (HIP1) in other known sequences from Synechococcus strains (estimated to occur at an average frequency of once every c. 664 bp). HIP1 is also abundant in the genomes of other cyanobacteria. The functional significance of smtB deletion and the possible role of HIP1 in genome plasticity and adaptation in cyanobacteria are discussed.

Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri.

PubMed

Nigg, Jared C; Nouri, Shahideh; Falk, Bryce W

2016-07-28

Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera. Copyright © 2016 Nigg et al.

Fractal landscape analysis of DNA walks

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.

1992-01-01

By mapping nucleotide sequences onto a "DNA walk", we uncovered remarkably long-range power law correlations [Nature 356 (1992) 168] that imply a new scale invariant property of DNA. We found such long-range correlations in intron-containing genes and in non-transcribed regulatory DNA sequences, but not in cDNA sequences or intron-less genes. In this paper, we present more explicit evidences to support our findings.

Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.

PubMed

Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A

1997-01-01

SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.

Complete genomic sequence of a Tobacco rattle virus isolate from Michigan-grown potatoes.

PubMed

Crosslin, James M; Hamm, Philip B; Kirk, William W; Hammond, Rosemarie W

2010-04-01

Tobacco rattle virus (TRV) causes stem mottle on potato leaves and necrotic arcs and rings in potato tubers, known as corky ringspot disease. Recently, TRV was reported in Michigan potato tubers cv. FL1879 exhibiting corky ringspot disease. Sequence analysis of the RNA-1-encoded 16-kDa gene of the Michigan isolate, designated MI-1, revealed homology to TRV isolates from Florida and Washington. Here, we report the complete genomic sequence of RNA-1 (6,791 nt) and RNA-2 (3,685 nt) of TRV MI-1. RNA-1 is predicted to contain four open reading frames, and the genome structure and phylogenetic analyses of the RNA-1 nucleotide sequence revealed significant homologies to the known sequences of other TRV-1 isolates. The relationships based on the full-length nucleotide sequence were different from than those based on the 16-kDa gene encoded on genomic RNA-1 and reflect sequence variation within a 20-25-aa residue region of the 16-kDa protein. MI-1 RNA-2 is predicted to contain three ORFs, encoding the coat protein (CP), a 37.6-kDa protein (ORF 2b), and a 33.6-kDa protein (ORF 2c). In addition, it contains a region of similarity to the 3' terminus of RNA-1, including a truncated portion of the 16-kDa cistron. Phylogenetic analysis of RNA-2, based on a comparison of nucleotide sequences with other members of the genus Tobravirus, indicates that TRV MI-1 and other North American isolates cluster as a distinct group. TRV M1-1 is only the second North American isolate for which there is a complete sequence of the genome, and it is distinct from the North American isolate TRV ORY. The relationship of the TRV MI-1 isolate to other tobravirus isolates is discussed.

Nucleotide sequence and further characterization of the Synechococcus sp. strain PCC 7002 recA gene: complementation of a cyanobacterial recA mutation by the Escherichia coli recA gene.

PubMed Central

Murphy, R C; Gasparich, G E; Bryant, D A; Porter, R D

1990-01-01

The nucleotide sequence and transcript initiation site of the Synechococcus sp. strain PCC 7002 recA gene have been determined. The deduced amino acid sequence of the RecA protein of this cyanobacterium is 56% identical and 73% similar to the Escherichia coli RecA protein. Northern (RNA) blot analysis indicates that the Synechococcus strain PCC 7002 recA gene is transcribed as a monocistronic transcript 1,200 bases in length. The 5' endpoint of the recA mRNA was mapped by primer extension by using synthetic oligonucleotides of 17 and 27 nucleotides as primers. The nucleotide sequence 5' to the mapped endpoint contained sequence motifs bearing a striking resemblance to the heat shock (sigma 32-specific) promoters of E. coli but did not contain sequences similar to the E. coli SOS operator recognized by the LexA repressor. An insertion mutation introduced into the recA locus of Synechococcus strain PCC 7002 via homologous recombination resulted in the formation of diploids carrying both mutant and wild-type recA alleles. A variety of growth regimens and transformation procedures failed to produce a recA Synechococcus strain PCC 7002 mutant. However, introduction into these diploid cells of the E. coli recA gene in trans on a biphasic shuttle vector resulted in segregation of the cyanobacterial recA alleles, indicating that the E. coli recA gene was able to provide a function required for growth of recA Synechococcus strain PCC 7002 cells. This interpretation is supported by the observation that the E. coli recA gene is maintained in these cells when antibiotic selection for the shuttle vector is removed. Images FIG. 3 FIG. 4 FIG. 6 PMID:2105307

Complete genome analysis of a novel umbravirus-polerovirus combination isolated from Ixeridium dentatum.

PubMed

Yoo, Ran Hee; Lee, Seung-Won; Lim, Seungmo; Zhao, Fumei; Igori, Davaajargal; Baek, Dasom; Hong, Jin-Sung; Lee, Su-Heon; Moon, Jae Sun

2017-12-01

Two novel viruses, isolated in Bonghwa, Republic of Korea, from an Ixeridium dentatum plant with yellowing mottle symptoms, have been provisionally named Ixeridium yellow mottle-associated virus 1 (IxYMaV-1) and Ixeridium yellow mottle-associated virus 2 (IxYMaV-2). IxYMaV-1 has a genome of 6,017 nucleotides sharing a 56.4% sequence identity with that of cucurbit aphid-borne yellows virus (genus Polerovirus). The IxYMaV-2 genome of 4,196 nucleotides has a sequence identity of less than 48.3% with e other species classified within the genus Umbravirus. Genome properties and phylogenetic analysis suggested that IxYMaV-1 and -2 are representative isolates of new species classifiable within the genus Polerovirus and Umbravirus, respectively.

Bioinformatic Analysis of Strawberry GSTF12 Gene

NASA Astrophysics Data System (ADS)

Wang, Xiran; Jiang, Leiyu; Tang, Haoru

2018-01-01

GSTF12 has always been known as a key factor of proanthocyanins accumulate in plant testa. Through bioinformatics analysis of the nucleotide and encoded protein sequence of GSTF12, it is more advantageous to the study of genes related to anthocyanin biosynthesis accumulation pathway. Therefore, we chosen GSTF12 gene of 11 kinds species, downloaded their nucleotide and protein sequence from NCBI as the research object, found strawberry GSTF12 gene via bioinformation analyse, constructed phylogenetic tree. At the same time, we analysed the strawberry GSTF12 gene of physical and chemical properties and its protein structure and so on. The phylogenetic tree showed that Strawberry and petunia were closest relative. By the protein prediction, we found that the protein owed one proper signal peptide without obvious transmembrane regions.

Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

PubMed

Brunak, S; Engelbrecht, J

1996-06-01

A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China

NASA Astrophysics Data System (ADS)

Zhao, Sufen; He, Peimin

2011-11-01

The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was <1.20%. Eucheumatoideae algae cultivated in China consisted of three clades, K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.

Identification of the initiation site of poliovirus polyprotein synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dorner, A.J.; Dorner, L.F.; Larsen, G.R.

1982-06-01

The complete nucleotide sequence of poliovirus RNA has a long open reading frame capable of encoding the precursor polyprotein NCVPOO. The first AUG codon in this reading frame is located 743 nucleotides from the 5' end of the RNA and is preceded by eight AUG codons in all three reading frames. Because all proteins that map at the amino terminus of the polyprotein (P1-1a, VPO, and VP4) are blocked at their amino termini and previous studies of ribosome binding have been inconclusive, direct identification of the initiation site of protein synthesis was difficult. We separated and identified all of themore » tryptic peptides of capsid protein VP4 and correlated these peptides with the amino acid sequence predicted to follow the AUG codon at nucleotide 743. Our data indicate that VP4 begins with a blocked glycine that is encoded immediately after the AUG codon at nucleotide 743. An S1 nuclease analysis of poliovirus mRNA failed to reveal a splice in the 5' region. We concluded that synthesis of poliovirus polyprotein is initiated at nucleotide 743, the first AUG codon in the long open reading frame.« less

Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

PubMed

Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

2012-06-01

Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Nucleotide sequence and phylogenetic analysis of Cucurbit yellow stunting disorder virus RNA 2.

PubMed

Livieratos, Ioannis C; Coutts, Robert H A

2002-06-01

The complete nucleotide sequence of Cucurbit yellow stunting disorder virus (CYSDV) RNA 2, a whitefly (Bemisia tabaci)-transmitted closterovirus with a bi-partite genome, is reported. CYSDV RNA 2 is 7,281 nucleotides long and contains the closterovirus hallmark gene array with a similar arrangement to the prototype member of the genus Crinivirus, Lettuce infectious yellows virus (LIYV). CYSDV RNA 2 contains open reading frames (ORFs) potentially encoding in a 5' to 3' direction for proteins of 5 kDa (ORF 1; hydrophobic protein), 62 kDa (ORF 2; heat shock protein 70 homolog, HSP70h), 59 kDa (ORF 3; protein of unknown function), 9 kDa (ORF 4; protein of unknown function), 28.5 kDa (ORF 5; coat protein, CP), 53 kDa (ORF 6; coat protein minor, CPm), and 26.5 kDa (ORF 7; protein of unknown function). Pairwise comparisons of CYSDV RNA 2-encoded proteins (HSP70h, p59 and CPm) among the closteroviruses showed that CYSDV is closely related to LIYV. Phylogenetic analysis based on the amino acid sequence of the HSP70h, indicated that CYSDV clusters with other members of the genus Crinivirus, and it is related to Little cherry virus-1 (LChV-1), but is distinct from the aphid- or mealybug-transmitted closteroviruses.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Phylogenetic analysis of Rutaceous plants based on single nucleotide polymorphism in chloroplast and nuclear gene sequences

USDA-ARS?s Scientific Manuscript database

The family Rutaceae encompasses several genera including the economically important genus Citrus. In this study, we selected 22 citrus relatives belonging to the various sub groups of Rutaceae and compared the sequences of three gene fragments. The accessions selected belong to the subfamily Rutoide...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurilla, M.G.; Stone, H.O.; Keene, J.D.

The 3' end of the genomic RNA of Newcastle disease virus (NDV) has been sequenced and the leader RNA defined. Using hybridization to a 3'-end-labeled genome, leader RNA species from in vitro transcription reactions and from infected cell extracts were found to be 47 and 53 nucleotides long. In addition, the start site of the 3'-proximal mRNA was determined by sequence analysis of in vitro (beta-32P)GTP-labeled transcription products. The genomic sequence extending beyond the leader region demonstrated an open reading frame for at least 42 amino acids and probably represents the amino terminus of the nucleocapsid protein (NP). The terminalmore » 8 nucleotides of the NDV genome were identical to those of measles virus and Sendai virus while the sequence of the distal half of the leader region was more similar to that of vesicular stomatitis virus. These data argue for strong evolutionary relatedness between the paramyxovirus and rhabdovirus groups.« less

Nucleotide sequencing analysis of a LEU gene of Candida maltosa which complements leuB mutation of Escherichia coli and leu2 mutation of Saccharomyces cerevisiae.

PubMed

Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K

1987-01-01

The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.

NABIC: A New Access Portal to Search, Visualize, and Share Agricultural Genomics Data

PubMed Central

Seol, Young-Joo; Lee, Tae-Ho; Park, Dong-Suk; Kim, Chang-Kug

2016-01-01

The National Agricultural Biotechnology Information Center developed an access portal to search, visualize, and share agricultural genomics data with a focus on South Korean information and resources. The portal features an agricultural biotechnology database containing a wide range of omics data from public and proprietary sources. We collected 28.4 TB of data from 162 agricultural organisms, with 10 types of omics data comprising next-generation sequencing sequence read archive, genome, gene, nucleotide, DNA chip, expressed sequence tag, interactome, protein structure, molecular marker, and single-nucleotide polymorphism datasets. Our genomic resources contain information on five animals, seven plants, and one fungus, which is accessed through a genome browser. We also developed a data submission and analysis system as a web service, with easy-to-use functions and cutting-edge algorithms, including those for handling next-generation sequencing data. PMID:26848255

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

PubMed

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

Molecular cloning and sequence analysis of the Anticarsia gemmatalis multicapsid nuclear polyhedrosis virus GP64 glycoprotein.

PubMed

Pilloff, Marcela Gabriela; Bilen, Marcos Fabián; Belaich, Mariano Nicolás; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

2003-01-01

The gp64 locus of Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate Santa Fe (AgMNPV-SF) was characterised molecularly in our laboratory. To this end, we have located and cloned a AgMNPV-SF genomic DNA fragment containing the gp64 gene and sequenced the complete gp64 locus. Nucleotide sequence analysis indicated that the AgMNPV gp64 gene consists of a 1500 nucleotide open reading frame (ORF), encoding a protein of 499 amino acids. Of the seven gp64 homologues identified to date, the AgMNPV gp64 ORF shared most sequence similarity with the gp64 gene of Orgyia pseudotsugata MNPV. The GP64 from AgMNPV is the smallest baculoviral envelope glycoprotein found to date, differing in 10 or more residues from the other group I nucleopolyhedroviruses. The biological activity of AgMNPV GP64 protein was assessed by cell fusion assays in UFL-AG-286 cells using the obtained recombinant plasmids. In the upstream and downstream regions, relative to the gp64 ORF, we found different conserved transcriptional and post-transcriptional regulatory elements, respectively.

Molecular Characterization of Watermelon Chlorotic Stunt Virus (WmCSV) from Palestine

PubMed Central

Ali-Shtayeh, Mohammed S.; Jamous, Rana M.; Mallah, Omar B.; Abu-Zeitoun, Salam Y.

2014-01-01

The incidence of watermelon chlorotic stunt disease and molecular characterization of the Palestinian isolate of Watermelon chlorotic stunt virus (WmCSV-[PAL]) are described in this study. Symptomatic leaf samples obtained from watermelon Citrullus lanatus (Thunb.), and cucumber (Cucumis sativus L.) plants were tested for WmCSV-[PAL] infection by polymerase chain reaction (PCR) and Rolling Circle Amplification (RCA). Disease incidence ranged between 25%–98% in watermelon fields in the studied area, 77% of leaf samples collected from Jenin were found to be mixed infected with WmCSV-[PAL] and SLCV. The full-length DNA-A and DNA-B genomes of WmCSV-[PAL] were amplified and sequenced, and the sequences were deposited in the GenBank. Sequence analysis of virus genomes showed that DNA-A and DNA-B had 97.6%–99.42% and 93.16%–98.26% nucleotide identity with other virus isolates in the region, respectively. Sequence analysis also revealed that the Palestinian isolate of WmCSV shared the highest nucleotide identity with an isolate from Israel suggesting that the virus was introduced to Palestine from Israel. PMID:24956181

Organization of nif gene cluster in Frankia sp. EuIK1 strain, a symbiont of Elaeagnus umbellata.

PubMed

Oh, Chang Jae; Kim, Ho Bang; Kim, Jitae; Kim, Won Jin; Lee, Hyoungseok; An, Chung Sun

2012-01-01

The nucleotide sequence of a 20.5-kb genomic region harboring nif genes was determined and analyzed. The fragment was obtained from Frankia sp. EuIK1 strain, an indigenous symbiont of Elaeagnus umbellata. A total of 20 ORFs including 12 nif genes were identified and subjected to comparative analysis with the genome sequences of 3 Frankia strains representing diverse host plant specificities. The nucleotide and deduced amino acid sequences showed highest levels of identity with orthologous genes from an Elaeagnus-infecting strain. The gene organization patterns around the nif gene clusters were well conserved among all 4 Frankia strains. However, characteristic features appeared in the location of the nifV gene for each Frankia strain, depending on the type of host plant. Sequence analysis was performed to determine the transcription units and suggested that there could be an independent operon starting from the nifW gene in the EuIK strain. Considering the organization patterns and their total extensions on the genome, we propose that the nif gene clusters remained stable despite genetic variations occurring in the Frankia genomes.

Cell proteins bind to multiple sites within the 5' untranslated region of poliovirus RNA.

PubMed Central

del Angel, R M; Papavassiliou, A G; Fernández-Tomás, C; Silverstein, S J; Racaniello, V R

1989-01-01

The 5' noncoding region of poliovirus RNA contains sequences necessary for translation and replication. These functions are probably carried out by recognition of poliovirus RNA by cellular and/or viral proteins. Using a mobility-shift electrophoresis assay and 1,10-phenanthroline/Cu+ footprinting, we demonstrate specific binding of cytoplasmic factors with a sequence from nucleotides 510-629 within the 5' untranslated region (UTR). Complex formation was also observed with a second sequence (nucleotides 97-182) within the 5' UTR. These two regions of the 5' UTR appear to be recognized by distinct cell factors as determined by competition analysis and the effects of ionic strength on complex formation. However, both complexes contain eukaryotic initiation factor 2 alpha, as revealed by their reaction with specific antibody. Images PMID:2554308

Genotypic relationships between Taenia saginata, Taenia asiatica and their hybrids.

PubMed

Yamane, Kanako; Yanagida, Tetsuya; Li, Tiaoying; Chen, Xingwang; Dekumyoy, Paron; Waikagul, Jitra; Nkouawa, Agathe; Nakao, Minoru; Sako, Yasuhito; Ito, Akira; Sato, Hiroshi; Okamoto, Munehiro

2013-11-01

Partial sequences of the DNA polymerase delta (pold) gene from Taenia saginata-like adult worms were sequenced. Phylogenetic analysis revealed that pold gene sequences were clearly divided into two clades, differing from each other in five to seven nucleotides. There is little doubt that T. saginata and Taenia asiatica were once separated into two distinct taxa as has been concluded in previous studies. On the other hand, most of the adult worms, which were identified as T. asiatica using mitochondrial DNA, were homozygous for an allele that originated from the allele of T. saginata via single nucleotide substitution. These results indicate that most of the adult worms, which had been called T. asiatica, are not actually 'pure T. asiatica' but instead originated from the hybridization of 'pure T. saginata' and 'pure T. asiatica'.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

PubMed

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

PubMed Central

Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

2015-01-01

Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).

PubMed

Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J

1998-06-01

Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

NASA Astrophysics Data System (ADS)

Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

2017-09-01

There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Genetic characterization of strains of Saccharomyces uvarum from New Zealand wineries.

PubMed

Zhang, Hanyao; Richards, Keith D; Wilson, Sandra; Lee, Soon A; Sheehan, Hester; Roncoroni, Miguel; Gardner, Richard C

2015-04-01

We present a genetic characterization of 65 isolates of Saccharomyces uvarum isolated from wineries in New Zealand, along with the complete nucleotide sequence of a single sulfite-tolerant isolate. The genome of the New Zealand isolate averaged 99.85% nucleotide identity to CBS7001, the previously sequenced strain of S. uvarum. However, three genomic segments (37-87 kb) showed 10% nucleotide divergence from CBS7001 but 99% identity to Saccharomyces eubayanus. We conclude that these three segments appear to have been introgressed from that species. The nucleotide sequence of the internal transcribed spacer (ITS) region from other New Zealand isolates were also very similar to that of CBS7001, and hybrids showed complete genetic compatibility for some strains, with tetrads giving four viable progeny that showed 2:2 segregations of marker genes. Some strains showed high tolerance to sulfite, with genetic analysis indicating linkage of this trait to the transcription factor FZF1, but not to SSU1, the sulfite efflux pump that it regulates in order to confer sulfite tolerance in Saccharomyces cerevisiae. The fermentation characteristics of selected strains of S. uvarum showed exceptionally good cold fermentation characteristics, superior to the best commercially available strains of S. cerevisiae. Copyright © 2014 Elsevier Ltd. All rights reserved.

Novel avian paramyxovirus (APMV-15) isolated from a migratory bird in South America.

PubMed

Thomazelli, Luciano Matsumiya; de Araújo, Jansen; Fabrizio, Thomas; Walker, David; Reischak, Dilmara; Ometto, Tatiana; Barbosa, Carla Meneguin; Petry, Maria Virginia; Webby, Richard J; Durigon, Edison Luiz

2017-01-01

A novel avian paramyxovirus (APMV) isolated from a migratory bird cloacal swab obtained during active surveillance in April 2012 in the Lagoa do Peixe National Park, Rio Grande do Sul state, South of Brazil was biologically and genetically characterized. The nucleotide sequence of the full viral genome was completed using a next-generation sequencing approach. The genome was 14,952 nucleotides (nt) long, with six genes (3'-NP-P-M-F-HN-L-5') encoding 7 different proteins, typical of APMV. The fusion (F) protein gene of isolate RS-1177 contained 1,707 nucleotides in a single open reading frame encoding a protein of 569 amino acids. The F protein cleavage site contained two basic amino acids (VPKER↓L), typical of avirulent strains. Phylogenetic analysis of the whole genome indicated that the virus is related to APMV-10, -2 and -8, with 60.1% nucleotide sequence identity to the closest APMV-10 virus, 58.7% and 58.5% identity to the closest APMV-8 and APMV-2 genome, respectively, and less than 52% identity to representatives of the other APMVs groups. Such distances are comparable to the distances observed among other previously identified APMVs serotypes. These results suggest that unclassified/calidris_fuscicollis/Brazil/RS-1177/2012 is the prototype strain of a new APMV serotype, APMV-15.

Poly A tail length analysis of in vitro transcribed mRNA by LC-MS.

PubMed

Beverly, Michael; Hagen, Caitlin; Slack, Olga

2018-02-01

The 3'-polyadenosine (poly A) tail of in vitro transcribed (IVT) mRNA was studied using liquid chromatography coupled to mass spectrometry (LC-MS). Poly A tails were cleaved from the mRNA using ribonuclease T1 followed by isolation with dT magnetic beads. Extracted tails were then analyzed by LC-MS which provided tail length information at single-nucleotide resolution. A 2100-nt mRNA with plasmid-encoded poly A tail lengths of either 27, 64, 100, or 117 nucleotides was used for these studies as enzymatically added poly A tails showed significant length heterogeneity. The number of As observed in the tails closely matched Sanger sequencing results of the DNA template, and even minor plasmid populations with sequence variations were detected. When the plasmid sequence contained a discreet number of poly As in the tail, analysis revealed a distribution that included tails longer than the encoded tail lengths. These observations were consistent with transcriptional slippage of T7 RNAP taking place within a poly A sequence. The type of RNAP did not alter the observed tail distribution, and comparison of T3, T7, and SP6 showed all three RNAPs produced equivalent tail length distributions. The addition of a sequence at the 3' end of the poly A tail did, however, produce narrower tail length distributions which supports a previously described model of slippage where the 3' end can be locked in place by having a G or C after the poly nucleotide region. Graphical abstract Determination of mRNA poly A tail length using magnetic beads and LC-MS.

First isolation of Actinobacillus genomospecies 2 in Japan.

PubMed

Murakami, Miyuki; Shimonishi, Yoshimasa; Hobo, Seiji; Niwa, Hidekazu; Ito, Hiroya

2016-05-03

We describe here the first isolation of Actinobacillus genomospecies 2 in Japan. The isolate was found in a septicemic foal and characterized by phenotypic and genetic analyses, with the latter consisting of 16S rDNA nucleotide sequence analysis plus multilocus sequence analysis using three housekeeping genes, recN, rpoA and thdF, that have been proposed for use as a genomic tool in place of DNA-DNA hybridization.

Error correction and diversity analysis of population mixtures determined by NGS

PubMed Central

Burroughs, Nigel J.; Evans, David J.; Ryabov, Eugene V.

2014-01-01

The impetus for this work was the need to analyse nucleotide diversity in a viral mix taken from honeybees. The paper has two findings. First, a method for correction of next generation sequencing error in the distribution of nucleotides at a site is developed. Second, a package of methods for assessment of nucleotide diversity is assembled. The error correction method is statistically based and works at the level of the nucleotide distribution rather than the level of individual nucleotides. The method relies on an error model and a sample of known viral genotypes that is used for model calibration. A compendium of existing and new diversity analysis tools is also presented, allowing hypotheses about diversity and mean diversity to be tested and associated confidence intervals to be calculated. The methods are illustrated using honeybee viral samples. Software in both Excel and Matlab and a guide are available at http://www2.warwick.ac.uk/fac/sci/systemsbiology/research/software/, the Warwick University Systems Biology Centre software download site. PMID:25405074

Detection and molecular characterization of tomato yellow leaf curl virus naturally infecting Lycopersicon esculentum in Egypt.

PubMed

Rabie, M; Ratti, C; Abdel Aleem, E; Fattouh, F

Tomato yellow leaf curl virus (TYLCV) infections of tomato crops in Egypt were widely spread in 2014. Infected symptomatic tomato plants from different governorates were sampled. TYLCV strains Israel and Mild (TYLCV-IL, TYLCV-Mild) were identified by multiplex and real-time PCR. In addition, nucleotide sequence analysis of the V1 and V2 protein genes, revealed ten TYLCV Egyptian isolates (TYLCV from TY1 to 10). Phylogenetic analysis showed their high degree of relatedness with TYLCV-IL Jordan isolate (98%). Here we have showed the complete nucleotide sequence of the TYLCV Egyptian isolate TY10, sampled from El Beheira. A high degree of similarity to other previously reported Egyptian isolates and isolates from Jordan and Japan reflect the importance of phylogenetic analysis in monitoring virus genetic diversity and possibilities for divergence of more virulent strains or genotypes.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Molecular evidence of father-to-child transmission of hepatitis B virus.

PubMed

Tajiri, Hitoshi; Tanaka, Yasuhito; Kagimoto, Seiiti; Murakami, Jun; Tokuhara, Daisuke; Mizokami, Masashi

2007-07-01

At present in Japan, only high-risk infants born to chronic hepatitis B virus (HBV)-infected mothers are given HBV vaccine. However, children can contract the virus from other HBV-infected family members, including fathers. The aim of this study is to present substantial and unequivocal evidence of father-to-child transmission of HBV infection using techniques including homology analysis and phylogenetic analysis. Thirteen chronic HBV-infected members of five families that included eight children and their respective fathers were enrolled in this study. Homology analysis and phylogenetic analyses of 2 coding region, the S gene and X gene, from the HBV genome were performed comparing the 13 nucleotide sequences from the 13 subjects. The nucleotide homology among the five sets of fathers and children was quite high (99.3-100%). A phylogenetic tree constructed on the 13 nucleotide sequences showed that all 5 sets of fathers and children were grouped into the same cluster with high bootstrap values. These results strongly indicate that father-to-child transmission is an important route of HBV infection in Japan and it is recommend that universal vaccination against HBV infection be instituted immediately in Japan for all children, in accordance with the WHO recommendation of 1997.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

2007-02-14

The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

PubMed Central

Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060

Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

PubMed

Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

2017-01-01

Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.

Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

PubMed Central

Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

2014-01-01

Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition

PubMed Central

Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Bazire, Pascal; Beluche, Odette; Bertrand, Laurie; Besnard-Gonnet, Marielle; Bordelais, Isabelle; Boutard, Magali; Dubois, Maria; Dumont, Corinne; Ettedgui, Evelyne; Fernandez, Patricia; Garcia, Espérance; Aiach, Nathalie Giordanenco; Guerin, Thomas; Hamon, Chadia; Brun, Elodie; Lebled, Sandrine; Lenoble, Patricia; Louesse, Claudine; Mahieu, Eric; Mairey, Barbara; Martins, Nathalie; Megret, Catherine; Milani, Claire; Muanga, Jacqueline; Orvain, Céline; Payen, Emilie; Perroud, Peggy; Petit, Emmanuelle; Robert, Dominique; Ronsin, Murielle; Vacherie, Benoit; Acinas, Silvia G.; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M.; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E.; Stepanauskas, Ramunas; Sullivan, Matthew B.; Brum, Jennifer R.; Duhaime, Melissa B.; Poulos, Bonnie T.; Hurwitz, Bonnie L.; Acinas, Silvia G.; Bork, Peer; Boss, Emmanuel; Bowler, Chris; De Vargas, Colomban; Follows, Michael; Gorsky, Gabriel; Grimsley, Nigel; Hingamp, Pascal; Iudicone, Daniele; Jaillon, Olivier; Kandels-Lewis, Stefanie; Karp-Boss, Lee; Karsenti, Eric; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stéphane; Raes, Jeroen; Sardet, Christian; Sieracki, Michael E.; Speich, Sabrina; Stemmann, Lars; Sullivan, Matthew B.; Sunagawa, Shinichi; Wincker, Patrick; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

2017-01-01

A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009–2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world’s planktonic ecosystems. PMID:28763055

Structural Analysis of Biodiversity

PubMed Central

Sirovich, Lawrence; Stoeckle, Mark Y.; Zhang, Yu

2010-01-01

Large, recently-available genomic databases cover a wide range of life forms, suggesting opportunity for insights into genetic structure of biodiversity. In this study we refine our recently-described technique using indicator vectors to analyze and visualize nucleotide sequences. The indicator vector approach generates correlation matrices, dubbed Klee diagrams, which represent a novel way of assembling and viewing large genomic datasets. To explore its potential utility, here we apply the improved algorithm to a collection of almost 17000 DNA barcode sequences covering 12 widely-separated animal taxa, demonstrating that indicator vectors for classification gave correct assignment in all 11000 test cases. Indicator vector analysis revealed discontinuities corresponding to species- and higher-level taxonomic divisions, suggesting an efficient approach to classification of organisms from poorly-studied groups. As compared to standard distance metrics, indicator vectors preserve diagnostic character probabilities, enable automated classification of test sequences, and generate high-information density single-page displays. These results support application of indicator vectors for comparative analysis of large nucleotide data sets and raise prospect of gaining insight into broad-scale patterns in the genetic structure of biodiversity. PMID:20195371

Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

PubMed

Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

2017-08-01

A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

Curated eutherian third party data gene data sets.

PubMed

Premzl, Marko

2016-03-01

The free available eutherian genomic sequence data sets advanced scientific field of genomics. Of note, future revisions of gene data sets were expected, due to incompleteness of public eutherian genomic sequence assemblies and potential genomic sequence errors. The eutherian comparative genomic analysis protocol was proposed as guidance in protection against potential genomic sequence errors in public eutherian genomic sequences. The protocol was applicable in updates of 7 major eutherian gene data sets, including 812 complete coding sequences deposited in European Nucleotide Archive as curated third party data gene data sets.

Molecular characterization of southern bluefin tuna myoglobin (Thunnus maccoyii).

PubMed

Nurilmala, Mala; Ochiai, Yoshihiro

2016-10-01

The primary structure of southern bluefin tuna Thunnus maccoyii Mb has been elucidated by molecular cloning techniques. The cDNA of this tuna encoding Mb contained 776 nucleotides, with an open reading frame of 444 nucleotides encoding 147 amino acids. The nucleotide sequence of the coding region was identical to those of other bluefin tunas (T. thynnus and T. orientalis), thus giving the same amino acid sequences. Based on the deduced amino acid sequence, bioinformatic analysis was performed including phylogenic tree, hydropathy plot and homology modeling. In order to investigate the autoxidation profiles, the isolation of Mb was performed from the dark muscle. The water soluble fraction was subjected to ammonium sulfate fractionation (60-90 % saturation) followed by preparative gel electrophoresis. Autoxidation profiles of Mb were delineated at pH 5.6, 6.5 and 7.4 at temperature 37 °C. The autoxidation rate of tuna Mb was slightly higher than that of horse Mb at all pH examined. These results revealed that tuna myoglobin was unstable than that of horse Mb mainly at acidic pH.

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

PubMed

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

Analysis of the whole mitochondrial genome: translation of the Ion Torrent Personal Genome Machine system to the diagnostic bench?

PubMed

Seneca, Sara; Vancampenhout, Kim; Van Coster, Rudy; Smet, Joél; Lissens, Willy; Vanlander, Arnaud; De Paepe, Boel; Jonckheere, An; Stouffs, Katrien; De Meirleir, Linda

2015-01-01

Next-generation sequencing (NGS), an innovative sequencing technology that enables the successful analysis of numerous gene sequences in a massive parallel sequencing approach, has revolutionized the field of molecular biology. Although NGS was introduced in a rather recent past, the technology has already demonstrated its potential and effectiveness in many research projects, and is now on the verge of being introduced into the diagnostic setting of routine laboratories to delineate the molecular basis of genetic disease in undiagnosed patient samples. We tested a benchtop device on retrospective genomic DNA (gDNA) samples of controls and patients with a clinical suspicion of a mitochondrial DNA disorder. This Ion Torrent Personal Genome Machine platform is a high-throughput sequencer with a fast turnaround time and reasonable running costs. We challenged the chemistry and technology with the analysis and processing of a mutational spectrum composed of samples with single-nucleotide substitutions, indels (insertions and deletions) and large single or multiple deletions, occasionally in heteroplasmy. The output data were compared with previously obtained conventional dideoxy sequencing results and the mitochondrial revised Cambridge Reference Sequence (rCRS). We were able to identify the majority of all nucleotide alterations, but three false-negative results were also encountered in the data set. At the same time, the poor performance of the PGM instrument in regions associated with homopolymeric stretches generated many false-positive miscalls demanding additional manual curation of the data.

Comparison and correlation of Simple Sequence Repeats distribution in genomes of Brucella species

PubMed Central

Kiran, Jangampalli Adi Pradeep; Chakravarthi, Veeraraghavulu Praveen; Kumar, Yellapu Nanda; Rekha, Somesula Swapna; Kruti, Srinivasan Shanthi; Bhaskar, Matcha

2011-01-01

Computational genomics is one of the important tools to understand the distribution of closely related genomes including simple sequence repeats (SSRs) in an organism, which gives valuable information regarding genetic variations. The central objective of the present study was to screen the SSRs distributed in coding and non-coding regions among different human Brucella species which are involved in a range of pathological disorders. Computational analysis of the SSRs in the Brucella indicates few deviations from expected random models. Statistical analysis also reveals that tri-nucleotide SSRs are overrepresented and tetranucleotide SSRs underrepresented in Brucella genomes. From the data, it can be suggested that over expressed tri-nucleotide SSRs in genomic and coding regions might be responsible in the generation of functional variation of proteins expressed which in turn may lead to different pathogenicity, virulence determinants, stress response genes, transcription regulators and host adaptation proteins of Brucella genomes. Abbreviations SSRs - Simple Sequence Repeats, ORFs - Open Reading Frames. PMID:21738309

Homology analysis and cross-immunogenicity of OmpA from pathogenic Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis.

PubMed

Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin

2015-12-01

The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.

Sequence determination and analysis of the NSs genes of two tospoviruses.

PubMed

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Universal Readers Based on Hydrogen Bonding or π-π Stacking for Identification of DNA Nucleotides in Electron Tunnel Junctions.

PubMed

Biswas, Sovan; Sen, Suman; Im, JongOne; Biswas, Sudipta; Krstic, Predrag; Ashcroft, Brian; Borges, Chad; Zhao, Yanan; Lindsay, Stuart; Zhang, Peiming

2016-12-27

A reader molecule, which recognizes all the naturally occurring nucleobases in an electron tunnel junction, is required for sequencing DNA by a recognition tunneling (RT) technique, referred to as a universal reader. In the present study, we have designed a series of heterocyclic carboxamides based on hydrogen bonding and a large-sized pyrene ring based on a π-π stacking interaction as universal reader candidates. Each of these compounds was synthesized to bear a thiolated linker for attachment to metal electrodes and examined for their interactions with naturally occurring DNA nucleosides and nucleotides by 1 H NMR, ESI-MS, computational calculations, and surface plasmon resonance. RT measurements were carried out in a scanning tunnel microscope. All of these molecules generated electrical signals with DNA nucleotides in tunneling junctions under physiological conditions (phosphate buffered aqueous solution, pH 7.4). Using a support vector machine as a tool for data analysis, we found that these candidates distinguished among naturally occurring DNA nucleotides with the accuracy of pyrene (by π-π stacking interactions) > azole carboxamides (by hydrogen-bonding interactions). In addition, the pyrene reader operated efficiently in a larger tunnel junction. However, the azole carboxamide could read abasic (AP) monophosphate, a product from spontaneous base hydrolysis or an intermediate of base excision repair. Thus, we envision that sequencing DNA using both π-π stacking and hydrogen-bonding-based universal readers in parallel should generate more comprehensive genome sequences than sequencing based on either reader molecule alone.

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

MIG-seq: an effective PCR-based method for genome-wide single-nucleotide polymorphism genotyping using the next-generation sequencing platform

PubMed Central

Suyama, Yoshihisa; Matsuki, Yu

2015-01-01

Restriction-enzyme (RE)-based next-generation sequencing methods have revolutionized marker-assisted genetic studies; however, the use of REs has limited their widespread adoption, especially in field samples with low-quality DNA and/or small quantities of DNA. Here, we developed a PCR-based procedure to construct reduced representation libraries without RE digestion steps, representing de novo single-nucleotide polymorphism discovery, and its genotyping using next-generation sequencing. Using multiplexed inter-simple sequence repeat (ISSR) primers, thousands of genome-wide regions were amplified effectively from a wide variety of genomes, without prior genetic information. We demonstrated: 1) Mendelian gametic segregation of the discovered variants; 2) reproducibility of genotyping by checking its applicability for individual identification; and 3) applicability in a wide variety of species by checking standard population genetic analysis. This approach, called multiplexed ISSR genotyping by sequencing, should be applicable to many marker-assisted genetic studies with a wide range of DNA qualities and quantities. PMID:26593239

Organization and transient expression of the gene for human U11 snRNA

PubMed Central

Clemens, Suter-Crazzolara; Walter, Keller

1991-01-01

The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

[Completed sequences analysis on the Chinese attenuated yellow fever 17D vaccine strain and the WHO standard yellow fever 17D vaccine strain].

PubMed

Li, Jing; Yu, Yong-Xin; Dong, Guan-Mu

2009-04-01

To compare the molecular characteristics of the Chinese attenuated yellow fever 17D vaccine strain and the WHO reference yellow fever 17D vaccine strain. The primers were designed according to the published nucleotide sequences of YFV 17D strains in GenBank. Total RNA of was extracted by the Trizol and reverse transcripted. The each fragments of the YFV genome were amplified by PCR and sequenced subsequently. The fragments of the 5' and 3' end of the two strains were cloned into the pGEM T-easy vector and then sequenced. The nucleotide acid and amino acid sequences of the homology to both strains were 99% with each other. No obvious nulceotide changes were found in the sequences of the entire genome of each 17D strains. Moreover, there was no obvious changes in the E protein genes. But the E173 of YF17D Tiantan, associted with the virulence, had mutantions. And the two live attenuated yellow fever 17D vaccine strains fell to the same lineage by the phylogenetic analysis. The results indicated that the two attenuated yellow fever 17D vaccine viruses accumulates mutations at a very low frequency and the genomes were relative stable.

An Outbreak of Acute Hepatitis Caused by Genotype IB Hepatitis A Viruses Contaminating the Water Supply in Thailand.

PubMed

Ruchusatsawat, Kriangsak; Wongpiyabovorn, Jongkonnee; Kawidam, Chonthicha; Thiemsing, Laddawan; Sangkitporn, Somchai; Yoshizaki, Sayaka; Tatsumi, Masashi; Takeda, Naokazu; Ishii, Koji

2016-01-01

In 2000, an outbreak of acute hepatitis A was reported in a province adjacent to Bangkok, Thailand. To investigate the cause of the 2000 hepatitis A outbreaks in Thailand using molecular epidemiological analysis. Serum and stool specimens were collected from patients who were clinically diagnosed with acute viral hepatitis. Water samples from drinking water and deep-drilled wells were also collected. These specimens were subjected to polymerase chain reaction (PCR) amplification and sequencing of the VP1/2A region of the hepatitis A virus (HAV) genome. The entire genome sequence of one of the fecal specimens was determined and phylogenetically analyzed with those of known HAV sequences. Eleven of 24 fecal specimens collected from acute viral hepatitis patients were positive as determined by semi- nested reverse transcription PCR targeting the VP1/2A region of HAV. The nucleotide sequence of these samples had an identical genotype IB sequence, suggesting that the same causative agent was present. The complete nucleotide sequence derived from one of the samples indicated that the Thai genotype IB strain should be classified in a unique phylogenetic cluster. The analysis using an adjusted odds ratio showed that the consumption of groundwater was the most likely risk factor associated with the disease. © 2017 S. Karger AG, Basel.

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis

PubMed Central

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Phylogenetic Diversity of NTT Nucleotide Transport Proteins in Free-Living and Parasitic Bacteria and Eukaryotes

PubMed Central

Major, Peter; Embley, T. Martin

2017-01-01

Plasma membrane-located nucleotide transport proteins (NTTs) underpin the lifestyle of important obligate intracellular bacterial and eukaryotic pathogens by importing energy and nucleotides from infected host cells that the pathogens can no longer make for themselves. As such their presence is often seen as a hallmark of an intracellular lifestyle associated with reductive genome evolution and loss of primary biosynthetic pathways. Here, we investigate the phylogenetic distribution of NTT sequences across the domains of cellular life. Our analysis reveals an unexpectedly broad distribution of NTT genes in both host-associated and free-living prokaryotes and eukaryotes. We also identify cases of within-bacteria and bacteria-to-eukaryote horizontal NTT transfer, including into the base of the oomycetes, a major clade of parasitic eukaryotes. In addition to identifying sequences that retain the canonical NTT structure, we detected NTT gene fusions with HEAT-repeat and cyclic nucleotide binding domains in Cyanobacteria, pathogenic Chlamydiae and Oomycetes. Our results suggest that NTTs are versatile functional modules with a much wider distribution and a broader range of potential roles than has previously been appreciated. PMID:28164241

Analysis of whole genome sequences of 16 strains of rubella virus from the United States, 1961-2009.

PubMed

Abernathy, Emily; Chen, Min-hsin; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen; Zheng, Qi; Bellini, William; Icenogle, Joseph

2013-01-25

Rubella virus is the causative agent of rubella, a mild rash illness, and a potent teratogenic agent when contracted by a pregnant woman. Global rubella control programs target the reduction and elimination of congenital rubella syndrome. Phylogenetic analysis of partial sequences of rubella viruses has contributed to virus surveillance efforts and played an important role in demonstrating that indigenous rubella viruses have been eliminated in the United States. Sixteen wild-type rubella viruses were chosen for whole genome sequencing. All 16 viruses were collected in the United States from 1961 to 2009 and are from 8 of the 13 known rubella genotypes. Phylogenetic analysis of 30 whole genome sequences produced a maximum likelihood tree giving high bootstrap values for all genotypes except provisional genotype 1a. Comparison of the 16 new complete sequences and 14 previously sequenced wild-type viruses found regions with clusters of variable amino acids. The 5' 250 nucleotides of the genome are more conserved than any other part of the genome. Genotype specific deletions in the untranslated region between the non-structural and structural open reading frames were observed for genotypes 2B and genotype 1G. No evidence was seen for recombination events among the 30 viruses. The analysis presented here is consistent with previous reports on the genetic characterization of rubella virus genomes. Conserved and variable regions were identified and additional evidence for genotype specific nucleotide deletions in the intergenic region was found. Phylogenetic analysis confirmed genotype groupings originally based on structural protein coding region sequences, which provides support for the WHO nomenclature for genetic characterization of wild-type rubella viruses.

High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by combining a re-sequencing approach and SNPlex technology

PubMed Central

Lijavetzky, Diego; Cabezas, José Antonio; Ibáñez, Ana; Rodríguez, Virginia; Martínez-Zapater, José M

2007-01-01

Background Single-nucleotide polymorphisms (SNPs) are the most abundant type of DNA sequence polymorphisms. Their higher availability and stability when compared to simple sequence repeats (SSRs) provide enhanced possibilities for genetic and breeding applications such as cultivar identification, construction of genetic maps, the assessment of genetic diversity, the detection of genotype/phenotype associations, or marker-assisted breeding. In addition, the efficiency of these activities can be improved thanks to the ease with which SNP genotyping can be automated. Expressed sequence tags (EST) sequencing projects in grapevine are allowing for the in silico detection of multiple putative sequence polymorphisms within and among a reduced number of cultivars. In parallel, the sequence of the grapevine cultivar Pinot Noir is also providing thousands of polymorphisms present in this highly heterozygous genome. Still the general application of those SNPs requires further validation since their use could be restricted to those specific genotypes. Results In order to develop a large SNP set of wide application in grapevine we followed a systematic re-sequencing approach in a group of 11 grape genotypes corresponding to ancient unrelated cultivars as well as wild plants. Using this approach, we have sequenced 230 gene fragments, what represents the analysis of over 1 Mb of grape DNA sequence. This analysis has allowed the discovery of 1573 SNPs with an average of one SNP every 64 bp (one SNP every 47 bp in non-coding regions and every 69 bp in coding regions). Nucleotide diversity in grape (π = 0.0051) was found to be similar to values observed in highly polymorphic plant species such as maize. The average number of haplotypes per gene sequence was estimated as six, with three haplotypes representing over 83% of the analyzed sequences. Short-range linkage disequilibrium (LD) studies within the analyzed sequences indicate the existence of a rapid decay of LD within the selected grapevine genotypes. To validate the use of the detected polymorphisms in genetic mapping, cultivar identification and genetic diversity studies we have used the SNPlex™ genotyping technology in a sample of grapevine genotypes and segregating progenies. Conclusion These results provide accurate values for nucleotide diversity in coding sequences and a first estimate of short-range LD in grapevine. Using SNPlex™ genotyping we have shown the application of a set of discovered SNPs as molecular markers for cultivar identification, linkage mapping and genetic diversity studies. Thus, the combination a highly efficient re-sequencing approach and the SNPlex™ high throughput genotyping technology provide a powerful tool for grapevine genetic analysis. PMID:18021442

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

IG and TR single chain fragment variable (scFv) sequence analysis: a new advanced functionality of IMGT/V-QUEST and IMGT/HighV-QUEST.

PubMed

Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule

2017-06-26

IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino changes). The functionality is generic and can analyse any IG or TR single chain nucleotide sequence containing two V domains, provided that the corresponding species IMGT reference directory is available. The "Analysis of single chain Fragment variable (scFv)" implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST provides the identification and full characterization of the two V domains of full-length scFv (~850 bp) nucleotide sequences from combinatorial libraries. The analysis can also be performed on concatenated paired chains of expressed antigen receptor IG or TR repertoires.

First isolation of Actinobacillus genomospecies 2 in Japan

PubMed Central

MURAKAMI, Miyuki; SHIMONISHI, Yoshimasa; HOBO, Seiji; NIWA, Hidekazu; ITO, Hiroya

2015-01-01

We describe here the first isolation of Actinobacillus genomospecies 2 in Japan. The isolate was found in a septicemic foal and characterized by phenotypic and genetic analyses, with the latter consisting of 16S rDNA nucleotide sequence analysis plus multilocus sequence analysis using three housekeeping genes, recN, rpoA and thdF, that have been proposed for use as a genomic tool in place of DNA-DNA hybridization. PMID:26668165

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

Nucleotide sequence of RNA2 of Lettuce big-vein virus and evidence for a possible transcription termination/initiation strategy similar to that of rhabdoviruses.

PubMed

Sasaya, Takahide; Kusaba, Shinnosuke; Ishikawa, Koichi; Koganezawa, Hiroki

2004-09-01

Lettuce big-vein virus (LBVV) is the type species of the genus Varicosavirus and is a two-segmented negative-sense single-stranded RNA virus. The larger LBVV genome segment (RNA1) consists of 6797 nt and encodes an L polymerase that resembles that of rhabdoviruses. Here, the nucleotide sequence of the second LBVV genome segment (RNA2) is reported. LBVV RNA2 consisted of 6081 nt and contained antisense information for five major ORFs: ORF1 (nt 210-1403 on the viral RNA), ORF2 (nt 1493-2494), ORF3 (nt 2617-3489), ORF4 (nt 3843-4337) and ORF5 (nt 4530-5636), which had coding capacities of 44, 36, 32, 19 and 41 kDa, respectively. The gene at the 3' end of the viral RNA encoded a coat protein, while the other four genes encoded proteins of unknown functions. The 3'-terminal 11 nt of LBVV RNA2 were identical to those of LBVV RNA1, and the 5'-terminal regions of LBVV RNA1 and RNA2 contained a long common nucleotide stretch of about 100 nt. Northern blot analysis using probes specific to the individual ORFs revealed that LBVV transcribes monocistronic RNAs. Analysis of the terminal sequences, and primer extension and RNase H digestion analysis of LBVV mRNAs, suggested that LBVV utilizes a transcription termination/initiation strategy comparable with that of rhabdoviruses.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Model-based quality assessment and base-calling for second-generation sequencing data.

PubMed

Bravo, Héctor Corrada; Irizarry, Rafael A

2010-09-01

Second-generation sequencing (sec-gen) technology can sequence millions of short fragments of DNA in parallel, making it capable of assembling complex genomes for a small fraction of the price and time of previous technologies. In fact, a recently formed international consortium, the 1000 Genomes Project, plans to fully sequence the genomes of approximately 1200 people. The prospect of comparative analysis at the sequence level of a large number of samples across multiple populations may be achieved within the next five years. These data present unprecedented challenges in statistical analysis. For instance, analysis operates on millions of short nucleotide sequences, or reads-strings of A,C,G, or T's, between 30 and 100 characters long-which are the result of complex processing of noisy continuous fluorescence intensity measurements known as base-calling. The complexity of the base-calling discretization process results in reads of widely varying quality within and across sequence samples. This variation in processing quality results in infrequent but systematic errors that we have found to mislead downstream analysis of the discretized sequence read data. For instance, a central goal of the 1000 Genomes Project is to quantify across-sample variation at the single nucleotide level. At this resolution, small error rates in sequencing prove significant, especially for rare variants. Sec-gen sequencing is a relatively new technology for which potential biases and sources of obscuring variation are not yet fully understood. Therefore, modeling and quantifying the uncertainty inherent in the generation of sequence reads is of utmost importance. In this article, we present a simple model to capture uncertainty arising in the base-calling procedure of the Illumina/Solexa GA platform. Model parameters have a straightforward interpretation in terms of the chemistry of base-calling allowing for informative and easily interpretable metrics that capture the variability in sequencing quality. Our model provides these informative estimates readily usable in quality assessment tools while significantly improving base-calling performance. © 2009, The International Biometric Society.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Isolation and Genomic Characterization of a Duck-Origin GPV-Related Parvovirus from Cherry Valley Ducklings in China

PubMed Central

Chen, Hao; Dou, Yanguo; Tang, Yi; Zhang, Zhenjie; Zheng, Xiaoqiang; Niu, Xiaoyu; Yang, Jing; Yu, Xianglong; Diao, Youxiang

2015-01-01

A newly emerged duck parvovirus, which causes beak atrophy and dwarfism syndrome (BADS) in Cherry Valley ducks, has appeared in Northern China since March 2015. To explore the genetic diversity among waterfowl parvovirus isolates, the complete genome of an identified isolate designated SDLC01 was sequenced and analyzed in the present study. Genomic sequence analysis showed that SDLC01 shared 90.8%–94.6% of nucleotide identity with goose parvovirus (GPV) isolates and 78.6%–81.6% of nucleotide identity with classical Muscovy duck parvovirus (MDPV) isolates. Phylogenetic analysis of 443 nucleotides (nt) of the fragment A showed that SDLC01 was highly similar to a mule duck isolate (strain D146/02) and close to European GPV isolates but separate from Asian GPV isolates. Analysis of the left inverted terminal repeat regions revealed that SDLC01 had two major segments deleted between positions 160–176 and 306–322 nt compared with field GPV and MDPV isolates. Phylogenetic analysis of Rep and VP1 encoded by two major open reading frames of parvoviruses revealed that SDLC01 was distinct from all GPV and MDPV isolates. The viral pathogenicity and genome characterization of SDLC01 suggest that the novel GPV (N-GPV) is the causative agent of BADS and belongs to a distinct GPV-related subgroup. Furthermore, N-GPV sequences were detected in diseased ducks by polymerase chain reaction and viral proliferation was demonstrated in duck embryos and duck embryo fibroblast cells. PMID:26465143

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W

2010-01-01

GenBank is a comprehensive database that contains publicly available nucleotide sequences for more than 300,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bi-monthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI homepage: www.ncbi.nlm.nih.gov.

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W

2009-01-01

GenBank is a comprehensive database that contains publicly available nucleotide sequences for more than 300,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank(R) staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through the National Center for Biotechnology Information (NCBI) Entrez retrieval system, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.

A comprehensive analysis of three Asiatic black bear mitochondrial genomes (subspecies ussuricus, formosanus and mupinensis), with emphasis on the complete mtDNA sequence of Ursus thibetanus ussuricus (Ursidae).

PubMed

Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong

2008-08-01

In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.

ADOMA: A Command Line Tool to Modify ClustalW Multiple Alignment Output.

PubMed

Zaal, Dionne; Nota, Benjamin

2016-01-01

We present ADOMA, a command line tool that produces alternative outputs from ClustalW multiple alignments of nucleotide or protein sequences. ADOMA can simplify the output of alignments by showing only the different residues between sequences, which is often desirable when only small differences such as single nucleotide polymorphisms are present (e.g., between different alleles). Another feature of ADOMA is that it can enhance the ClustalW output by coloring the residues in the alignment. This tool is easily integrated into automated Linux pipelines for next-generation sequencing data analysis, and may be useful for researchers in a broad range of scientific disciplines including evolutionary biology and biomedical sciences. The source code is freely available at https://sourceforge. net/projects/adoma/. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genetic similarity between Taenia solium cysticerci collected from the two distant endemic areas in North and North East India.

PubMed

Sharma, Monika; Devi, Kangjam Rekha; Sehgal, Rakesh; Narain, Kanwar; Mahanta, Jagadish; Malla, Nancy

2014-01-01

Taenia solium taeniasis/cysticercosis is a major public health problem in developing countries. This study reports genotypic analysis of T. solium cysticerci collected from two different endemic areas of North (Chandigarh) and North East India (Dibrugarh) by the sequencing of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The variation in cox1 sequences of samples collected from these two different geographical regions located at a distance of 2585 km was minimal. Alignment of the nucleotide sequences with different species of Taenia showed the similarity with Asian genotype of T. solium. Among 50 isolates, 6 variant nucleotide positions (0.37% of total length) were detected. These results suggest that population in these geographical areas are homogenous. Copyright © 2013 Elsevier B.V. All rights reserved.

Correlations of nucleotide substitution rates and base composition of mammalian coding sequences with protein structure.

PubMed

Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G

1999-09-30

We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

PubMed

Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

2011-10-17

The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

PubMed Central

2011-01-01

Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

PubMed

Goggin, C L; Barker, S C

1993-07-01

Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates.

Decipher the mechanisms of protein conformational changes induced by nucleotide binding through free-energy landscape analysis: ATP binding to Hsp70.

PubMed

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins.

Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

PubMed Central

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins. PMID:24348227

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Identification of a new genotype H wild-type mumps virus strain and its molecular relatedness to other virulent and attenuated strains.

PubMed

Amexis, Georgios; Rubin, Steven; Chatterjee, Nando; Carbone, Kathryn; Chumakov, Kostantin

2003-06-01

A single clinical isolate of mumps virus designated 88-1961 was obtained from a patient hospitalized with a clinical history of upper respiratory tract infection, parotitis, severe headache, fever and lymphadenopathy. We have sequenced the full-length genome of 88-1961 and compared it against all available full-length sequences of mumps virus. Based upon its nucleotide sequence of the SH gene 88-1961 was identified as a genotype H mumps strain. The overall extent of nucleotide and amino acid differences between each individual gene and protein of 88-1961 and the full-length mumps samples showed that the missense to silent ratios were unevenly distributed. Upon evaluation of the consensus sequence of 88-1961, four positions were found to be clearly heterogeneous at the nucleotide level (NP 315C/T, NP 318C/T, F 271A/C, and HN 855C/T). Sequence analysis revealed that the amino acid sequences for the NP, M, and the L protein were the most conserved, whereas the SH protein exhibited the highest variability among the compared mumps genotypes A, B, and G. No identifying molecular patterns in the non-coding (intergenic) or coding regions of 88-1961 were found when we compared it against relatively virulent (Urabe AM9 B, Glouc1/UK96, 87-1004 and 87-1005) and non-virulent mumps strains (Jeryl Lynn and all Urabe Am9 A substrains). Copyright 2003 Wiley-Liss, Inc.

Infectious hematopoietic necrosis virus: monophyletic origin of European isolates from North American genogroup M.

PubMed

Enzmann, P J; Kurath, G; Fichtner, D; Bergmann, S M

2005-09-23

Infectious hematopoietic necrosis virus (IHNV) was first detected in Europe in 1987 in France and Italy, and later, in 1992, in Germany. The source of the virus and the route of introduction are unknown. The present study investigates the molecular epidemiology of IHNV outbreaks in Germany since its first introduction. The complete nucleotide sequences of the glycoprotein (G) and non-virion (NV) genes from 9 IHNV isolates from Germany have been determined, and this has allowed the identification of characteristic differences between these isolates. Phylogenetic analysis of partial G gene sequences (mid-G, 303 nucleotides) from North American IHNV isolates (Kurath et al. 2003) has revealed 3 major genogroups, designated U, M and L. Using this gene region with 2 different North American IHNV data sets, it was possible to group the European IHNV strains within the M genogroup, but not in any previously defined subgroup. Analysis of the full length G gene sequences indicated that an independent evolution of IHN viruses had occurred in Europe. IHN viruses in Europe seem to be of a monophyletic origin, again most closely related to North American isolates in the M genogroup. Analysis of the NV gene sequences also showed the European isolates to be monophyletic, but resolution of the 3 genogroups was poor with this gene region. As a result of comparative sequence analyses, several different genotypes have been identified circulating in Europe.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

ADEPT, a dynamic next generation sequencing data error-detection program with trimming

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng, Shihai; Lo, Chien-Chi; Li, Po-E

Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less

The complete sequence and promoter activity of the human A-raf-1 gene (ARAF1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, J.E.; Beck, T.W.; Brennscheidt, U.

1994-03-01

The raf proto-oncogenes encode cytoplasmic protein serine/threonine kinases, which play a critical role in cell growth and development. One of these, A-raf-1 (human gene symbol, ARAF1), which is predominantly expressed in mouse urogenital tissues, has been mapped to an evolutionarily conserved linkage group composed of ARAF1, SYN1, TIMP, and properdin located at human chromosome Xp11.2. The authors have isolated human genomic DNA clones containing the expressed gene (ARAF1) on the X chromosome and a pseudogene (ARAF2) on chromosome 7p12-q11.21. Analysis of the nucleotide sequence from the ARAF1 genomic clones demonstrated that it consists of 16 exons encoded by minimally 10,776more » nucleotides. The major transcriptional start site (+1) was determined by RNase protection and primer extension assays. Promoter activity was confirmed by functional assays using DNA fragments fused to a CAT reporter gene. The ARAF1 minimal promoter, located between nucleotides -59 and +93, has a low G + C content and lacks consensus TATA and Inr sequences but shows sequence similarity at position -1 to the E box that is known to interact with USF and TFII-I transcription factors. 65 refs., 7 figs., 1 tab.« less

ADEPT, a dynamic next generation sequencing data error-detection program with trimming

DOE PAGES

Feng, Shihai; Lo, Chien-Chi; Li, Po-E; ...

2016-02-29

Illumina is the most widely used next generation sequencing technology and produces millions of short reads that contain errors. These sequencing errors constitute a major problem in applications such as de novo genome assembly, metagenomics analysis and single nucleotide polymorphism discovery. In this study, we present ADEPT, a dynamic error detection method, based on the quality scores of each nucleotide and its neighboring nucleotides, together with their positions within the read and compares this to the position-specific quality score distribution of all bases within the sequencing run. This method greatly improves upon other available methods in terms of the truemore » positive rate of error discovery without affecting the false positive rate, particularly within the middle of reads. We conclude that ADEPT is the only tool to date that dynamically assesses errors within reads by comparing position-specific and neighboring base quality scores with the distribution of quality scores for the dataset being analyzed. The result is a method that is less prone to position-dependent under-prediction, which is one of the most prominent issues in error prediction. The outcome is that ADEPT improves upon prior efforts in identifying true errors, primarily within the middle of reads, while reducing the false positive rate.« less

Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

PubMed Central

Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

1999-01-01

We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

PubMed

Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

2016-02-01

Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency

PubMed Central

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua

2016-01-01

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575

Intron loss from the NADH dehydrogenase subunit 4 gene of lettuce mitochondrial DNA: evidence for homologous recombination of a cDNA intermediate.

PubMed

Geiss, K T; Abbas, G M; Makaroff, C A

1994-04-01

The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.

Expansion of the Preimmune Antibody Repertoire by Junctional Diversity in Bos taurus

PubMed Central

Liljavirta, Jenni; Niku, Mikael; Pessa-Morikawa, Tiina; Ekman, Anna; Iivanainen, Antti

2014-01-01

Cattle have a limited range of immunoglobulin genes which are further diversified by antigen independent somatic hypermutation in fetuses. Junctional diversity generated during somatic recombination contributes to antibody diversity but its relative significance has not been comprehensively studied. We have investigated the importance of terminal deoxynucleotidyl transferase (TdT) -mediated junctional diversity to the bovine immunoglobulin repertoire. We also searched for new bovine heavy chain diversity (IGHD) genes as the information of the germline sequences is essential to define the junctional boundaries between gene segments. New heavy chain variable genes (IGHV) were explored to address the gene usage in the fetal recombinations. Our bioinformatics search revealed five new IGHD genes, which included the longest IGHD reported so far, 154 bp. By genomic sequencing we found 26 new IGHV sequences that represent potentially new IGHV genes or allelic variants. Sequence analysis of immunoglobulin heavy chain cDNA libraries of fetal bone marrow, ileum and spleen showed 0 to 36 nontemplated N-nucleotide additions between variable, diversity and joining genes. A maximum of 8 N nucleotides were also identified in the light chains. The junctional base profile was biased towards A and T nucleotide additions (64% in heavy chain VD, 52% in heavy chain DJ and 61% in light chain VJ junctions) in contrast to the high G/C content which is usually observed in mice. Sequence analysis also revealed extensive exonuclease activity, providing additional diversity. B-lymphocyte specific TdT expression was detected in bovine fetal bone marrow by reverse transcription-qPCR and immunofluorescence. These results suggest that TdT-mediated junctional diversity and exonuclease activity contribute significantly to the size of the cattle preimmune antibody repertoire already in the fetal period. PMID:24926997

Phylogenetic and nucleotide sequence analysis of influenza A (H1N1) HA and NA genes of strains isolated from Saudi Arabia.

PubMed

Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N

2017-01-30

In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.

[Genome-scale sequence data processing and epigenetic analysis of DNA methylation].

PubMed

Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong

2013-06-01

A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

NASA Astrophysics Data System (ADS)

Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

2018-01-01

The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

Whole-genome random sequencing and assembly of Haemophilus influenzae Rd

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fleischmann, R.D.; Adams, M.D.; White, O.

1995-07-28

An approach for genome analysis based on sequencing and assembly of unselected pieces of DNA from the whole chromosome has been applied to obtain the complete nucleotide sequence (1,830,137 base pairs) of the genome from the bacterium Haemophilus influenzae Rd. This approach eliminates the need for initial mapping efforts and is therefore applicable to the vast array of microbial species for which genome maps are unavailable. The H. influenzae Rd genome sequence (Genome Sequence DataBase accession number L42023) represents the only complete genome sequence from a free-living organism. 46 refs., 4 figs., 4 tabs.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar

Treesearch

John Kuzio; Margot N. Pearson; Steve H. Harwood; C. Joel Funk; Jay T. Evans; James M. Slavicek; George F. Rohrmann

1999-01-01

The genome of the Lymantria dispar multinucleocapsid nucleopolyhedrovirus (LdMNPV) was sequenced and analyzed. It is composed of 161,046 bases with a G + C content of 57.5% and contains 163 putative open reading frames (ORFs) of ≥150 nucleotides. Homologs were found to 95 of the 155 genes predicted for the Autographa californica...

Short-read, high-throughput sequencing technology for STR genotyping

PubMed Central

Bornman, Daniel M.; Hester, Mark E.; Schuetter, Jared M.; Kasoji, Manjula D.; Minard-Smith, Angela; Barden, Curt A.; Nelson, Scott C.; Godbold, Gene D.; Baker, Christine H.; Yang, Boyu; Walther, Jacquelyn E.; Tornes, Ivan E.; Yan, Pearlly S.; Rodriguez, Benjamin; Bundschuh, Ralf; Dickens, Michael L.; Young, Brian A.; Faith, Seth A.

2013-01-01

DNA-based methods for human identification principally rely upon genotyping of short tandem repeat (STR) loci. Electrophoretic-based techniques for variable-length classification of STRs are universally utilized, but are limited in that they have relatively low throughput and do not yield nucleotide sequence information. High-throughput sequencing technology may provide a more powerful instrument for human identification, but is not currently validated for forensic casework. Here, we present a systematic method to perform high-throughput genotyping analysis of the Combined DNA Index System (CODIS) STR loci using short-read (150 bp) massively parallel sequencing technology. Open source reference alignment tools were optimized to evaluate PCR-amplified STR loci using a custom designed STR genome reference. Evaluation of this approach demonstrated that the 13 CODIS STR loci and amelogenin (AMEL) locus could be accurately called from individual and mixture samples. Sensitivity analysis showed that as few as 18,500 reads, aligned to an in silico referenced genome, were required to genotype an individual (>99% confidence) for the CODIS loci. The power of this technology was further demonstrated by identification of variant alleles containing single nucleotide polymorphisms (SNPs) and the development of quantitative measurements (reads) for resolving mixed samples. PMID:25621315

Novel Detection of Insecticide Resistance Related P450 Genes and Transcriptome Analysis of the Hemimetabolous Pest Erthesina fullo (Thunberg) (Hemiptera: Heteroptera).

PubMed

Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun

2015-01-01

Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.

Laser Desorption Mass Spectrometry for DNA Sequencing and Analysis

NASA Astrophysics Data System (ADS)

Chen, C. H. Winston; Taranenko, N. I.; Golovlev, V. V.; Isola, N. R.; Allman, S. L.

1998-03-01

Rapid DNA sequencing and/or analysis is critically important for biomedical research. In the past, gel electrophoresis has been the primary tool to achieve DNA analysis and sequencing. However, gel electrophoresis is a time-consuming and labor-extensive process. Recently, we have developed and used laser desorption mass spectrometry (LDMS) to achieve sequencing of ss-DNA longer than 100 nucleotides. With LDMS, we succeeded in sequencing DNA in seconds instead of hours or days required by gel electrophoresis. In addition to sequencing, we also applied LDMS for the detection of DNA probes for hybridization LDMS was also used to detect short tandem repeats for forensic applications. Clinical applications for disease diagnosis such as cystic fibrosis caused by base deletion and point mutation have also been demonstrated. Experimental details will be presented in the meeting. abstract.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, J.M.; Fisher, L.W.; Termine, J.D.

The authors have isolated and partially sequenced the human bone sialoprotein gene (IBSP). IBSP has been sublocalized by in situ hybridization to chromosome 4q38-q31 and is composed of six small exons (51 to 159 bp) and 1 large exon ([approximately]2.6 kb). The intron/exon junctions defined by sequence analysis are of class O, retaining an intact coding triplet. Sequence analysis of the 5[prime] upstream region revealed a TATAA (nucleotides -30 to-25 from the transcriptional start point) and a CCAAT (nucleotides -56 to-52) box, both in the reverse orientation. Intron 1 contains interesting structural elements composed of polypyrimidine repeats followed by amore » poly(AC)[sub n] tract. Both types of structural elements have been detected in promoter regions of other genes and have been implicated in transcriptional regulation. Several differences between the previously published cDNA sequence and the authors' sequence have been identified, most of which are contained within the untranslated exon 1. Three base revisions in the coding region include a G to T (Gly to Val, amino acid 195), T to C (Val to Ala, amino acid 268), and T to A (Glu to Asp, amino acid 270). In conclusion, the genomic organization and potential regulatory elements of human IBSP have been elucidated. 42 refs., 4 figs., 1 tab.« less

The augmentation algorithm and molecular phylogenetic trees

NASA Technical Reports Server (NTRS)

Holmquist, R.

1978-01-01

Moore's (1977) augmentation procedure is discussed, and it is concluded that the procedure is valid for obtaining estimates of the total number of fixed nucleotide substitutions both theoretically and in practice, for both simulated and real data, and in agreement, for experimentally dense data sets, with stochastic estimates of the divergence, provided the restrictions on codon mutability resulting from natural selection are explicitly allowed for. Tateno and Nei's (1978) critique that the augmentation procedure has a systematic bias toward overestimation of the total number of nucleotide replacements is disputed, and a data analysis suggests that ancestral sequences inferred by the method of parsimony contain a large number of incorrectly assigned nucleotides.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

PubMed

Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

2016-01-01

Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

The BaMM web server for de-novo motif discovery and regulatory sequence analysis.

PubMed

Kiesel, Anja; Roth, Christian; Ge, Wanwan; Wess, Maximilian; Meier, Markus; Söding, Johannes

2018-05-28

The BaMM web server offers four tools: (i) de-novo discovery of enriched motifs in a set of nucleotide sequences, (ii) scanning a set of nucleotide sequences with motifs to find motif occurrences, (iii) searching with an input motif for similar motifs in our BaMM database with motifs for >1000 transcription factors, trained from the GTRD ChIP-seq database and (iv) browsing and keyword searching the motif database. In contrast to most other servers, we represent sequence motifs not by position weight matrices (PWMs) but by Bayesian Markov Models (BaMMs) of order 4, which we showed previously to perform substantially better in ROC analyses than PWMs or first order models. To address the inadequacy of P- and E-values as measures of motif quality, we introduce the AvRec score, the average recall over the TP-to-FP ratio between 1 and 100. The BaMM server is freely accessible without registration at https://bammmotif.mpibpc.mpg.de.

Sequence analysis and expression of the M1 and M2 matrix protein genes of hirame rhabdovirus (HIRRV)

USGS Publications Warehouse

Nishizawa, T.; Kurath, G.; Winton, J.R.

1997-01-01

We have cloned and sequenced a 2318 nucleotide region of the genomic RNA of hirame rhabdovirus (HIRRV), an important viral pathogen of Japanese flounder Paralichthys olivaceus. This region comprises approximately two-thirds of the 3' end of the nucleocapsid protein (N) gene and the complete matrix protein (M1 and M2) genes with the associated intergenic regions. The partial N gene sequence was 812 nucleotides in length with an open reading frame (ORF) that encoded the carboxyl-terminal 250 amino acids of the N protein. The M1 and M2 genes were 771 and 700 nucleotides in length, respectively, with ORFs encoding proteins of 227 and 193 amino acids. The M1 gene sequence contained an additional small ORF that could encode a highly basic, arginine-rich protein of 25 amino acids. Comparisons of the N, M1, and M2 gene sequences of HIRRV with the corresponding sequences of the fish rhabdoviruses, infectious hematopoietic necrosis virus (IHNV) or viral hemorrhagic septicemia virus (VHSV) indicated that HIRRV was more closely related to IHNV than to VHSV, but was clearly distinct from either. The putative consensus gene termination sequence for IHNV and VHSV, AGAYAG(A)(7), was present in the N-M1, M1-M2, and M2-G intergenic regions of HIRRV as were the putative transcription initiation sequences YGGCAC and AACA. An Escherichia coli expression system was used to produce recombinant proteins from the M1 and M2 genes of HIRRV. These were the same size as the authentic M1 and M2 proteins and reacted with anti-HIRRV rabbit serum in western blots. These reagents can be used for further study of the fish immune response and to test novel control methods.

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1991-01-21

bisphosphate carboxylase ( RubisCO ) from symbiotic bacteria of various origins, b) To continue methods development for 16S rRNA sequencing from symbionts in...frozen and badly preserved specimens, and c) To use these new techniques to sequence 16s DNA from a variety of symbionts a) RubisCO We have cloned the...gene coding for RubisCO from the sulfur oxidixing symbiont of the gastropod Alvinochoncha hessleri. Nucleotide sequence analysis of the cloned fragment

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China

PubMed Central

Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man

2017-01-01

Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic).

PubMed

Kartashov, Mikhail Yu; Glushkova, Ludmila I; Mikryukova, Tamara P; Korabelnikov, Igor V; Egorova, Yulia I; Tupota, Natalia L; Protopopova, Elena V; Konovalova, Svetlana N; Ternovoi, Vladimir A; Loktev, Valery B

2017-06-01

The number of tick-borne infections in the northern European regions of Russia has increased considerably in the last years. In the present study, 676 unfed adult Ixodes persulcatus ticks were collected in the Komi Republic from 2011 to 2013 to study tick-borne rickettsioses. Rickettsia spp. DNA was detected by PCR in 51 (7.6%) ticks. The nucleotide sequence analysis of gltA fragments (765bp) from 51 ticks indicated that 60.8% and 39.2% of the ticks were infected with Rickettsia helvetica and Candidatus R. tarasevichiae, respectively. The gltA fragments showed 100% identity with those of Candidatus R. tarasevichiae previously discovered in Siberia and China, whereas R. helvetica showed 99.9% sequence identity with European isolates. The ompB had 8 nucleotide substitutions, 6 of which resulted in amino acid substitutions. In the sca9 gene, 3 nucleotide substitutions were detected, and only one resulted in amino acid substitution. The smpA, ompW, and β-lactamase genes of R. helvetica also showed a high level of sequence identity. Copyright © 2017 Elsevier GmbH. All rights reserved.

Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

PubMed

Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

2016-12-01

The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

High levels of MHC class II allelic diversity in lake trout from Lake Superior

USGS Publications Warehouse

Dorschner, M.O.; Duris, T.; Bronte, C.R.; Burnham-Curtis, M. K.; Phillips, R.B.

2000-01-01

Sequence variation in a 216 bp portion of the major histocompatibility complex (MHC) II B1 domain was examined in 74 individual lake trout (Salvelinus namaycush) from different locations in Lake Superior. Forty-three alleles were obtained which encoded 71-72 amino acids of the mature protein. These sequences were compared with previous data obtained from five Pacific salmon species and Atlantic salmon using the same primers. Although all of the lake trout alleles clustered together in the neighbor-joining analysis of amino acid sequences, one amino acid allelic lineage was shared with Atlantic salmon (Salmo salar), a species in another genus which probably diverged from Salvelinus more than 10-20 million years ago. As shown previously in other salmonids, the level of nonsynonymous nucleotide substitution (d(N)) exceeded the level of synonymous substitution (d(S)). The level of nucleotide diversity at the MHC class II B1 locus was considerably higher in lake trout than in the Pacific salmon (genus Oncorhynchus). These results are consistent with the hypothesis that lake trout colonized Lake Superior from more than one refuge following the Wisconsin glaciation. Recent population bottlenecks may have reduced nucleotide diversity in Pacific salmon populations.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

PubMed

Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

2015-10-01

Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species.

PubMed

Chen, Zhiwen; Feng, Kun; Grover, Corrinne E; Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F; Wang, Kunbo; Hua, Jinping

2016-01-01

The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium.

Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species

PubMed Central

Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo

2016-01-01

The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W

2011-01-01

GenBank® is a comprehensive database that contains publicly available nucleotide sequences for more than 380,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Nucleotide Archive (ENA) and the DNA Data Bank of Japan (DDBJ) ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system that integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.

Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand.

PubMed

Pohuang, Tawatchai; Chansiripornchai, Niwat; Tawatsin, Achara; Sasipreeyajan, Jiroj

2009-09-01

Thirteen field isolates of infectious bronchitis virus (IBV) were isolated from broiler flocks in Thailand between January and June 2008. The 878-bp of the S1 gene covering a hypervariable region was amplified and sequenced. Phylogenetic analysis based on that region revealed that these viruses were separated into two groups (I and II). IBV isolates in group I were not related to other IBV strains published in the GenBank database. Group 1 nucleotide sequence identities were less than 85% and amino acid sequence identities less than 84% in common with IBVs published in the GenBank database. This group likely represents the strains indigenous to Thailand. The isolates in group II showed a close relationship with Chinese IBVs. They had nucleotide sequence identities of 97-98% and amino acid sequence identities 96-98% in common with Chinese IBVs (strain A2, SH and QXIBV). This finding indicated that the recent Thai IBVs evolved separately and at least two groups of viruses are circulating in Thailand.

Characterization of rat calcitonin mRNA.

PubMed Central

Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

1980-01-01

A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

Zseq: An Approach for Preprocessing Next-Generation Sequencing Data.

PubMed

Alkhateeb, Abedalrhman; Rueda, Luis

2017-08-01

Next-generation sequencing technology generates a huge number of reads (short sequences), which contain a vast amount of genomic data. The sequencing process, however, comes with artifacts. Preprocessing of sequences is mandatory for further downstream analysis. We present Zseq, a linear method that identifies the most informative genomic sequences and reduces the number of biased sequences, sequence duplications, and ambiguous nucleotides. Zseq finds the complexity of the sequences by counting the number of unique k-mers in each sequence as its corresponding score and also takes into the account other factors such as ambiguous nucleotides or high GC-content percentage in k-mers. Based on a z-score threshold, Zseq sweeps through the sequences again and filters those with a z-score less than the user-defined threshold. Zseq algorithm is able to provide a better mapping rate; it reduces the number of ambiguous bases significantly in comparison with other methods. Evaluation of the filtered reads has been conducted by aligning the reads and assembling the transcripts using the reference genome as well as de novo assembly. The assembled transcripts show a better discriminative ability to separate cancer and normal samples in comparison with another state-of-the-art method. Moreover, de novo assembled transcripts from the reads filtered by Zseq have longer genomic sequences than other tested methods. Estimating the threshold of the cutoff point is introduced using labeling rules with optimistic results.

Gene 2 of the sigma rhabdovirus genome encodes the P protein, and gene 3 encodes a protein related to the reverse transcriptase of retroelements.

PubMed

Landès-Devauchelle, C; Bras, F; Dezélée, S; Teninges, D

1995-11-10

The nucleotide sequence of the genes 2 and 3 of the Drosophila rhabdovirus sigma was determined from cDNAs to viral genome and poly(A)+ mRNAs. Gene 2 comprises 1032 nucleotides and contains a long ORF encoding a molecular weight 35,208 polypeptide present in infected cells and in virions which migrates in SDS-PAGE as a doublet of M(r) about 60 kDa. The distribution of acidic charges as well as the electrophoretic properties of the protein are characteristic of the rhabdovirus P proteins. Gene 3 comprises 923 nucleotides and contains a long ORF capable of coding a polypeptide of 298 amino acids of MW 33,790. The putative protein (PP3) is similar in size to a minor component of the virions. Computer analysis shows that the sequence of PP3 contains three motifs related to the conserved motifs of reverse transcriptases.

Second generation DNA sequencing of the mitogenome of the Chinstrap penguin and comparative genomics of Antarctic penguins.

PubMed

Subramanian, Sankar; Lingala, Syamala Gowri; Swaminathan, Siva; Huynen, Leon; Lambert, David

2014-08-01

The complete mitochondrial genome of the Chinstrap penguin (Pygoscelis antarcticus) was sequenced and compared with other penguin mitogenomes. The genome is 15,972 bp in length with the number and order of protein coding genes and RNAs being very similar to that of other known penguin mitogenomes. Comparative nucleotide analysis showed the Chinstrap mitogenome shares 94% homology with the mitogenome of its sister species, Pygoscelis adelie (Adélie penguin). Divergence at nonsynonymous nucleotide positions was found to be up to 23 times less than that observed in synonymous positions of protein coding genes, suggesting high selection constraints. The complete mitogenome data will be useful for genetic and evolutionary studies of penguins.

Cymbidium chlorotic mosaic virus, a new sobemovirus isolated from a spring orchid (Cymbidium goeringii) in Japan.

PubMed

Kondo, Hideki; Takemoto, Shogo; Maruyama, Kazuyuki; Chiba, Sotaro; Andika, Ida Bagus; Suzuki, Nobuhiro

2015-08-01

Cymbidium chlorotic mosaic virus (CyCMV), isolated from a spring orchid (Cymbidium goeringii), was characterized molecularly. CyCMV isometric virions comprise a single, positive-strand RNA genome of 4,083 nucleotides and 30-kDa coat protein. The virus genome contains five overlapping open reading frames with a genomic organization similar to that of sobemoviruses. BLAST searches and phylogenetic analysis revealed that CyCMV is most closely related to papaya lethal yellowing virus, a proposed dicot-infecting sobemovirus (58.8 % nucleotide sequence identity), but has a relatively distant relationship to monocot-infecting sobemoviruses, with only modest sequence identities. This suggests that CyCMV is a new monocot-infecting member of the floating genus Sobemovirus.

Phylogenic analysis of human bocavirus detected in children with acute respiratory infection in Yaounde, Cameroon.

PubMed

Kenmoe, Sebastien; Vernet, Marie-Astrid; Njankouo-Ripa, Mohamadou; Penlap, Véronique Beng; Vabret, Astrid; Njouom, Richard

2017-07-17

Human Bocavirus (HBoV) was first identified in 2005 and has been shown to be a common cause of respiratory infections and gastroenteritis in children. In a recent study, we found that 10.7% of children with acute respiratory infections (ARI) were infected by HBoV. Genetic characterization of this virus remains unknown in Central Africa, particularly in Cameroon Leeding us to evaluate the molecular characteristics of HBoV strains in Cameroonian children with ARI. Phylogenetic analysis of partial HBoV VP1/2 sequences showed a low level of nucleotide variation and the circulation of HBoV genotype 1 (HBoV-1) only. Three clades were obtained, two clustering with each of the reference strains ST1 and ST2, and a third group consisting of only Cameroon strains. By comparing with the Swedish reference sequences, ST1 and ST2, Cameroon sequences showed nucleotide and amino acid similarities of respectively 97.36-100% and 98.35-100%. These results could help improve strategies for monitoring and control of respiratory infections in Cameroon.

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Analysis of genomic DNA of DcACS1, a 1-aminocyclopropane-1-carboxylate synthase gene, expressed in senescing petals of carnation (Dianthus caryophyllus) and its orthologous genes in D. superbus var. longicalycinus.

PubMed

Harada, Taro; Murakoshi, Yuino; Torii, Yuka; Tanase, Koji; Onozaki, Takashi; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

2011-04-01

Carnation (Dianthus caryophyllus) flowers exhibit climacteric ethylene production followed by petal wilting, a senescence symptom. DcACS1, which encodes 1-aminocyclopropane-1-carboxylate synthase (ACS), is a gene involved in this phenomenon. We determined the genomic DNA structure of DcACS1 by genomic PCR. In the genome of 'Light Pink Barbara', we found two distinct nucleotide sequences: one corresponding to the gene previously shown as DcACS1, designated here as DcACS1a, and the other novel one designated as DcACS1b. It was revealed that both DcACS1a and DcACS1b have five exons and four introns. These two genes had almost identical nucleotide sequences in exons, but not in some introns and 3'-UTR. Analysis of transcript accumulation revealed that DcACS1b is expressed in senescing petals as well as DcACS1a. Genomic PCR analysis of 32 carnation cultivars showed that most cultivars have only DcACS1a and some have both DcACS1a and DcACS1b. Moreover, we found two DcACS1 orthologous genes with different nucleotide sequences from D. superbus var. longicalycinus, and designated them as DsuACS1a and DsuACS1b. Petals of D. superbus var. longicalycinus produced ethylene in response to exogenous ethylene, accompanying accumulation of DsuACS1 transcripts. These data suggest that climacteric ethylene production in flowers was genetically established before the cultivation of carnation.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Using information content and base frequencies to distinguish mutations from genetic polymorphisms in splice junction recognition sites.

PubMed

Rogan, P K; Schneider, T D

1995-01-01

Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Complete genome sequence analysis of a duck circovirus from Guangxi pockmark ducks.

PubMed

Xie, Liji; Xie, Zhixun; Zhao, Guangyuan; Liu, Jiabo; Pang, Yaoshan; Deng, Xianwen; Xie, Zhiqin; Fan, Qing

2012-12-01

We report here the complete genomic sequence of a novel duck circovirus (DuCV) strain, GX1104, isolated from Guangxi pockmark ducks in Guangxi, China. The whole nucleotide sequence had the highest homology (97.2%) with the sequence of strain TC/2002 (GenBank accession number AY394721.1) and had a low homology (76.8% to 78.6%) with the sequences of other strains isolated from China, Germany, and the United States. This report will help to understand the epidemiology and molecular characteristics of Guangxi pockmark duck circovirus in southern China.

The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

PubMed

Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

1994-12-02

Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

Molecular phylogeny of Coxsackievirus A16 in Shenzhen, China, from 2005 to 2009.

PubMed

Zong, Wenping; He, Yaqing; Yu, Shouyi; Yang, Hong; Xian, Huixia; Liao, Yuxue; Hu, Guifang

2011-04-01

Phylogenetic analysis of a Coxsackievirus A16 (CA16) sequence from Shenzhen, China, and other Chinese and international CA16 sequences revealed a pattern of endemic cocirculation of strains of clusters B2a and B2b within subtype B2 viruses. Amino acid evolution and nucleotide variation in the VP1 region were slight for 5 years.

Crimean-Congo Hemorrhagic Fever

DTIC Science & Technology

2004-01-01

aminocaproic acid were also indicated. Much emphasis was also placed on preventing reinfection, including the necessity of remov- ing blood crusts from...The se- quence is approximately 60% identical both at the nucleotide and amino acid levels to the L segment of Dugbe virus, the only other Nairovirus...However, more recent data based on nucleic acid sequence analysis have revealed extensive genetic diversity. The first published CCHFV sequence

Isolation and molecular characterization of a urease-negative Actinobacillus pleuropneumoniae mutant.

PubMed

Ito, Hiroya; Takahashi, Sayaka; Asai, Tetsuo; Tamura, Yutaka; Yamamoto, Koshi

2018-01-01

An atypical urease-negative mutant of Actinobacillus pleuropneumoniae serovar 2 was isolated in Japan. Nucleotide sequence analysis of the urease gene cluster revealed that the insertion of a short DNA sequence into the cbiM gene was responsible for the urease-negative activity of the mutant. Veterinary diagnostic laboratories should be watchful for the presence of aberrant urease-negative A. pleuropneumoniae isolates.

The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

PubMed

Murray, Vincent; Chen, Jon K; Tanaka, Mark M

2016-07-01

The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

EBI metagenomics--a new resource for the analysis and archiving of metagenomic data.

PubMed

Hunter, Sarah; Corbett, Matthew; Denise, Hubert; Fraser, Matthew; Gonzalez-Beltran, Alejandra; Hunter, Christopher; Jones, Philip; Leinonen, Rasko; McAnulla, Craig; Maguire, Eamonn; Maslen, John; Mitchell, Alex; Nuka, Gift; Oisel, Arnaud; Pesseat, Sebastien; Radhakrishnan, Rajesh; Rocca-Serra, Philippe; Scheremetjew, Maxim; Sterk, Peter; Vaughan, Daniel; Cochrane, Guy; Field, Dawn; Sansone, Susanna-Assunta

2014-01-01

Metagenomics is a relatively recently established but rapidly expanding field that uses high-throughput next-generation sequencing technologies to characterize the microbial communities inhabiting different ecosystems (including oceans, lakes, soil, tundra, plants and body sites). Metagenomics brings with it a number of challenges, including the management, analysis, storage and sharing of data. In response to these challenges, we have developed a new metagenomics resource (http://www.ebi.ac.uk/metagenomics/) that allows users to easily submit raw nucleotide reads for functional and taxonomic analysis by a state-of-the-art pipeline, and have them automatically stored (together with descriptive, standards-compliant metadata) in the European Nucleotide Archive.

EBI metagenomics—a new resource for the analysis and archiving of metagenomic data

PubMed Central

Hunter, Sarah; Corbett, Matthew; Denise, Hubert; Fraser, Matthew; Gonzalez-Beltran, Alejandra; Hunter, Christopher; Jones, Philip; Leinonen, Rasko; McAnulla, Craig; Maguire, Eamonn; Maslen, John; Mitchell, Alex; Nuka, Gift; Oisel, Arnaud; Pesseat, Sebastien; Radhakrishnan, Rajesh; Rocca-Serra, Philippe; Scheremetjew, Maxim; Sterk, Peter; Vaughan, Daniel; Cochrane, Guy; Field, Dawn; Sansone, Susanna-Assunta

2014-01-01

Metagenomics is a relatively recently established but rapidly expanding field that uses high-throughput next-generation sequencing technologies to characterize the microbial communities inhabiting different ecosystems (including oceans, lakes, soil, tundra, plants and body sites). Metagenomics brings with it a number of challenges, including the management, analysis, storage and sharing of data. In response to these challenges, we have developed a new metagenomics resource (http://www.ebi.ac.uk/metagenomics/) that allows users to easily submit raw nucleotide reads for functional and taxonomic analysis by a state-of-the-art pipeline, and have them automatically stored (together with descriptive, standards-compliant metadata) in the European Nucleotide Archive. PMID:24165880

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

1995-01-01

Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

Infectious hematopoietic necrosis virus: Monophyletic origin of European isolates from North American Genogroup M

USGS Publications Warehouse

Enzmann, P.-J.; Kurath, G.; Fichtner, D.; Bergmann, S.M.

2005-01-01

Infectious hematopoietic necrosis virus (IHNV) was first detected in Europe in 1987 in France and Italy, and later, in 1992, in Germany. The source of the virus and the route of introduction are unknown. The present study investigates the molecular epidemiology of IHNV outbreaks in Germany since its first introduction. The complete nucleotide sequences of the glycoprotein (G) and non-virion (NV) genes from 9 IHNV isolates from Germany have been determined, and this has allowed the identification of characteristic differences between these isolates. Phylogenetic analysis of partial G gene sequences (mid-G, 303 nucleotides) from North American IHNV isolates (Kurath et al. 2003) has revealed 3 major genogroups, designated U, M and L. Using this gene region with 2 different North American IHNV data sets, it was possible to group the European IHNV strains within the M genogroup, but not in any previously defined subgroup. Analysis of the full length G gene sequences indicated that an independent evolution of IHN viruses had occurred in Europe. IHN viruses in Europe seem to be of a monophyletic origin, again most closely related to North American isolates in the M genogroup. Analysis of the NV gene sequences also showed the European isolates to be monophyletic, but resolution of the 3 genogroups was poor with this gene region. As a result of comparative sequence analyses, several different genotypes have been identified circulating in Europe. ?? Inter-Research 2005.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

PubMed

Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

2011-08-01

In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection

PubMed Central

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike

2018-01-01

ABSTRACT Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection. PMID:29564396

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

PubMed

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

2018-01-01

Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

Epidemic Keratoconjunctivitis Due to the Novel Hexon-Chimeric-Intermediate 22,37/H8 Human Adenovirus ▿

PubMed Central

Aoki, Koki; Ishiko, Hiroaki; Konno, Tsunetada; Shimada, Yasushi; Hayashi, Akio; Kaneko, Hisatoshi; Ohguchi, Takeshi; Tagawa, Yoshitsugu; Ohno, Shigeaki; Yamazaki, Shudo

2008-01-01

In a 2-month period in 2003, we encountered an outbreak of epidemic keratoconjunctivitis (EKC) in Japan. We detected 67 human adenoviruses (HAdVs) by PCR from eye swabs of patients with EKC at five eye clinics in different parts of Japan. Forty-one of the 67 HAdV DNAs from the swabs were identified as HAdV-37 by phylogenetic analysis using a partial hexon gene sequence. When the restriction patterns of these viral genomes were compared with that of the HAdV-37 prototype strain, one isolate showed a never-before-seen restriction pattern. Within 1 year, we encountered three more EKC cases caused by a genetically identical virus: two nosocomial infections at two different university hospitals and a sporadic infection at an eye clinic. We determined the nucleotide sequences of the full-length hexon and fiber genes of these isolates and compared them to those of the 51 prototype strains. Surprisingly, the sequence of the hexon (ɛ determinant) loop-1 and -2 regions showed the highest nucleotide identity with HAdV-22, a rare EKC isolate. However, the nucleotide sequence of the fiber gene was identical to that of the HAdV-8 prototype strain. 22 We propose that this virus is a new hexon-chimeric intermediate HAdV-22,37/H8, and may be an etiological agent of EKC. PMID:18701656

Ray Wu as Fifth Business: Deconstructing collective memory in the history of DNA sequencing.

PubMed

Onaga, Lisa A

2014-06-01

The concept of 'Fifth Business' is used to analyze a minority standpoint and bring serious attention to the role of scientists who play a galvanizing role in a science but for multiple reasons appear less prominently in more common recounts of any particular development. Biochemist Ray Wu (1928-2008) published a DNA sequencing experiment in March 1970 using DNA polymerase catalysis and specific nucleotide labeling, both of which are foundational to general sequencing methods today. The scant mention of Wu's work from textbooks, research articles, and other accounts of DNA sequencing calls into question how scientific collective memory forms. This alternative history seeks to understand why a key figure in nucleic acid sequence analysis has remained less visibly connected or peripheral to solidifying narratives about the history of DNA sequencing. The study resists predictable dismissals of Wu's work in order to seriously examine the formation of his nucleic acid sequence analysis research program and how he shared his knowledge of sequencing during a period of rapid advancement in the field. An analysis of Wu's work on sequencing the cohesive ends of lambda bacteriophage in the 1960s and 1970s exemplifies how a variety of individuals and groups attempted to develop protocol for sequencing the order of nucleotide base pairs comprising DNA. This historical examination of the sociality of scientific research suggests a way to understand how Wu and others contributed to the very collective memory of DNA sequencing that Wu eventually tried to repair. The study of Wu, who was a Chinese immigrant to the United States, provides a foundation for further critical scholarship on the heterogeneous histories of Asian American bioscientists, the sociality of their scientific works, and how the resulting knowledge produced is preserved, if not evenly, in a scientific field's collective memory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Multiple regions of Harvey sarcoma virus RNA can dimerize in vitro.

PubMed Central

Feng, Y X; Fu, W; Winter, A J; Levin, J G; Rein, A

1995-01-01

Retroviruses contain a dimeric RNA consisting of two identical molecules of plus-strand genomic RNA. The structure of the linkage between the two monomers is not known, but they are believed to be joined near their 5' ends. Darlix and coworkers have reported that transcripts of retroviral RNA sequences can dimerize spontaneously in vitro (see, for example, E. Bieth, C. Gabus, and J. L. Darlix, Nucleic Acids Res. 18:119-127, 1990). As one approach to identification of sequences which might participate in the linkage, we have mapped sequences derived from the 5' 378 bases of Harvey sarcoma virus (HaSV) RNA which can dimerize in vitro. We found that at least three distinct regions, consisting of nucleotides 37 to 229, 205 to 272, and 271 to 378, can form these dimers. Two of these regions contain nucleotides 205 to 226; computer analysis suggests that this region can form a stem-loop with an inverted repeat in the loop. We propose that this hypothetical structure is involved in dimer formation by these two transcripts. We also compared the thermal stabilities of each of these dimers with that of HaSV viral RNA. Dimers of nucleotides 37 to 229 and 205 to 272 both exhibited melting temperatures near that of viral RNA, while dimers of nucleotides 271 to 378 are quite unstable. We also found that dimers of nucleotides 37 to 378 formed at 37 degrees C are less thermostable than dimers of the same RNA formed at 55 degrees C. It seems possible that bases from all of these regions participate in the dimer linkage present in viral RNA. PMID:7884897

Multiple regions of Harvey sarcoma virus RNA can dimerize in vitro.

PubMed

Feng, Y X; Fu, W; Winter, A J; Levin, J G; Rein, A

1995-04-01

Retroviruses contain a dimeric RNA consisting of two identical molecules of plus-strand genomic RNA. The structure of the linkage between the two monomers is not known, but they are believed to be joined near their 5' ends. Darlix and coworkers have reported that transcripts of retroviral RNA sequences can dimerize spontaneously in vitro (see, for example, E. Bieth, C. Gabus, and J. L. Darlix, Nucleic Acids Res. 18:119-127, 1990). As one approach to identification of sequences which might participate in the linkage, we have mapped sequences derived from the 5' 378 bases of Harvey sarcoma virus (HaSV) RNA which can dimerize in vitro. We found that at least three distinct regions, consisting of nucleotides 37 to 229, 205 to 272, and 271 to 378, can form these dimers. Two of these regions contain nucleotides 205 to 226; computer analysis suggests that this region can form a stem-loop with an inverted repeat in the loop. We propose that this hypothetical structure is involved in dimer formation by these two transcripts. We also compared the thermal stabilities of each of these dimers with that of HaSV viral RNA. Dimers of nucleotides 37 to 229 and 205 to 272 both exhibited melting temperatures near that of viral RNA, while dimers of nucleotides 271 to 378 are quite unstable. We also found that dimers of nucleotides 37 to 378 formed at 37 degrees C are less thermostable than dimers of the same RNA formed at 55 degrees C. It seems possible that bases from all of these regions participate in the dimer linkage present in viral RNA.

2'-O-methyl-5-formylcytidine (f5Cm), a new modified nucleotide at the 'wobble' of two cytoplasmic tRNAs Leu (NAA) from bovine liver.

PubMed Central

Païs de Barros, J P; Keith, G; El Adlouni, C; Glasser, A L; Mack, G; Dirheimer, G; Desgrès, J

1996-01-01

The nucleotide analysis of a cytoplasmic tRNA(Leu) isolated from bovine liver revealed the presence of an unknown modified nucleotide N. The corresponding N nucleoside was isolated by different enzymatic and chromatographic protocols from a partially purified preparation of this tRNA(Leu). Its chemical characterization was determined from its chromatographic properties, UV-absorption spectroscopy and mass spectrometric measurements, as well as from those of the borohydride reduced N nucleoside and its etheno-trimethylsilyl derivative. The structure of N was established as 2'-O-methyl-5-formylcytidine (f5CM), and its reduced derivative as 2'-O-methyl-5-hydroxy-methylcytidine (om5Cm). By sequencing the bovine liver tRNA(Leu), the structure of the anticodon was determined as f5CmAA. In addition, the nucleotide sequence showed two primary structures differing only by the nucleotide 47c which is either uridine or adenosine. The two slightly differing bovine liver tRNAs-Leu(f5CmAA) are the only tRNAs so far sequenced which contain f5Cm. The role of such a modified cytidine at the first position of the anticodon is discussed in terms of decoding properties for the UUG and UUA leucine codons. Recently, precise evidence was obtained for the presence of f5Cm at the same position in tRNAs(Leu)(NAA) isolated from rabbit and lamb liver. Therefore, the 2'-O-methyl-5-formyl modification of cytidine at position 34 could be a general feature of cytoplasmic tRNAs(Leu)(NAA) in mammals. PMID:8628682

Phylogenetic analysis of West Nile virus, Nuevo Leon State, Mexico.

PubMed

Blitvich, Bradley J; Fernández-Salas, Ildefonso; Contreras-Cordero, Juan F; Loroño-Pino, María A; Marlenee, Nicole L; Díaz, Francisco J; González-Rojas, José I; Obregón-Martínez, Nelson; Chiu-García, Jorge A; Black, William C; Beaty, Barry J

2004-07-01

West Nile virus RNA was detected in brain tissue from a horse that died in June 2003 in Nuevo Leon State, Mexico. Nucleotide sequencing and phylogenetic analysis of the premembrane and envelope genes showed that the virus was most closely related to West Nile virus isolates collected in Texas in 2002.

Phylogenetic Analysis of West Nile Virus, Nuevo Leon State, Mexico

PubMed Central

Blitvich, Bradley J.; Fernández-Salas, Ildefonso; Contreras-Cordero, Juan F.; Loroño-Pino, María A.; Marlenee, Nicole L.; Díaz, Francisco J.; González-Rojas, José I.; Obregón-Martínez, Nelson; Chiu-García, Jorge A.; Black, William C.

2004-01-01

West Nile virus RNA was detected in brain tissue from a horse that died in June 2003 in Nuevo Leon State, Mexico. Nucleotide sequencing and phylogenetic analysis of the premembrane and envelope genes showed that the virus was most closely related to West Nile virus isolates collected in Texas in 2002. PMID:15324558

Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

2013-09-23

Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

Mitochondrial control-region sequence variation in aboriginal Australians.

PubMed Central

van Holst Pellekaan, S; Frommer, M; Sved, J; Boettcher, B

1998-01-01

The mitochondrial D-loop hypervariable segment 1 (mt HVS1) between nucleotides 15997 and 16377 has been examined in aboriginal Australian people from the Darling River region of New South Wales (riverine) and from Yuendumu in central Australia (desert). Forty-seven unique HVS1 types were identified, varying at 49 nucleotide positions. Pairwise analysis by calculation of BEPPI (between population proportion index) reveals statistically significant structure in the populations, although some identical HVS1 types are seen in the two contrasting regions. mt HVS1 types may reflect more-ancient distributions than do linguistic diversity and other culturally distinguishing attributes. Comparison with sequences from five published global studies reveals that these Australians demonstrate greatest divergence from some Africans, least from Papua New Guinea highlanders, and only slightly more from some Pacific groups (Indonesian, Asian, Samoan, and coastal Papua New Guinea), although the HVS1 types vary at different nucleotide sites. Construction of a median network, displaying three main groups, suggests that several hypervariable nucleotide sites within the HVS1 are likely to have undergone mutation independently, making phylogenetic comparison with global samples by conventional methods difficult. Specific nucleotide-site variants are major separators in median networks constructed from Australian HVS1 types alone and for one global selection. The distribution of these, requiring extended study, suggests that they may be signatures of different groups of prehistoric colonizers into Australia, for which the time of colonization remains elusive. PMID:9463317

Characterization of Foodborne Outbreaks of Salmonella enterica Serovar Enteritidis with Whole-Genome Sequencing Single Nucleotide Polymorphism-Based Analysis for Surveillance and Outbreak Detection.

PubMed

Taylor, Angela J; Lappi, Victoria; Wolfgang, William J; Lapierre, Pascal; Palumbo, Michael J; Medus, Carlota; Boxrud, David

2015-10-01

Salmonella enterica serovar Enteritidis is a significant cause of gastrointestinal illness in the United States; however, current molecular subtyping methods lack resolution for this highly clonal serovar. Advances in next-generation sequencing technologies have made it possible to examine whole-genome sequencing (WGS) as a potential molecular subtyping tool for outbreak detection and source trace back. Here, we conducted a retrospective analysis of S. Enteritidis isolates from seven epidemiologically confirmed foodborne outbreaks and sporadic isolates (not epidemiologically linked) to determine the utility of WGS to identify outbreaks. A collection of 55 epidemiologically characterized clinical and environmental S. Enteritidis isolates were sequenced. Single nucleotide polymorphism (SNP)-based cluster analysis of the S. Enteritidis genomes revealed well supported clades, with less than four-SNP pairwise diversity, that were concordant with epidemiologically defined outbreaks. Sporadic isolates were an average of 42.5 SNPs distant from the outbreak clusters. Isolates collected from the same patient over several weeks differed by only two SNPs. Our findings show that WGS provided greater resolution between outbreak, sporadic, and suspect isolates than the current gold standard subtyping method, pulsed-field gel electrophoresis (PFGE). Furthermore, results could be obtained in a time frame suitable for surveillance activities, supporting the use of WGS as an outbreak detection and characterization method for S. Enteritidis. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Cloning and sequence analysis of the Antheraea pernyi nucleopolyhedrovirus gp64 gene.

PubMed

Wang, Wenbing; Zhu, Shanying; Wang, Liqun; Yu, Feng; Shen, Weide

2005-12-01

Frequent outbreaks of the purulence disease of Chinese oak silkworm are reported in Middle and Northeast China. The disease is produced by the pathogen Antheraea pernyi nucleopolyhedrovirus (AnpeNPV). To obtain molecular information of the virus, the polyhedra of AnpeNPV were purified and characterized. The genomic DNA of AnpeNPV was extracted and digested with HindIII. The genome size of AnpeNPV is estimated at 128 kb. Based on the analysis of DNA fragments digested with HindIII, 23 fragments were bigger than 564 bp. A genomic library was generated using HindIII and the positive clones were sequenced and analysed. The gp64 gene, encoding the baculovirus envelope protein GP64, was found in an insert. The nucleotide sequence analysis indicated that the AnpeNPV gp64 gene consists of a 1,530 nucleotide open reading frame (ORF), encoding a protein of 509 amino acids. Of the eight gp64 homologues, the AnpeNPV gp64 ORF shared the most sequence similarity with the gp64 gene of Anticarsia gemmatalis NPV, but not Bombyx mori NPV. The upstream region of the AnpeNPV gp64 ORF encoded the conserved transcriptional elements for early and late stage of the viral infection cycle. These results indicated that AnpeNPV belongs to group I NPV and was far removed in molecular phylogeny from the BmNPV.

Genotyping of Chromobacterium violaceum isolates by recA PCR-RFLP analysis.

PubMed

Scholz, Holger Christian; Witte, Angela; Tomaso, Herbert; Al Dahouk, Sascha; Neubauer, Heinrich

2005-03-15

Intraspecies variation of Chromobacterium violaceum was examined by comparative sequence - and by restriction fragment length polymorphism analysis of the recombinase A gene (recA-PCR-RFLP). Primers deduced from the known recA gene sequence of the type strain C. violaceum ATCC 12472(T) allowed the specific amplification of a 1040bp recA fragment from each of the 13 C. violaceum strains investigated, whereas other closely related organisms tested negative. HindII-PstI-recA RFLP analysis generated from 13 representative C. violaceum strains enabled us to identify at least three different genospecies. In conclusion, analysis of the recA gene provides a rapid and robust nucleotide sequence-based approach to specifically identify and classify C. violaceum on genospecies level.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

Molecular Tracing of Hepatitis C Virus Genotype 1 Isolates in Iran: A NS5B Phylogenetic Analysis with Systematic Review.

PubMed

Hesamizadeh, Khashayar; Alavian, Seyed Moayed; Najafi Tireh Shabankareh, Azar; Sharafi, Heidar

2016-12-01

Hepatitis C virus (HCV) is characterized by a high degree of genetic heterogeneity and classified into 7 genotypes and different subtypes. It heterogeneously distributed through various risk groups and geographical regions. A well-established phylogenetic relationship can simplify the tracing of HCV hierarchical strata into geographical regions. The current study aimed to find genetic phylogeny of subtypes 1a and 1b of HCV isolates based on NS5B nucleotide sequences in Iran and other members of Eastern Mediterranean regional office of world health organization, as well as other Middle Eastern countries, with a systematic review of available published and unpublished studies. The phylogenetic analyses were performed based on the nucleotide sequences of NS5B gene of HCV genotype 1 (HCV-1), which were registered in the GenBank database. The literature review was performed in two steps: 1) searching studies evaluating the NS5B sequences of HCV-1, on PubMed, Scopus, and Web of Science, and 2) Searching sequences of unpublished studies registered in the GenBank database. In this study, 442 sequences from HCV-1a and 232 from HCV-1b underwent phylogenetic analysis. Phylogenetic analysis of all sequences revealed different clusters in the phylogenetic trees. The results showed that the proportion of HCV-1a and -1b isolates from Iranian patients probably originated from domestic sources. Moreover, the HCV-1b isolates from Iranian patients may have similarities with the European ones. In this study, phylogenetic reconstruction of HCV-1 sequences clearly indicated for molecular tracing and ancestral relationships of the HCV genotypes in Iran, and showed the likelihood of domestic origin for HCV-1a and various origin for HCV-1b.

Avian influenza virus and Newcastle disease virus (NDV) surveillance in commercial breeding farm in China and the characterization of Class I NDV isolates.

PubMed

Hu, Beixia; Huang, Yanyan; He, Yefeng; Xu, Chuantian; Lu, Xishan; Zhang, Wei; Meng, Bin; Yan, Shigan; Zhang, Xiumei

2010-07-29

In order to determine the actual prevalence of avian influenza virus (AIV) and Newcastle disease virus (NDV) in ducks in Shandong province of China, extensive surveillance studies were carried out in the breeding ducks of an intensive farm from July 2007 to September 2008. Each month cloacal and tracheal swabs were taken from 30 randomly selected birds that appeared healthy. All of the swabs were negative for influenza A virus recovery, whereas 87.5% of tracheal swabs and 100% cloacal swabs collected in September 2007, were positive for Newcastle disease virus isolation. Several NDV isolates were recovered from tracheal and cloacal swabs of apparently healthy ducks. All of the isolates were apathogenic as determined by the MDT and ICPI. The HN gene and the variable region of F gene (nt 47-420) of four isolates selected at random were sequenced. A 374 bp region of F gene and the full length of HN gene were used for phylogenetic analysis. Four isolates were identified as the same isolate based on nucleotide sequences identities of 99.2-100%, displaying a closer phylogenetic relationship to lentogenic Class I viruses. There were 1.9-9.9% nucleotide differences between the isolates and other Class I virus in the variable region of F gene (nt 47-420), whereas there were 38.5-41.2% nucleotide difference between the isolates and Class II viruses. The amino acid sequences of the F protein cleavage sites in these isolates were 112-ERQERL-117. The full length of HN gene of these isolates was 1851 bp, coding 585 amino acids. The homology analysis of the nucleotide sequence of HN gene indicated that there were 2.0-4.2% nucleotide differences between the isolates and other Class I viruses, whereas there were 29.5-40.9% differences between the isolates and Class II viruses. The results shows that these isolates are not phylogenetically related to the vaccine strain (LaSota). This study adds to the understanding of the ecology of influenza viruses and Newcastle disease viruses in ducks and emphasizes the need for constant surveillance in times of an ongoing and expanding epidemic of AIV and NDV. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences

PubMed Central

Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

2016-01-01

The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species’ genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Trading genes along the silk road: mtDNA sequences and the origin of central Asian populations.

PubMed Central

Comas, D; Calafell, F; Mateu, E; Pérez-Lezaun, A; Bosch, E; Martínez-Arias, R; Clarimon, J; Facchini, F; Fiori, G; Luiselli, D; Pettener, D; Bertranpetit, J

1998-01-01

Central Asia is a vast region at the crossroads of different habitats, cultures, and trade routes. Little is known about the genetics and the history of the population of this region. We present the analysis of mtDNA control-region sequences in samples of the Kazakh, the Uighurs, the lowland Kirghiz, and the highland Kirghiz, which we have used to address both the population history of the region and the possible selective pressures that high altitude has on mtDNA genes. Central Asian mtDNA sequences present features intermediate between European and eastern Asian sequences, in several parameters-such as the frequencies of certain nucleotides, the levels of nucleotide diversity, mean pairwise differences, and genetic distances. Several hypotheses could explain the intermediate position of central Asia between Europe and eastern Asia, but the most plausible would involve extensive levels of admixture between Europeans and eastern Asians in central Asia, possibly enhanced during the Silk Road trade and clearly after the eastern and western Eurasian human groups had diverged. Lowland and highland Kirghiz mtDNA sequences are very similar, and the analysis of molecular variance has revealed that the fraction of mitochondrial genetic variance due to altitude is not significantly different from zero. Thus, it seems unlikely that altitude has exerted a major selective pressure on mitochondrial genes in central Asian populations. PMID:9837835

Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

PubMed Central

Song, Wen Jun; Qin, Qi Wei; Qiu, Jin; Huang, Can Hua; Wang, Fan; Hew, Choy Leong

2004-01-01

Here we report the complete genome sequence of Singapore grouper iridovirus (SGIV). Sequencing of the random shotgun and restriction endonuclease genomic libraries showed that the entire SGIV genome consists of 140,131 nucleotide bp. One hundred sixty-two open reading frames (ORFs) from the sense and antisense DNA strands, coding for lengths varying from 41 to 1,268 amino acids, were identified. Computer-assisted analyses of the deduced amino acid sequences revealed that 77 of the ORFs exhibited homologies to known virus genes, 23 of which matched functional iridovirus proteins. Forty-two putative conserved domains or signatures were detected in the National Center for Biotechnology Information CD-Search database and PROSITE database. An assortment of enzyme activities involved in DNA replication, transcription, nucleotide metabolism, cell signaling, etc., were identified. Viruses were cultured on a cell line derived from the embryonated egg of the grouper Epinephelus tauvina, isolated, and purified by sucrose gradient ultracentrifugation. The protein extract from the purified virions was analyzed by polyacrylamide gel electrophoresis followed by in-gel digestion of protein bands. Matrix-assisted laser desorption ionization-time of flight mass spectrometry and database searching led to identification of 26 proteins. Twenty of these represented novel or previously unidentified genes, which were further confirmed by reverse transcription-PCR (RT-PCR) and DNA sequencing of their respective RT-PCR products. PMID:15507645

PseKNC: a flexible web server for generating pseudo K-tuple nucleotide composition.

PubMed

Chen, Wei; Lei, Tian-Yu; Jin, Dian-Chuan; Lin, Hao; Chou, Kuo-Chen

2014-07-01

The pseudo oligonucleotide composition, or pseudo K-tuple nucleotide composition (PseKNC), can be used to represent a DNA or RNA sequence with a discrete model or vector yet still keep considerable sequence order information, particularly the global or long-range sequence order information, via the physicochemical properties of its constituent oligonucleotides. Therefore, the PseKNC approach may hold very high potential for enhancing the power in dealing with many problems in computational genomics and genome sequence analysis. However, dealing with different DNA or RNA problems may need different kinds of PseKNC. Here, we present a flexible and user-friendly web server for PseKNC (at http://lin.uestc.edu.cn/pseknc/default.aspx) by which users can easily generate many different modes of PseKNC according to their need by selecting various parameters and physicochemical properties. Furthermore, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the current web server to generate their desired PseKNC without the need to follow the complicated mathematical equations, which are presented in this article just for the integrity of PseKNC formulation and its development. It is anticipated that the PseKNC web server will become a very useful tool in computational genomics and genome sequence analysis. Copyright © 2014 Elsevier Inc. All rights reserved.

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies.

PubMed

Gonzalez, P; Barroso, G; Labarère, J

1998-10-05

The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.

Breaking the 1000-gene barrier for Mimivirus using ultra-deep genome and transcriptome sequencing.

PubMed

Legendre, Matthieu; Santini, Sébastien; Rico, Alain; Abergel, Chantal; Claverie, Jean-Michel

2011-03-04

Mimivirus, a giant dsDNA virus infecting Acanthamoeba, is the prototype of the mimiviridae family, the latest addition to the family of the nucleocytoplasmic large DNA viruses (NCLDVs). Its 1.2 Mb-genome was initially predicted to encode 917 genes. A subsequent RNA-Seq analysis precisely mapped many transcript boundaries and identified 75 new genes. We now report a much deeper analysis using the SOLiD™ technology combining RNA-Seq of the Mimivirus transcriptome during the infectious cycle (202.4 Million reads), and a complete genome re-sequencing (45.3 Million reads). This study corrected the genome sequence and identified several single nucleotide polymorphisms. Our results also provided clear evidence of previously overlooked transcription units, including an important RNA polymerase subunit distantly related to Euryarchea homologues. The total Mimivirus gene count is now 1018, 11% greater than the original annotation. This study highlights the huge progress brought about by ultra-deep sequencing for the comprehensive annotation of virus genomes, opening the door to a complete one-nucleotide resolution level description of their transcriptional activity, and to the realistic modeling of the viral genome expression at the ultimate molecular level. This work also illustrates the need to go beyond bioinformatics-only approaches for the annotation of short protein and non-coding genes in viral genomes.

Analysis of the beak and feather disease viral genome indicates the existence of several genotypes which have a complex psittacine host specificity.

PubMed

de Kloet, E; de Kloet, S R

2004-12-01

A study was made of the phylogenetic relationships between fifteen complete nucleotide sequences as well as 43 nucleotide sequences of the putative coat protein gene of different strains belonging to the virus species Beak and feather disease virus obtained from 39 individuals of 16 psittacine species. The species included among others, cockatoos ( Cacatuini), African grey parrots ( Psittacus erithacus) and peach-faced lovebirds ( Agapornis roseicollis), which were infected at different geographical locations, within and outside Australia, the native origin of the virus. The derived amino acid sequences of the putative coat protein were highly diverse, with differences between some strains amounting to 50 of the 250 amino acids. Phylogenetic analysis demonstrated that the putative coat gene sequences form six clusters which show a varying degree of psittacine species specificity. Most, but not all strains infecting African grey parrots formed a single cluster as did the strains infecting the cockatoos. Strains infecting the lovebirds clustered with those infecting such Australasian species as Eclectus roratus, Psittacula kramerii and Psephotus haematogaster. Although individual birds included in this study were, where studied, often infected by closely related strains, infection by highly diverged trains was also detected. The possible relationship between BFD viral strains and clinical disease signs is discussed.

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

Partial sequencing analysis of the NS5B region confirmed the predominance of hepatitis C virus genotype 1 infection in Jeddah, Saudi Arabia.

PubMed

El Hadad, Sahar; Al-Hamdan, Hesa; Linjawi, Sabah

2017-01-01

Chronic hepatitis C virus (HCV) infection and its progression are major health problems that many countries including Saudi Arabia are facing. Determination of HCV genotypes and subgenotypes is critical for epidemiological and clinical analysis and aids in the determination of the ideal treatment strategy that needs to be followed and the expected therapy response. Although HCV infection has been identified as the second most predominant type of hepatitis in Saudi Arabia, little is known about the molecular epidemiology and genetic variability of HCV circulating in the Jeddah province of Saudi Arabia. The aim of this study was to determine the dominance of various HCV genotypes and subgenotypes circulating in Jeddah using partial sequencing of the NS5B region. To the best of our knowledge, this is the first study of its kind in Saudi Arabia. To characterize HCV genotypes and subgenotypes, serum samples from 56 patients with chronic HCV infection were collected and subjected to partial NS5B gene amplification and sequence analysis. Phylogenetic analysis of the NS5B partial sequences revealed that HCV/1 was the predominant genotype (73%), followed by HCV/4 (24.49%) and HCV/3 (2.04%). Moreover, pairwise analysis also confirmed these results based on the average specific nucleotide distance identity: ±0.112, ±0.112, and ±0.179 for HCV/1, HCV/4, and HCV/3, respectively, without any interference between genotypes. Notably, the phylogenetic tree of the HCV/1 subgenotypes revealed that all the isolates (100%) from the present study belonged to the HCV/1a subgenotype. Our findings also revealed similarities in the nucleotide sequences between HCV circulating in Saudi Arabia and those circulating in countries such as Morocco, Egypt, Canada, India, Pakistan, and France. These results indicated that determination of HCV genotypes and subgenotypes based on partial sequence analysis of the NS5B region is accurate and reliable for HCV subtype determination.

Genomic analysis reveals Nairobi sheep disease virus to be highly diverse and present in both Africa, and in India in the form of the Ganjam virus variant.

PubMed

Yadav, Pragya D; Vincent, Martin J; Khristova, Marina; Kale, Charuta; Nichol, Stuart T; Mishra, Akhilesh C; Mourya, Devendra T

2011-07-01

Nairobi sheep disease (NSD) virus, the prototype tick-borne virus of the genus Nairovirus, family Bunyaviridae is associated with acute hemorrhagic gastroenteritis in sheep and goats in East and Central Africa. The closely related Ganjam virus found in India is associated with febrile illness in humans and disease in livestock. The complete S, M and L segment sequences of Ganjam and NSD virus and partial sequence analysis of Ganjam viral RNA genome S, M and L segments encoding regions (396 bp, 701 bp and 425 bp) of the viral nucleocapsid (N), glycoprotein precursor (GPC) and L polymerase (L) proteins, respectively, was carried out for multiple Ganjam virus isolates obtained from 1954 to 2002 and from various regions of India. M segments of NSD and Ganjam virus encode a large ORF for the glycoprotein precursor (GPC), (1627 and 1624 amino acids in length, respectively) and their L segments encode a very large L polymerase (3991 amino acids). The complete S, M and L segments of NSD and Ganjam viruses were more closely related to one another than to other characterized nairoviruses, and no evidence of reassortment was found. However, the NSD and Ganjam virus complete M segment differed by 22.90% and 14.70%, for nucleotide and amino acid respectively, and the complete L segment nucleotide and protein differing by 9.90% and 2.70%, respectively among themselves. Ganjam and NSD virus, complete S segment differed by 9.40-10.40% and 3.2-4.10 for nucleotide and proteins while among Ganjam viruses 0.0-6.20% and 0.0-1.4%, variation was found for nucleotide and amino acids. Ganjam virus isolates differed by up to 17% and 11% at the nucleotide level for the partial S and L gene fragments, respectively, with less variation observed at the deduced amino acid level (10.5 and 2%, S and L, respectively). However, the virus partial M gene fragment (which encodes the hypervariable mucin-like domain) of these viruses differed by as much as 56% at the nucleotide level. Phylogenetic analysis of partial sequence differences suggests considerable mixing and movement of Ganjam virus strains within India, with no clear relationship between genetic lineages and virus geographic origin or year of isolation. Surprisingly, NSD virus does not represent a distinct lineage, but appears as a variant with other Ganjam virus among NSD virus group. Copyright © 2011 Elsevier B.V. All rights reserved.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

PubMed

Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

2013-10-01

Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Choice of Reference Sequence and Assembler for Alignment of Listeria monocytogenes Short-Read Sequence Data Greatly Influences Rates of Error in SNP Analyses

PubMed Central

Pightling, Arthur W.; Petronella, Nicholas; Pagotto, Franco

2014-01-01

The wide availability of whole-genome sequencing (WGS) and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs) in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs) are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps) are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i) depth of sequencing coverage, ii) choice of reference-guided short-read sequence assembler, iii) choice of reference genome, and iv) whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT), using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming). We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers should test a variety of conditions to achieve optimal results. PMID:25144537

Discovery of 100K SNP array and its utilization in sugarcane

USDA-ARS?s Scientific Manuscript database

Next generation sequencing (NGS) enable us to identify thousands of single nucleotide polymorphisms (SNPs) marker for genotyping and fingerprinting. However, the process requires very precise bioinformatics analysis and filtering process. High throughput SNP array with predefined genomic location co...

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

PubMed Central

Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

2013-01-01

The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Molecular Epidemiology of a novel re-assorted epidemic strain of equine influenza virus in Pakistan in 2015-16.

PubMed

Khan, Amjad; Mushtaq, Muhammad Hassan; Ahmad, Mansur Ud Din; Nazir, Jawad; Farooqi, Shahid Hussain; Khan, Asghar

2017-08-15

A widespread epidemic of equine influenza (EI) occurred in nonvaccinated equine population across multiple districts in Khyber Pakhtunkhwa Province of Pakistan during 2015-2016. An epidemiological surveillance study was conducted from Oct 2015 to April 2016 to investigate the outbreak. EI virus strains were isolated in embryonated eggs from suspected equines swab samples and were subjected to genome sequencing using M13 tagged segment specific primers. Phylogenetic analyses of the nucleotide sequences were concluded using Geneious. Haemagglutinin (HA), Neuraminidase (NA), Matrix (M) and nucleoprotein (NP) genes nucleotide and amino acid sequences of the isolated viruses were aligned with those of OIE recommended, FC-1, FC-2, and contemporary isolates of influenza A viruses from other species. HA and NA genes amino acid sequences were very similar to Tennessee/14 and Malaysia/15 of FC-1 and clustered with the contemporary isolates recently reported in the USA. Phylogenetic analysis showed that these viruses were mostly identical (with 99.6% and 97.4% nucleotide homology) to, and were reassortants containing chicken/Pakistan/14 (H7N3) and Canine/Beijing/10 (H3N2) like M and NP genes. Genetic analysis indicated that A/equine/Pakistan/16 viruses were most probably the result of several re-assortments between the co-circulating avian and equine viruses, and were genetically unlike the other equine viruses due to the presence of H7N3 or H3N2 like M and NP genes. Epidemiological data analysis indicated the potential chance of mixed, and management such as mixed farming system by keeping equine, canine and backyard poultry together in confined premises as the greater risk factors responsible for the re-assortments. Other factors might have contributed to the spread of the epidemic, including low awareness level, poor control of equine movements, and absence of border control disease strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, G.; Korber, B.; Wain-Hobson, S.

1993-12-31

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

Determination and analysis of the complete genome sequence of Paralichthys olivaceus rhabdovirus (PORV).

PubMed

Zhu, Ruo-Lin; Zhang, Qi-Ya

2014-04-01

Paralichthys olivaceus rhabdovirus (PORV), which is associated with high mortality rates in flounder, was isolated in China in 2005. Here, we provide an annotated sequence record of PORV, the genome of which comprises 11,182 nucleotides and contains six genes in the order 3'-N-P-M-G-NV-L-5'. Phylogenetic analysis based on glycoprotein sequences of PORV and other rhabdoviruses showed that PORV clusters with viral haemorrhagic septicemia virus (VHSV), genus Novirhabdovirus, family Rhabdoviridae. Further phylogenetic analysis of the combined amino acid sequences of six proteins of PORV and VHSV strains showed that PORV clusters with Korean strains and is closely related to Asian strains, all of which were isolated from flounder. In a comparison in which the sequences of the six proteins were combined, PORV shared the highest identity (98.3 %) with VHSV strain KJ2008 from Korea.

PCR amplification and sequence analysis of the major capsid protein gene of megalocytiviruses isolated in Taiwan.

PubMed

Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H

2009-06-01

Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.

Porcine parvovirus: DNA sequence and genome organization.

PubMed

Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

1989-10-01

We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

Identification and molecular characterization of a new recombinant begomovirus and associated betasatellite DNA infecting Capsicum annuum in India.

PubMed

Bhatt, Bhavin S; Chahwala, Fenisha D; Rathod, Sangeeta; Singh, Achuit K

2016-05-01

Capsicum annuum (Chilli) is a perennial herbaceous plant that is cultivated as an annual crop throughout the world, including India. Chilli leaf curl disease (ChiLCD) is a major biotic constraint, causing major losses in chilli production. During 2014, leaf samples of chilli plants displaying leaf curl disease were collected from the Ahmedabad district of Gujarat, India. These samples were used to isolate, clone and sequence viral genomic DNA and an associated betasatellite DNA molecule. Sequence analysis showed 90.4 % nucleotide sequence identity to the previously reported chilli leaf curl virus-[India:Guntur:2009] (ChiLCV-[IN:Gun:09]. As per ICTV nomenclature rules, ChiLCV-Ahm represents a new species of begomovirus, and we therefore propose the name chilli leaf curl Ahmedabad virus-[India:Ahmedabad:2014] (ChiLCAV-[IN:Ahm:14]). The associated betasatellite DNA showed a maximum of 93.5 % nucleotide sequence identity to a previously reported tomato leaf curl Bangladesh betasatellite and may be named tomato leaf curl Bangladesh betasatellite-[India:Ahmedabad:Chilli:2014].

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing

USDA-ARS?s Scientific Manuscript database

Spinach (Spinacia oleracea L., 2n=2x=12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and mineral compounds. The objective of this research is to conduct genetic diversity and population structure analysis of w...

Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.

PubMed Central

Eriani, G; Dirheimer, G; Gangloff, J

1989-01-01

The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891

A combination of PhP typing and β-d-glucuronidase gene sequence variation analysis for differentiation of Escherichia coli from humans and animals.

PubMed

Masters, N; Christie, M; Katouli, M; Stratton, H

2015-06-01

We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

USGS Publications Warehouse

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

DNA Barcodes of Asian Houbara Bustard (Chlamydotis undulata macqueenii)

PubMed Central

Arif, Ibrahim A.; Khan, Haseeb A.; Williams, Joseph B.; Shobrak, Mohammad; Arif, Waad I.

2012-01-01

Populations of Houbara Bustards have dramatically declined in recent years. Captive breeding and reintroduction programs have had limited success in reviving population numbers and thus new technological solutions involving molecular methods are essential for the long term survival of this species. In this study, we sequenced the 694 bp segment of COI gene of the four specimens of Asian Houbara Bustard (Chlamydotis undulata macqueenii). We also compared these sequences with earlier published barcodes of 11 individuals comprising different families of the orders Gruiformes, Ciconiiformes, Podicipediformes and Crocodylia (out group). The pair-wise sequence comparison showed a total of 254 variable sites across all the 15 sequences from different taxa. Three of the four specimens of Houbara Bustard had an identical sequence of COI gene and one individual showed a single nucleotide difference (G > A transition at position 83). Within the bustard family (Otididae), comparison among the three species (Asian Houbara Bustard, Great Bustard (Otis tarda) and the Little Bustard (Tetrax tetrax)), representing three different genera, showed 116 variable sites. For another family (Rallidae), the intra-family variable sites among the individuals of four different genera were found to be 146. The COI genetic distances among the 15 individuals varied from 0.000 to 0.431. Phylogenetic analysis using 619 bp nucleotide segment of COI clearly discriminated all the species representing different genera, families and orders. All the four specimens of Houbara Bustard formed a single clade and are clearly separated from other two individuals of the same family (Otis tarda and Tetrax tetrax). The nucleotide sequence of partial segment of COI gene effectively discriminated the closely related species. This is the first study reporting the barcodes of Houbara Bustard and would be helpful in future molecular studies, particularly for the conservation of this threatened bird in Saudi Arabia. PMID:22408462

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

PubMed Central

Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

1991-01-01

A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis

PubMed Central

Smola, Matthew J.; Rice, Greggory M.; Busan, Steven; Siegfried, Nathan A.; Weeks, Kevin M.

2016-01-01

SHAPE chemistries exploit small electrophilic reagents that react with the 2′-hydroxyl group to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues based on the ability of reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as for simple model RNAs. This protocol describes the experimental steps, implemented over three days, required to perform SHAPE probing and construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. These steps include RNA folding and SHAPE structure probing, mutational profiling by reverse transcription, library construction, and sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots, and provides useful troubleshooting information, often within an hour. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures, and visualize probable and alternative helices, often in under a day. We illustrate these algorithms with the E. coli thiamine pyrophosphate riboswitch, E. coli 16S rRNA, and HIV-1 genomic RNAs. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles, and entire transcriptomes. The straightforward MaP strategy greatly expands the number, length, and complexity of analyzable RNA structures. PMID:26426499

Unraveling Haplotype Diversity of the Apical Membrane Antigen-1 Gene in Plasmodium falciparum Populations in Thailand

PubMed Central

Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn

2018-01-01

Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).

PubMed Central

Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P

1995-01-01

An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711

Molecular characterization of Giardia psittaci by multilocus sequence analysis.

PubMed

Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi

2012-12-01

Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.