Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

PubMed Central

Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

2011-01-01

We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Mechanisms generating long range correlation in nucleotide composition of the Borrelia Burgdorferi genome

NASA Astrophysics Data System (ADS)

Mackiewicz, P.; Gierlik, A.; Kowalczuk, M.; Szczepanik, D.; Dudek, M. R.; Cebrat, S.

1999-12-01

We have analysed protein coding and intergenic sequences in the Borrelia burgdorferi (the Lyme disease bacterium) genome using different kinds of DNA walks. Genes occupying the leading strand of DNA have significantly different nucleotide composition from genes occupying the lagging strand. Nucleotide compositional bias of the two DNA strands reflects the aminoacid composition of proteins. 96% of genes coding for ribosomal proteins lie on the leading DNA strand, which suggests that the positions of these as well as other genes are non-random. In the B. burgdorferi genome, the asymmetry in intergenic DNA sequences is lower than the asymmetry in the third positions in codons. All these characters of the B. burgdorferi genome suggest that both replication-associated mutational pressure and recombination mechanisms have established the specific structure of the genome and now any recombination leading to inversion of a gene in respect to the direction of replication is forbidden. This property of the genome allows us to assume that it is in a steady state, which enables us to fix some parameters for simulations of DNA evolution.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

PubMed

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions

PubMed Central

Nishizawa, Manami; Nishizawa, Kazuhisa

2000-01-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273

Correlations of nucleotide substitution rates and base composition of mammalian coding sequences with protein structure.

PubMed

Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G

1999-09-30

We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

PubMed

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2015-04-15

In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

RY-Coding and Non-Homogeneous Models Can Ameliorate the Maximum-Likelihood Inferences From Nucleotide Sequence Data with Parallel Compositional Heterogeneity.

PubMed

Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo

2012-01-01

In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

Overproduction and nucleotide sequence of the respiratory D-lactate dehydrogenase of Escherichia coli.

PubMed Central

Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C

1985-01-01

Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663

A comprehensive bioinformatic analysis of hepatitis D virus full-length genomes.

PubMed

Delfino, C M; Cerrudo, C S; Biglione, M; Oubiña, J R; Ghiringhelli, P D; Mathet, V L

2018-02-06

In association with hepatitis B virus (HBV), hepatitis delta virus (HDV) is a subviral agent that may promote severe acute and chronic forms of liver disease. Based on the percentage of nucleotide identity of the genome, HDV was initially classified into three genotypes. However, since 2006, the original classification has been further expanded into eight clades/genotypes. The intergenotype divergence may be as high as 35%-40% over the entire RNA genome, whereas sequence heterogeneity among the isolates of a given genotype is <20%; furthermore, HDV recombinants have been clearly demonstrated. The genetic diversity of HDV is related to the geographic origin of the isolates. This study shows the first comprehensive bioinformatic analysis of the complete available set of HDV sequences, using both nucleotide and protein phylogenies (based on an evolutionary model selection, gamma distribution estimation, tree inference and phylogenetic distance estimation), protein composition analysis and comparison (based on the presence of invariant residues, molecular signatures, amino acid frequencies and mono- and di-amino acid compositional distances), as well as amino acid changes in sequence evolution. Taking into account the congruent and consistent results of both nucleotide and amino acid analyses of GenBank available sequences (recorded as of January, 2017), we propose that the eight hepatitis D virus genotypes may be grouped into three large genogroups fully supported by their shared characteristics. © 2018 John Wiley & Sons Ltd.

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

PseKNC: a flexible web server for generating pseudo K-tuple nucleotide composition.

PubMed

Chen, Wei; Lei, Tian-Yu; Jin, Dian-Chuan; Lin, Hao; Chou, Kuo-Chen

2014-07-01

The pseudo oligonucleotide composition, or pseudo K-tuple nucleotide composition (PseKNC), can be used to represent a DNA or RNA sequence with a discrete model or vector yet still keep considerable sequence order information, particularly the global or long-range sequence order information, via the physicochemical properties of its constituent oligonucleotides. Therefore, the PseKNC approach may hold very high potential for enhancing the power in dealing with many problems in computational genomics and genome sequence analysis. However, dealing with different DNA or RNA problems may need different kinds of PseKNC. Here, we present a flexible and user-friendly web server for PseKNC (at http://lin.uestc.edu.cn/pseknc/default.aspx) by which users can easily generate many different modes of PseKNC according to their need by selecting various parameters and physicochemical properties. Furthermore, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the current web server to generate their desired PseKNC without the need to follow the complicated mathematical equations, which are presented in this article just for the integrity of PseKNC formulation and its development. It is anticipated that the PseKNC web server will become a very useful tool in computational genomics and genome sequence analysis. Copyright © 2014 Elsevier Inc. All rights reserved.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Methods of automatic nucleotide-sequence analysis. Multicomponent spectrophotometric analysis of mixtures of nucleic acid components by a least-squares procedure

PubMed Central

Lee, Sheila; McMullen, D.; Brown, G. L.; Stokes, A. R.

1965-01-01

1. A theoretical analysis of the errors in multicomponent spectrophotometric analysis of nucleoside mixtures, by a least-squares procedure, has been made to obtain an expression for the error coefficient, relating the error in calculated concentration to the error in extinction measurements. 2. The error coefficients, which depend only on the `library' of spectra used to fit the experimental curves, have been computed for a number of `libraries' containing the following nucleosides found in s-RNA: adenosine, guanosine, cytidine, uridine, 5-ribosyluracil, 7-methylguanosine, 6-dimethylaminopurine riboside, 6-methylaminopurine riboside and thymine riboside. 3. The error coefficients have been used to determine the best conditions for maximum accuracy in the determination of the compositions of nucleoside mixtures. 4. Experimental determinations of the compositions of nucleoside mixtures have been made and the errors found to be consistent with those predicted by the theoretical analysis. 5. It has been demonstrated that, with certain precautions, the multicomponent spectrophotometric method described is suitable as a basis for automatic nucleotide-composition analysis of oligonucleotides containing nine nucleotides. Used in conjunction with continuous chromatography and flow chemical techniques, this method can be applied to the study of the sequence of s-RNA. PMID:14346087

Higher-level phylogeny of paraneopteran insects inferred from mitochondrial genome sequences

PubMed Central

Li, Hu; Shao, Renfu; Song, Nan; Song, Fan; Jiang, Pei; Li, Zhihong; Cai, Wanzhi

2015-01-01

Mitochondrial (mt) genome data have been proven to be informative for animal phylogenetic studies but may also suffer from systematic errors, due to the effects of accelerated substitution rate and compositional heterogeneity. We analyzed the mt genomes of 25 insect species from the four paraneopteran orders, aiming to better understand how accelerated substitution rate and compositional heterogeneity affect the inferences of the higher-level phylogeny of this diverse group of hemimetabolous insects. We found substantial heterogeneity in base composition and contrasting rates in nucleotide substitution among these paraneopteran insects, which complicate the inference of higher-level phylogeny. The phylogenies inferred with concatenated sequences of mt genes using maximum likelihood and Bayesian methods and homogeneous models failed to recover Psocodea and Hemiptera as monophyletic groups but grouped, instead, the taxa that had accelerated substitution rates together, including Sternorrhyncha (a suborder of Hemiptera), Thysanoptera, Phthiraptera and Liposcelididae (a family of Psocoptera). Bayesian inference with nucleotide sequences and heterogeneous models (CAT and CAT + GTR), however, recovered Psocodea, Thysanoptera and Hemiptera each as a monophyletic group. Within Psocodea, Liposcelididae is more closely related to Phthiraptera than to other species of Psocoptera. Furthermore, Thysanoptera was recovered as the sister group to Hemiptera. PMID:25704094

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency.

PubMed

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua

2016-09-22

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

PubMed

Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

NASA Astrophysics Data System (ADS)

Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

PubMed

Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

2016-11-01

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

Comparison of base composition analysis and Sanger sequencing of mitochondrial DNA for four U.S. population groups.

PubMed

Kiesler, Kevin M; Coble, Michael D; Hall, Thomas A; Vallone, Peter M

2014-01-01

A set of 711 samples from four U.S. population groups was analyzed using a novel mass spectrometry based method for mitochondrial DNA (mtDNA) base composition profiling. Comparison of the mass spectrometry results with Sanger sequencing derived data yielded a concordance rate of 99.97%. Length heteroplasmy was identified in 46% of samples and point heteroplasmy was observed in 6.6% of samples in the combined mass spectral and Sanger data set. Using discrimination capacity as a metric, Sanger sequencing of the full control region had the highest discriminatory power, followed by the mass spectrometry base composition method, which was more discriminating than Sanger sequencing of just the hypervariable regions. This trend is in agreement with the number of nucleotides covered by each of the three assays. Published by Elsevier Ireland Ltd.

Simple sequence repeats in Escherichia coli: abundance, distribution, composition, and polymorphism.

PubMed

Gur-Arie, R; Cohen, C J; Eitan, Y; Shelef, L; Hallerman, E M; Kashi, Y

2000-01-01

Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.

An extended sequence specificity for UV-induced DNA damage.

PubMed

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

PubMed

Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

2014-12-12

GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

A Bayesian compound stochastic process for modeling nonstationary and nonhomogeneous sequence evolution.

PubMed

Blanquart, Samuel; Lartillot, Nicolas

2006-11-01

Variations of nucleotidic composition affect phylogenetic inference conducted under stationary models of evolution. In particular, they may cause unrelated taxa sharing similar base composition to be grouped together in the resulting phylogeny. To address this problem, we developed a nonstationary and nonhomogeneous model accounting for compositional biases. Unlike previous nonstationary models, which are branchwise, that is, assume that base composition only changes at the nodes of the tree, in our model, the process of compositional drift is totally uncoupled from the speciation events. In addition, the total number of events of compositional drift distributed across the tree is directly inferred from the data. We implemented the method in a Bayesian framework, relying on Markov Chain Monte Carlo algorithms, and applied it to several nucleotidic data sets. In most cases, the stationarity assumption was rejected in favor of our nonstationary model. In addition, we show that our method is able to resolve a well-known artifact. By Bayes factor evaluation, we compared our model with 2 previously developed nonstationary models. We show that the coupling between speciations and compositional shifts inherent to branchwise models may lead to an overparameterization, resulting in a lesser fit. In some cases, this leads to incorrect conclusions, concerning the nature of the compositional biases. In contrast, our compound model more flexibly adapts its effective number of parameters to the data sets under investigation. Altogether, our results show that accounting for nonstationary sequence evolution may require more elaborate and more flexible models than those currently used.

Genomic diversity of the human intestinal parasite Entamoeba histolytica

PubMed Central

2012-01-01

Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency

PubMed Central

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua

2016-01-01

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575

Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism

PubMed Central

Gur-Arie, Riva; Cohen, Cyril J.; Eitan, Yuval; Shelef, Leora; Hallerman, Eric M.; Kashi, Yechezkel

2000-01-01

Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AF209020–209030 and AF209508–209518.] PMID:10645951

Updating Our View of Organelle Genome Nucleotide Landscape

PubMed Central

Smith, David Roy

2012-01-01

Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299

Using Maximum Entropy to Find Patterns in Genomes

NASA Astrophysics Data System (ADS)

Liu, Sophia; Hockenberry, Adam; Lancichinetti, Andrea; Jewett, Michael; Amaral, Luis

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. To accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. This approach can also be easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes. National Institute of General Medical Science, Northwestern University Presidential Fellowship, National Science Foundation, David and Lucile Packard Foundation, Camille Dreyfus Teacher Scholar Award.

Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences.

PubMed

Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter

2014-01-13

Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Superstatistical model of bacterial DNA architecture

NASA Astrophysics Data System (ADS)

Bogachev, Mikhail I.; Markelov, Oleg A.; Kayumov, Airat R.; Bunde, Armin

2017-02-01

Understanding the physical principles that govern the complex DNA structural organization as well as its mechanical and thermodynamical properties is essential for the advancement in both life sciences and genetic engineering. Recently we have discovered that the complex DNA organization is explicitly reflected in the arrangement of nucleotides depicted by the universal power law tailed internucleotide interval distribution that is valid for complete genomes of various prokaryotic and eukaryotic organisms. Here we suggest a superstatistical model that represents a long DNA molecule by a series of consecutive ~150 bp DNA segments with the alternation of the local nucleotide composition between segments exhibiting long-range correlations. We show that the superstatistical model and the corresponding DNA generation algorithm explicitly reproduce the laws governing the empirical nucleotide arrangement properties of the DNA sequences for various global GC contents and optimal living temperatures. Finally, we discuss the relevance of our model in terms of the DNA mechanical properties. As an outlook, we focus on finding the DNA sequences that encode a given protein while simultaneously reproducing the nucleotide arrangement laws observed from empirical genomes, that may be of interest in the optimization of genetic engineering of long DNA molecules.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Organizational heterogeneity of vertebrate genomes.

PubMed

Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

2012-01-01

Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences

PubMed Central

2014-01-01

Background Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Results Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. Conclusion The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification. PMID:24418292

An improved model for whole genome phylogenetic analysis by Fourier transform.

PubMed

Yin, Changchuan; Yau, Stephen S-T

2015-10-07

DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Improved nucleic acid descriptors for siRNA efficacy prediction.

PubMed

Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

2013-02-01

Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Molecular mechanisms of adaptation emerging from the physics and evolution of nucleic acids and proteins.

PubMed

Goncearenco, Alexander; Ma, Bin-Guang; Berezovsky, Igor N

2014-03-01

DNA, RNA and proteins are major biological macromolecules that coevolve and adapt to environments as components of one highly interconnected system. We explore here sequence/structure determinants of mechanisms of adaptation of these molecules, links between them, and results of their mutual evolution. We complemented statistical analysis of genomic and proteomic sequences with folding simulations of RNA molecules, unraveling causal relations between compositional and sequence biases reflecting molecular adaptation on DNA, RNA and protein levels. We found many compositional peculiarities related to environmental adaptation and the life style. Specifically, thermal adaptation of protein-coding sequences in Archaea is characterized by a stronger codon bias than in Bacteria. Guanine and cytosine load in the third codon position is important for supporting the aerobic life style, and it is highly pronounced in Bacteria. The third codon position also provides a tradeoff between arginine and lysine, which are favorable for thermal adaptation and aerobicity, respectively. Dinucleotide composition provides stability of nucleic acids via strong base-stacking in ApG dinucleotides. In relation to coevolution of nucleic acids and proteins, thermostability-related demands on the amino acid composition affect the nucleotide content in the second codon position in Archaea.

Molecular mechanisms of adaptation emerging from the physics and evolution of nucleic acids and proteins

PubMed Central

Goncearenco, Alexander; Ma, Bin-Guang; Berezovsky, Igor N.

2014-01-01

DNA, RNA and proteins are major biological macromolecules that coevolve and adapt to environments as components of one highly interconnected system. We explore here sequence/structure determinants of mechanisms of adaptation of these molecules, links between them, and results of their mutual evolution. We complemented statistical analysis of genomic and proteomic sequences with folding simulations of RNA molecules, unraveling causal relations between compositional and sequence biases reflecting molecular adaptation on DNA, RNA and protein levels. We found many compositional peculiarities related to environmental adaptation and the life style. Specifically, thermal adaptation of protein-coding sequences in Archaea is characterized by a stronger codon bias than in Bacteria. Guanine and cytosine load in the third codon position is important for supporting the aerobic life style, and it is highly pronounced in Bacteria. The third codon position also provides a tradeoff between arginine and lysine, which are favorable for thermal adaptation and aerobicity, respectively. Dinucleotide composition provides stability of nucleic acids via strong base-stacking in ApG dinucleotides. In relation to coevolution of nucleic acids and proteins, thermostability-related demands on the amino acid composition affect the nucleotide content in the second codon position in Archaea. PMID:24371267

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms.

PubMed

Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro

2010-04-27

To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be caused by a recent human selection in rice breeding. The definition of pedigree haplotypes by means of genome-wide SNPs will facilitate next-generation breeding of rice and other crops.

Inferring Multiple Refugia and Phylogeographical Patterns in Pinus massoniana Based on Nucleotide Sequence Variation and DNA Fingerprinting

PubMed Central

Lin, Chung-Jian; Huang, Chi-Chung; Huang, Chao-Ching; Chiang, Yu-Chung; Chiang, Tzen-Yuh

2012-01-01

Background Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central–marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. Methodology/Principal Findings We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central–marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. Conclusions/Significance The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record. PMID:22952747

Leishmania tropica isolates from non-healed and healed patients in Iran: A molecular typing and phylogenetic analysis.

PubMed

Bamorovat, Mehdi; Sharifi, Iraj; Mohammadi, Mohammad Ali; Eybpoosh, Sana; Nasibi, Saeid; Aflatoonian, Mohammad Reza; Khosravi, Ahmad

2018-03-01

The precise identification of the parasite species causing leishmaniasis is essential for selecting proper treatment modality. The present study aims to compare the nucleotide variations of the ITS1, 7SL RNA, and Hsp70 sequences between non-healed and healed anthroponotic cutaneous leishmaniasis (ACL) patients in major foci in Iran. A case-control study was carried out from September 2015 to October 2016 in the cities of Kerman and Bam, in the southeast of Iran. Randomly selected skin-scraping lesions of 40 patients (20 non-healed and 20 healed) were examined and the organisms were grown in a culture medium. Promastigotes were collected by centrifugation and kept for further molecular examinations. The extracted DNA was amplified and sequenced. After global sequence alignment with BioEdit software, maximum likelihood phylogenetic analysis was performed in PhyML for typing of Leishmania isolates. Nucleotide composition of each genetic region was also compared between non-healed and healed patients. Our results showed that all isolates belonged to the Leishmania tropica complex, with their genetic composition in the ITS1 region being different among non-healed and healed patients. 7SL RNA and Hsp70 regions were genetically identical between both groups. Variability in nucleotide patterns observed between both groups in the ITS1 region may serve to encourage future research on the function of these polymorphisms and may improve our understanding of the role of parasite genome properties on patients' response to Leishmania treatment. Our results also do not support future use of 7SL RNA and Hsp70 regions of the parasite for comparative genomic analyses. Copyright © 2018 Elsevier Ltd. All rights reserved.

A computer aided thermodynamic approach for predicting the formation of Z-DNA in naturally occurring sequences

NASA Technical Reports Server (NTRS)

Ho, P. S.; Ellison, M. J.; Quigley, G. J.; Rich, A.

1986-01-01

The ease with which a particular DNA segment adopts the left-handed Z-conformation depends largely on the sequence and on the degree of negative supercoiling to which it is subjected. We describe a computer program (Z-hunt) that is designed to search long sequences of naturally occurring DNA and retrieve those nucleotide combinations of up to 24 bp in length which show a strong propensity for Z-DNA formation. Incorporated into Z-hunt is a statistical mechanical model based on empirically determined energetic parameters for the B to Z transition accumulated to date. The Z-forming potential of a sequence is assessed by ranking its behavior as a function of negative superhelicity relative to the behavior of similar sized randomly generated nucleotide sequences assembled from over 80,000 combinations. The program makes it possible to compare directly the Z-forming potential of sequences with different base compositions and different sequence lengths. Using Z-hunt, we have analyzed the DNA sequences of the bacteriophage phi X174, plasmid pBR322, the animal virus SV40 and the replicative form of the eukaryotic adenovirus-2. The results are compared with those previously obtained by others from experiments designed to locate Z-DNA forming regions in these sequences using probes which show specificity for the left-handed DNA conformation.

Estimating population genetic parameters and comparing model goodness-of-fit using DNA sequences with error

PubMed Central

Liu, Xiaoming; Fu, Yun-Xin; Maxwell, Taylor J.; Boerwinkle, Eric

2010-01-01

It is known that sequencing error can bias estimation of evolutionary or population genetic parameters. This problem is more prominent in deep resequencing studies because of their large sample size n, and a higher probability of error at each nucleotide site. We propose a new method based on the composite likelihood of the observed SNP configurations to infer population mutation rate θ = 4Neμ, population exponential growth rate R, and error rate ɛ, simultaneously. Using simulation, we show the combined effects of the parameters, θ, n, ɛ, and R on the accuracy of parameter estimation. We compared our maximum composite likelihood estimator (MCLE) of θ with other θ estimators that take into account the error. The results show the MCLE performs well when the sample size is large or the error rate is high. Using parametric bootstrap, composite likelihood can also be used as a statistic for testing the model goodness-of-fit of the observed DNA sequences. The MCLE method is applied to sequence data on the ANGPTL4 gene in 1832 African American and 1045 European American individuals. PMID:19952140

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Recoding method that removes inhibitory sequences and improves HIV gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rabadan, Raul; Krasnitz, Michael; Robins, Harlan

The invention relates to inhibitory nucleotide signal sequences or "INS" sequences in the genomes of lentiviruses. In particular the invention relates to the AGG motif present in all viral genomes. The AGG motif may have an inhibitory effect on a virus, for example by reducing the levels of, or maintaining low steady-state levels of, viral RNAs in host cells, and inducing and/or maintaining in viral latency. In one aspect, the invention provides vaccines that contain, or are produced from, viral nucleic acids in which the AGG sequences have been mutated. In another aspect, the invention provides methods and compositions formore » affecting the function of the AGG motif, and methods for identifying other INS sequences in viral genomes.« less

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

Fluorescent signatures for variable DNA sequences

PubMed Central

Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.

2012-01-01

Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Ab initio gene identification in metagenomic sequences

PubMed Central

Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark

2010-01-01

We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Population structure and genetic variability within isolates of Grapevine fanleaf virus from a naturally infected vineyard in France: evidence for mixed infection and recombination.

PubMed

Vigne, Emmanuelle; Bergdoll, Marc; Guyader, Sébastien; Fuchs, Marc

2004-08-01

The nematode-borne Grapevine fanleaf virus, from the genus Nepovirus in the family Comoviridae, causes severe degeneration of grapevines in most vineyards worldwide. We characterized 347 isolates from transgenic and conventional grapevines from two vineyard sites in the Champagne region of France for their molecular variant composition. The population structure and genetic diversity were examined in the coat protein gene by IC-RT-PCR-RFLP analysis with EcoRI and StyI, and nucleotide sequencing, respectively. RFLP data suggested that 55 % (191 of 347) of the isolates had a population structure consisting of one predominant variant. Sequencing data of 51 isolates representing the different restrictotypes confirmed the existence of mixed infection with a frequency of 33 % (17 of 51) and showed two major predominant haplotypes representing 71 % (60 of 85) of the sequence variants. Comparative nucleotide diversity among population subsets implied a lack of genetic differentiation according to host (transgenic vs conventional) or field site for most restrictotypes (17 of 18 and 13 of 18) and for haplotypes in most phylogenetic groups (seven of eight and six of eight), respectively. Interestingly, five of the 85 haplotypes sequenced had an intermediate divergence (0.036-0.066) between the lower (0.005-0.028) and upper range (0.083-0.138) of nucleotide variability, suggesting the occurrence of homologous RNA recombination. Sequence alignments clearly indicated a mosaic structure for four of these five variants, for which recombination sites were identified and parental lineages proposed. This is the first in-depth characterization of the population structure and genetic diversity in a nepovirus.

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

STUDIES ON ISOLATED NUCLEI. II. ISOLATION AND CHEMICAL CHARACTERIZATION OF NUCLEOLAR AND NUCLEOPLASMIC SUBFRACTIONS.

PubMed

MAGGIO, R; SIEKEVITZ, P; PALADE, G E

1963-08-01

This paper describes the subfractionation of nuclei isolated from guinea pig liver by the procedure presented in the first article of the series (8). Centrifugation in a density gradient system of nuclear fractions disrupted by sonication permits the isolation of the following subfractions: (a) a nucleolar subfraction which consists mainly of nucleoli surrounded by a variable amount of nucleolus-associated chromatin and contaminated by chromatin blocks derived primarily from von Kupffer cell nuclei; (b) and (c), two nucleoplasmic subfractions (I and II) which consist mainly of chromatin threads in a coarser (I) or finer (II) degree of fragmentation. The protein, RNA, and DNA content of these subfractions was determined, and their RNA's characterized in terms of NaCl-solubility, nucleotide composition, and in vivo nucleotide turnover, using inorganic (32)P as a marker. The results indicate that there are at least three types of RNA in the nucleus (one in the nucleolus and two in the nucleoplasm or chromatin), which differ from one another in NaCl-solubility, nucleotide composition, turnover, and possibly sequence. Possible relations among these RNA's and those of the cytoplasm are discussed.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Unsupervised discovery of microbial population structure within metagenomes using nucleotide base composition

PubMed Central

Saeed, Isaam; Tang, Sen-Lin; Halgamuge, Saman K.

2012-01-01

An approach to infer the unknown microbial population structure within a metagenome is to cluster nucleotide sequences based on common patterns in base composition, otherwise referred to as binning. When functional roles are assigned to the identified populations, a deeper understanding of microbial communities can be attained, more so than gene-centric approaches that explore overall functionality. In this study, we propose an unsupervised, model-based binning method with two clustering tiers, which uses a novel transformation of the oligonucleotide frequency-derived error gradient and GC content to generate coarse groups at the first tier of clustering; and tetranucleotide frequency to refine these groups at the secondary clustering tier. The proposed method has a demonstrated improvement over PhyloPythia, S-GSOM, TACOA and TaxSOM on all three benchmarks that were used for evaluation in this study. The proposed method is then applied to a pyrosequenced metagenomic library of mud volcano sediment sampled in southwestern Taiwan, with the inferred population structure validated against complementary sequencing of 16S ribosomal RNA marker genes. Finally, the proposed method was further validated against four publicly available metagenomes, including a highly complex Antarctic whale-fall bone sample, which was previously assumed to be too complex for binning prior to functional analysis. PMID:22180538

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

The full mitochondrial genome sequence of Raillietina tetragona from chicken (Cestoda: Davaineidae).

PubMed

Liang, Jian-Ying; Lin, Rui-Qing

2016-11-01

In the present study, the complete mitochondrial DNA (mtDNA) sequence of Raillietina tetragona was sequenced and its gene contents and genome organizations was compared with that of other tapeworm. The complete mt genome sequence of R. tetragona is 14,444 bp in length. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and two non-coding region. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T of the complete mt genome are 71.4% for R. tetragona. The R. tetragona mt genome sequence provides novel mtDNA marker for studying the molecular epidemiology and population genetics of Raillietina and has implications for the molecular diagnosis of chicken cestodosis caused by Raillietina.

Identification of protein-interacting nucleotides in a RNA sequence using composition profile of tri-nucleotides.

PubMed

Panwar, Bharat; Raghava, Gajendra P S

2015-04-01

The RNA-protein interactions play a diverse role in the cells, thus identification of RNA-protein interface is essential for the biologist to understand their function. In the past, several methods have been developed for predicting RNA interacting residues in proteins, but limited efforts have been made for the identification of protein-interacting nucleotides in RNAs. In order to discriminate protein-interacting and non-interacting nucleotides, we used various classifiers (NaiveBayes, NaiveBayesMultinomial, BayesNet, ComplementNaiveBayes, MultilayerPerceptron, J48, SMO, RandomForest, SMO and SVM(light)) for prediction model development using various features and achieved highest 83.92% sensitivity, 84.82 specificity, 84.62% accuracy and 0.62 Matthew's correlation coefficient by SVM(light) based models. We observed that certain tri-nucleotides like ACA, ACC, AGA, CAC, CCA, GAG, UGA, and UUU preferred in protein-interaction. All the models have been developed using a non-redundant dataset and are evaluated using five-fold cross validation technique. A web-server called RNApin has been developed for the scientific community (http://crdd.osdd.net/raghava/rnapin/). Copyright © 2015 Elsevier Inc. All rights reserved.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Composition bias and the origin of ORFan genes

PubMed Central

Yomtovian, Inbal; Teerakulkittipong, Nuttinee; Lee, Byungkook; Moult, John; Unger, Ron

2010-01-01

Motivation: Intriguingly, sequence analysis of genomes reveals that a large number of genes are unique to each organism. The origin of these genes, termed ORFans, is not known. Here, we explore the origin of ORFan genes by defining a simple measure called ‘composition bias’, based on the deviation of the amino acid composition of a given sequence from the average composition of all proteins of a given genome. Results: For a set of 47 prokaryotic genomes, we show that the amino acid composition bias of real proteins, random ‘proteins’ (created by using the nucleotide frequencies of each genome) and ‘proteins’ translated from intergenic regions are distinct. For ORFans, we observed a correlation between their composition bias and their relative evolutionary age. Recent ORFan proteins have compositions more similar to those of random ‘proteins’, while the compositions of more ancient ORFan proteins are more similar to those of the set of all proteins of the organism. This observation is consistent with an evolutionary scenario wherein ORFan genes emerged and underwent a large number of random mutations and selection, eventually adapting to the composition preference of their organism over time. Contact: ron@biocoml.ls.biu.ac.il Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20231229

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Comparative chloroplast genomics: Analyses including new sequencesfrom the angiosperms Nuphar advena and Ranunculus macranthus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raubeso, Linda A.; Peery, Rhiannon; Chumley, Timothy W.

2007-03-01

The number of completely sequenced plastid genomes available is growing rapidly. This new array of sequences presents new opportunities to perform comparative analyses. In comparative studies, it is most useful to compare across wide phylogenetic spans and, within angiosperms, to include representatives from basally diverging lineages such as the new genomes reported here: Nuphar advena (from a basal-most lineage) and Ranunculus macranthus (from the basal group of eudicots). We report these two new plastid genome sequences and make comparisons (within angiosperms, seed plants, or all photosynthetic lineages) to evaluate features such as the status of ycf15 and ycf68 as proteinmore » coding genes, the distribution of simple sequence repeats (SSRs) and longer dispersed repeats (SDR), and patterns of nucleotide composition.« less

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

ISRNA: an integrative online toolkit for short reads from high-throughput sequencing data.

PubMed

Luo, Guan-Zheng; Yang, Wei; Ma, Ying-Ke; Wang, Xiu-Jie

2014-02-01

Integrative Short Reads NAvigator (ISRNA) is an online toolkit for analyzing high-throughput small RNA sequencing data. Besides the high-speed genome mapping function, ISRNA provides statistics for genomic location, length distribution and nucleotide composition bias analysis of sequence reads. Number of reads mapped to known microRNAs and other classes of short non-coding RNAs, coverage of short reads on genes, expression abundance of sequence reads as well as some other analysis functions are also supported. The versatile search functions enable users to select sequence reads according to their sub-sequences, expression abundance, genomic location, relationship to genes, etc. A specialized genome browser is integrated to visualize the genomic distribution of short reads. ISRNA also supports management and comparison among multiple datasets. ISRNA is implemented in Java/C++/Perl/MySQL and can be freely accessed at http://omicslab.genetics.ac.cn/ISRNA/.

Detecting the borders between coding and non-coding DNA regions in prokaryotes based on recursive segmentation and nucleotide doublets statistics

PubMed Central

2012-01-01

Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225

High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

PubMed Central

Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

2015-01-01

The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

The complete mitochondrial genome of the stomatopod crustacean Squilla mantis

PubMed Central

Cook, Charles E

2005-01-01

Background Animal mitochondrial genomes are physically separate from the much larger nuclear genomes and have proven useful both for phylogenetic studies and for understanding genome evolution. Within the phylum Arthropoda the subphylum Crustacea includes over 50,000 named species with immense variation in body plans and habitats, yet only 23 complete mitochondrial genomes are available from this subphylum. Results I describe here the complete mitochondrial genome of the crustacean Squilla mantis (Crustacea: Malacostraca: Stomatopoda). This 15994-nucleotide genome, the first described from a hoplocarid, contains the standard complement of 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, and a non-coding AT-rich region that is found in most other metazoans. The gene order is identical to that considered ancestral for hexapods and crustaceans. The 70% AT base composition is within the range described for other arthropods. A single unusual feature of the genome is a 230 nucleotide non-coding region between a serine transfer RNA and the nad1 gene, which has no apparent function. I also compare gene order, nucleotide composition, and codon usage of the S. mantis genome and eight other malacostracan crustaceans. A translocation of the histidine transfer RNA gene is shared by three taxa in the order Decapoda, infraorder Brachyura; Callinectes sapidus, Portunus trituberculatus and Pseudocarcinus gigas. This translocation may be diagnostic for the Brachyura. For all nine taxa nucleotide composition is biased towards AT-richness, as expected for arthropods, and is within the range reported for other arthropods. Codon usage is biased, and much of this bias is probably due to the skew in nucleotide composition towards AT-richness. Conclusion The mitochondrial genome of Squilla mantis contains one unusual feature, a 230 base pair non-coding region has so far not been described in any other malacostracan. Comparisons with other Malacostraca show that all nine genomes, like most other mitochondrial genomes, share a bias toward AT-richness and a related bias in codon usage. The nine malacostracans included in this analysis are not representative of the diversity of the class Malacostraca, and additional malacostracan sequences would surely reveal other unusual genomic features that could be useful in understanding mitochondrial evolution in this taxon. PMID:16091132

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Sequence, Structure, and Context Preferences of Human RNA Binding Proteins.

PubMed

Dominguez, Daniel; Freese, Peter; Alexis, Maria S; Su, Amanda; Hochman, Myles; Palden, Tsultrim; Bazile, Cassandra; Lambert, Nicole J; Van Nostrand, Eric L; Pratt, Gabriel A; Yeo, Gene W; Graveley, Brenton R; Burge, Christopher B

2018-06-07

RNA binding proteins (RBPs) orchestrate the production, processing, and function of mRNAs. Here, we present the affinity landscapes of 78 human RBPs using an unbiased assay that determines the sequence, structure, and context preferences of these proteins in vitro by deep sequencing of bound RNAs. These data enable construction of "RNA maps" of RBP activity without requiring crosslinking-based assays. We found an unexpectedly low diversity of RNA motifs, implying frequent convergence of binding specificity toward a relatively small set of RNA motifs, many with low compositional complexity. Offsetting this trend, however, we observed extensive preferences for contextual features distinct from short linear RNA motifs, including spaced "bipartite" motifs, biased flanking nucleotide composition, and bias away from or toward RNA structure. Our results emphasize the importance of contextual features in RNA recognition, which likely enable targeting of distinct subsets of transcripts by different RBPs that recognize the same linear motif. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences

PubMed Central

Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

2016-01-01

The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species’ genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

PubMed Central

Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.

2014-01-01

In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853

Are mutagenic non D-loop direct repeat motifs in mitochondrial DNA under a negative selection pressure?

PubMed Central

Lakshmanan, Lakshmi Narayanan; Gruber, Jan; Halliwell, Barry; Gunawan, Rudiyanto

2015-01-01

Non D-loop direct repeats (DRs) in mitochondrial DNA (mtDNA) have been commonly implicated in the mutagenesis of mtDNA deletions associated with neuromuscular disease and ageing. Further, these DRs have been hypothesized to put a constraint on the lifespan of mammals and are under a negative selection pressure. Using a compendium of 294 mammalian mtDNA, we re-examined the relationship between species lifespan and the mutagenicity of such DRs. Contradicting the prevailing hypotheses, we found no significant evidence that long-lived mammals possess fewer mutagenic DRs than short-lived mammals. By comparing DR counts in human mtDNA with those in selectively randomized sequences, we also showed that the number of DRs in human mtDNA is primarily determined by global mtDNA properties, such as the bias in synonymous codon usage (SCU) and nucleotide composition. We found that SCU bias in mtDNA positively correlates with DR counts, where repeated usage of a subset of codons leads to more frequent DR occurrences. While bias in SCU and nucleotide composition has been attributed to nucleotide mutational bias, mammalian mtDNA still exhibit higher SCU bias and DR counts than expected from such mutational bias, suggesting a lack of negative selection against non D-loop DRs. PMID:25855815

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Prediction of siRNA potency using sparse logistic regression.

PubMed

Hu, Wei; Hu, John

2014-06-01

RNA interference (RNAi) can modulate gene expression at post-transcriptional as well as transcriptional levels. Short interfering RNA (siRNA) serves as a trigger for the RNAi gene inhibition mechanism, and therefore is a crucial intermediate step in RNAi. There have been extensive studies to identify the sequence characteristics of potent siRNAs. One such study built a linear model using LASSO (Least Absolute Shrinkage and Selection Operator) to measure the contribution of each siRNA sequence feature. This model is simple and interpretable, but it requires a large number of nonzero weights. We have introduced a novel technique, sparse logistic regression, to build a linear model using single-position specific nucleotide compositions which has the same prediction accuracy of the linear model based on LASSO. The weights in our new model share the same general trend as those in the previous model, but have only 25 nonzero weights out of a total 84 weights, a 54% reduction compared to the previous model. Contrary to the linear model based on LASSO, our model suggests that only a few positions are influential on the efficacy of the siRNA, which are the 5' and 3' ends and the seed region of siRNA sequences. We also employed sparse logistic regression to build a linear model using dual-position specific nucleotide compositions, a task LASSO is not able to accomplish well due to its high dimensional nature. Our results demonstrate the superiority of sparse logistic regression as a technique for both feature selection and regression over LASSO in the context of siRNA design.

Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species

PubMed Central

Di Giallonardo, Francesca; Schlub, Timothy E.; Shi, Mang

2017-01-01

ABSTRACT Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and whether dinucleotide composition can be used to accurately predict host species. Using a comparative analysis, we show that dinucleotide composition has a strong phylogenetic association across different RNA virus families, such that dinucleotide composition can predict the family from which a virus sequence has been isolated. Conversely, dinucleotide composition has a poorer predictive power for the different host species within a virus family and across different virus families, indicating that the host has a relatively small impact on the dinucleotide composition of a virus genome. PMID:28148785

Compositional searching of CpG islands in the human genome

NASA Astrophysics Data System (ADS)

Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

2005-06-01

We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

The complete mitochondrial genome of Cricetulus kamensis (Rodentia: Cricetidae).

PubMed

Kang, Chunlan; Yue, Hao; Liu, Mengyao; Huang, Ting; Liu, Yang; Zhang, Xiuyue; Yue, Bisong; Zeng, Tao; Liu, Shaoying

2016-01-01

The Cricetulus kamensis is endemic to China and is popular as pet. In the present study, the complete mitogenome of C. kamensis was first determined. It was 16,270 bp in length and the composition and arrangement of its genes are analogous to most other mammals. The overall base composition of heavy strand is 33.2% A, 26.8% T, 27.2% C and 12.7% G. The sequence is highly G-C poor (∼40%) and A is the most numerous nucleotide followed by T >C >G, which is similar to other mammalian mitochondrial genomes. It is notable that three extra bases "CAT" were inserted in cytb at the 3' end position and no stop codon was found for this coding region. The mitogenome sequence of C. kamensis could contribute to a better solution of its phylogenetic position and phylogenetic relationship within Cricetinae in the future.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Whole-genome analyses of DS-1-like human G2P[4] and G8P[4] rotavirus strains from Eastern, Western and Southern Africa

PubMed Central

Nyaga, Martin M.; Stucker, Karla M.; Esona, Mathew D.; Jere, Khuzwayo C.; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N.; Adolfine, Hokororo; Halpin, Rebecca A.; Roy, Sunando; Stockwell, Timothy B.; Berejena, Chipo; Seheri, Mapaseka L.; Mwenda, Jason M.; Steele, A. Duncan; Wentworth, David E.

2018-01-01

Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007–2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio’s clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7–100 % and 90.6–100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa. PMID:24952422

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

PubMed

Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

2016-10-01

As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment

DOE PAGES

Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...

2015-04-09

Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less

DNA Data Visualization (DDV): Software for Generating Web-Based Interfaces Supporting Navigation and Analysis of DNA Sequence Data of Entire Genomes.

PubMed

Neugebauer, Tomasz; Bordeleau, Eric; Burrus, Vincent; Brzezinski, Ryszard

2015-01-01

Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Complexity: an internet resource for analysis of DNA sequence complexity

PubMed Central

Orlov, Y. L.; Potapov, V. N.

2004-01-01

The search for DNA regions with low complexity is one of the pivotal tasks of modern structural analysis of complete genomes. The low complexity may be preconditioned by strong inequality in nucleotide content (biased composition), by tandem or dispersed repeats or by palindrome-hairpin structures, as well as by a combination of all these factors. Several numerical measures of textual complexity, including combinatorial and linguistic ones, together with complexity estimation using a modified Lempel–Ziv algorithm, have been implemented in a software tool called ‘Complexity’ (http://wwwmgs.bionet.nsc.ru/mgs/programs/low_complexity/). The software enables a user to search for low-complexity regions in long sequences, e.g. complete bacterial genomes or eukaryotic chromosomes. In addition, it estimates the complexity of groups of aligned sequences. PMID:15215465

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Clonal architecture of secondary acute myeloid leukemia defined by single-cell sequencing.

PubMed

Hughes, Andrew E O; Magrini, Vincent; Demeter, Ryan; Miller, Christopher A; Fulton, Robert; Fulton, Lucinda L; Eades, William C; Elliott, Kevin; Heath, Sharon; Westervelt, Peter; Ding, Li; Conrad, Donald F; White, Brian S; Shao, Jin; Link, Daniel C; DiPersio, John F; Mardis, Elaine R; Wilson, Richard K; Ley, Timothy J; Walter, Matthew J; Graubert, Timothy A

2014-07-01

Next-generation sequencing has been used to infer the clonality of heterogeneous tumor samples. These analyses yield specific predictions-the population frequency of individual clones, their genetic composition, and their evolutionary relationships-which we set out to test by sequencing individual cells from three subjects diagnosed with secondary acute myeloid leukemia, each of whom had been previously characterized by whole genome sequencing of unfractionated tumor samples. Single-cell mutation profiling strongly supported the clonal architecture implied by the analysis of bulk material. In addition, it resolved the clonal assignment of single nucleotide variants that had been initially ambiguous and identified areas of previously unappreciated complexity. Accordingly, we find that many of the key assumptions underlying the analysis of tumor clonality by deep sequencing of unfractionated material are valid. Furthermore, we illustrate a single-cell sequencing strategy for interrogating the clonal relationships among known variants that is cost-effective, scalable, and adaptable to the analysis of both hematopoietic and solid tumors, or any heterogeneous population of cells.

Phylogenetic Distribution of the Capsid Assembly Protein Gene (g20) of Cyanophages in Paddy Floodwaters in Northeast China

PubMed Central

Jing, Ruiyong; Liu, Junjie; Yu, Zhenhua; Liu, Xiaobing; Wang, Guanghua

2014-01-01

Numerous studies have revealed the high diversity of cyanophages in marine and freshwater environments, but little is currently known about the diversity of cyanophages in paddy fields, particularly in Northeast (NE) China. To elucidate the genetic diversity of cyanophages in paddy floodwaters in NE China, viral capsid assembly protein gene (g20) sequences from five floodwater samples were amplified with the primers CPS1 and CPS8. Denaturing gradient gel electrophoresis (DGGE) was applied to distinguish different g20 clones. In total, 54 clones differing in g20 nucleotide sequences were obtained in this study. Phylogenetic analysis showed that the distribution of g20 sequences in this study was different from that in Japanese paddy fields, and all the sequences were grouped into Clusters α, β, γ and ε. Within Clusters α and β, three new small clusters (PFW-VII∼-IX) were identified. UniFrac analysis of g20 clone assemblages demonstrated that the community compositions of cyanophage varied among marine, lake and paddy field environments. In paddy floodwater, community compositions of cyanophage were also different between NE China and Japan. PMID:24533125

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

The sequence and de novo assembly of the giant panda genome

PubMed Central

Li, Ruiqiang; Fan, Wei; Tian, Geng; Zhu, Hongmei; He, Lin; Cai, Jing; Huang, Quanfei; Cai, Qingle; Li, Bo; Bai, Yinqi; Zhang, Zhihe; Zhang, Yaping; Wang, Wen; Li, Jun; Wei, Fuwen; Li, Heng; Jian, Min; Li, Jianwen; Zhang, Zhaolei; Nielsen, Rasmus; Li, Dawei; Gu, Wanjun; Yang, Zhentao; Xuan, Zhaoling; Ryder, Oliver A.; Leung, Frederick Chi-Ching; Zhou, Yan; Cao, Jianjun; Sun, Xiao; Fu, Yonggui; Fang, Xiaodong; Guo, Xiaosen; Wang, Bo; Hou, Rong; Shen, Fujun; Mu, Bo; Ni, Peixiang; Lin, Runmao; Qian, Wubin; Wang, Guodong; Yu, Chang; Nie, Wenhui; Wang, Jinhuan; Wu, Zhigang; Liang, Huiqing; Min, Jiumeng; Wu, Qi; Cheng, Shifeng; Ruan, Jue; Wang, Mingwei; Shi, Zhongbin; Wen, Ming; Liu, Binghang; Ren, Xiaoli; Zheng, Huisong; Dong, Dong; Cook, Kathleen; Shan, Gao; Zhang, Hao; Kosiol, Carolin; Xie, Xueying; Lu, Zuhong; Zheng, Hancheng; Li, Yingrui; Steiner, Cynthia C.; Lam, Tommy Tsan-Yuk; Lin, Siyuan; Zhang, Qinghui; Li, Guoqing; Tian, Jing; Gong, Timing; Liu, Hongde; Zhang, Dejin; Fang, Lin; Ye, Chen; Zhang, Juanbin; Hu, Wenbo; Xu, Anlong; Ren, Yuanyuan; Zhang, Guojie; Bruford, Michael W.; Li, Qibin; Ma, Lijia; Guo, Yiran; An, Na; Hu, Yujie; Zheng, Yang; Shi, Yongyong; Li, Zhiqiang; Liu, Qing; Chen, Yanling; Zhao, Jing; Qu, Ning; Zhao, Shancen; Tian, Feng; Wang, Xiaoling; Wang, Haiyin; Xu, Lizhi; Liu, Xiao; Vinar, Tomas; Wang, Yajun; Lam, Tak-Wah; Yiu, Siu-Ming; Liu, Shiping; Zhang, Hemin; Li, Desheng; Huang, Yan; Wang, Xia; Yang, Guohua; Jiang, Zhi; Wang, Junyi; Qin, Nan; Li, Li; Li, Jingxiang; Bolund, Lars; Kristiansen, Karsten; Wong, Gane Ka-Shu; Olson, Maynard; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian; Wang, Jun

2013-01-01

Using next-generation sequencing technology alone, we have successfully generated and assembled a draft sequence of the giant panda genome. The assembled contigs (2.25 gigabases (Gb)) cover approximately 94% of the whole genome, and the remaining gaps (0.05 Gb) seem to contain carnivore-specific repeats and tandem repeats. Comparisons with the dog and human showed that the panda genome has a lower divergence rate. The assessment of panda genes potentially underlying some of its unique traits indicated that its bamboo diet might be more dependent on its gut microbiome than its own genetic composition. We also identified more than 2.7 million heterozygous single nucleotide polymorphisms in the diploid genome. Our data and analyses provide a foundation for promoting mammalian genetic research, and demonstrate the feasibility for using next-generation sequencing technologies for accurate, cost-effective and rapid de novo assembly of large eukaryotic genomes. PMID:20010809

A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

NASA Technical Reports Server (NTRS)

Winker, S.; Woese, C. R.

1991-01-01

The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

Complete genome sequence of a novel avian paramyxovirus isolated from wild birds in South Korea.

PubMed

Jeong, Jipseol; Kim, Youngsik; An, Injung; Wang, Seung-Jun; Kim, Yongkwan; Lee, Hyun-Jeong; Choi, Kang-Seuk; Im, Se-Pyeong; Min, Wongi; Oem, Jae-Ku; Jheong, Weonhwa

2018-01-01

A novel avian paramyxovirus (APMV), Cheonsu1510, was isolated from wild bird feces in South Korea and serologically and genetically characterized. In hemagglutination inhibition tests, antiserum against Cheonsu1510 showed low reactivity with other APMVs and vice versa. The complete genome of Cheonsu1510 comprised 15,408 nucleotides, contained six open reading frames (3'-N-P-M-F-HN-L-5'), and showed low sequence identity to other APMVs (< 63%) and a unique genomic composition. Phylogenetic analysis revealed that Cheonsu1510 was related to but distinct from APMV-1, -9, and -15. These results suggest that Cheonsu1510 represents a new APMV serotype, APMV-17.

The complete sequence of the mitochondrial genome of Arctic fox (Alopex lagopus).

PubMed

Yan, Shou-Qing; Guo, Peng-Cheng; Yue, Yuan; Li, Wan-Hong; Bai, Chun-Yan; Li, Yu-Mei; Sun, Jin-Hai; Zhao, Zhi-Hui

2016-11-01

In the present study, the complete mitochondrial genome sequence of Arctic fox (Alopex lagopus) was determined for the first time. It has a total length of 16,656 bp, and contains 13 protein-coding genes, 22 tRNA genes, 2 ribosome RNA genes and 1 control region. The nucleotide composition is 31.3% for A, 26.2% for C, 14.8% for G and 27.7% for T, respectively. The D-loop region located between tRNA Pro and tRNA Phe contains a (ACACGTACACGCAT) 18 tandem repeat array. The data will be useful for the investigation of the genetic structure and diversity in the natural and farmed population of Arctic foxes.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.

PubMed

Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth

2015-04-09

The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

Conservation/Mutation in the Splice Sites of Mitochondrial Solute Carrier Genes of Vertebrates.

PubMed

Calvello, Rosa; Panaro, Maria A; Salvatore, Rosaria; Mitolo, Vincenzo; Cianciulli, Antonia

2016-10-01

The "canonical" introns begin by the dinucleotide GT and end by the dinucleotide AG. GT, together with a few downstream nucleotides, and AG, with a few of the immediately preceding nucleotides, are thought to be the strongest splicing signals (5'ss and 3'ss, respectively). We examined the composition of the intronic initial and terminal hexanucleotides of the mitochondrial solute carrier genes (SLC25A's) of zebrafish, chicken, mouse, and human. These genes are orthologous and we selected the transcripts in which the arrangement of exons and introns was superimposable in the species considered. Both 5'ss and 3'ss were highly polymorphic, with 104 and 126 different configurations, respectively, in our sample. In the line of evolution from zebrafish to chicken, as well as in that from zebrafish to mammals, the average nucleotide conservation in the four variable nucleotides was about 50 % at 5' and 40 % at 3'. In the divergent evolution of mouse and human, the conservation was about 80 % at 5' and 70 % at 3'. Despite these changes, the splicing signals remain strong enough to operate at the same site. At both 5' and 3', the frequency of a nucleotide at a given position in the zebrafish sequence is positively correlated with its conservation in chicken and mammals, suggesting that selection continued to operate in birds and mammals along similar lines.

Dinucleotide Composition in Animal RNA Viruses Is Shaped More by Virus Family than by Host Species.

PubMed

Di Giallonardo, Francesca; Schlub, Timothy E; Shi, Mang; Holmes, Edward C

2017-04-15

Viruses use the cellular machinery of their hosts for replication. It has therefore been proposed that the nucleotide and dinucleotide compositions of viruses should match those of their host species. If this is upheld, it may then be possible to use dinucleotide composition to predict the true host species of viruses sampled in metagenomic surveys. However, it is also clear that different taxonomic groups of viruses tend to have distinctive patterns of dinucleotide composition that may be independent of host species. To determine the relative strength of the effect of host versus virus family in shaping dinucleotide composition, we performed a comparative analysis of 20 RNA virus families from 15 host groupings, spanning two animal phyla and more than 900 virus species. In particular, we determined the odds ratios for the 16 possible dinucleotides and performed a discriminant analysis to evaluate the capability of virus dinucleotide composition to predict the correct virus family or host taxon from which it was isolated. Notably, while 81% of the data analyzed here were predicted to the correct virus family, only 62% of these data were predicted to their correct subphylum/class host and a mere 32% to their correct mammalian order. Similarly, dinucleotide composition has a weak predictive power for different hosts within individual virus families. We therefore conclude that dinucleotide composition is generally uniform within a virus family but less well reflects that of its host species. This has obvious implications for attempts to accurately predict host species from virus genome sequences alone. IMPORTANCE Determining the processes that shape virus genomes is central to understanding virus evolution and emergence. One question of particular importance is why nucleotide and dinucleotide frequencies differ so markedly between viruses. In particular, it is currently unclear whether host species or virus family has the biggest impact on dinucleotide frequencies and whether dinucleotide composition can be used to accurately predict host species. Using a comparative analysis, we show that dinucleotide composition has a strong phylogenetic association across different RNA virus families, such that dinucleotide composition can predict the family from which a virus sequence has been isolated. Conversely, dinucleotide composition has a poorer predictive power for the different host species within a virus family and across different virus families, indicating that the host has a relatively small impact on the dinucleotide composition of a virus genome. Copyright © 2017 American Society for Microbiology.

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Emergence of new types of Theileria orientalis in Australian cattle and possible cause of theileriosis outbreaks

PubMed Central

2011-01-01

Theileria parasites cause a benign infection of cattle in parts of Australia where they are endemic, but have, in recent years, been suspected of being responsible for a number of outbreaks of disease in cattle near the coast of New South Wales. The objective of this study was to identify and characterize the species of Theileria in cattle on six farms in New South Wales where disease outbreaks have occurred, and compare with Theileria from three disease-free farms in Queensland that is endemic for Theileria. Special reference was made to sub-typing of T. orientalis by type-specific PCR and sequencing of the small subunit (SSU) rRNA gene, and sequence analysis of the gene encoding a polymorphic merozoite/piroplasm surface protein (MPSP) that may be under immune selection. Nucleotide sequencing of SSU rRNA and MPSP genes revealed the presence of four Theileria genotypes: T. orientalis (buffeli), T. orientalis (ikeda), T. orientalis (chitose) and T. orientalis type 4 (MPSP) or type C (SSU rRNA). The majority of animals showed mixed infections while a few showed single infection. When MPSP nucleotide sequences were translated into amino acids, base transition did not change amino acid composition of the protein product, suggesting possible silent polymorphism. The occurrence of ikeda and type 4 (type C) previously not reported to occur and silent mutation is thought to have enhanced parasite evasion of the host immune response causing the outbreak. PMID:21338493

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

Complete mitochondrial genomes of the yellow-bellied slider turtle Trachemys scripta scripta and anoxia tolerant red-eared slider Trachemys scripta elegans.

PubMed

Yu, Danna; Fang, Xindong; Storey, Kenneth B; Zhang, Yongpu; Zhang, Jiayong

2016-05-01

The complete mitochondrial genomes of the yellow-bellied slider (Trachemys scripta scripta) and anoxia tolerant red-eared slider (Trachemys scripta elegans) turtles were sequenced to analyze gene arrangement. The complete mt genomes of T. s. scripta and elegans were circular molecules of 16,791 bp and 16,810 bp in length, respectively, and included an A + 1 frameshift insertion in ND3 and ND4L genes. The AT content of the overall base composition of scripta and elegans was 61.2%. Nucleotide sequence divergence of the mt-genome (p distance) between scripta and elegans was 0.4%. A detailed comparison between the mitochondrial genomes of the two subspecies is shown.

Mitochondrial genome of the tomato clownfish Amphiprion frenatus (Pomacentridae, Amphiprioninae).

PubMed

Ye, Le; Hu, Jing; Wu, Kaichang; Wang, Yu; Li, Jianlong

2016-01-01

The complete mitochondrial (mt) genome of the tomato clownfish Amphiprion frenatus was obtained in this study. The circular mtDNA molecule was 16,774 bp in size and the overall nucleotide composition of the H-strand was 29.72% A, 25.81% T, 15.38% G and 29.09% C, with an A + T bias. The complete mitogenome encoded 13 protein-coding genes, 2 rRNAs, 22 tRNAs and a control region (D-loop), with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. The D-loop included termination associated sequence (TAS), central conserved domain (CCD) and conserved sequence block (CSB), and was composed of 6 complete continuity tandem repeat units and an imperfect tandem repeat unit.

Symbiotic Bacteria Associated with Stomach Discs of Human Lice▿ †

PubMed Central

Sasaki-Fukatsu, Kayoko ; Koga, Ryuichi; Nikoh, Naruo; Yoshizawa, Kazunori; Kasai, Shinji; Mihara, Minoru; Kobayashi, Mutsuo; Tomita, Takashi; Fukatsu, Takema

2006-01-01

The symbiotic bacteria associated with the stomach disc, a large aggregate of bacteriocytes on the ventral side of the midgut, of human body and head lice were characterized. Molecular phylogenetic analysis of 16S rRNA gene sequences showed that the symbionts formed a distinct and well-defined clade in the Gammaproteobacteria. The sequences exhibited AT-biased nucleotide composition and accelerated molecular evolution. In situ hybridization revealed that in nymphs and adult males, the symbiont was localized in the stomach disc, while in adult females, the symbiont was not in the stomach disc but in the lateral oviducts and the posterior pole of the oocytes due to female-specific symbiont migration. We propose the designation “Candidatus Riesia pediculicola” for the louse symbionts. PMID:16950915

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Biochemical and Molecular Phylogenetic Study of Agriculturally Useful Association of a Nitrogen-Fixing Cyanobacterium and Nodule Sinorhizobium with Medicago sativa L.

PubMed Central

Karaushu, E. V.; Kravzova, T. R.; Vorobey, N. A.; Kiriziy, D. A.; Olkhovich, O. P.; Taran, N. Yu.; Kots, S. Ya.; Omarova, E.

2015-01-01

Seed inoculation with bacterial consortium was found to increase legume yield, providing a higher growth than the standard nitrogen treatment methods. Alfalfa plants were inoculated by mono- and binary compositions of nitrogen-fixing microorganisms. Their physiological and biochemical properties were estimated. Inoculation by microbial consortium of Sinorhizobium meliloti T17 together with a new cyanobacterial isolate Nostoc PTV was more efficient than the single-rhizobium strain inoculation. This treatment provides an intensification of the processes of biological nitrogen fixation by rhizobia bacteria in the root nodules and an intensification of plant photosynthesis. Inoculation by bacterial consortium stimulates growth of plant mass and rhizogenesis and leads to increased productivity of alfalfa and to improving the amino acid composition of plant leaves. The full nucleotide sequence of the rRNA gene cluster and partial sequence of the dinitrogenase reductase (nifH) gene of Nostoc PTV were deposited to GenBank (JQ259185.1, JQ259186.1). Comparison of these gene sequences of Nostoc PTV with all sequences present at the GenBank shows that this cyanobacterial strain does not have 100% identity with any organisms investigated previously. Phylogenetic analysis showed that this cyanobacterium clustered with high credibility values with Nostoc muscorum. PMID:26114100

Biochemical and Molecular Phylogenetic Study of Agriculturally Useful Association of a Nitrogen-Fixing Cyanobacterium and Nodule Sinorhizobium with Medicago sativa L.

PubMed

Karaushu, E V; Lazebnaya, I V; Kravzova, T R; Vorobey, N A; Lazebny, O E; Kiriziy, D A; Olkhovich, O P; Taran, N Yu; Kots, S Ya; Popova, A A; Omarova, E; Koksharova, O A

2015-01-01

Seed inoculation with bacterial consortium was found to increase legume yield, providing a higher growth than the standard nitrogen treatment methods. Alfalfa plants were inoculated by mono- and binary compositions of nitrogen-fixing microorganisms. Their physiological and biochemical properties were estimated. Inoculation by microbial consortium of Sinorhizobium meliloti T17 together with a new cyanobacterial isolate Nostoc PTV was more efficient than the single-rhizobium strain inoculation. This treatment provides an intensification of the processes of biological nitrogen fixation by rhizobia bacteria in the root nodules and an intensification of plant photosynthesis. Inoculation by bacterial consortium stimulates growth of plant mass and rhizogenesis and leads to increased productivity of alfalfa and to improving the amino acid composition of plant leaves. The full nucleotide sequence of the rRNA gene cluster and partial sequence of the dinitrogenase reductase (nifH) gene of Nostoc PTV were deposited to GenBank (JQ259185.1, JQ259186.1). Comparison of these gene sequences of Nostoc PTV with all sequences present at the GenBank shows that this cyanobacterial strain does not have 100% identity with any organisms investigated previously. Phylogenetic analysis showed that this cyanobacterium clustered with high credibility values with Nostoc muscorum.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.

PubMed

Mitra, Sanga; Das, Pijush; Samadder, Arpa; Das, Smarajit; Betai, Rupal; Chakrabarti, Jayprokas

2015-01-01

During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.

The mitochondrial genome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae).

PubMed

Xin, Tianrong; Li, Lei; Yao, Chengyi; Wang, Yayu; Zou, Zhiwen; Wang, Jing; Xia, Bin

2016-07-01

We present the complete mitogenome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae) in this article. The mitogenome was a circle molecular consisting of 15,286 nucleotides, 37 genes, and an A + T-rich region. The order of 37 genes was typical of insect mitochondrial DNA sequences described to date. The overall base composition of the genome is A (37.41%), T (42.80%), C (11.87%), and G (7.91%) with an A + T-rich hallmark as that of other invertebrate mitochondrial genomes. The start codon was mainly ATA in most of the mitochondrial protein-coding genes such as ND2, COI, ATP8, ND3, ND5, ND4, ND6, and ND1, but COII, ATP6, COIII, ND4L, and Cob genes employing ATG. The stop codon was TAA in all the protein-coding genes. The A + T region is located between 12S rRNA and tRNA(M)(et). The phylogenetic relationships of Lepidoptera species were constructed based on the nucleotides sequences of 13 PCGs of mitogenomes using the neighbor-joining method. The molecular-based phylogeny supported the traditional morphological classification on relationships within Lepidoptera species.

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

PubMed

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Structure and Evolution of Chlorate Reduction Composite Transposons

PubMed Central

Clark, Iain C.; Melnyk, Ryan A.; Engelbrektson, Anna; Coates, John D.

2013-01-01

ABSTRACT The genes for chlorate reduction in six bacterial strains were analyzed in order to gain insight into the metabolism. A newly isolated chlorate-reducing bacterium (Shewanella algae ACDC) and three previously isolated strains (Ideonella dechloratans, Pseudomonas sp. strain PK, and Dechloromarinus chlorophilus NSS) were genome sequenced and compared to published sequences (Alicycliphilus denitrificans BC plasmid pALIDE01 and Pseudomonas chloritidismutans AW-1). De novo assembly of genomes failed to join regions adjacent to genes involved in chlorate reduction, suggesting the presence of repeat regions. Using a bioinformatics approach and finishing PCRs to connect fragmented contigs, we discovered that chlorate reduction genes are flanked by insertion sequences, forming composite transposons in all four newly sequenced strains. These insertion sequences delineate regions with the potential to move horizontally and define a set of genes that may be important for chlorate reduction. In addition to core metabolic components, we have highlighted several such genes through comparative analysis and visualization. Phylogenetic analysis places chlorate reductase within a functionally diverse clade of type II dimethyl sulfoxide (DMSO) reductases, part of a larger family of enzymes with reactivity toward chlorate. Nucleotide-level forensics of regions surrounding chlorite dismutase (cld), as well as its phylogenetic clustering in a betaproteobacterial Cld clade, indicate that cld has been mobilized at least once from a perchlorate reducer to build chlorate respiration. PMID:23919996

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

The complete mitochondrial genome of Plodia interpunctella (Lepidoptera: Pyralidae) and comparison with other Pyraloidea insects.

PubMed

Liu, Qiu-Ning; Chai, Xin-Yue; Bian, Dan-Dan; Zhou, Chun-Lin; Tang, Bo-Ping

2016-01-01

The mitochondrial (mt) genome can provide important information for the understanding of phylogenetic relationships. The complete mt genome of Plodia interpunctella (Lepidoptera: Pyralidae) has been sequenced. The circular genome is 15 287 bp in size, encoding 13 protein-coding genes (PCGs), 2 rRNA genes, 22 tRNA genes, and a control region. The AT skew of this mt genome is slightly negative, and the nucleotide composition is biased toward A+T nucleotides (80.15%). All PCGs start with the typical ATN (ATA, ATC, ATG, and ATT) codons, except for the cox1 gene which may start with the CGA codon. Four of the 13 PCGs harbor the incomplete termination codon T or TA. All the tRNA genes are folded into the typical clover-leaf structure of mitochondrial tRNA, except for trnS1 (AGN) in which the DHU arm fails to form a stable stem-loop structure. The overlapping sequences are 35 bp in total and are found in seven different locations. A total of 240 bp of intergenic spacers are scattered in 16 regions. The control region of the mt genome is 327 bp in length and consisted of several features common to the sequenced lepidopteran insects. Phylogenetic analysis based on 13 PCGs using the Maximum Likelihood method shows that the placement of P. interpunctella was within the Pyralidae.

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

NASA Astrophysics Data System (ADS)

Berti, Lorenzo; Burley, Glenn A.

2008-02-01

Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

DOEpatents

Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

2007-12-04

The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

PubMed Central

2012-01-01

Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Alfalfa virus S, a new species in the family Alphaflexiviridae

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named alfalfa virus S (AVS) was discovered in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by high throughput sequenc...

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Molecular Characterization of an Avian Astrovirus

PubMed Central

Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

2000-01-01

Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

PubMed Central

Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

2014-01-01

Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

Sequence and phylogenetic analysis of chicken anaemia virus obtained from backyard and commercial chickens in Nigeria.

PubMed

Oluwayelu, D O; Todd, D; Olaleye, O D

2008-12-01

This work reports the first molecular analysis study of chicken anaemia virus (CAV) in backyard chickens in Africa using molecular cloning and sequence analysis to characterize CAV strains obtained from commercial chickens and Nigerian backyard chickens. Partial VP1 gene sequences were determined for three CAVs from commercial chickens and for six CAV variants present in samples from a backyard chicken. Multiple alignment analysis revealed that the 6% and 4% nucleotide diversity obtained respectively for the commercial and backyard chicken strains translated to only 2% amino acid diversity for each breed. Overall, the amino acid composition of Nigerian CAVs was found to be highly conserved. Since the partial VP1 gene sequence of two backyard chicken cloned CAV strains (NGR/CI-8 and NGR/CI-9) were almost identical and evolutionarily closely related to the commercial chicken strains NGR-1, and NGR-4 and NGR-5, respectively, we concluded that CAV infections had crossed the farm boundary.

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Vertebrate codon bias indicates a highly GC-rich ancestral genome.

PubMed

Nabiyouni, Maryam; Prakash, Ashwin; Fedorov, Alexei

2013-04-25

Two factors are thought to have contributed to the origin of codon usage bias in eukaryotes: 1) genome-wide mutational forces that shape overall GC-content and create context-dependent nucleotide bias, and 2) positive selection for codons that maximize efficient and accurate translation. Particularly in vertebrates, these two explanations contradict each other and cloud the origin of codon bias in the taxon. On the one hand, mutational forces fail to explain GC-richness (~60%) of third codon positions, given the GC-poor overall genomic composition among vertebrates (~40%). On the other hand, positive selection cannot easily explain strict regularities in codon preferences. Large-scale bioinformatic assessment, of nucleotide composition of coding and non-coding sequences in vertebrates and other taxa, suggests a simple possible resolution for this contradiction. Specifically, we propose that the last common vertebrate ancestor had a GC-rich genome (~65% GC). The data suggest that whole-genome mutational bias is the major driving force for generating codon bias. As the bias becomes prominent, it begins to affect translation and can result in positive selection for optimal codons. The positive selection can, in turn, significantly modulate codon preferences. Copyright © 2013 Elsevier B.V. All rights reserved.

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

PubMed

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

Productive mRNA stem loop-mediated transcriptional slippage: Crucial features in common with intrinsic terminators.

PubMed

Penno, Christophe; Sharma, Virag; Coakley, Arthur; O'Connell Motherway, Mary; van Sinderen, Douwe; Lubkowska, Lucyna; Kireeva, Maria L; Kashlev, Mikhail; Baranov, Pavel V; Atkins, John F

2015-04-21

Escherichia coli and yeast DNA-dependent RNA polymerases are shown to mediate efficient nascent transcript stem loop formation-dependent RNA-DNA hybrid realignment. The realignment was discovered on the heteropolymeric sequence T5C5 and yields transcripts lacking a C residue within a corresponding U5C4. The sequence studied is derived from a Roseiflexus insertion sequence (IS) element where the resulting transcriptional slippage is required for transposase synthesis. The stability of the RNA structure, the proximity of the stem loop to the slippage site, the length and composition of the slippage site motif, and the identity of its 3' adjacent nucleotides (nt) are crucial for transcripts lacking a single C. In many respects, the RNA structure requirements for this slippage resemble those for hairpin-dependent transcription termination. In a purified in vitro system, the slippage efficiency ranges from 5% to 75% depending on the concentration ratios of the nucleotides specified by the slippage sequence and the 3' nt context. The only previous proposal of stem loop mediated slippage, which was in Ebola virus expression, was based on incorrect data interpretation. We propose a mechanical slippage model involving the RNAP translocation state as the main motor in slippage directionality and efficiency. It is distinct from previously described models, including the one proposed for paramyxovirus, where following random movement efficiency is mainly dependent on the stability of the new realigned hybrid. In broadening the scope for utilization of transcription slippage for gene expression, the stimulatory structure provides parallels with programmed ribosomal frameshifting at the translation level.

The complete mitochondrial genome of domestic sheep, Ovis aries.

PubMed

Hu, Xiao-di; Gao, Li-zhi

2016-01-01

In this study, we report a complete mitochondrial (mt) genome sequence of the Texel ewe, Ovis aries. The total genome is 16,615 bp in length and its overall base composition was estimated to be 33.68% for A, 27.36% for T, 25.86% for C, and 13.10% for G indicating an AT-rich (61.04%) feature in the O. aries mtgenome. It contains a total of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and a control region (D-loop region). Comparisons with other publicly available sheep mitogenomes revealed a bunch of nucleotide diversity. This complete mitgenome sequence would enlarge useful genomic information for further studies on sheep evolution and domestication that will enhance germplasm conservation and breeding programs of O. aries.

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

Resolving the Complexity of Human Skin Metagenomes Using Single-Molecule Sequencing

PubMed Central

Tsai, Yu-Chih; Deming, Clayton; Segre, Julia A.; Kong, Heidi H.; Korlach, Jonas

2016-01-01

ABSTRACT Deep metagenomic shotgun sequencing has emerged as a powerful tool to interrogate composition and function of complex microbial communities. Computational approaches to assemble genome fragments have been demonstrated to be an effective tool for de novo reconstruction of genomes from these communities. However, the resultant “genomes” are typically fragmented and incomplete due to the limited ability of short-read sequence data to assemble complex or low-coverage regions. Here, we use single-molecule, real-time (SMRT) sequencing to reconstruct a high-quality, closed genome of a previously uncharacterized Corynebacterium simulans and its companion bacteriophage from a skin metagenomic sample. Considerable improvement in assembly quality occurs in hybrid approaches incorporating short-read data, with even relatively small amounts of long-read data being sufficient to improve metagenome reconstruction. Using short-read data to evaluate strain variation of this C. simulans in its skin community at single-nucleotide resolution, we observed a dominant C. simulans strain with moderate allelic heterozygosity throughout the population. We demonstrate the utility of SMRT sequencing and hybrid approaches in metagenome quantitation, reconstruction, and annotation. PMID:26861018

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Sequence specificity of the human mRNA N6-adenosine methylase in vitro.

PubMed Central

Harper, J E; Miceli, S M; Roberts, R J; Manley, J L

1990-01-01

N6-adenosine methylation is a frequent modification of mRNAs and their precursors, but little is known about the mechanism of the reaction or the function of the modification. To explore these questions, we developed conditions to examine N6-adenosine methylase activity in HeLa cell nuclear extracts. Transfer of the methyl group from S-[3H methyl]-adenosylmethionine to unlabeled random copolymer RNA substrates of varying ribonucleotide composition revealed a substrate specificity consistent with a previously deduced consensus sequence, Pu[G greater than A]AC[A/C/U]. 32-P labeled RNA substrates of defined sequence were used to examine the minimum sequence requirements for methylation. Each RNA was 20 nucleotides long, and contained either the core consensus sequence GGACU, or some variation of this sequence. RNAs containing GGACU, either in single or multiple copies, were good substrates for methylation, whereas RNAs containing single base substitutions within the GGACU sequence gave dramatically reduced methylation. These results demonstrate that the N6-adenosine methylase has a strict sequence specificity, and that there is no requirement for extended sequences or secondary structures for methylation. Recognition of this sequence does not require an RNA component, as micrococcal nuclease pretreatment of nuclear extracts actually increased methylation efficiency. Images PMID:2216767

DNA sequence-based comparative studies between non-extremophile and extremophile organisms with implications in exobiology

NASA Astrophysics Data System (ADS)

Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.

2008-08-01

We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

PubMed

Trotta, Edoardo

2016-05-17

The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

USDA-ARS?s Scientific Manuscript database

Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

The influence of specific neighboring bases on substitution bias in noncoding regions of the plant chloroplast genome.

PubMed

Morton, B R; Oberholzer, V M; Clegg, M T

1997-09-01

Substitutions occurring in noncoding sequences of the plant chloroplast genome violate the independence of sites that is assumed by substitution models in molecular evolution. The probability that a substitution at a site is a transversion, as opposed to a transition, increases significantly with increasing A + T content of the two adjacent nucleotides. In the present study, this dependency of substitutions on local context is examined further in a number of noncoding regions from the chloroplast genome of members of the grass family (Poaceae). Two features were examined; the influence of specific neighboring bases, as opposed to the general A + T content, on transversion proportion and an influence on substitutions by nucleotides other than the two immediately adjacent to the site of substitution. In both cases, a significant effect was found. In the case of specific nucleotides, transversion proportion is significantly higher at sites with a pyrimidine immediately 5' on either strand. Substitutions at sites of the type YNR, where N is the site of substitution, have the highest rate of transversion. This specific effect is secondary to the A + T content effect such that, in terms of proportion of substitutions that are transversions, the nucleotides are ranked T > A > C > G as to their effect when they are immediately 5' to the site of substitution. In the case of nucleotides other than the immediate neighbors, a significant influence on substitution dynamics is observed in the case where the two neighboring bases are both A and/or T. Thus, substitutions are primarily, but not exclusively, influenced by the composition of the two nucleotides that are immediately adjacent. These results indicate that the pattern of molecular evolution of the plant chloroplast genome is extremely complex as a result of a variety of inter-site dependencies.

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

The mitochondrial genome of Frankliniella intonsa: insights into the evolution of mitochondrial genomes at lower taxonomic levels in Thysanoptera.

PubMed

Yan, Dankan; Tang, Yunxia; Hu, Min; Liu, Fengquan; Zhang, Dongfang; Fan, Jiaqin

2014-10-01

Thrips is an ideal group for studying the evolution of mitochondrial (mt) genomes in the genus and family due to independent rearrangements within this order. The complete sequence of the mitochondrial DNA (mtDNA) of the flower thrips Frankliniella intonsa has been completed and annotated in this study. The circular genome is 15,215bp in length with an A+T content of 75.9% and contains the typical 37 genes and it has triplicate putative control regions. Nucleotide composition is A+T biased, and the majority of the protein-coding genes present opposite CG skew which is reflected by the nucleotide composition, codon and amino acid usage. Although the known thrips have massive gene rearrangements, it showed no reversal of strand asymmetry. Gene rearrangements have been found in the lower taxonomic levels of thrips. Three tRNA genes were translocated in the genus Frankliniella and eight tRNA genes in the family Thripidae. Although the gene arrangements of mt genomes of all three thrips species differ massively from the ancestral insect, they are all very similar to each other, indicating that there was a large rearrangement somewhere before the most recent common ancestor of these three species and very little genomic evolution or rearrangements after then. The extremely similar sequences among the CRs suggest that they are ongoing concerted evolution. Analyses of the up and downstream sequence of CRs reveal that the CR2 is actually the ancestral CR. The three CRs are in the same spot in each of the three thrips mt genomes which have the identical inverted genes. These characteristics might be obtained from the most recent common ancestor of this three thrips. Above observations suggest that the mt genomes of the three thrips keep a single massive rearrangement from the common ancestor and have low evolutionary rates among them. Copyright © 2014 Elsevier Inc. All rights reserved.

Detection of a single nucleotide polymorphism in the human alpha-lactalbumin gene: implications for human milk proteins.

PubMed

Chowanadisai, Winyoo; Kelleher, Shannon L; Nemeth, Jennifer F; Yachetti, Stephen; Kuhlman, Charles F; Jackson, Joan G; Davis, Anne M; Lien, Eric L; Lönnerdal, Bo

2005-05-01

Variability in the protein composition of breast milk has been observed in many women and is believed to be due to natural variation of the human population. Single nucleotide polymorphisms (SNPs) are present throughout the entire human genome, but the impact of this variation on human milk composition and biological activity and infant nutrition and health is unclear. The goals of this study were to characterize a variant of human alpha-lactalbumin observed in milk from a Filipino population by determining the location of the polymorphism in the amino acid and genomic sequences of alpha-lactalbumin. Milk and blood samples were collected from 20 Filipino women, and milk samples were collected from an additional 450 women from nine different countries. alpha-Lactalbumin concentration was measured by high-performance liquid chromatography (HPLC), and milk samples containing the variant form of the protein were identified with both HPLC and mass spectrometry (MS). The molecular weight of the variant form was measured by MS, and the location of the polymorphism was narrowed down by protein reduction, alkylation and trypsin digestion. Genomic DNA was isolated from whole blood, and the polymorphism location and subject genotype were determined by amplifying the entire coding sequence of human alpha-lactalbumin by PCR, followed by DNA sequencing. A variant form of alpha-lactalbumin was observed in HPLC chromatograms, and the difference in molecular weight was determined by MS (wild type=14,070 Da, variant=14,056 Da). Protein reduction and digestion narrowed the polymorphism between the 33rd and 77th amino acid of the protein. The genetic polymorphism was identified as adenine to guanine, which translates to a substitution from isoleucine to valine at amino acid 46. The frequency of variation was higher in milk from China, Japan and Philippines, which suggests that this polymorphism is most prevalent in Asia. There are SNPs in the genome for human milk proteins and their implications for protein bioactivity and infant nutrition need to be considered.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Context based computational analysis and characterization of ARS consensus sequences (ACS) of Saccharomyces cerevisiae genome.

PubMed

Singh, Vinod Kumar; Krishnamachari, Annangarachari

2016-09-01

Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS) requires an essential consensus sequence (ACS) for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC) denoted as ORC-ACS and non-replicating ACS sequences (nrACS), that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

Corallimorpharians are not “naked corals”: insights into relationships between Scleractinia and Corallimorpharia from phylogenomic analyses

PubMed Central

Lin, Mei Fang; Chou, Wen Hwa; Kitahara, Marcelo V.; Chen, Chao Lun Allen

2016-01-01

Calcification is one of the most distinctive traits of scleractinian corals. Their hard skeletons form the substratum of reef ecosystems and confer on corals their remarkable diversity of shapes. Corallimorpharians are non-calcifying, close relatives of scleractinian corals, and the evolutionary relationship between these two groups is key to understanding the evolution of calcification in the coral lineage. One pivotal question is whether scleractinians are a monophyletic group, paraphyly being an alternative possibility if corallimorpharians are corals that have lost their ability to calcify, as is implied by the “naked-coral” hypothesis. Despite major efforts, relationships between scleractinians and corallimorpharians remain equivocal and controversial. Although the complete mitochondrial genomes of a range of scleractinians and corallimorpharians have been obtained, heterogeneity in composition and evolutionary rates means that mitochondrial sequences are insufficient to understand the relationship between these two groups. To overcome these limitations, transcriptome data were generated for three representative corallimorpharians. These were used in combination with sequences available for a representative range of scleractinians to identify 291 orthologous single copy protein-coding nuclear markers. Unlike the mitochondrial sequences, these nuclear markers do not display any distinct compositional bias in their nucleotide or amino-acid sequences. A range of phylogenomic approaches congruently reveal a topology consistent with scleractinian monophyly and corallimorpharians as the sister clade of scleractinians. PMID:27761308

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Effect of restricted mobility on RNA content and nucleotide composition and on protein content in motoneurons of spinal cord anterior horns

NASA Technical Reports Server (NTRS)

Gorbunova, A. V.

1980-01-01

An investigation into the effect of hypokinesia on the ribonucleic acid (RNA) content, the nucleotide composition, and dynamics of protein content in the motoneuron of the rat spinal cord anterior horns is described. Methodology and findings are presented. The study results showed that the nucleotide composition of the total cellular RNA at all the studied periods of hypokinesia remained unchanged and is characteristic for the cytoplasmic, high polymer ribosomal RNA. This means that with a change in the functional state of the neuron the newly formed RNA of the nerve cell has the same composition of bases as the original RNA that belongs to the ribosomal type.

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Genotyping by Sequencing in Almond: SNP Discovery, Linkage Mapping, and Marker Design

PubMed Central

Goonetilleke, Shashi N.; March, Timothy J.; Wirthensohn, Michelle G.; Arús, Pere; Walker, Amanda R.; Mather, Diane E.

2017-01-01

In crop plant genetics, linkage maps provide the basis for the mapping of loci that affect important traits and for the selection of markers to be applied in crop improvement. In outcrossing species such as almond (Prunus dulcis Mill. D. A. Webb), application of a double pseudotestcross mapping approach to the F1 progeny of a biparental cross leads to the construction of a linkage map for each parent. Here, we report on the application of genotyping by sequencing to discover and map single nucleotide polymorphisms in the almond cultivars “Nonpareil” and “Lauranne.” Allele-specific marker assays were developed for 309 tag pairs. Application of these assays to 231 Nonpareil × Lauranne F1 progeny provided robust linkage maps for each parent. Analysis of phenotypic data for shell hardness demonstrated the utility of these maps for quantitative trait locus mapping. Comparison of these maps to the peach genome assembly confirmed high synteny and collinearity between the peach and almond genomes. The marker assays were applied to progeny from several other Nonpareil crosses, providing the basis for a composite linkage map of Nonpareil. Applications of the assays to a panel of almond clones and a panel of rootstocks used for almond production demonstrated the broad applicability of the markers and provide subsets of markers that could be used to discriminate among accessions. The sequence-based linkage maps and single nucleotide polymorphism assays presented here could be useful resources for the genetic analysis and genetic improvement of almond. PMID:29141988

iPro54-PseKNC: a sequence-based predictor for identifying sigma-54 promoters in prokaryote with pseudo k-tuple nucleotide composition

PubMed Central

Lin, Hao; Deng, En-Ze; Ding, Hui; Chen, Wei; Chou, Kuo-Chen

2014-01-01

The σ54 promoters are unique in prokaryotic genome and responsible for transcripting carbon and nitrogen-related genes. With the avalanche of genome sequences generated in the postgenomic age, it is highly desired to develop automated methods for rapidly and effectively identifying the σ54 promoters. Here, a predictor called ‘iPro54-PseKNC’ was developed. In the predictor, the samples of DNA sequences were formulated by a novel feature vector called ‘pseudo k-tuple nucleotide composition’, which was further optimized by the incremental feature selection procedure. The performance of iPro54-PseKNC was examined by the rigorous jackknife cross-validation tests on a stringent benchmark data set. As a user-friendly web-server, iPro54-PseKNC is freely accessible at http://lin.uestc.edu.cn/server/iPro54-PseKNC. For the convenience of the vast majority of experimental scientists, a step-by-step protocol guide was provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics that were presented in this paper just for its integrity. Meanwhile, we also discovered through an in-depth statistical analysis that the distribution of distances between the transcription start sites and the translation initiation sites were governed by the gamma distribution, which may provide a fundamental physical principle for studying the σ54 promoters. PMID:25361964

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

NASA Astrophysics Data System (ADS)

Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

2017-01-01

Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

Improved assemblies using a source-agnostic pipeline for MetaGenomic Assembly by Merging (MeGAMerge) of contigs

DOE PAGES

Scholz, Matthew; Lo, Chien -Chi; Chain, Patrick S. G.

2014-10-01

Assembly of metagenomic samples is a very complex process, with algorithms designed to address sequencing platform-specific issues, (read length, data volume, and/or community complexity), while also faced with genomes that differ greatly in nucleotide compositional biases and in abundance. To address these issues, we have developed a post-assembly process: MetaGenomic Assembly by Merging (MeGAMerge). We compare this process to the performance of several assemblers, using both real, and in-silico generated samples of different community composition and complexity. MeGAMerge consistently outperforms individual assembly methods, producing larger contigs with an increased number of predicted genes, without replication of data. MeGAMerge contigs aremore » supported by read mapping and contig alignment data, when using synthetically-derived and real metagenomic data, as well as by gene prediction analyses and similarity searches. Ultimately, MeGAMerge is a flexible method that generates improved metagenome assemblies, with the ability to accommodate upcoming sequencing platforms, as well as present and future assembly algorithms.« less

Characteristics and phylogenetic analysis of the complete mitochondrial genome of Cheilodactylus quadricornis (Perciformes, Cheilodactylidae).

PubMed

Wang, Aishuai; Sun, Yuena; Wu, Changwen

2016-11-01

The complete mitochondrial genome of the Cheilodactylus quadricornis was firstly determined in the present study. The mitochondrial genome of C. quadricornis is 16 521 nucleotides, comprising 13 protein-coding genes and 2 ribosomal RNA genes, 22 tRNA genes and 2 main non-coding regions (the control region and the origin of the light-strand replication). The overall base composition was T, 26.3%; C, 29.6%; A, 27.8% and G, 16.3%. The gene arrangement, base composition, and tRNA structures of the complete mitochondrial genome of C. quadricornis is similar to other teleosts. Only two central conserved sequence blocks (CSB-2 and CSB-3) were identified in the control region. In addition, the conserved motif 5'-GCCGG-3' was identified in the origin of light-strand replication of C. quadricornis. The complete mitochondrial genome of C. quadricornis was used to construct phylogenetic tree, which shows that C. quadricornis and C. variegatus clustered in a clade and formed a sister relationship. This mitogenome sequence data would play an important role in population genetics and phylogenetic analysis of the Cheilodactylidae.

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

Phenomenological Partial Specific Volumes for G-Quadruplex DNAs

PubMed Central

Hellman, Lance M.; Rodgers, David W.; Fried, Michael G.

2009-01-01

Accurate partial specific volume (ν̄) values are required for sedimentation velocity and sedimentation equilibrium analyses. For nucleic acids, the estimation of these values is complicated by the fact that ν̄ depends on base composition, secondary structure, solvation and the concentrations and identities of ions in the surrounding buffer. Here we describe sedimentation equilibrium measurements of the apparent isopotential partial specific volume φ′ for two G-quadruplex DNAs and a single-stranded DNA of similar molecular weight and base composition. The G-quadruplex DNAs are a 22 nucleotide fragment of the human telomere consensus sequence and a 27 nucleotide fragment from the human c-myc promoter. The single-stranded DNA is 26 nucleotides long and is designed to have low propensity to form secondary structures. Parallel measurements were made in buffers containing NaCl and in buffers containing KCl, spanning the range 0.09M ≤ [salt] ≤ 2.3M. Limiting values of φ′, extrapolated to [salt] = 0M, were: 22-mer (NaCl-form), 0.525 ± 0.004 mL/g; 22-mer (KCl-form), 0.531 ± 0.006 mL/g; 27-mer (NaCl-form), 0.548 ± 0.005 mL/g; 27-mer (KCl-form), 0.557 ± 0.006 mL/g; 26-mer (NaCl-form), 0.555 ± 0.004 mL/g; 26-mer (KCl-form), 0.564 ± 0.006 mL/g. Small changes in φ′ with [salt] suggest that large changes in counterion association or hydration are unlikely to take place over these concentration ranges. PMID:19238377

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

PubMed

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

A missense mutation in the vasopressin-neurophysin precursor gene cosegregates with human autosomal dominant neurohypophyseal diabetes insipidus.

PubMed Central

Bahnsen, U; Oosting, P; Swaab, D F; Nahke, P; Richter, D; Schmale, H

1992-01-01

Familial neurohypophyseal diabetes insipidus in humans is a rare disease transmitted as an autosomal dominant trait. Affected individuals have very low or undetectable levels of circulating vasopressin and suffer from polydipsia and polyuria. An obvious candidate gene for the disease is the vasopressin-neurophysin (AVP-NP) precursor gene on human chromosome 20. The 2 kb gene with three exons encodes a composite precursor protein consisting of the neuropeptide vasopressin and two associated proteins, neurophysin and a glycopeptide. Cloning and nucleotide sequence analysis of both alleles of the AVP-NP gene present in a Dutch ADNDI family reveals a point mutation in one allele of the affected family members. Comparison of the nucleotide sequences shows a G----T transversion within the neurophysin-encoding exon B. This missense mutation converts a highly conserved glycine (Gly17 of neurophysin) to a valine residue. RFLP analysis of six related family members indicates cosegregation of the mutant allele with the DI phenotype. The mutation is not present in 96 chromosomes of an unrelated control group. These data suggest that a single amino acid exchange within a highly conserved domain of the human vasopressin-associated neurophysin is the primary cause of one form of ADNDI. Images PMID:1740104

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species

PubMed Central

Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne

2012-01-01

Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761

New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species.

PubMed

Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne

2012-11-01

Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

DNA sequencing using polymerase substrate-binding kinetics

PubMed Central

Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

2015-01-01

Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

VarDetect: a nucleotide sequence variation exploratory tool

PubMed Central

Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

2008-01-01

Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Insight into pattern of codon biasness and nucleotide base usage in serotonin receptor gene family from different mammalian species.

PubMed

Dass, J Febin Prabhu; Sudandiradoss, C

2012-07-15

5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.

Effects of nutrition (herbivore vs carnivore) on energy charge and nucleotide composition in Hyas araneus larvae

NASA Astrophysics Data System (ADS)

Harms, J.

1992-03-01

Growth rate expressed as dry weight, elemetnal composition (C, N, H), protein content and nucleotide composition (ATP, ADP, AMP, CTP, GTP and UTP) as well as adenosine were measured in laboratory cultured Hyas araneus larvae fed two different diets. One group was fed freshly hatched Artemia sp. nauplii, the other the diatom Odontella (Biddulphia) sinensis. Growth rate was reduced in the O. sinensis-fed group, reaching 20 to 50% of the growth rate of Artemia-fed larvae. In all cases, some further development to the next instar occurred when larvae were fed O. sinensis, although at reduced levels compared to Artemia-fed larvae. The adenylic energy charge was quite similar for the two nutritional conditions tested and therefore does not reflect the reduced growth rate in O. sinensis-fed larvae. The individual nucleotide content was clearly reduced in O. sinensis-fed larvae, reflecting the nutritional conditions already during early developmental periods. These reduced amount of nucleotides in O. sinensis-fed larvae were most obvious when adenylic nucleotide contents were pooled. Pooled adenylic nucleotides were found to be correlated with the individual content of carbon and protein, showing significant differences at both nutritional conditions tested.

Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

PubMed

Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

2017-04-01

There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.

Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

PubMed Central

Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

1984-01-01

The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

PubMed

Wickersheim, Michelle L; Blumenstiel, Justin P

2013-11-01

A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

PubMed Central

Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

1993-01-01

The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

iRNA-2methyl: Identify RNA 2'-O-methylation Sites by Incorporating Sequence-Coupled Effects into General PseKNC and Ensemble Classifier.

PubMed

Qiu, Wang-Ren; Jiang, Shi-Yu; Sun, Bi-Qian; Xiao, Xuan; Cheng, Xiang; Chou, Kuo-Chen

2017-01-01

Being a kind of post-transcriptional modification (PTCM) in RNA, the 2'-Omethylation modification occurs in the processes of life development and disease formation as well. Accordingly, from the angles of both basic research and drug development, we are facing a challenging problem: given an uncharacterized RNA sequence formed by many nucleotides of A (adenine), C (cytosine), G (guanine), and U (uracil), which one can be of 2-O'-methylation modification, and which one cannot? Unfortunately, so far no computational method whatsoever has been developed to address such a problem. To fill this empty area, we propose a predictor called iRNA-2methyl. It is formed by incorporating a series of sequence-coupled factors into the general PseKNC (pseudo nucleotide composition), followed by fusing 12 basic random forest classifier into four ensemble predictors, with each aimed to identify the cases of A, C, G, and U along the RNA sequence concerned, respectively. Rigorous jackknife cross-validations have indicated that the success rates are very high (>93%). For the convenience of most experimental scientists, a user-friendly web-server for iRNA-2methyl has been established at http://www.jci-bioinfo.cn/iRNA-2methyl, by which users can easily obtain their desired results without the need to go through the complicated mathematical equations involved. The proposed predictor iRNA-2methyl will become a very useful bioinformatics tool for medicinal chemistry, helping to design effective drugs against the diseases related to the 2'-Omethylation modification. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Sequence Analysis of Mitochondrial Genome of Toxascaris leonina from a South China Tiger.

PubMed

Li, Kangxin; Yang, Fang; Abdullahi, A Y; Song, Meiran; Shi, Xianli; Wang, Minwei; Fu, Yeqi; Pan, Weida; Shan, Fang; Chen, Wu; Li, Guoqing

2016-12-01

Toxascaris leonina is a common parasitic nematode of wild mammals and has significant impacts on the protection of rare wild animals. To analyze population genetic characteristics of T. leonina from South China tiger, its mitochondrial (mt) genome was sequenced. Its complete circular mt genome was 14,277 bp in length, including 12 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 2 non-coding regions. The nucleotide composition was biased toward A and T. The most common start codon and stop codon were TTG and TAG, and 4 genes ended with an incomplete stop codon. There were 13 intergenic regions ranging 1 to 10 bp in size. Phylogenetically, T. leonina from a South China tiger was close to canine T. leonina . This study reports for the first time a complete mt genome sequence of T. leonina from the South China tiger, and provides a scientific basis for studying the genetic diversity of nematodes between different hosts.

The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paule Roth, M.; Malfroy, L.; Offer, C.

1995-07-20

Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

PubMed Central

Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

2006-01-01

A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

The complete mitochondrial genome of eastern lowland gorilla, Gorilla beringei graueri, and comparative mitochondrial genomics of Gorilla species.

PubMed

Hu, Xiao-di; Gao, Li-zhi

2016-01-01

In this study, we determined the complete mitochondrial (mt) genome of eastern lowland gorilla, Gorilla beringei graueri for the first time. The total genome was 16,416 bp in length. It contained a total of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and 1 control region (D-loop region). The base composition was A (30.88%), G (13.10%), C (30.89%) and T (25.13%), indicating that the percentage of A+T (56.01%) was higher than G+C (43.99%). Comparisons with the other publicly available Gorilla mitogenome showed the conservation of gene order and base compositions but a bunch of nucleotide diversity. This complete mitochondrial genome sequence will provide valuable genetic information for further studies on conservation genetics of eastern lowland gorilla.

UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.

PubMed

Modolo, Laurent; Lerat, Emmanuelle

2015-04-29

Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .

Structural and metabolic characterization of RNAs from rats with experimental Guerin tumor - I. Nucleotide composition of RNAs from the liver and tumor tissues of rats.

PubMed

Ratkiewicz, A; Galasinski, W

1976-01-01

The characteristics of the ribonucleic acids of Guerin tumor was the subject of this work. The effect of tumor development on the structure of the ribonucleic acids in the liver of tumor bearing rats was studied. Some differences of nucleotide compositions in RNAs isolated from subcellular fractions of liver of control and tumor bearing rats and of cancer tissue were observed. The nucleotide compositions of cancer nuclear RNA is distinctly different from liver RNA. The changes in primary structure of liver RNAs due by development of tumor in rats may be result of metabolic peculiarities of these RNAs.

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

PubMed Central

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

PubMed

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Nucleotide Sequence of the blaRTG-2 (CARB-5) Gene and Phylogeny of a New Group of Carbenicillinases

PubMed Central

Choury, Daniele; Szajnert, Marie-France; Joly-Guillou, Marie-Laure; Azibi, Kemal; Delpech, Marc; Paul, Gérard

2000-01-01

We determined the nucleotide sequence of the bla gene for the Acinetobacter calcoaceticus β-lactamase previously described as CARB-5. Alignment of the deduced amino acid sequence with those of known β-lactamases revealed that CARB-5 possesses an RTG triad in box VII, as described for the Proteus mirabilis GN79 enzyme, instead of the RSG consensus characteristic of the other carbenicillinases. Phylogenetic studies showed that these RTG enzymes constitute a new, separate group, possibly ancestors of the carbenicillinase family. PMID:10722515

Mosaic organization of DNA nucleotides

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

1994-01-01

Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

Asystasia mosaic Madagascar virus: a novel bipartite begomovirus infecting the weed Asystasia gangetica in Madagascar.

PubMed

De Bruyn, Alexandre; Harimalala, Mireille; Hoareau, Murielle; Ranomenjanahary, Sahondramalala; Reynaud, Bernard; Lefeuvre, Pierre; Lett, Jean-Michel

2015-06-01

Here, we describe for the first time the complete genome sequence of a new bipartite begomovirus in Madagascar isolated from the weed Asystasia gangetica (Acanthaceae), for which we propose the tentative name asystasia mosaic Madagascar virus (AMMGV). DNA-A and -B nucleotide sequences of AMMGV were only distantly related to known begomovirus sequence and shared highest nucleotide sequence identity of 72.9 % (DNA-A) and 66.9 % (DNA-B) with a recently described bipartite begomovirus infecting Asystasia sp. in West Africa. Phylogenetic analysis demonstrated that this novel virus from Madagascar belongs to a new lineage of Old World bipartite begomoviruses.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

PubMed

Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE PAGES

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco; ...

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

PubMed

Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

2015-01-01

Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less

Effects of transcriptional start site sequence and position on nucleotide-sensitive selection of alternative start sites at the pyrC promoter in Escherichia coli.

PubMed Central

Liu, J; Turnbough, C L

1994-01-01

In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.

PubMed Central

Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M

1990-01-01

African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139

Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

PubMed

M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

2007-12-01

Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.

3D RNA and functional interactions from evolutionary couplings

PubMed Central

Weinreb, Caleb; Riesselman, Adam; Ingraham, John B.; Gross, Torsten; Sander, Chris; Marks, Debora S.

2016-01-01

Summary Non-coding RNAs are ubiquitous, but the discovery of new RNA gene sequences far outpaces research on their structure and functional interactions. We mine the evolutionary sequence record to derive precise information about function and structure of RNAs and RNA-protein complexes. As in protein structure prediction, we use maximum entropy global probability models of sequence co-variation to infer evolutionarily constrained nucleotide-nucleotide interactions within RNA molecules, and nucleotide-amino acid interactions in RNA-protein complexes. The predicted contacts allow all-atom blinded 3D structure prediction at good accuracy for several known RNA structures and RNA-protein complexes. For unknown structures, we predict contacts in 160 non-coding RNA families. Beyond 3D structure prediction, evolutionary couplings help identify important functional interactions, e.g., at switch points in riboswitches and at a complex nucleation site in HIV. Aided by accelerating sequence accumulation, evolutionary coupling analysis can accelerate the discovery of functional interactions and 3D structures involving RNA. PMID:27087444

Deep learning of the regulatory grammar of yeast 5′ untranslated regions from 500,000 random sequences

PubMed Central

Groves, Benjamin; Kuchina, Anna; Rosenberg, Alexander B.; Jojic, Nebojsa; Fields, Stanley; Seelig, Georg

2017-01-01

Our ability to predict protein expression from DNA sequence alone remains poor, reflecting our limited understanding of cis-regulatory grammar and hampering the design of engineered genes for synthetic biology applications. Here, we generate a model that predicts the protein expression of the 5′ untranslated region (UTR) of mRNAs in the yeast Saccharomyces cerevisiae. We constructed a library of half a million 50-nucleotide-long random 5′ UTRs and assayed their activity in a massively parallel growth selection experiment. The resulting data allow us to quantify the impact on protein expression of Kozak sequence composition, upstream open reading frames (uORFs), and secondary structure. We trained a convolutional neural network (CNN) on the random library and showed that it performs well at predicting the protein expression of both a held-out set of the random 5′ UTRs as well as native S. cerevisiae 5′ UTRs. The model additionally was used to computationally evolve highly active 5′ UTRs. We confirmed experimentally that the great majority of the evolved sequences led to higher protein expression rates than the starting sequences, demonstrating the predictive power of this model. PMID:29097404

Assessing Diversity of DNA Structure-Related Sequence Features in Prokaryotic Genomes

PubMed Central

Huang, Yongjie; Mrázek, Jan

2014-01-01

Prokaryotic genomes are diverse in terms of their nucleotide and oligonucleotide composition as well as presence of various sequence features that can affect physical properties of the DNA molecule. We present a survey of local sequence patterns which have a potential to promote non-canonical DNA conformations (i.e. different from standard B-DNA double helix) and interpret the results in terms of relationships with organisms' habitats, phylogenetic classifications, and other characteristics. Our present work differs from earlier similar surveys not only by investigating a wider range of sequence patterns in a large number of genomes but also by using a more realistic null model to assess significant deviations. Our results show that simple sequence repeats and Z-DNA-promoting patterns are generally suppressed in prokaryotic genomes, whereas palindromes and inverted repeats are over-represented. Representation of patterns that promote Z-DNA and intrinsic DNA curvature increases with increasing optimal growth temperature (OGT), and decreases with increasing oxygen requirement. Additionally, representations of close direct repeats, palindromes and inverted repeats exhibit clear negative trends with increasing OGT. The observed relationships with environmental characteristics, particularly OGT, suggest possible evolutionary scenarios of structural adaptation of DNA to particular environmental niches. PMID:24408877

Telling apart Felidae and Ursidae from the distribution of nucleotides in mitochondrial DNA

NASA Astrophysics Data System (ADS)

Rovenchak, Andrij

2018-02-01

Rank-frequency distributions of nucleotide sequences in mitochondrial DNA are defined in a way analogous to the linguistic approach, with the highest-frequent nucleobase serving as a whitespace. For such sequences, entropy and mean length are calculated. These parameters are shown to discriminate the species of the Felidae (cats) and Ursidae (bears) families. From purely numerical values we are able to see in particular that giant pandas are bears while koalas are not. The observed linear relation between the parameters is explained using a simple probabilistic model. The approach based on the non-additive generalization of the Bose distribution is used to analyze the frequency spectra of the nucleotide sequences. In this case, the separation of families is not very sharp. Nevertheless, the distributions for Felidae have on average longer tails comparing to Ursidae.

MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.

PubMed

Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

2016-03-01

Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.

Forensically informative nucleotide sequencing (FINS) for the first time authentication of Indian Varanus species: implication in wildlife forensics and conservation.

PubMed

Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra

2017-11-01

Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.

High Degree of Interlaboratory Reproducibility of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Sequencing of Plasma Samples from Heavily Treated Patients

PubMed Central

Shafer, Robert W.; Hertogs, Kurt; Zolopa, Andrew R.; Warford, Ann; Bloor, Stuart; Betts, Bradley J.; Merigan, Thomas C.; Harrigan, Richard; Larder, Brendon A.

2001-01-01

We assessed the reproducibility of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and protease sequencing using cryopreserved plasma aliquots obtained from 46 heavily treated HIV-1-infected individuals in two laboratories using dideoxynucleotide sequencing. The rates of complete sequence concordance between the two laboratories were 99.1% for the protease sequence and 99.0% for the RT sequence. Approximately 90% of the discordances were partial, defined as one laboratory detecting a mixture and the second laboratory detecting only one of the mixture's components. Only 0.1% of the nucleotides were completely discordant between the two laboratories, and these were significantly more likely to occur in plasma samples with lower plasma HIV-1 RNA levels. Nucleotide mixtures were detected at approximately 1% of the nucleotide positions, and in every case in which one laboratory detected a mixture, the second laboratory either detected the same mixture or detected one of the mixture's components. The high rate of concordance in detecting mixtures and the fact that most discordances between the two laboratories were partial suggest that most discordances were caused by variation in sampling of the HIV-1 quasispecies by PCR rather than by technical errors in the sequencing process itself. PMID:11283081

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

RNAdualPF: software to compute the dual partition function with sample applications in molecular evolution theory.

PubMed

Garcia-Martin, Juan Antonio; Bayegan, Amir H; Dotu, Ivan; Clote, Peter

2016-10-19

RNA inverse folding is the problem of finding one or more sequences that fold into a user-specified target structure s 0 , i.e. whose minimum free energy secondary structure is identical to the target s 0 . Here we consider the ensemble of all RNA sequences that have low free energy with respect to a given target s 0 . We introduce the program RNAdualPF, which computes the dual partition function Z ∗ , defined as the sum of Boltzmann factors exp(-E(a,s 0 )/RT) of all RNA nucleotide sequences a compatible with target structure s 0 . Using RNAdualPF, we efficiently sample RNA sequences that approximately fold into s 0 , where additionally the user can specify IUPAC sequence constraints at certain positions, and whether to include dangles (energy terms for stacked, single-stranded nucleotides). Moreover, since we also compute the dual partition function Z ∗ (k) over all sequences having GC-content k, the user can require that all sampled sequences have a precise, specified GC-content. Using Z ∗ , we compute the dual expected energy 〈E ∗ 〉, and use it to show that natural RNAs from the Rfam 12.0 database have higher minimum free energy than expected, thus suggesting that functional RNAs are under evolutionary pressure to be only marginally thermodynamically stable. We show that C. elegans precursor microRNA (pre-miRNA) is significantly non-robust with respect to mutations, by comparing the robustness of each wild type pre-miRNA sequence with 2000 [resp. 500] sequences of the same GC-content generated by RNAdualPF, which approximately [resp. exactly] fold into the wild type target structure. We confirm and strengthen earlier findings that precursor microRNAs and bacterial small noncoding RNAs display plasticity, a measure of structural diversity. We describe RNAdualPF, which rapidly computes the dual partition function Z ∗ and samples sequences having low energy with respect to a target structure, allowing sequence constraints and specified GC-content. Using different inverse folding software, another group had earlier shown that pre-miRNA is mutationally robust, even controlling for compositional bias. Our opposite conclusion suggests a cautionary note that computationally based insights into molecular evolution may heavily depend on the software used. C/C++-software for RNAdualPF is available at http://bioinformatics.bc.edu/clotelab/RNAdualPF .

Begomoviruses infecting weeds in Cuba: increased host range and a novel virus infecting Sida rhombifolia.

PubMed

Fiallo-Olivé, Elvira; Navas-Castillo, Jesús; Moriones, Enrique; Martínez-Zubiaur, Yamila

2012-01-01

As a result of surveys conducted during the last few years to search for wild reservoirs of begomoviruses in Cuba, we detected a novel bipartite begomovirus, sida yellow mottle virus (SiYMoV), infecting Sida rhombifolia plants. The complete genome sequence was obtained, showing that DNA-A was 2622 nucleotides (nt) in length and that it was most closely related (87.6% nucleotide identity) to DNA-A of an isolate of sida golden mosaic virus (SiGMV) that infects snap beans (Phaseolus vulgaris) in Florida. The DNA-B sequence was 2600 nt in length and shared the highest nucleotide identity (75.1%) with corchorus yellow spot virus (CoYSV). Phylogenetic relationship analysis showed that both DNA components of SiYMoV were grouped in the Abutilon clade, along with begomoviruses from Florida and the Caribbean islands. We also present here the complete nucleotide sequence of a novel strain of sida yellow vein virus found infecting Malvastrum coromandelianum and an isolate of euphorbia mosaic virus that was found for the first time infecting Euphorbia heterophylla in Cuba.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

Comprehensive analysis of the T-cell receptor beta chain gene in rhesus monkey by high throughput sequencing

PubMed Central

Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui

2015-01-01

Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410

[The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

PubMed

Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

2011-02-01

To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

SNPGenie: estimating evolutionary parameters to detect natural selection using pooled next-generation sequencing data.

PubMed

Nelson, Chase W; Moncla, Louise H; Hughes, Austin L

2015-11-15

New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

PubMed

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

PubMed

Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

2004-03-01

We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

Traceability of Plant Diet Contents in Raw Cow Milk Samples

PubMed Central

Ponzoni, Elena; Mastromauro, Francesco; Gianì, Silvia; Breviario, Diego

2009-01-01

The use of molecular marker in the dairy sector is gaining large acceptance as a reliable diagnostic approach for food authenticity and traceability. Using a PCR approach, the rbcL marker, a chloroplast-based gene, was selected to amplify plant DNA fragments in raw cow milk samples collected from stock farms or bought on the Italian market. rbcL-specific DNA fragments could be found in total milk, as well as in the skimmed and the cream fractions. When the PCR amplified fragments were sent to sequence, the nucleotide composition of the chromatogram reflected the multiple contents of the polyphytic diet. PMID:22253982

The mitochondrial genomes of Campodea fragilis and C. lubbocki(Hexapoda: Diplura): high genetic divergence in a morphologically uniformtaxon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Podsiadlowski, L.; Carapelli, A.; Nardi, F.

2005-12-01

Mitochondrial genomes from two dipluran hexapods of the genus Campodea have been sequenced. Gene order is the same as in most other hexapods and crustaceans. Secondary structures of tRNAs reveal specific structural changes in tRNA-C, tRNA-R, tRNA-S1 and tRNA-S2. Comparative analyses of nucleotide and amino acid composition, as well as structural features of both ribosomal RNA subunits, reveal substantial differences among the analyzed taxa. Although the two Campodea species are morphologically highly uniform, genetic divergence is larger than expected, suggesting a long evolutionary history under stable ecological conditions.

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

37 CFR 41.37 - Appeal brief.

Code of Federal Regulations, 2011 CFR

2011-07-01

... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

37 CFR 41.37 - Appeal brief.

Code of Federal Regulations, 2010 CFR

2010-07-01

... limitation is described in the specification as filed. If there is a drawing or amino acid or nucleotide material sequence, and at least one limitation is illustrated in a drawing or amino acid or nucleotide...

Nucleotides Adjacent to the Ligand-Binding Pocket are Linked to Activity Tuning in the Purine Riboswitch

PubMed Central

Stoddard, Colby D.; Widmann, Jeremy; Trausch, Jeremiah J.; Marcano-Velázquez, Joan G.; Knight, Rob; Batey, Robert T.

2013-01-01

Direct sensing of intracellular metabolite concentrations by riboswitch RNAs provides an economical and rapid means to maintain metabolic homeostasis. Since many organisms employ the same class of riboswitch to control different genes or transcription units, it is likely that functional variation exists in riboswitches such that activity is tuned to meet cellular needs. Using a bioinformatic approach, we have identified a region of the purine riboswitch aptamer domain that displays conservation patterns linked to riboswitch activity. Aptamer domain compositions within this region can be divided into nine classes that display a spectrum of activities. Naturally occurring compositions in this region favor rapid association rate constants and slow dissociation rate constants for ligand binding. Using X-ray crystallography and chemical probing, we demonstrate that both the free and bound states are influenced by the composition of this region and that modest sequence alterations have a dramatic impact on activity. The introduction of non-natural compositions result in the inability to regulate gene expression in vivo, suggesting that aptamer domain activity is highly plastic and thus readily tunable to meet cellular needs. PMID:23485418

Genetic characterization of L-Zagreb mumps vaccine strain.

PubMed

Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

2005-04-01

Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

PubMed

Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

2011-09-01

Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.

PubMed

Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H

2017-04-15

Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.

Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification

PubMed Central

Sinclair, Robert M.; Ravantti, Janne J.

2017-01-01

ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979

Dynamics of actin evolution in dinoflagellates.

PubMed

Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

2011-04-01

Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

Genotyping by Sequencing in Almond: SNP Discovery, Linkage Mapping, and Marker Design.

PubMed

Goonetilleke, Shashi N; March, Timothy J; Wirthensohn, Michelle G; Arús, Pere; Walker, Amanda R; Mather, Diane E

2018-01-04

In crop plant genetics, linkage maps provide the basis for the mapping of loci that affect important traits and for the selection of markers to be applied in crop improvement. In outcrossing species such as almond ( Prunus dulcis Mill. D. A. Webb), application of a double pseudotestcross mapping approach to the F 1 progeny of a biparental cross leads to the construction of a linkage map for each parent. Here, we report on the application of genotyping by sequencing to discover and map single nucleotide polymorphisms in the almond cultivars "Nonpareil" and "Lauranne." Allele-specific marker assays were developed for 309 tag pairs. Application of these assays to 231 Nonpareil × Lauranne F 1 progeny provided robust linkage maps for each parent. Analysis of phenotypic data for shell hardness demonstrated the utility of these maps for quantitative trait locus mapping. Comparison of these maps to the peach genome assembly confirmed high synteny and collinearity between the peach and almond genomes. The marker assays were applied to progeny from several other Nonpareil crosses, providing the basis for a composite linkage map of Nonpareil. Applications of the assays to a panel of almond clones and a panel of rootstocks used for almond production demonstrated the broad applicability of the markers and provide subsets of markers that could be used to discriminate among accessions. The sequence-based linkage maps and single nucleotide polymorphism assays presented here could be useful resources for the genetic analysis and genetic improvement of almond. Copyright © 2018 Goonetilleke et al.

Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla.

PubMed

Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C

1999-08-05

The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Characterization of durum wheat high molecular weight glutenin subunits Bx20 and By20 sequences by a molecular and proteomic approach.

PubMed

Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania

2016-07-01

Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Open reading frames in a 4556 nucleotide sequence within MDV-1 BamHI-D DNA fragment: evidence for splicing of mRNA from a new viral glycoprotein gene.

PubMed

Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M

1994-01-01

A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.

Sequence Analysis of IncA/C and IncI1 Plasmids Isolated from Multidrug-Resistant Salmonella Newport Using Single-Molecule Real-Time Sequencing.

PubMed

Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong

2018-06-01

Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome sequences and provided possible spread mechanism of IncA/C plasmids in Salmonella Newport Lineage II.

The Complete Chloroplast and Mitochondrial Genome Sequences of Boea hygrometrica: Insights into the Evolution of Plant Organellar Genomes

PubMed Central

Wang, Xumin; Deng, Xin; Zhang, Xiaowei; Hu, Songnian; Yu, Jun

2012-01-01

The complete nucleotide sequences of the chloroplast (cp) and mitochondrial (mt) genomes of resurrection plant Boea hygrometrica (Bh, Gesneriaceae) have been determined with the lengths of 153,493 bp and 510,519 bp, respectively. The smaller chloroplast genome contains more genes (147) with a 72% coding sequence, and the larger mitochondrial genome have less genes (65) with a coding faction of 12%. Similar to other seed plants, the Bh cp genome has a typical quadripartite organization with a conserved gene in each region. The Bh mt genome has three recombinant sequence repeats of 222 bp, 843 bp, and 1474 bp in length, which divide the genome into a single master circle (MC) and four isomeric molecules. Compared to other angiosperms, one remarkable feature of the Bh mt genome is the frequent transfer of genetic material from the cp genome during recent Bh evolution. We also analyzed organellar genome evolution in general regarding genome features as well as compositional dynamics of sequence and gene structure/organization, providing clues for the understanding of the evolution of organellar genomes in plants. The cp-derived sequences including tRNAs found in angiosperm mt genomes support the conclusion that frequent gene transfer events may have begun early in the land plant lineage. PMID:22291979

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1997-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Large scale DNA microsequencing device

DOEpatents

Foote, Robert S.

1999-01-01

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

PubMed

Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

2016-07-01

The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

Complete nucleotide sequence of spring beauty latent virus, a bromovirus infectious to Arabidopsis thaliana.

PubMed

Fujisaki, K; Hagihara, F; Kaido, M; Mise, K; Okuno, T

2003-01-01

Spring beauty latent virus (SBLV), a bromovirus, systemically and efficiently infected Arabidopsis thaliana, whereas the well-studied bromoviruses brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV) did not infect and poorly infected A. thaliana, respectively. We constructed biologically active cDNA clones of SBLV genomic RNAs and determined their complete nucleotide sequences. Interestingly, SBLV RNA3 contains both the box B motif in the intercistronic region, as does BMV, and the subgenomic promoter-like sequence in the 5' noncoding region, as does CCMV. Sequence comparisons of SBLV, BMV, CCMV, and broad bean mottle virus demonstrated that SBLV is closely related to BMV and CCMV.

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1999-08-31

A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome.

PubMed Central

Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E

1985-01-01

The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815

A three-nucleotide helix I is sufficient for full activity of a hammerhead ribozyme: advantages of an asymmetric design.

PubMed Central

Tabler, M; Homann, M; Tzortzakaki, S; Sczakiel, G

1994-01-01

Trans-cleaving hammerhead ribozymes with long target-specific antisense sequences flanking the catalytic domain share some features with conventional antisense RNA and are therefore termed 'catalytic antisense RNAs'. Sequences 5' to the catalytic domain form helix I and sequences 3' to it form helix III when complexed with the target RNA. A catalytic antisense RNA of more than 400 nucleotides, and specific for the human immunodeficiency virus type 1 (HIV-1), was systematically truncated within the arm that constituted originally a helix I of 128 base pairs. The resulting ribozymes formed helices I of 13, 8, 5, 3, 2, 1 and 0 nucleotides, respectively, and a helix III of about 280 nucleotides. When their in vitro cleavage activity was compared with the original catalytic antisense RNA, it was found that a helix I of as little as three nucleotides was sufficient for full endonucleolytic activity. The catalytically active constructs inhibited HIV-1 replication about four-fold more effectively than the inactive ones when tested in human cells. A conventional hammerhead ribozyme having helices of just 8 nucleotides on either side failed to cleave the target RNA in vitro when tested under the conditions for catalytic antisense RNA. Cleavage activity could only be detected after heat-treatment of the ribozyme substrate mixture which indicates that hammerhead ribozymes with short arms do not associate as efficiently to the target RNA as catalytic antisense RNA. The requirement of just a three-nucleotide helix I allows simple PCR-based generation strategies for asymmetric hammerhead ribozymes. Advantages of an asymmetric design will be discussed. Images PMID:7937118

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

NASA Astrophysics Data System (ADS)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

Long-term excretion of vaccine-derived poliovirus by a healthy child.

PubMed

Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

2004-12-01

A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

The emergence and evolution of life in a "fatty acid world" based on quantum mechanics.

PubMed

Tamulis, Arvydas; Grigalavicius, Mantas

2011-02-01

Quantum mechanical based electron correlation interactions among molecules are the source of the weak hydrogen and Van der Waals bonds that are critical to the self-assembly of artificial fatty acid micelles. Life on Earth or elsewhere could have emerged in the form of self-reproducing photoactive fatty acid micelles, which gradually evolved into nucleotide-containing micelles due to the enhanced ability of nucleotide-coupled sensitizer molecules to absorb visible light. Comparison of the calculated absorption spectra of micelles with and without nucleotides confirmed this idea and supports the idea of the emergence and evolution of nucleotides in minimal cells of a so-called Fatty Acid World. Furthermore, the nucleotide-caused wavelength shift and broadening of the absorption pattern potentially gives these molecules an additional valuable role, other than a purely genetic one in the early stages of the development of life. From the information theory point of view, the nucleotide sequences in such micelles carry positional information providing better electron transport along the nucleotide-sensitizer chain and, in addition, providing complimentary copies of that information for the next generation. Nucleotide sequences, which in the first period of evolution of fatty acid molecules were useful just for better absorbance of the light in the longer wavelength region, later in the PNA or RNA World, took on the role of genetic information storage.

Isolation of a full-length CC-NBS-LRR resistance gene analog candidate from sugar pine showing low nucleotide diversity.

Treesearch

K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale

2006-01-01

The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBS–LRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...

Identification of largemouth bass virus in the introduced Northern Snakehead inhabiting the Chesapeake Bay watershed.

PubMed

Iwanowicz, L; Densmore, C; Hahn, C; McAllister, P; Odenkirk, J

2013-09-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Modular and configurable optimal sequence alignment software: Cola.

PubMed

Zamani, Neda; Sundström, Görel; Höppner, Marc P; Grabherr, Manfred G

2014-01-01

The fundamental challenge in optimally aligning homologous sequences is to define a scoring scheme that best reflects the underlying biological processes. Maximising the overall number of matches in the alignment does not always reflect the patterns by which nucleotides mutate. Efficiently implemented algorithms that can be parameterised to accommodate more complex non-linear scoring schemes are thus desirable. We present Cola, alignment software that implements different optimal alignment algorithms, also allowing for scoring contiguous matches of nucleotides in a nonlinear manner. The latter places more emphasis on short, highly conserved motifs, and less on the surrounding nucleotides, which can be more diverged. To illustrate the differences, we report results from aligning 14,100 sequences from 3' untranslated regions of human genes to 25 of their mammalian counterparts, where we found that a nonlinear scoring scheme is more consistent than a linear scheme in detecting short, conserved motifs. Cola is freely available under LPGL from https://github.com/nedaz/cola.

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.

PubMed

Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W

2016-01-01

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.

Identification of largemouth bass virus in the introduced Northern snakehead inhabiting the Cheasapeake Bay watershed

USGS Publications Warehouse

Iwanowicz, Luke R.; Densmore, Christine L.; Hahn, Cassidy M.; McAllister, Phillip; Odenkirk, John

2013-01-01

The Northern Snakehead Channa argus is an introduced species that now inhabits the Chesapeake Bay. During a preliminary survey for introduced pathogens possibly harbored by these fish in Virginia waters, a filterable agent was isolated from five specimens that produced cytopathic effects in BF-2 cells. Based on PCR amplification and partial sequencing of the major capsid protein (MCP), DNA polymerase (DNApol), and DNA methyltransferase (Mtase) genes, the isolates were identified as Largemouth Bass virus (LMBV). Nucleotide sequences of the MCP (492 bp) and DNApol (419 pb) genes were 100% identical to those of LMBV. The nucleotide sequence of the Mtase (206 bp) gene was 99.5% identical to that of LMBV, and the single nucleotide substitution did not lead to a predicted amino acid coding change. This is the first report of LMBV from the Northern Snakehead, and provides evidence that noncentrarchid fishes may be susceptible to this virus.

Systematically frameshifting by deletion of every 4th or 4th and 5th nucleotides during mitochondrial transcription: RNA self-hybridization regulates delRNA expression.

PubMed

Seligmann, Hervé

2016-01-01

In mitochondria, secondary structures punctuate post-transcriptional RNA processing. Recently described transcripts match the human mitogenome after systematic deletions of every 4th, respectively every 4th and 5th nucleotides, called delRNAs. Here I explore predicted stem-loop hairpin formation by delRNAs, and their associations with delRNA transcription and detected peptides matching their translation. Despite missing 25, respectively 40% of the nucleotides in the original sequence, del-transformed sequences form significantly more secondary structures than corresponding randomly shuffled sequences, indicating biological function, independently of, and in combination with, previously detected delRNA and thereof translated peptides. Self-hybridization decreases delRNA abundances, indicating downregulation. Systematic deletions of the human mitogenome reveal new, unsuspected coding and structural informations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

MSuPDA: A memory efficient algorithm for sequence alignment.

PubMed

Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

2015-01-16

Space complexity is a million dollar question in DNA sequence alignments. In this regards, MSuPDA (Memory Saving under Pushdown Automata) can help to reduce the occupied spaces in computer memory. Our proposed process is that Anchor Seed (AS) will be selected from given data set of Nucleotides base pairs for local sequence alignment. Quick Splitting (QS) techniques will separate the Anchor Seed from all the DNA genome segments. Selected Anchor Seed will be placed to pushdown Automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. Anchor Seed from input unit will be matched with the DNA genome segments from stack of PDA. Whatever matches, mismatches or Indel, of Nucleotides will be POP from the stack under the control of control unit of Pushdown Automata. During the POP operation on stack it will free the memory cell occupied by the Nucleotide base pair.

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

A novel HLA-B allele, B*5214, detected in a Taiwanese volunteer bone marrow donor using a sequence-based typing method.

PubMed

Chen, M J; Chu, C C; Shyr, M H; Lin, C L; Lin, P Y; Yang, K L

2010-02-01

HLA-B*5214, a novel rare allele of HLA-B*52 variant, was found in a Taiwanese volunteer bone marrow donor by sequence-based typing method. The sequence of B*5214 is identical to that of B*520101 in exon 2 but differs from B*520101 in exon 3 at nucleotide positions 419 A-->T and 435 A-->G. Alteration of these two nucleotides resulted an amino acid substitution at amino acid residue 116 Y-->F ( TAC-->TTC) and a silent exchange at residue 121 K-->K (AAA-->AAG).

Nucleotide sequencing and characterization of the genes encoding benzene oxidation enzymes of Pseudomonas putida.

PubMed Central

Irie, S; Doi, S; Yorifuji, T; Takagi, M; Yano, K

1987-01-01

The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed. Images PMID:3667527

Nucleotide sequence of the gene determining plasmid-mediated citrate utilization.

PubMed Central

Ishiguro, N; Sato, G

1985-01-01

The citrate utilization determinant from transposon Tn3411 has been cloned and sequenced, and its polypeptide products have been characterized in minicell experiments. The nucleotide sequence was determined for a 2,047-base-pair BglII restriction endonuclease fragment that includes the citrate determinant. This region contains an open reading frame that would encode a 431-amino-acid very hydrophobic polypeptide and which is preceded by a reasonable ribosomal binding site. However, the single polypeptide found in minicell experiments had an apparent molecular weight of 35,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2999087

Computational prediction of CRISPR cassettes in gut metagenome samples from Chinese type-2 diabetic patients and healthy controls.

PubMed

Mangericao, Tatiana C; Peng, Zhanhao; Zhang, Xuegong

2016-01-11

CRISPR has been becoming a hot topic as a powerful technique for genome editing for human and other higher organisms. The original CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats coupled with CRISPR-associated proteins) is an important adaptive defence system for prokaryotes that provides resistance against invading elements such as viruses and plasmids. A CRISPR cassette contains short nucleotide sequences called spacers. These unique regions retain a history of the interactions between prokaryotes and their invaders in individual strains and ecosystems. One important ecosystem in the human body is the human gut, a rich habitat populated by a great diversity of microorganisms. Gut microbiomes are important for human physiology and health. Metagenome sequencing has been widely applied for studying the gut microbiomes. Most efforts in metagenome study has been focused on profiling taxa compositions and gene catalogues and identifying their associations with human health. Less attention has been paid to the analysis of the ecosystems of microbiomes themselves especially their CRISPR composition. We conducted a preliminary analysis of CRISPR sequences in a human gut metagenomic data set of Chinese individuals of type-2 diabetes patients and healthy controls. Applying an available CRISPR-identification algorithm, PILER-CR, we identified 3169 CRISPR cassettes in the data, from which we constructed a set of 1302 unique repeat sequences and 36,709 spacers. A more extensive analysis was made for the CRISPR repeats: these repeats were submitted to a more comprehensive clustering and classification using the web server tool CRISPRmap. All repeats were compared with known CRISPRs in the database CRISPRdb. A total of 784 repeats had matches in the database, and the remaining 518 repeats from our set are potentially novel ones. The computational analysis of CRISPR composition based contigs of metagenome sequencing data is feasible. It provides an efficient approach for finding potential novel CRISPR arrays and for analysing the ecosystem and history of human microbiomes.

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

Comparative genome analysis of Alkhumra hemorrhagic fever virus with Kyasanur forest disease and tick-borne encephalitis viruses by the in silico approach.

PubMed

Palanisamy, Navaneethan; Akaberi, Dario; Lennerstrand, Johan; Lundkvist, Åke

2018-05-10

Alkhumra hemorrhagic fever virus (AHFV), a relatively new member of the Flaviviruses, was discovered in Saudi Arabia 23 years ago. AHFV is classified in the tick-borne encephalitis virus serocomplex, along with the Kyasanur forest disease virus (KFDV) and tick-borne encephalitis virus (TBEV). Currently, very little is known about the pathologies of AHFV. In this study, using the available genome information of AHFV, KFDV and TBEV, we have predicted and compared the following aspects of these viruses: evolution, nucleotide and protein compositions, recombination, codon frequency, substitution rate, N- and O-glycosylation sites, signal peptide and cleavage site, transmembrane region, secondary structure of 5' and 3' UTRs and RNA-RNA interactions. Additionally, we have modeled the 3D protease and RNA-dependent RNA polymerase structures for AHFV, KFDV and TBEV. Recombination analysis showed no evidence of recombination in the AHFV genome with that of either KFDV or TBEV, although single break point analysis showed that nucleotide position 7399 (in the NS4B) is a breakpoint location. AHFV, KFDV and TBEV are very similar in terms of codon frequency, the number of transmembrane regions, properties of the polyprotein, RNA-RNA interaction sequences, NS3 protease and NS5 polymerase structures and 5' UTR structure. Using genome sequences, we showed the similarities between these closely- related viruses on several different areas.

Implication of an Aldehyde Dehydrogenase Gene and a Phosphinothricin N-Acetyltransferase Gene in the Diversity of Pseudomonas cichorii Virulence

PubMed Central

Tanaka, Masayuki; Wali, Ullah Md; Nakayashiki, Hitoshi; Fukuda, Tatsuya; Mizumoto, Hiroyuki; Ohnishi, Kouhei; Kiba, Akinori; Hikichi, Yasufumi

2011-01-01

Pseudomonas cichorii harbors the hrp genes. hrp-mutants lose their virulence on eggplant but not on lettuce. A phosphinothricin N-acetyltransferase gene (pat) is located between hrpL and an aldehyde dehydrogenase gene (aldH) in the genome of P. cichorii. Comparison of nucleotide sequences and composition of the genes among pseudomonads suggests a common ancestor of hrp and pat between P. cichorii strains and P. viridiflava strains harboring the single hrp pathogenicity island. In contrast, phylogenetic diversification of aldH corresponded to species diversification amongst pseudomonads. In this study, the involvement of aldH and pat in P. cichorii virulence was analyzed. An aldH-deleted mutant (ΔaldH) and a pat-deleted mutant (Δpat) lost their virulence on eggplant but not on lettuce. P. cichorii expressed both genes in eggplant leaves, independent of HrpL, the transcriptional activator for the hrp. Inoculation into Asteraceae species susceptible to P. cichorii showed that the involvement of hrp, pat and aldH in P. cichorii virulence is independent of each other and has no relationship with the phylogeny of Asteraceae species based on the nucleotide sequences of ndhF and rbcL. It is thus thought that not only the hrp genes but also pat and aldH are implicated in the diversity of P. cichorii virulence on susceptible host plant species. PMID:24704843

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

PubMed Central

Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

2015-01-01

Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

SENCA: A Multilayered Codon Model to Study the Origins and Dynamics of Codon Usage

PubMed Central

Pouyet, Fanny; Bailly-Bechet, Marc; Mouchiroud, Dominique; Guéguen, Laurent

2016-01-01

Gene sequences are the target of evolution operating at different levels, including the nucleotide, codon, and amino acid levels. Disentangling the impact of those different levels on gene sequences requires developing a probabilistic model with three layers. Here we present SENCA (site evolution of nucleotides, codons, and amino acids), a codon substitution model that separately describes 1) nucleotide processes which apply on all sites of a sequence such as the mutational bias, 2) preferences between synonymous codons, and 3) preferences among amino acids. We argue that most synonymous substitutions are not neutral and that SENCA provides more accurate estimates of selection compared with more classical codon sequence models. We study the forces that drive the genomic content evolution, intraspecifically in the core genome of 21 prokaryotes and interspecifically for five Enterobacteria. We retrieve the existence of a universal mutational bias toward AT, and that taking into account selection on synonymous codon usage has consequences on the measurement of selection on nonsynonymous substitutions. We also confirm that codon usage bias is mostly driven by selection on preferred codons. We propose new summary statistics to measure the relative importance of the different evolutionary processes acting on sequences. PMID:27401173

E2FM: an encrypted and compressed full-text index for collections of genomic sequences.

PubMed

Montecuollo, Ferdinando; Schmid, Giovannni; Tagliaferri, Roberto

2017-09-15

Next Generation Sequencing (NGS) platforms and, more generally, high-throughput technologies are giving rise to an exponential growth in the size of nucleotide sequence databases. Moreover, many emerging applications of nucleotide datasets-as those related to personalized medicine-require the compliance with regulations about the storage and processing of sensitive data. We have designed and carefully engineered E 2 FM -index, a new full-text index in minute space which was optimized for compressing and encrypting nucleotide sequence collections in FASTA format and for performing fast pattern-search queries. E 2 FM -index allows to build self-indexes which occupy till to 1/20 of the storage required by the input FASTA file, thus permitting to save about 95% of storage when indexing collections of highly similar sequences; moreover, it can exactly search the built indexes for patterns in times ranging from few milliseconds to a few hundreds milliseconds, depending on pattern length. Source code is available at https://github.com/montecuollo/E2FM . ferdinando.montecuollo@unicampania.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Complete genome sequence of a new begomovirus associated with yellow mosaic disease of Hemidesmus indicus in India.

PubMed

Reddy, M Sreekanth; Kanakala, S; Srinivas, K P; Hema, M; Malathi, V G; Sreenivasulu, P

2014-05-01

The complete DNA A genome of a virus isolate associated with yellow mosaic disease of a medicinal plant, Hemidesmus indicus, from India was cloned and sequenced. The length of DNA A was 2825 nucleotides, 35 nucleotides longer than the unit genome of monopartite begomoviruses. Comparison of the nucleotide sequence of DNA A of the virus isolate with those of other begomoviruses showed maximum sequence identity of 69 % to DNA A of ageratum yellow vein China virus (AYVCNV; AJ558120) and 68 % with tomato yellow leaf curl virus- LBa4 (TYLCV; EF185318), and it formed a distinct clade in phylogenetic analysis. The genome organization of the present virus isolate was found to be similar to that of Old World monopartite begomoviruses. The genome was considered to be monopartite, because association of DNA B and β satellite DNA components was not detected. Based on its sequence identity (<70 %) to all other begomoviruses known to date and ICTV (International Committee on Taxonomy of Viruses) species demarcating criteria (<89 % identity), it is considered a member of a novel begomovirus species, and the tentative name "Hemidesmus yellow mosaic virus" (HeYMV) is proposed.

INFO-RNA--a server for fast inverse RNA folding satisfying sequence constraints.

PubMed

Busch, Anke; Backofen, Rolf

2007-07-01

INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/

INFO-RNA—a server for fast inverse RNA folding satisfying sequence constraints

PubMed Central

Busch, Anke; Backofen, Rolf

2007-01-01

INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/ PMID:17452349

alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

PubMed Central

Long, C M; Virolle, M J; Chang, S Y; Chang, S; Bibb, M J

1987-01-01

The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzyme to an inhibitor of mammalian alpha-amylases. The amino-terminal sequence of the extracellular enzyme was determined, revealing the presence of a typical signal peptide preceding the mature form of the alpha-amylase. Images PMID:3500166

Complete genome analysis of jasmine virus T from Jasminum sambac in China.

PubMed

Tang, Yajun; Gao, Fangluan; Yang, Zhen; Wu, Zujian; Yang, Liang

2016-07-01

The genome of a potyvirus (isolate JaVT_FZ) recovered from jasmine (Jasminum sambac L.) showing yellow ringspot symptoms in Fuzhou, China, was sequenced. JaVT_FZ is closely related to seven other potyviruses with completely sequenced genomes, with which it shares 66-70 % nucleotide and 52-56 % amino acid sequence identity. However, the coat protein (CP) gene shares 82-92 % nucleotide and 90-97 % amino acid sequence identity with those of two partially sequenced potyviruses, named jasmine potyvirus T (JaVT-jasmine) and jasmine yellow mosaic potyvirus (JaYMV-India), respectively. This suggests that JaVT_FZ, JaVT-jasmine and JaYMV-India should be regarded as members of a single potyvirus species, for which the name "Jasmine virus T" has priority.

Nucleotide sequence of the phosphoglycerate kinase gene from the extreme thermophile Thermus thermophilus. Comparison of the deduced amino acid sequence with that of the mesophilic yeast phosphoglycerate kinase.

PubMed Central

Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L

1988-01-01

Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437

Complete mitochondrial genome sequence from an endangered Indian snake, Python molurus molurus (Serpentes, Pythonidae).

PubMed

Dubey, Bhawna; Meganathan, P R; Haque, Ikramul

2012-07-01

This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.

Parsimony and Model-Based Analyses of Indels in Avian Nuclear Genes Reveal Congruent and Incongruent Phylogenetic Signals

PubMed Central

Yuri, Tamaki; Kimball, Rebecca T.; Harshman, John; Bowie, Rauri C. K.; Braun, Michael J.; Chojnowski, Jena L.; Han, Kin-Lan; Hackett, Shannon J.; Huddleston, Christopher J.; Moore, William S.; Reddy, Sushma; Sheldon, Frederick H.; Steadman, David W.; Witt, Christopher C.; Braun, Edward L.

2013-01-01

Insertion/deletion (indel) mutations, which are represented by gaps in multiple sequence alignments, have been used to examine phylogenetic hypotheses for some time. However, most analyses combine gap data with the nucleotide sequences in which they are embedded, probably because most phylogenetic datasets include few gap characters. Here, we report analyses of 12,030 gap characters from an alignment of avian nuclear genes using maximum parsimony (MP) and a simple maximum likelihood (ML) framework. Both trees were similar, and they exhibited almost all of the strongly supported relationships in the nucleotide tree, although neither gap tree supported many relationships that have proven difficult to recover in previous studies. Moreover, independent lines of evidence typically corroborated the nucleotide topology instead of the gap topology when they disagreed, although the number of conflicting nodes with high bootstrap support was limited. Filtering to remove short indels did not substantially reduce homoplasy or reduce conflict. Combined analyses of nucleotides and gaps resulted in the nucleotide topology, but with increased support, suggesting that gap data may prove most useful when analyzed in combination with nucleotide substitutions. PMID:24832669

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

PubMed

Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

2013-07-01

The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

Detection and characterization of hepatitis A virus circulating in Egypt.

PubMed

Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam

2017-07-01

Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

Variation in the Nucleotide Sequence of Cottontail Rabbit Papillomavirus a and b Subtypes Affects Wart Regression and Malignant Transformation and Level of Viral Replication in Domestic Rabbits

PubMed Central

Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise

2000-01-01

We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

2007-02-14

The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

Bellerophon: A program to detect chimeric sequences in multiple sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2003-12-23

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.

Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

1990-01-01

A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

Nucleotide sequence and further characterization of the Synechococcus sp. strain PCC 7002 recA gene: complementation of a cyanobacterial recA mutation by the Escherichia coli recA gene.

PubMed Central

Murphy, R C; Gasparich, G E; Bryant, D A; Porter, R D

1990-01-01

The nucleotide sequence and transcript initiation site of the Synechococcus sp. strain PCC 7002 recA gene have been determined. The deduced amino acid sequence of the RecA protein of this cyanobacterium is 56% identical and 73% similar to the Escherichia coli RecA protein. Northern (RNA) blot analysis indicates that the Synechococcus strain PCC 7002 recA gene is transcribed as a monocistronic transcript 1,200 bases in length. The 5' endpoint of the recA mRNA was mapped by primer extension by using synthetic oligonucleotides of 17 and 27 nucleotides as primers. The nucleotide sequence 5' to the mapped endpoint contained sequence motifs bearing a striking resemblance to the heat shock (sigma 32-specific) promoters of E. coli but did not contain sequences similar to the E. coli SOS operator recognized by the LexA repressor. An insertion mutation introduced into the recA locus of Synechococcus strain PCC 7002 via homologous recombination resulted in the formation of diploids carrying both mutant and wild-type recA alleles. A variety of growth regimens and transformation procedures failed to produce a recA Synechococcus strain PCC 7002 mutant. However, introduction into these diploid cells of the E. coli recA gene in trans on a biphasic shuttle vector resulted in segregation of the cyanobacterial recA alleles, indicating that the E. coli recA gene was able to provide a function required for growth of recA Synechococcus strain PCC 7002 cells. This interpretation is supported by the observation that the E. coli recA gene is maintained in these cells when antibiotic selection for the shuttle vector is removed. Images FIG. 3 FIG. 4 FIG. 6 PMID:2105307

Identification of phylogenetic position in the Chlamydiaceae family for Chlamydia strains released from monkeys and humans with chlamydial pathology.

PubMed

Karaulov, Alexander; Aleshkin, Vladimir; Slobodenyuk, Vladimir; Grechishnikova, Olga; Afanasyev, Stanislav; Lapin, Boris; Dzhikidze, Eteri; Nesvizhsky, Yuriy; Evsegneeva, Irina; Voropayeva, Elena; Afanasyev, Maxim; Aleshkin, Andrei; Metelskaya, Valeria; Yegorova, Ekaterina; Bayrakova, Alexandra

2010-01-01

Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S-23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S-23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga) have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration.

Complete genome sequence of maize yellow striate virus, a new cytorhabdovirus infecting maize and wheat crops in Argentina.

PubMed

Maurino, Fernanda; Dumón, Analía D; Llauger, Gabriela; Alemandri, Vanina; de Haro, Luis A; Mattio, M Fernanda; Del Vas, Mariana; Laguna, Irma Graciela; Giménez Pecci, María de la Paz

2018-01-01

A rhabdovirus infecting maize and wheat crops in Argentina was molecularly characterized. Through next-generation sequencing (NGS) of symptomatic leaf samples, the complete genome was obtained of two isolates of maize yellow striate virus (MYSV), a putative new rhabdovirus, differing by only 0.4% at the nucleotide level. The MYSV genome consists of 12,654 nucleotides for maize and wheat virus isolates, and shares 71% nucleotide sequence identity with the complete genome of barley yellow striate mosaic virus (BYSMV, NC028244). Ten open reading frames (ORFs) were predicted in the MYSV genome from the antigenomic strand and were compared with their BYSMV counterparts. The highest amino acid sequence identity of the MYSV and BYSMV proteins was 80% between the L proteins, and the lowest was 37% between the proteins 4. Phylogenetic analysis suggested that the MYSV isolates are new members of the genus Cytorhabdovirus, family Rhabdoviridae. Yellow striate, affecting maize and wheat crops in Argentina, is an emergent disease that presents a potential economic risk for these widely distributed crops.

[A new variant of the simian T-lymphotropic retrovirus type I (STLV-IF) in the Sukhumi colony of hamadryas baboons].

PubMed

Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A

1993-01-01

Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.

Reference genotype and exome data from an Australian Aboriginal population for health-based research

PubMed Central

Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.

2016-01-01

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114

Reference genotype and exome data from an Australian Aboriginal population for health-based research.

PubMed

Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M

2016-04-12

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.

Nonneutral mitochondrial DNA variation in humans and chimpanzees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nachman, M.W.; Aquadro, C.F.; Brown, W.M.

1996-03-01

We sequenced the NADH dehydrogenase subunit 3 (ND3) gene from a sample of 61 humans, five common chimpanzees, and one gorilla to test whether patterns of mitochondrial DNA (mtDNA) variation are consistent with a neutral model of molecular evolution. Within humans and within chimpanzees, the ratio of replacement to silent nucleotide substitutions was higher than observed in comparisons between species, contrary to neutral expectations. To test the generality of this result, we reanalyzed published human RFLP data from the entire mitochondrial genome. Gains of restriction sites relative to a known human mtDNA sequence were used to infer unambiguous nucleotide substitutions.more » We also compared the complete mtDNA sequences of three humans. Both the RFLP data and the sequence data reveal a higher ratio of replacement to silent nucleotide substitutions within humans than is seen between species. This pattern is observed at most or all human mitochondrial genes and is inconsistent with a strictly neutral model. These data suggest that many mitochondrial protein polymorphisms are slightly deleterious, consistent with studies of human mitochondrial diseases. 59 refs., 2 figs., 8 tabs.« less

Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

PubMed

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

2016-09-01

Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

Absence of ancient DNA in sub-fossil insect inclusions preserved in 'Anthropocene' Colombian copal.

PubMed

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L; Preziosi, Richard F; Brown, Terence A

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in 'Anthropocene' Colombian copal, dated to 'post-Bomb' and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal.

Absence of Ancient DNA in Sub-Fossil Insect Inclusions Preserved in ‘Anthropocene’ Colombian Copal

PubMed Central

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L.; Preziosi, Richard F.; Brown, Terence A.

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in ‘Anthropocene’ Colombian copal, dated to ‘post-Bomb’ and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal. PMID:24039876

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

Single nucleotide polymorphism discovery in cutthroat trout subspecies using genome reduction, barcoding, and 454 pyro-sequencing

PubMed Central

2012-01-01

Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies) and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and bioinformatic protocols were successfully implemented to identify 125 nuclear SNPs that are capable of differentiating most subspecies of cutthroat trout from one another. The ability to use this suite of SNPs to identify individuals of unknown genetic background to subspecies can be a valuable tool for management agencies in their efforts to evaluate the genetic structure of cutthroat trout populations prior to constructing and implementing conservation plans. PMID:23259499

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

Human jagged polypeptide, encoding nucleic acids and methods of use

DOEpatents

Li, Linheng; Hood, Leroy

2000-01-01

The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

Methods of diagnosing alagille syndrome

DOEpatents

Li, Linheng; Hood, Leroy; Krantz, Ian D.; Spinner, Nancy B.

2004-03-09

The present invention provides an isolated polypeptide exhibiting substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the polypeptide does not have the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. The invention further provides an isolated nucleic acid molecule containing a nucleotide sequence encoding substantially the same amino acid sequence as JAGGED, or an active fragment thereof, provided that the nucleotide sequence does not encode the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:6. Also provided herein is a method of inhibiting differentiation of hematopoietic progenitor cells by contacting the progenitor cells with an isolated JAGGED polypeptide, or active fragment thereof. The invention additionally provides a method of diagnosing Alagille Syndrome in an individual. The method consists of detecting an Alagille Syndrome disease-associated mutation linked to a JAGGED locus.

Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

[Identification and phylogenetic application of unique nucleotide sequence of nad7 intron2 in Rhodiola (Crassulaceae) species].

PubMed

Deng, Ke-Jun; Yang, Zu-Jun; Liu, Cheng; Zhao, Wei; Liu, Chang; Feng, Juan; Ren, Zheng-Long

2007-03-01

Genetic characterization of 9 populations of Rhodiola crenulata, R. fastigiata and R. sachalinensis (Crassulaceae) species from Sichuan and Jilin Provinces of China, was investigated using the conserved primer of nad7 intron 2. All PCR products about 800 bp long were shorter than other Crassulaceae plants, which were used as molecular markers to identify the Rhodiola species. The sequence of the products indicated that total exon of 53 bp and intron of 738 bp exhibit only 9 nucleotide variations. Blasting the nad7 sequences to GenBank and the phylogenetic analysis showed that the sequence of Rhodiola species was clusted independently, and the length was smaller than all the registered sequences of higher plants. The result suggests that the Rhiodola species had a unique sequence in this gene region, which might be related to the special growth condition.

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

Routine HLA-B genotyping with PCR-sequence-specific oligonucleotides detects a B*52 variant (B*5206).

PubMed

Hoelsch, K; Lenggeler, I; Pfannes, W; Knabe, H; Klein, H-G; Woelpl, A

2005-05-01

A new human leukocyte antigen (HLA)-B allele was found during routine typing of samples for a German unrelated bone marrow donor registry, the "Aktion Knochenmarkspende Bayern". After first interpretation of data of two independent low-resolution sequence-specific oligonucleotide typing tests, a B*51 variant was suggested. Further analysis via sequence-based typing identified the sequence as new B*52 allele. This new allele officially assigned as B*5206 differs from HLA-B*520102 by one nucleotide exchange in exon 2. The mutation is located at nucleotide position 274, at which a cytosine is substituted by a thymine leading to an amino acid change at protein position 67 from serine (TCC) to phenylalanine (TTC).

Large scale DNA microsequencing device

DOEpatents

Foote, R.S.

1997-08-26

A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

Isolates of viral hemorrhagic septicemia virus from North America and Europe can be detected and distinguished by DNA probes

USGS Publications Warehouse

Batts, W.N.; Arakawa, C.K.; Bernard, J.; Winton, J.R.

1993-01-01

Biotinylated DNA probes were constructed to hybndize with speclfic sequences within the messenger RNA (mRNA) of the nucleoprotein (N) gene of vlral hemorrhagic septicemia virus (VHSV) reference strains from Europe (07-71) and North Arnenca (Makah) Probes were synthesized that were complementary to (1) a 29-nucleotide sequence near the center of the N gene conlmon to both the 07-71 and Makah reference strains of the virus (2) a unique 28- nucleotide sequence that followed the open readng frame of the Makah N gene mRNA most of which was absent In the 07-71 strain, and (3) a 22-nucleobde sequence wthin the 07-71 N gene that had 6 nllsmatches \

Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China

NASA Astrophysics Data System (ADS)

Zhao, Sufen; He, Peimin

2011-11-01

The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was <1.20%. Eucheumatoideae algae cultivated in China consisted of three clades, K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.

Zn-metalloprotease sequences in extremophiles

NASA Astrophysics Data System (ADS)

Holden, T.; Dehipawala, S.; Golebiewska, U.; Cheung, E.; Tremberger, G., Jr.; Williams, E.; Schneider, P.; Gadura, N.; Lieberman, D.; Cheung, T.

2010-09-01

The Zn-metalloprotease family contains conserved amino acid structures such that the nucleotide fluctuation at the DNA level would exhibit correlated randomness as described by fractal dimension. A nucleotide sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. The structure's vibration modes can also be studied using a Gaussian Network Model. The vibration measure and fractal dimension values form a two-dimensional plot with a standard vector metric that can be used for comparison of structures. The preference for amino acid usage in extremophiles may suppress nucleotide fluctuations that could be analyzed in terms of fractal dimension and Shannon entropy. A protein level cold adaptation study of the thermolysin Zn-metalloprotease family using molecular dynamics simulation was reported recently and our results show that the associated nucleotide fluctuation suppression is consistent with a regression pattern generated from the sequences's fractal dimension and entropy values (R-square { 0.98, N =5). It was observed that cold adaptation selected for high entropy and low fractal dimension values. Extension to the Archaemetzincin M54 family in extremophiles reveals a similar regression pattern (R-square = 0.98, N = 6). It was observed that the metalloprotease sequences of extremely halophilic organisms possess high fractal dimension and low entropy values as compared with non-halophiles. The zinc atom is usually bonded to the histidine residue, which shows limited levels of vibration in the Gaussian Network Model. The variability of the fractal dimension and entropy for a given protein structure suggests that extremophiles would have evolved after mesophiles, consistent with the bias usage of non-prebiotic amino acids by extremophiles. It may be argued that extremophiles have the capacity to offer extinction protection during drastic changes in astrobiological environments.

Identification of Forensically Important Calliphoridae and Sarcophagidae Species Collected in Korea Using SNaPshot Multiplex System Targeting the Cytochrome c Oxidase Subunit I Gene

PubMed Central

Park, Ji Hye

2018-01-01

Estimation of postmortem interval (PMI) is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin). The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI) nucleotide sequences. The molecular identification method commonly uses Sanger's nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger's nucleotide sequencing, single-nucleotide polymorphisms (SNPs) in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE) technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae) previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger's nucleotide sequencing. PMID:29682531

The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

PubMed

Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

2010-11-01

Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

Sequence specificity of the hammerhead ribozyme revisited; the NHH rule.

PubMed Central

Kore, A R; Vaish, N K; Kutzke, U; Eckstein, F

1998-01-01

The sequence specificity of hammerhead ribozyme cleavage has been re-evaluated with respect to the NUH rule. Contrary to previous reports it was found that substrates with GAC triplets were also cleaved. This was established in three different sequence contexts. The rate of cleavage under single turnover conditions was between 3 and 7% that of cleavage 3' of GUC. Specificity of cleavage of substrates containing a central A in the cleavable triplet can be described as NAH, where N can be any nucleotide and H any nucleotide but G. As cleavage 3' of NCH triplets has recently been described, the NUH rule can be reformulated to NHH. PMID:9722629

Adenovirus sequences required for replication in vivo.

PubMed Central

Wang, K; Pearson, G D

1985-01-01

We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occupies the first 18 to 21 bp and includes sequences conserved between all adenovirus serotypes. The adjacent auxillary region extends past nucleotide 36 but not past nucleotide 67 and contains the binding site for nuclear factor I. Images PMID:2991857

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

“Shovel-ready” Sequences as a Stimulus for the Next Generation of Life Scientists

PubMed Central

Boyle, Michael D.

2010-01-01

Genomics and bioinformatics are dynamic fields well-suited for capturing the imagination of undergraduates in both research laboratories and classrooms. Currently, raw nucleotide sequence is being provided, as part of several genomics research initiatives, for undergraduate research and teaching. These initiatives could be easily extended and much more effective if the source of the sequenced material and the subsequent focus of the data analysis were aligned with the research interests of individual faculty at undergraduate institutions. By judicious use of surplus capacity in existing nucleotide sequencing cores, raw sequence data could be generated to support ongoing research efforts involving undergraduates. This would allow these students to participate actively in discovery research, with a goal of making novel contributions to their field through original research while nurturing the next generation of talented research scientists. PMID:23653696

"Shovel-ready" Sequences as a Stimulus for the Next Generation of Life Scientists.

PubMed

Boyle, Michael D

2010-01-01

Genomics and bioinformatics are dynamic fields well-suited for capturing the imagination of undergraduates in both research laboratories and classrooms. Currently, raw nucleotide sequence is being provided, as part of several genomics research initiatives, for undergraduate research and teaching. These initiatives could be easily extended and much more effective if the source of the sequenced material and the subsequent focus of the data analysis were aligned with the research interests of individual faculty at undergraduate institutions. By judicious use of surplus capacity in existing nucleotide sequencing cores, raw sequence data could be generated to support ongoing research efforts involving undergraduates. This would allow these students to participate actively in discovery research, with a goal of making novel contributions to their field through original research while nurturing the next generation of talented research scientists.

Molecular characterization of a novel Nucleorhabdovirus from black currant identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence similarities to several nucleorhabdoviruses were identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genomic sequence of this new nucleorhabdovirus is 14,432 nucleotides. Its genomic organization is typical of nucleorh...

SNP discovery through de novo deep sequencing using the next generation of DNA sequencers

USDA-ARS?s Scientific Manuscript database

The production of high volumes of DNA sequence data using new technologies has permitted more efficient identification of single nucleotide polymorphisms in vertebrate genomes. This chapter presented practical methodology for production and analysis of DNA sequence data for SNP discovery....

Inhibition of Escherichia coli viability by external guide sequences complementary to two essential genes

PubMed Central

McKinney, Jeffrey; Guerrier-Takada, Cecilia; Wesolowski, Donna; Altman, Sidney

2001-01-01

Narrow spectrum antimicrobial activity has been designed to reduce the expression of two essential genes, one coding for the protein subunit of RNase P (C5 protein) and one for gyrase (gyrase A). In both cases, external guide sequences (EGS) have been designed to complex with either mRNA. Using the EGS technology, the level of microbial viability is reduced to less than 10% of the wild-type strain. The EGSs are additive when used together and depend on the number of nucleotides paired when attacking gyrase A mRNA. In the case of gyrase A, three nucleotides unpaired out of a 15-mer EGS still favor complete inhibition by the EGS but five unpaired nucleotides do not. PMID:11381134

LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

PubMed Central

Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

1994-01-01

We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. In this database each sequence has been attributed a single genetic name. In the case of duplicated sequences a simple method has been applied to distinguish between sequences of one and the same gene from non-allelic sequences of duplicated genes. If necessary, synonyms are given in the case of allelic duplicated sequences. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, Swissprot and EMBL accession numbers. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). PMID:7937046

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gelb, Bruce D; Tartaglia, Marco; Pennacchio, Len

Diagnostic and therapeutic applications for Noonan Syndrome are described. The diagnostic and therapeutic applications are based on certain mutations in a RAS-specific guanine nucleotide exchange factor gene SOS1 or its expression product. The diagnostic and therapeutic applications are also based on certain mutations in a serine/threonine protein kinase gene RAF1 or its expression product thereof. Also described are nucleotide sequences, amino acid sequences, probes, and primers related to RAF1 or SOS1, and variants thereof, as well as host cells expressing such variants.

Variants of beta-glucosidase

DOEpatents

Fidantsef, Ana; Lamsa, Michael; Gorre-Clancy, Brian

2015-07-14

The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Human ribosomal protein L37 has motifs predicting serine/threonine phosphorylation and a zinc-finger domain.

PubMed

Barnard, G F; Staniunas, R J; Puder, M; Steele, G D; Chen, L B

1994-08-02

Ribosomal protein L37 mRNA is overexpressed in colon cancer. The nucleotide sequences of human L37 from several tumor and normal, colon and liver cDNA sources were determined to be identical. L37 mRNA was approximately 375 nucleotides long encoding 97 amino acids with M(r) = 11,070, pI = 12.6, multiple potential serine/threonine phosphorylation sites and a zinc-finger domain. The human sequence is compared to other species.

Molecular detection of kobuviruses in European roe deer (Capreolus capreolus) in Italy.

PubMed

Di Martino, Barbara; Di Profio, Federica; Melegari, Irene; Di Felice, Elisabetta; Robetto, Serena; Guidetti, Cristina; Orusa, Riccardo; Martella, Vito; Marsilio, Fulvio

2015-08-01

Kobuvirus RNA was found in 6.6 % (13/198) of stool specimens from roe deer (Capreolus capreolus) captured during the regular hunting season. Upon sequence analysis of a fragment of the 3D gene, nine strains displayed the highest nucleotide sequence identity (91.2-97.4 %) to bovine kobuviruses previously detected in either diarrhoeic or asymptomatic calves. Interestingly, four strains were genetically related to the newly discovered caprine kobuviruses (84.2-87.6 % nucleotide identity) identified in black goats in Korea.

Variants of beta-glucosidases

DOEpatents

Fidantsef, Ana; Lamsa, Michael; Gorre-Clancy, Brian

2014-10-07

The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Variants of beta-glucosidase

DOEpatents

Fidantsef, Ana [Davis, CA; Lamsa, Michael [Davis, CA; Gorre-Clancy, Brian [Elk Grove, CA

2009-12-29

The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Weak Negative and Positive Selection and the Drift Load at Splice Sites

PubMed Central

Denisov, Stepan V.; Bazykin, Georgii A.; Sutormin, Roman; Favorov, Alexander V.; Mironov, Andrey A.; Gelfand, Mikhail S.; Kondrashov, Alexey S.

2014-01-01

Splice sites (SSs) are short sequences that are crucial for proper mRNA splicing in eukaryotic cells, and therefore can be expected to be shaped by strong selection. Nevertheless, in mammals and in other intron-rich organisms, many of the SSs often involve nonconsensus (Nc), rather than consensus (Cn), nucleotides, and beyond the two critical nucleotides, the SSs are not perfectly conserved between species. Here, we compare the SS sequences between primates, and between Drosophila fruit flies, to reveal the pattern of selection acting at SSs. Cn-to-Nc substitutions are less frequent, and Nc-to-Cn substitutions are more frequent, than neutrally expected, indicating, respectively, negative and positive selection. This selection is relatively weak (1 < |4Nes| < 4), and has a similar efficiency in primates and in Drosophila. Within some nucleotide positions, the positive selection in favor of Nc-to-Cn substitutions is weaker than the negative selection maintaining already established Cn nucleotides; this difference is due to site-specific negative selection favoring current Nc nucleotides. In general, however, the strength of negative selection protecting the Cn alleles is similar in magnitude to the strength of positive selection favoring replacement of Nc alleles, as expected under the simple nearly neutral turnover. In summary, although a fraction of the Nc nucleotides within SSs is maintained by selection, the abundance of deleterious nucleotides in this class suggests a substantial genome-wide drift load. PMID:24966225

Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

PubMed

Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

1987-08-01

To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

Catalytic properties of RNA polymerases IV and V: accuracy, nucleotide incorporation and rNTP/dNTP discrimination

PubMed Central

Marasco, Michelle; Li, Weiyi; Lynch, Michael

2017-01-01

Abstract All eukaryotes have three essential nuclear multisubunit RNA polymerases, abbreviated as Pol I, Pol II and Pol III. Plants are remarkable in having two additional multisubunit RNA polymerases, Pol IV and Pol V, which synthesize noncoding RNAs that coordinate RNA-directed DNA methylation for silencing of transposons and a subset of genes. Based on their subunit compositions, Pols IV and V clearly evolved as specialized forms of Pol II, but their catalytic properties remain undefined. Here, we show that Pols IV and V differ from one another, and Pol II, in nucleotide incorporation rate, transcriptional accuracy and the ability to discriminate between ribonucleotides and deoxyribonucleotides. Pol IV transcription is considerably more error-prone than Pols II or V, which may be tolerable in its synthesis of short RNAs that serve as precursors for siRNAs targeting non-identical members of transposon families. By contrast, Pol V exhibits high fidelity transcription, similar to Pol II, suggesting a need for Pol V transcripts to faithfully reflect the DNA sequence of target loci to which siRNA–Argonaute silencing complexes are recruited. PMID:28977461

CNG site-specific and methyl-sensitive endonuclease WEN1 from wheat seedlings.

PubMed

Fedoreyeva, L I; Vanyushin, B F

2011-06-01

Endonuclease WEN1 with apparent molecular mass about 27 kDa isolated from cytoplasmic vesicular fraction of aging coleoptiles of wheat seedlings has expressed site specificity action. This is a first detection and isolation of a site-specific endonuclease from higher eukaryotes, in general, and higher plants, in particular. The enzyme hydrolyzes deoxyribooligonucleotides of different composition on CNG (N is G, A, C, or T) sites by splitting the phosphodiester bond between C and N nucleotide residues in CNG sequence independent from neighbor nucleotide context except for CCCG. WEN1 prefers to hydrolyze methylated λ phage DNA and double-stranded deoxyribooligonucleotides containing 5-methylcytosine sites (m(5)CAG, m(5)CTG) compared with unmethylated substrates. The enzyme is also able to hydrolyze single-stranded substrates, but in this case it splits unmethylated substrates predominantly. Detection in wheat seedlings of WEN1 endonuclease that is site specific, sensitive to the substrate methylation status, and modulated with S-adenosyl-L-methionine indicates that in higher plants restriction--modification systems or some of their elements, at least, may exist.

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.

Evidence for a Complex Class of Nonadenylated mRNA in Drosophila

PubMed Central

Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.

1980-01-01

The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246