Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.

PubMed

Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A

1997-01-01

SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.

AgdbNet – antigen sequence database software for bacterial typing

PubMed Central

Jolley, Keith A; Maiden, Martin CJ

2006-01-01

Background Bacterial typing schemes based on the sequences of genes encoding surface antigens require databases that provide a uniform, curated, and widely accepted nomenclature of the variants identified. Due to the differences in typing schemes, imposed by the diversity of genes targeted, creating these databases has typically required the writing of one-off code to link the database to a web interface. Here we describe agdbNet, widely applicable web database software that facilitates simultaneous BLAST querying of multiple loci using either nucleotide or peptide sequences. Results Databases are described by XML files that are parsed by a Perl CGI script. Each database can have any number of loci, which may be defined by nucleotide and/or peptide sequences. The software is currently in use on at least five public databases for the typing of Neisseria meningitidis, Campylobacter jejuni and Streptococcus equi and can be set up to query internal isolate tables or suitably-configured external isolate databases, such as those used for multilocus sequence typing. The style of the resulting website can be fully configured by modifying stylesheets and through the use of customised header and footer files that surround the output of the script. Conclusion The software provides a rapid means of setting up customised Internet antigen sequence databases. The flexible configuration options enable typing schemes with differing requirements to be accommodated. PMID:16790057

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Partial DNA sequencing of Douglas-fir cDNAs used in RFLP mapping

Treesearch

K.D. Jermstad; D.L. Bassoni; C.S. Kinlaw; D.B. Neale

1998-01-01

DNA sequences from 87 Douglas-fir (Pseudotsuga menziesii [Mirb.] Franco) cDNA RFLP probes were determined. Sequences were submitted to the GenBank dbEST database and searched for similarity against nucleotide and protein databases using the BLASTn and BLASTx programs. Twenty-one sequences (24%) were assigned putative functions; 18 of which...

De novo assembly of pen shell ( Atrina pectinata) transcriptome and screening of its genic microsatellites

NASA Astrophysics Data System (ADS)

Sun, Xiujun; Li, Dongming; Liu, Zhihong; Zhou, Liqing; Wu, Biao; Yang, Aiguo

2017-10-01

The pen shell ( Atrina pectinata) is a large wedge-shaped bivalve, which belongs to family Pinnidae. Due to its large and nutritious adductor muscle, it is the popular seafood with high commercial value in Asia-Pacific countries. However, limiting genomic and transcriptomic data have hampered its genetic investigations. In this study, the transcriptome of A. pectinata was deeply sequenced using Illumina pair-end sequencing technology. After assembling, a total of 127263 unigenes were obtained. Functional annotation indicated that the highest percentage of unigenes (18.60%) was annotated on GO database, followed by 18.44% on PFAM database and 17.04% on NR database. There were 270 biological pathways matched with those in KEGG database. Furthermore, a total of 23452 potential simple sequence repeats (SSRs) were identified, of them the most abundant type was mono-nucleotide repeats (12902, 55.01%), which was followed by di-nucleotide (8132, 34.68%), tri-nucleotide (2010, 8.57%), tetra-nucleotide (401, 1.71%), and penta-nucleotide (7, 0.03%) repeats. Sixty SSRs were selected for validating and developing genic SSR markers, of them 23 showed polymorphism in a cultured population with the average observed and expected heterozygosities of 0.412 and 0.579, respectively. In this study, we established the first comprehensive transcript dataset of A. pectinata genes. Our results demonstrated that RNA-Seq is a fast and cost-effective method for genic SSR development in non-model species.

LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

PubMed Central

Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

1994-01-01

We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. In this database each sequence has been attributed a single genetic name. In the case of duplicated sequences a simple method has been applied to distinguish between sequences of one and the same gene from non-allelic sequences of duplicated genes. If necessary, synonyms are given in the case of allelic duplicated sequences. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, Swissprot and EMBL accession numbers. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). PMID:7937046

Sequencing artifacts in the type A influenza databases and attempts to correct them.

PubMed

Suarez, David L; Chester, Nikki; Hatfield, Jason

2014-07-01

There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

DNA Data Bank of Japan

PubMed Central

Mashima, Jun; Kodama, Yuichi; Fujisawa, Takatomo; Katayama, Toshiaki; Okuda, Yoshihiro; Kaminuma, Eli; Ogasawara, Osamu; Okubo, Kousaku; Nakamura, Yasukazu; Takagi, Toshihisa

2017-01-01

The DNA Data Bank of Japan (DDBJ) (http://www.ddbj.nig.ac.jp) has been providing public data services for thirty years (since 1987). We are collecting nucleotide sequence data from researchers as a member of the International Nucleotide Sequence Database Collaboration (INSDC, http://www.insdc.org), in collaboration with the US National Center for Biotechnology Information (NCBI) and European Bioinformatics Institute (EBI). The DDBJ Center also services Japanese Genotype-phenotype Archive (JGA), with the National Bioscience Database Center to collect human-subjected data from Japanese researchers. Here, we report our database activities for INSDC and JGA over the past year, and introduce retrieval and analytical services running on our supercomputer system and their recent modifications. Furthermore, with the Database Center for Life Science, the DDBJ Center improves semantic web technologies to integrate and to share biological data, for providing the RDF version of the sequence data. PMID:27924010

The DNA Data Bank of Japan launches a new resource, the DDBJ Omics Archive of functional genomics experiments.

PubMed

Kodama, Yuichi; Mashima, Jun; Kaminuma, Eli; Gojobori, Takashi; Ogasawara, Osamu; Takagi, Toshihisa; Okubo, Kousaku; Nakamura, Yasukazu

2012-01-01

The DNA Data Bank of Japan (DDBJ; http://www.ddbj.nig.ac.jp) maintains and provides archival, retrieval and analytical resources for biological information. The central DDBJ resource consists of public, open-access nucleotide sequence databases including raw sequence reads, assembly information and functional annotation. Database content is exchanged with EBI and NCBI within the framework of the International Nucleotide Sequence Database Collaboration (INSDC). In 2011, DDBJ launched two new resources: the 'DDBJ Omics Archive' (DOR; http://trace.ddbj.nig.ac.jp/dor) and BioProject (http://trace.ddbj.nig.ac.jp/bioproject). DOR is an archival database of functional genomics data generated by microarray and highly parallel new generation sequencers. Data are exchanged between the ArrayExpress at EBI and DOR in the common MAGE-TAB format. BioProject provides an organizational framework to access metadata about research projects and the data from the projects that are deposited into different databases. In this article, we describe major changes and improvements introduced to the DDBJ services, and the launch of two new resources: DOR and BioProject.

Evaluation of the authenticity of a highly novel environmental sequence from boreal forest soil using ribosomal RNA secondary structure modeling

Treesearch

D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor

2013-01-01

The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W

2011-01-01

GenBank® is a comprehensive database that contains publicly available nucleotide sequences for more than 380,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Nucleotide Archive (ENA) and the DNA Data Bank of Japan (DDBJ) ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system that integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.

Duplicates, redundancies and inconsistencies in the primary nucleotide databases: a descriptive study.

PubMed

Chen, Qingyu; Zobel, Justin; Verspoor, Karin

2017-01-01

GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC-a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases - in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases.Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w. © The Author(s) 2017. Published by Oxford University Press.

Duplicates, redundancies and inconsistencies in the primary nucleotide databases: a descriptive study

PubMed Central

Chen, Qingyu; Zobel, Justin; Verspoor, Karin

2017-01-01

GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC—a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases – in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases. Database URL: the merged records are available at https://cloudstor.aarnet.edu.au/plus/index.php/s/Xef2fvsebBEAv9w PMID:28077566

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Prediction and phylogenetic analysis of mammalian short interspersed elements (SINEs).

PubMed

Rogozin, I B; Mayorov, V I; Lavrentieva, M V; Milanesi, L; Adkison, L R

2000-09-01

The presence of repetitive elements can create serious problems for sequence analysis, especially in the case of homology searches in nucleotide sequence databases. Repetitive elements should be treated carefully by using special programs and databases. In this paper, various aspects of SINE (short interspersed repetitive element) identification, analysis and evolution are discussed.

iMETHYL: an integrative database of human DNA methylation, gene expression, and genomic variation.

PubMed

Komaki, Shohei; Shiwa, Yuh; Furukawa, Ryohei; Hachiya, Tsuyoshi; Ohmomo, Hideki; Otomo, Ryo; Satoh, Mamoru; Hitomi, Jiro; Sobue, Kenji; Sasaki, Makoto; Shimizu, Atsushi

2018-01-01

We launched an integrative multi-omics database, iMETHYL (http://imethyl.iwate-megabank.org). iMETHYL provides whole-DNA methylation (~24 million autosomal CpG sites), whole-genome (~9 million single-nucleotide variants), and whole-transcriptome (>14 000 genes) data for CD4 + T-lymphocytes, monocytes, and neutrophils collected from approximately 100 subjects. These data were obtained from whole-genome bisulfite sequencing, whole-genome sequencing, and whole-transcriptome sequencing, making iMETHYL a comprehensive database.

The BaMM web server for de-novo motif discovery and regulatory sequence analysis.

PubMed

Kiesel, Anja; Roth, Christian; Ge, Wanwan; Wess, Maximilian; Meier, Markus; Söding, Johannes

2018-05-28

The BaMM web server offers four tools: (i) de-novo discovery of enriched motifs in a set of nucleotide sequences, (ii) scanning a set of nucleotide sequences with motifs to find motif occurrences, (iii) searching with an input motif for similar motifs in our BaMM database with motifs for >1000 transcription factors, trained from the GTRD ChIP-seq database and (iv) browsing and keyword searching the motif database. In contrast to most other servers, we represent sequence motifs not by position weight matrices (PWMs) but by Bayesian Markov Models (BaMMs) of order 4, which we showed previously to perform substantially better in ROC analyses than PWMs or first order models. To address the inadequacy of P- and E-values as measures of motif quality, we introduce the AvRec score, the average recall over the TP-to-FP ratio between 1 and 100. The BaMM server is freely accessible without registration at https://bammmotif.mpibpc.mpg.de.

LISTA, LISTA-HOP and LISTA-HON: a comprehensive compilation of protein encoding sequences and its associated homology databases from the yeast Saccharomyces.

PubMed Central

Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P

1996-01-01

We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. As in previous editions the genetic names are consistently associated to each sequence with a known and confirmed ORF. If necessary, synonyms are given in the case of allelic duplicated sequences. Although the first publication of a sequence gives-according to our rules-the genetic name of a gene, in some instances more commonly used names are given to avoid nomenclature problems and the use of ancient designations which are no longer used. In these cases the old designation is given as synonym. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, SWISSPROT and EMBL accession numbers. New entries will also contain the name from the systematic sequencing efforts. Since the release of LISTA4.1 we update the database continuously. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. This release includes reports from full Smith and Watermann peptide-level searches against a non-redundant protein sequence database. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). The database is available by FTP and on World Wide Web. PMID:8594599

Reference genotype and exome data from an Australian Aboriginal population for health-based research

PubMed Central

Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.

2016-01-01

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114

Reference genotype and exome data from an Australian Aboriginal population for health-based research.

PubMed

Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M

2016-04-12

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.

NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins

PubMed Central

Pruitt, Kim D.; Tatusova, Tatiana; Maglott, Donna R.

2005-01-01

The National Center for Biotechnology Information (NCBI) Reference Sequence (RefSeq) database (http://www.ncbi.nlm.nih.gov/RefSeq/) provides a non-redundant collection of sequences representing genomic data, transcripts and proteins. Although the goal is to provide a comprehensive dataset representing the complete sequence information for any given species, the database pragmatically includes sequence data that are currently publicly available in the archival databases. The database incorporates data from over 2400 organisms and includes over one million proteins representing significant taxonomic diversity spanning prokaryotes, eukaryotes and viruses. Nucleotide and protein sequences are explicitly linked, and the sequences are linked to other resources including the NCBI Map Viewer and Gene. Sequences are annotated to include coding regions, conserved domains, variation, references, names, database cross-references, and other features using a combined approach of collaboration and other input from the scientific community, automated annotation, propagation from GenBank and curation by NCBI staff. PMID:15608248

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection

PubMed Central

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike

2018-01-01

ABSTRACT Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection. PMID:29564396

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

PubMed

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

2018-01-01

Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.

Using the TIGR gene index databases for biological discovery.

PubMed

Lee, Yuandan; Quackenbush, John

2003-11-01

The TIGR Gene Index web pages provide access to analyses of ESTs and gene sequences for nearly 60 species, as well as a number of resources derived from these. Each species-specific database is presented using a common format with a homepage. A variety of methods exist that allow users to search each species-specific database. Methods implemented currently include nucleotide or protein sequence queries using WU-BLAST, text-based searches using various sequence identifiers, searches by gene, tissue and library name, and searches using functional classes through Gene Ontology assignments. This protocol provides guidance for using the Gene Index Databases to extract information.

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE PAGES

Williams, Kelly Porter; Lau, Britney Yan

2016-10-28

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Kelly Porter; Lau, Britney Yan

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

NCBI-compliant genome submissions: tips and tricks to save time and money.

PubMed

Pirovano, Walter; Boetzer, Marten; Derks, Martijn F L; Smit, Sandra

2017-03-01

Genome sequences nowadays play a central role in molecular biology and bioinformatics. These sequences are shared with the scientific community through sequence databases. The sequence repositories of the International Nucleotide Sequence Database Collaboration (INSDC, comprising GenBank, ENA and DDBJ) are the largest in the world. Preparing an annotated sequence in such a way that it will be accepted by the database is challenging because many validation criteria apply. In our opinion, it is an undesirable situation that researchers who want to submit their sequence need either a lot of experience or help from partners to get the job done. To save valuable time and money, we list a number of recommendations for people who want to submit an annotated genome to a sequence database, as well as for tool developers, who could help to ease the process. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Identification of phylogenetic position in the Chlamydiaceae family for Chlamydia strains released from monkeys and humans with chlamydial pathology.

PubMed

Karaulov, Alexander; Aleshkin, Vladimir; Slobodenyuk, Vladimir; Grechishnikova, Olga; Afanasyev, Stanislav; Lapin, Boris; Dzhikidze, Eteri; Nesvizhsky, Yuriy; Evsegneeva, Irina; Voropayeva, Elena; Afanasyev, Maxim; Aleshkin, Andrei; Metelskaya, Valeria; Yegorova, Ekaterina; Bayrakova, Alexandra

2010-01-01

Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S-23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S-23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga) have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration.

CLAST: CUDA implemented large-scale alignment search tool.

PubMed

Yano, Masahiro; Mori, Hiroshi; Akiyama, Yutaka; Yamada, Takuji; Kurokawa, Ken

2014-12-11

Metagenomics is a powerful methodology to study microbial communities, but it is highly dependent on nucleotide sequence similarity searching against sequence databases. Metagenomic analyses with next-generation sequencing technologies produce enormous numbers of reads from microbial communities, and many reads are derived from microbes whose genomes have not yet been sequenced, limiting the usefulness of existing sequence similarity search tools. Therefore, there is a clear need for a sequence similarity search tool that can rapidly detect weak similarity in large datasets. We developed a tool, which we named CLAST (CUDA implemented large-scale alignment search tool), that enables analyses of millions of reads and thousands of reference genome sequences, and runs on NVIDIA Fermi architecture graphics processing units. CLAST has four main advantages over existing alignment tools. First, CLAST was capable of identifying sequence similarities ~80.8 times faster than BLAST and 9.6 times faster than BLAT. Second, CLAST executes global alignment as the default (local alignment is also an option), enabling CLAST to assign reads to taxonomic and functional groups based on evolutionarily distant nucleotide sequences with high accuracy. Third, CLAST does not need a preprocessed sequence database like Burrows-Wheeler Transform-based tools, and this enables CLAST to incorporate large, frequently updated sequence databases. Fourth, CLAST requires <2 GB of main memory, making it possible to run CLAST on a standard desktop computer or server node. CLAST achieved very high speed (similar to the Burrows-Wheeler Transform-based Bowtie 2 for long reads) and sensitivity (equal to BLAST, BLAT, and FR-HIT) without the need for extensive database preprocessing or a specialized computing platform. Our results demonstrate that CLAST has the potential to be one of the most powerful and realistic approaches to analyze the massive amount of sequence data from next-generation sequencing technologies.

SAM: String-based sequence search algorithm for mitochondrial DNA database queries

PubMed Central

Röck, Alexander; Irwin, Jodi; Dür, Arne; Parsons, Thomas; Parson, Walther

2011-01-01

The analysis of the haploid mitochondrial (mt) genome has numerous applications in forensic and population genetics, as well as in disease studies. Although mtDNA haplotypes are usually determined by sequencing, they are rarely reported as a nucleotide string. Traditionally they are presented in a difference-coded position-based format relative to the corrected version of the first sequenced mtDNA. This convention requires recommendations for standardized sequence alignment that is known to vary between scientific disciplines, even between laboratories. As a consequence, database searches that are vital for the interpretation of mtDNA data can suffer from biased results when query and database haplotypes are annotated differently. In the forensic context that would usually lead to underestimation of the absolute and relative frequencies. To address this issue we introduce SAM, a string-based search algorithm that converts query and database sequences to position-free nucleotide strings and thus eliminates the possibility that identical sequences will be missed in a database query. The mere application of a BLAST algorithm would not be a sufficient remedy as it uses a heuristic approach and does not address properties specific to mtDNA, such as phylogenetically stable but also rapidly evolving insertion and deletion events. The software presented here provides additional flexibility to incorporate phylogenetic data, site-specific mutation rates, and other biologically relevant information that would refine the interpretation of mitochondrial DNA data. The manuscript is accompanied by freeware and example data sets that can be used to evaluate the new software (http://stringvalidation.org). PMID:21056022

Viral Genome DataBase: storing and analyzing genes and proteins from complete viral genomes.

PubMed

Hiscock, D; Upton, C

2000-05-01

The Viral Genome DataBase (VGDB) contains detailed information of the genes and predicted protein sequences from 15 completely sequenced genomes of large (&100 kb) viruses (2847 genes). The data that is stored includes DNA sequence, protein sequence, GenBank and user-entered notes, molecular weight (MW), isoelectric point (pI), amino acid content, A + T%, nucleotide frequency, dinucleotide frequency and codon use. The VGDB is a mySQL database with a user-friendly JAVA GUI. Results of queries can be easily sorted by any of the individual parameters. The software and additional figures and information are available at http://athena.bioc.uvic.ca/genomes/index.html .

The VirusBanker database uses a Java program to allow flexible searching through Bunyaviridae sequences.

PubMed

Fourment, Mathieu; Gibbs, Mark J

2008-02-05

Viruses of the Bunyaviridae have segmented negative-stranded RNA genomes and several of them cause significant disease. Many partial sequences have been obtained from the segments so that GenBank searches give complex results. Sequence databases usually use HTML pages to mediate remote sorting, but this approach can be limiting and may discourage a user from exploring a database. The VirusBanker database contains Bunyaviridae sequences and alignments and is presented as two spreadsheets generated by a Java program that interacts with a MySQL database on a server. Sequences are displayed in rows and may be sorted using information that is displayed in columns and includes data relating to the segment, gene, protein, species, strain, sequence length, terminal sequence and date and country of isolation. Bunyaviridae sequences and alignments may be downloaded from the second spreadsheet with titles defined by the user from the columns, or viewed when passed directly to the sequence editor, Jalview. VirusBanker allows large datasets of aligned nucleotide and protein sequences from the Bunyaviridae to be compiled and winnowed rapidly using criteria that are formulated heuristically.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Souza, T.M.; Boominathan, K.; Reddy, C.A.

1996-10-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less

Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, G.; Korber, B.; Wain-Hobson, S.

1993-12-31

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Human retroviruses and AIDS, 1991. [CONTAINS GLOSSARY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, G.; Korber, B.; Berzofsky, J.A.

1991-05-01

This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses.The scope of the compendium and database is best summarized by the five parts that it comprises: (1) HIV and SIV Nucleotide Sequences; (2) Amino Acid Sequences; (3) Analyses; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

PubMed Central

Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

1993-01-01

The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

PubMed

Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

2009-10-23

We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand.

PubMed

Pohuang, Tawatchai; Chansiripornchai, Niwat; Tawatsin, Achara; Sasipreeyajan, Jiroj

2009-09-01

Thirteen field isolates of infectious bronchitis virus (IBV) were isolated from broiler flocks in Thailand between January and June 2008. The 878-bp of the S1 gene covering a hypervariable region was amplified and sequenced. Phylogenetic analysis based on that region revealed that these viruses were separated into two groups (I and II). IBV isolates in group I were not related to other IBV strains published in the GenBank database. Group 1 nucleotide sequence identities were less than 85% and amino acid sequence identities less than 84% in common with IBVs published in the GenBank database. This group likely represents the strains indigenous to Thailand. The isolates in group II showed a close relationship with Chinese IBVs. They had nucleotide sequence identities of 97-98% and amino acid sequence identities 96-98% in common with Chinese IBVs (strain A2, SH and QXIBV). This finding indicated that the recent Thai IBVs evolved separately and at least two groups of viruses are circulating in Thailand.

GenBank

PubMed Central

Benson, Dennis A.; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Wheeler, David L.

2007-01-01

GenBank (R) is a comprehensive database that contains publicly available nucleotide sequences for more than 240 000 named organisms, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the EMBL Data Library in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through NCBI's retrieval system, Entrez, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage (). PMID:17202161

The annotation-enriched non-redundant patent sequence databases.

PubMed

Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo

2013-01-01

The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/

The Annotation-enriched non-redundant patent sequence databases

PubMed Central

Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo

2013-01-01

The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/ PMID:23396323

Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

PubMed

Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

2017-06-26

Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

PubMed

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-02-23

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

PubMed Central

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-01-01

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Inquiry-Based Learning of Molecular Phylogenetics

ERIC Educational Resources Information Center

Campo, Daniel; Garcia-Vazquez, Eva

2008-01-01

Reconstructing phylogenies from nucleotide sequences is a challenge for students because it strongly depends on evolutionary models and computer tools that are frequently updated. We present here an inquiry-based course aimed at learning how to trace a phylogeny based on sequences existing in public databases. Computer tools are freely available…

The VirusBanker database uses a Java program to allow flexible searching through Bunyaviridae sequences

PubMed Central

Fourment, Mathieu; Gibbs, Mark J

2008-01-01

Background Viruses of the Bunyaviridae have segmented negative-stranded RNA genomes and several of them cause significant disease. Many partial sequences have been obtained from the segments so that GenBank searches give complex results. Sequence databases usually use HTML pages to mediate remote sorting, but this approach can be limiting and may discourage a user from exploring a database. Results The VirusBanker database contains Bunyaviridae sequences and alignments and is presented as two spreadsheets generated by a Java program that interacts with a MySQL database on a server. Sequences are displayed in rows and may be sorted using information that is displayed in columns and includes data relating to the segment, gene, protein, species, strain, sequence length, terminal sequence and date and country of isolation. Bunyaviridae sequences and alignments may be downloaded from the second spreadsheet with titles defined by the user from the columns, or viewed when passed directly to the sequence editor, Jalview. Conclusion VirusBanker allows large datasets of aligned nucleotide and protein sequences from the Bunyaviridae to be compiled and winnowed rapidly using criteria that are formulated heuristically. PMID:18251994

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Real-Time Pathogen Detection in the Era of Whole-Genome Sequencing and Big Data: Comparison of k-mer and Site-Based Methods for Inferring the Genetic Distances among Tens of Thousands of Salmonella Samples.

PubMed

Pettengill, James B; Pightling, Arthur W; Baugher, Joseph D; Rand, Hugh; Strain, Errol

2016-01-01

The adoption of whole-genome sequencing within the public health realm for molecular characterization of bacterial pathogens has been followed by an increased emphasis on real-time detection of emerging outbreaks (e.g., food-borne Salmonellosis). In turn, large databases of whole-genome sequence data are being populated. These databases currently contain tens of thousands of samples and are expected to grow to hundreds of thousands within a few years. For these databases to be of optimal use one must be able to quickly interrogate them to accurately determine the genetic distances among a set of samples. Being able to do so is challenging due to both biological (evolutionary diverse samples) and computational (petabytes of sequence data) issues. We evaluated seven measures of genetic distance, which were estimated from either k-mer profiles (Jaccard, Euclidean, Manhattan, Mash Jaccard, and Mash distances) or nucleotide sites (NUCmer and an extended multi-locus sequence typing (MLST) scheme). When analyzing empirical data (whole-genome sequence data from 18,997 Salmonella isolates) there are features (e.g., genomic, assembly, and contamination) that cause distances inferred from k-mer profiles, which treat absent data as informative, to fail to accurately capture the distance between samples when compared to distances inferred from differences in nucleotide sites. Thus, site-based distances, like NUCmer and extended MLST, are superior in performance, but accessing the computing resources necessary to perform them may be challenging when analyzing large databases.

Real-Time Pathogen Detection in the Era of Whole-Genome Sequencing and Big Data: Comparison of k-mer and Site-Based Methods for Inferring the Genetic Distances among Tens of Thousands of Salmonella Samples

DOE PAGES

Pettengill, James B.; Pightling, Arthur W.; Baugher, Joseph D.; ...

2016-11-10

The adoption of whole-genome sequencing within the public health realm for molecular characterization of bacterial pathogens has been followed by an increased emphasis on real-time detection of emerging outbreaks (e.g., food-borne Salmonellosis). In turn, large databases of whole-genome sequence data are being populated. These databases currently contain tens of thousands of samples and are expected to grow to hundreds of thousands within a few years. For these databases to be of optimal use one must be able to quickly interrogate them to accurately determine the genetic distances among a set of samples. Being able to do so is challenging duemore » to both biological (evolutionary diverse samples) and computational (petabytes of sequence data) issues. We evaluated seven measures of genetic distance, which were estimated from either k-mer profiles (Jaccard, Euclidean, Manhattan, Mash Jaccard, and Mash distances) or nucleotide sites (NUCmer and an extended multi-locus sequence typing (MLST) scheme). Finally, when analyzing empirical data (wholegenome sequence data from 18,997 Salmonella isolates) there are features (e.g., genomic, assembly, and contamination) that cause distances inferred from k-mer profiles, which treat absent data as informative, to fail to accurately capture the distance between samples when compared to distances inferred from differences in nucleotide sites. Thus, site-based distances, like NUCmer and extended MLST, are superior in performance, but accessing the computing resources necessary to perform them may be challenging when analyzing large databases.« less

Real-Time Pathogen Detection in the Era of Whole-Genome Sequencing and Big Data: Comparison of k-mer and Site-Based Methods for Inferring the Genetic Distances among Tens of Thousands of Salmonella Samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pettengill, James B.; Pightling, Arthur W.; Baugher, Joseph D.

The adoption of whole-genome sequencing within the public health realm for molecular characterization of bacterial pathogens has been followed by an increased emphasis on real-time detection of emerging outbreaks (e.g., food-borne Salmonellosis). In turn, large databases of whole-genome sequence data are being populated. These databases currently contain tens of thousands of samples and are expected to grow to hundreds of thousands within a few years. For these databases to be of optimal use one must be able to quickly interrogate them to accurately determine the genetic distances among a set of samples. Being able to do so is challenging duemore » to both biological (evolutionary diverse samples) and computational (petabytes of sequence data) issues. We evaluated seven measures of genetic distance, which were estimated from either k-mer profiles (Jaccard, Euclidean, Manhattan, Mash Jaccard, and Mash distances) or nucleotide sites (NUCmer and an extended multi-locus sequence typing (MLST) scheme). Finally, when analyzing empirical data (wholegenome sequence data from 18,997 Salmonella isolates) there are features (e.g., genomic, assembly, and contamination) that cause distances inferred from k-mer profiles, which treat absent data as informative, to fail to accurately capture the distance between samples when compared to distances inferred from differences in nucleotide sites. Thus, site-based distances, like NUCmer and extended MLST, are superior in performance, but accessing the computing resources necessary to perform them may be challenging when analyzing large databases.« less

UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Robasky, Kimberly; Bulyk, Martha L

2011-01-01

The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

WWW Entrez: A Hypertext Retrieval Tool for Molecular Biology.

ERIC Educational Resources Information Center

Epstein, Jonathan A.; Kans, Jonathan A.; Schuler, Gregory D.

This article describes the World Wide Web (WWW) Entrez server which is based upon the National Center for Biotechnology Information's (NCBI) Entrez retrieval database and software. Entrez is a molecular sequence retrieval system that contains an integrated view of portions of Medline and all publicly available nucleotide and protein databases,…

5S ribosomal RNA database Y2K

PubMed Central

Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

5S ribosomal RNA database Y2K.

PubMed

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

DNA Data Bank of Japan: 30th anniversary.

PubMed

Kodama, Yuichi; Mashima, Jun; Kosuge, Takehide; Kaminuma, Eli; Ogasawara, Osamu; Okubo, Kousaku; Nakamura, Yasukazu; Takagi, Toshihisa

2018-01-04

The DNA Data Bank of Japan (DDBJ) Center (http://www.ddbj.nig.ac.jp) has been providing public data services for 30 years since 1987. We are collecting nucleotide sequence data and associated biological information from researchers as a member of the International Nucleotide Sequence Database Collaboration (INSDC), in collaboration with the US National Center for Biotechnology Information and the European Bioinformatics Institute. The DDBJ Center also services the Japanese Genotype-phenotype Archive (JGA) with the National Bioscience Database Center to collect genotype and phenotype data of human individuals. Here, we outline our database activities for INSDC and JGA over the past year, and introduce submission, retrieval and analysis services running on our supercomputer system and their recent developments. Furthermore, we highlight our responses to the amended Japanese rules for the protection of personal information and the launch of the DDBJ Group Cloud service for sharing pre-publication data among research groups. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

SINEBase: a database and tool for SINE analysis.

PubMed

Vassetzky, Nikita S; Kramerov, Dmitri A

2013-01-01

SINEBase (http://sines.eimb.ru) integrates the revisited body of knowledge about short interspersed elements (SINEs). A set of formal definitions concerning SINEs was introduced. All available sequence data were screened through these definitions and the genetic elements misidentified as SINEs were discarded. As a result, 175 SINE families have been recognized in animals, flowering plants and green algae. These families were classified by the modular structure of their nucleotide sequences and the frequencies of different patterns were evaluated. These data formed the basis for the database of SINEs. The SINEBase website can be used in two ways: first, to explore the database of SINE families, and second, to analyse candidate SINE sequences using specifically developed tools. This article presents an overview of the database and the process of SINE identification and analysis.

SINEBase: a database and tool for SINE analysis

PubMed Central

Vassetzky, Nikita S.; Kramerov, Dmitri A.

2013-01-01

SINEBase (http://sines.eimb.ru) integrates the revisited body of knowledge about short interspersed elements (SINEs). A set of formal definitions concerning SINEs was introduced. All available sequence data were screened through these definitions and the genetic elements misidentified as SINEs were discarded. As a result, 175 SINE families have been recognized in animals, flowering plants and green algae. These families were classified by the modular structure of their nucleotide sequences and the frequencies of different patterns were evaluated. These data formed the basis for the database of SINEs. The SINEBase website can be used in two ways: first, to explore the database of SINE families, and second, to analyse candidate SINE sequences using specifically developed tools. This article presents an overview of the database and the process of SINE identification and analysis. PMID:23203982

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis

PubMed Central

Song, Wen Jun; Qin, Qi Wei; Qiu, Jin; Huang, Can Hua; Wang, Fan; Hew, Choy Leong

2004-01-01

Here we report the complete genome sequence of Singapore grouper iridovirus (SGIV). Sequencing of the random shotgun and restriction endonuclease genomic libraries showed that the entire SGIV genome consists of 140,131 nucleotide bp. One hundred sixty-two open reading frames (ORFs) from the sense and antisense DNA strands, coding for lengths varying from 41 to 1,268 amino acids, were identified. Computer-assisted analyses of the deduced amino acid sequences revealed that 77 of the ORFs exhibited homologies to known virus genes, 23 of which matched functional iridovirus proteins. Forty-two putative conserved domains or signatures were detected in the National Center for Biotechnology Information CD-Search database and PROSITE database. An assortment of enzyme activities involved in DNA replication, transcription, nucleotide metabolism, cell signaling, etc., were identified. Viruses were cultured on a cell line derived from the embryonated egg of the grouper Epinephelus tauvina, isolated, and purified by sucrose gradient ultracentrifugation. The protein extract from the purified virions was analyzed by polyacrylamide gel electrophoresis followed by in-gel digestion of protein bands. Matrix-assisted laser desorption ionization-time of flight mass spectrometry and database searching led to identification of 26 proteins. Twenty of these represented novel or previously unidentified genes, which were further confirmed by reverse transcription-PCR (RT-PCR) and DNA sequencing of their respective RT-PCR products. PMID:15507645

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

RECOVIR Software for Identifying Viruses

NASA Technical Reports Server (NTRS)

Chakravarty, Sugoto; Fox, George E.; Zhu, Dianhui

2013-01-01

Most single-stranded RNA (ssRNA) viruses mutate rapidly to generate a large number of strains with highly divergent capsid sequences. Determining the capsid residues or nucleotides that uniquely characterize these strains is critical in understanding the strain diversity of these viruses. RECOVIR (an acronym for "recognize viruses") software predicts the strains of some ssRNA viruses from their limited sequence data. Novel phylogenetic-tree-based databases of protein or nucleic acid residues that uniquely characterize these virus strains are created. Strains of input virus sequences (partial or complete) are predicted through residue-wise comparisons with the databases. RECOVIR uses unique characterizing residues to identify automatically strains of partial or complete capsid sequences of picorna and caliciviruses, two of the most highly diverse ssRNA virus families. Partition-wise comparisons of the database residues with the corresponding residues of more than 300 complete and partial sequences of these viruses resulted in correct strain identification for all of these sequences. This study shows the feasibility of creating databases of hitherto unknown residues uniquely characterizing the capsid sequences of two of the most highly divergent ssRNA virus families. These databases enable automated strain identification from partial or complete capsid sequences of these human and animal pathogens.

Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

PubMed

M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

2007-12-01

Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.

miBLAST: scalable evaluation of a batch of nucleotide sequence queries with BLAST

PubMed Central

Kim, You Jung; Boyd, Andrew; Athey, Brian D.; Patel, Jignesh M.

2005-01-01

A common task in many modern bioinformatics applications is to match a set of nucleotide query sequences against a large sequence dataset. Exis-ting tools, such as BLAST, are designed to evaluate a single query at a time and can be unacceptably slow when the number of sequences in the query set is large. In this paper, we present a new algorithm, called miBLAST, that evaluates such batch workloads efficiently. At the core, miBLAST employs a q-gram filtering and an index join for efficiently detecting similarity between the query sequences and database sequences. This set-oriented technique, which indexes both the query and the database sets, results in substantial performance improvements over existing methods. Our results show that miBLAST is significantly faster than BLAST in many cases. For example, miBLAST aligned 247 965 oligonucleotide sequences in the Affymetrix probe set against the Human UniGene in 1.26 days, compared with 27.27 days with BLAST (an improvement by a factor of 22). The relative performance of miBLAST increases for larger word sizes; however, it decreases for longer queries. miBLAST employs the familiar BLAST statistical model and output format, guaranteeing the same accuracy as BLAST and facilitating a seamless transition for existing BLAST users. PMID:16061938

GenBank.

PubMed

Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Wheeler, David L

2007-01-01

GenBank (R) is a comprehensive database that contains publicly available nucleotide sequences for more than 240 000 named organisms, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the EMBL Data Library in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through NCBI's retrieval system, Entrez, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage (www.ncbi.nlm.nih.gov).

Mining biological databases for candidate disease genes

NASA Astrophysics Data System (ADS)

Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

2001-07-01

The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

RefSeq microbial genomes database: new representation and annotation strategy.

PubMed

Tatusova, Tatiana; Ciufo, Stacy; Fedorov, Boris; O'Neill, Kathleen; Tolstoy, Igor

2014-01-01

The source of the microbial genomic sequences in the RefSeq collection is the set of primary sequence records submitted to the International Nucleotide Sequence Database public archives. These can be accessed through the Entrez search and retrieval system at http://www.ncbi.nlm.nih.gov/genome. Next-generation sequencing has enabled researchers to perform genomic sequencing at rates that were unimaginable in the past. Microbial genomes can now be sequenced in a matter of hours, which has led to a significant increase in the number of assembled genomes deposited in the public archives. This huge increase in DNA sequence data presents new challenges for the annotation, analysis and visualization bioinformatics tools. New strategies have been developed for the annotation and representation of reference genomes and sequence variations derived from population studies and clinical outbreaks.

PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

PubMed

Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

2011-01-01

PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

Non-redundant patent sequence databases with value-added annotations at two levels

PubMed Central

Li, Weizhong; McWilliam, Hamish; de la Torre, Ana Richart; Grodowski, Adam; Benediktovich, Irina; Goujon, Mickael; Nauche, Stephane; Lopez, Rodrigo

2010-01-01

The European Bioinformatics Institute (EMBL-EBI) provides public access to patent data, including abstracts, chemical compounds and sequences. Sequences can appear multiple times due to the filing of the same invention with multiple patent offices, or the use of the same sequence by different inventors in different contexts. Information relating to the source invention may be incomplete, and biological information available in patent documents elsewhere may not be reflected in the annotation of the sequence. Search and analysis of these data have become increasingly challenging for both the scientific and intellectual-property communities. Here, we report a collection of non-redundant patent sequence databases, which cover the EMBL-Bank nucleotides patent class and the patent protein databases and contain value-added annotations from patent documents. The databases were created at two levels by the use of sequence MD5 checksums. Sequences within a level-1 cluster are 100% identical over their whole length. Level-2 clusters were defined by sub-grouping level-1 clusters based on patent family information. Value-added annotations, such as publication number corrections, earliest publication dates and feature collations, significantly enhance the quality of the data, allowing for better tracking and cross-referencing. The databases are available format: http://www.ebi.ac.uk/patentdata/nr/. PMID:19884134

Non-redundant patent sequence databases with value-added annotations at two levels.

PubMed

Li, Weizhong; McWilliam, Hamish; de la Torre, Ana Richart; Grodowski, Adam; Benediktovich, Irina; Goujon, Mickael; Nauche, Stephane; Lopez, Rodrigo

2010-01-01

The European Bioinformatics Institute (EMBL-EBI) provides public access to patent data, including abstracts, chemical compounds and sequences. Sequences can appear multiple times due to the filing of the same invention with multiple patent offices, or the use of the same sequence by different inventors in different contexts. Information relating to the source invention may be incomplete, and biological information available in patent documents elsewhere may not be reflected in the annotation of the sequence. Search and analysis of these data have become increasingly challenging for both the scientific and intellectual-property communities. Here, we report a collection of non-redundant patent sequence databases, which cover the EMBL-Bank nucleotides patent class and the patent protein databases and contain value-added annotations from patent documents. The databases were created at two levels by the use of sequence MD5 checksums. Sequences within a level-1 cluster are 100% identical over their whole length. Level-2 clusters were defined by sub-grouping level-1 clusters based on patent family information. Value-added annotations, such as publication number corrections, earliest publication dates and feature collations, significantly enhance the quality of the data, allowing for better tracking and cross-referencing. The databases are available format: http://www.ebi.ac.uk/patentdata/nr/.

gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes.

PubMed

Nakagawa, So; Takahashi, Mahoko Ueda

2016-01-01

In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species.Database URL: http://geve.med.u-tokai.ac.jp. © The Author(s) 2016. Published by Oxford University Press.

gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes

PubMed Central

Nakagawa, So; Takahashi, Mahoko Ueda

2016-01-01

In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species. Database URL: http://geve.med.u-tokai.ac.jp PMID:27242033

DNAAlignEditor: DNA alignment editor tool

PubMed Central

Sanchez-Villeda, Hector; Schroeder, Steven; Flint-Garcia, Sherry; Guill, Katherine E; Yamasaki, Masanori; McMullen, Michael D

2008-01-01

Background With advances in DNA re-sequencing methods and Next-Generation parallel sequencing approaches, there has been a large increase in genomic efforts to define and analyze the sequence variability present among individuals within a species. For very polymorphic species such as maize, this has lead to a need for intuitive, user-friendly software that aids the biologist, often with naïve programming capability, in tracking, editing, displaying, and exporting multiple individual sequence alignments. To fill this need we have developed a novel DNA alignment editor. Results We have generated a nucleotide sequence alignment editor (DNAAlignEditor) that provides an intuitive, user-friendly interface for manual editing of multiple sequence alignments with functions for input, editing, and output of sequence alignments. The color-coding of nucleotide identity and the display of associated quality score aids in the manual alignment editing process. DNAAlignEditor works as a client/server tool having two main components: a relational database that collects the processed alignments and a user interface connected to database through universal data access connectivity drivers. DNAAlignEditor can be used either as a stand-alone application or as a network application with multiple users concurrently connected. Conclusion We anticipate that this software will be of general interest to biologists and population genetics in editing DNA sequence alignments and analyzing natural sequence variation regardless of species, and will be particularly useful for manual alignment editing of sequences in species with high levels of polymorphism. PMID:18366684

NABIC: A New Access Portal to Search, Visualize, and Share Agricultural Genomics Data.

PubMed

Seol, Young-Joo; Lee, Tae-Ho; Park, Dong-Suk; Kim, Chang-Kug

2016-01-01

The National Agricultural Biotechnology Information Center developed an access portal to search, visualize, and share agricultural genomics data with a focus on South Korean information and resources. The portal features an agricultural biotechnology database containing a wide range of omics data from public and proprietary sources. We collected 28.4 TB of data from 162 agricultural organisms, with 10 types of omics data comprising next-generation sequencing sequence read archive, genome, gene, nucleotide, DNA chip, expressed sequence tag, interactome, protein structure, molecular marker, and single-nucleotide polymorphism datasets. Our genomic resources contain information on five animals, seven plants, and one fungus, which is accessed through a genome browser. We also developed a data submission and analysis system as a web service, with easy-to-use functions and cutting-edge algorithms, including those for handling next-generation sequencing data.

Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

PubMed

Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

2003-04-02

Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

A new approach for detecting adventitious viruses shows Sf-rhabdovirus-negative Sf-RVN cells are suitable for safe biologicals production.

PubMed

Geisler, Christoph

2018-02-07

Adventitious viral contamination in cell substrates used for biologicals production is a major safety concern. A powerful new approach that can be used to identify adventitious viruses is a combination of bioinformatics tools with massively parallel sequencing technology. Typically, this involves mapping or BLASTN searching individual reads against viral nucleotide databases. Although extremely sensitive for known viruses, this approach can easily miss viruses that are too dissimilar to viruses in the database. Moreover, it is computationally intensive and requires reference cell genome databases. To avoid these drawbacks, we set out to develop an alternative approach. We reasoned that searching genome and transcriptome assemblies for adventitious viral contaminants using TBLASTN with a compact viral protein database covering extant viral diversity as the query could be fast and sensitive without a requirement for high performance computing hardware. We tested our approach on Spodoptera frugiperda Sf-RVN, a recently isolated insect cell line, to determine if it was contaminated with one or more adventitious viruses. We used Illumina reads to assemble the Sf-RVN genome and transcriptome and searched them for adventitious viral contaminants using TBLASTN with our viral protein database. We found no evidence of viral contamination, which was substantiated by the fact that our searches otherwise identified diverse sequences encoding virus-like proteins. These sequences included Maverick, R1 LINE, and errantivirus transposons, all of which are common in insect genomes. We also identified previously described as well as novel endogenous viral elements similar to ORFs encoded by diverse insect viruses. Our results demonstrate TBLASTN searching massively parallel sequencing (MPS) assemblies with a compact, manually curated viral protein database is more sensitive for adventitious virus detection than BLASTN, as we identified various sequences that encoded virus-like proteins, but had no similarity to viral sequences at the nucleotide level. Moreover, searches were fast without requiring high performance computing hardware. Our study also documents the enhanced biosafety profile of Sf-RVN as compared to other Sf cell lines, and supports the notion that Sf-RVN is highly suitable for the production of safe biologicals.

Enhancing a Pathway-Genome Database (PGDB) to capture subcellular localization of metabolites and enzymes: the nucleotide-sugar biosynthetic pathways of Populus trichocarpa.

PubMed

Nag, Ambarish; Karpinets, Tatiana V; Chang, Christopher H; Bar-Peled, Maor

2012-01-01

Understanding how cellular metabolism works and is regulated requires that the underlying biochemical pathways be adequately represented and integrated with large metabolomic data sets to establish a robust network model. Genetically engineering energy crops to be less recalcitrant to saccharification requires detailed knowledge of plant polysaccharide structures and a thorough understanding of the metabolic pathways involved in forming and regulating cell-wall synthesis. Nucleotide-sugars are building blocks for synthesis of cell wall polysaccharides. The biosynthesis of nucleotide-sugars is catalyzed by a multitude of enzymes that reside in different subcellular organelles, and precise representation of these pathways requires accurate capture of this biological compartmentalization. The lack of simple localization cues in genomic sequence data and annotations however leads to missing compartmentalization information for eukaryotes in automatically generated databases, such as the Pathway-Genome Databases (PGDBs) of the SRI Pathway Tools software that drives much biochemical knowledge representation on the internet. In this report, we provide an informal mechanism using the existing Pathway Tools framework to integrate protein and metabolite sub-cellular localization data with the existing representation of the nucleotide-sugar metabolic pathways in a prototype PGDB for Populus trichocarpa. The enhanced pathway representations have been successfully used to map SNP abundance data to individual nucleotide-sugar biosynthetic genes in the PGDB. The manually curated pathway representations are more conducive to the construction of a computational platform that will allow the simulation of natural and engineered nucleotide-sugar precursor fluxes into specific recalcitrant polysaccharide(s). Database URL: The curated Populus PGDB is available in the BESC public portal at http://cricket.ornl.gov/cgi-bin/beocyc_home.cgi and the nucleotide-sugar biosynthetic pathways can be directly accessed at http://cricket.ornl.gov:1555/PTR/new-image?object=SUGAR-NUCLEOTIDES.

Enhancing a Pathway-Genome Database (PGDB) to capture subcellular localization of metabolites and enzymes: the nucleotide-sugar biosynthetic pathways of Populus trichocarpa

PubMed Central

Nag, Ambarish; Karpinets, Tatiana V.; Chang, Christopher H.; Bar-Peled, Maor

2012-01-01

Understanding how cellular metabolism works and is regulated requires that the underlying biochemical pathways be adequately represented and integrated with large metabolomic data sets to establish a robust network model. Genetically engineering energy crops to be less recalcitrant to saccharification requires detailed knowledge of plant polysaccharide structures and a thorough understanding of the metabolic pathways involved in forming and regulating cell-wall synthesis. Nucleotide-sugars are building blocks for synthesis of cell wall polysaccharides. The biosynthesis of nucleotide-sugars is catalyzed by a multitude of enzymes that reside in different subcellular organelles, and precise representation of these pathways requires accurate capture of this biological compartmentalization. The lack of simple localization cues in genomic sequence data and annotations however leads to missing compartmentalization information for eukaryotes in automatically generated databases, such as the Pathway-Genome Databases (PGDBs) of the SRI Pathway Tools software that drives much biochemical knowledge representation on the internet. In this report, we provide an informal mechanism using the existing Pathway Tools framework to integrate protein and metabolite sub-cellular localization data with the existing representation of the nucleotide-sugar metabolic pathways in a prototype PGDB for Populus trichocarpa. The enhanced pathway representations have been successfully used to map SNP abundance data to individual nucleotide-sugar biosynthetic genes in the PGDB. The manually curated pathway representations are more conducive to the construction of a computational platform that will allow the simulation of natural and engineered nucleotide-sugar precursor fluxes into specific recalcitrant polysaccharide(s). Database URL: The curated Populus PGDB is available in the BESC public portal at http://cricket.ornl.gov/cgi-bin/beocyc_home.cgi and the nucleotide-sugar biosynthetic pathways can be directly accessed at http://cricket.ornl.gov:1555/PTR/new-image?object=SUGAR-NUCLEOTIDES. PMID:22465851

E2FM: an encrypted and compressed full-text index for collections of genomic sequences.

PubMed

Montecuollo, Ferdinando; Schmid, Giovannni; Tagliaferri, Roberto

2017-09-15

Next Generation Sequencing (NGS) platforms and, more generally, high-throughput technologies are giving rise to an exponential growth in the size of nucleotide sequence databases. Moreover, many emerging applications of nucleotide datasets-as those related to personalized medicine-require the compliance with regulations about the storage and processing of sensitive data. We have designed and carefully engineered E 2 FM -index, a new full-text index in minute space which was optimized for compressing and encrypting nucleotide sequence collections in FASTA format and for performing fast pattern-search queries. E 2 FM -index allows to build self-indexes which occupy till to 1/20 of the storage required by the input FASTA file, thus permitting to save about 95% of storage when indexing collections of highly similar sequences; moreover, it can exactly search the built indexes for patterns in times ranging from few milliseconds to a few hundreds milliseconds, depending on pattern length. Source code is available at https://github.com/montecuollo/E2FM . ferdinando.montecuollo@unicampania.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

When insect endosymbionts and plant endophytes mediate biological control outcomes

USDA-ARS?s Scientific Manuscript database

The identification of endosymbionts and endophytes within insect and plant tissues, respectively, has increased exponentially over the past 10-15 years, enabled largely by the proliferation of sensitive molecular techniques and publicly accessible databases of nucleotide sequences. However, the rate...

Proteogenomics: Integrating Next-Generation Sequencing and Mass Spectrometry to Characterize Human Proteomic Variation

NASA Astrophysics Data System (ADS)

Sheynkman, Gloria M.; Shortreed, Michael R.; Cesnik, Anthony J.; Smith, Lloyd M.

2016-06-01

Mass spectrometry-based proteomics has emerged as the leading method for detection, quantification, and characterization of proteins. Nearly all proteomic workflows rely on proteomic databases to identify peptides and proteins, but these databases typically contain a generic set of proteins that lack variations unique to a given sample, precluding their detection. Fortunately, proteogenomics enables the detection of such proteomic variations and can be defined, broadly, as the use of nucleotide sequences to generate candidate protein sequences for mass spectrometry database searching. Proteogenomics is experiencing heightened significance due to two developments: (a) advances in DNA sequencing technologies that have made complete sequencing of human genomes and transcriptomes routine, and (b) the unveiling of the tremendous complexity of the human proteome as expressed at the levels of genes, cells, tissues, individuals, and populations. We review here the field of human proteogenomics, with an emphasis on its history, current implementations, the types of proteomic variations it reveals, and several important applications.

Proteogenomics: Integrating Next-Generation Sequencing and Mass Spectrometry to Characterize Human Proteomic Variation

PubMed Central

Sheynkman, Gloria M.; Shortreed, Michael R.; Cesnik, Anthony J.; Smith, Lloyd M.

2016-01-01

Mass spectrometry–based proteomics has emerged as the leading method for detection, quantification, and characterization of proteins. Nearly all proteomic workflows rely on proteomic databases to identify peptides and proteins, but these databases typically contain a generic set of proteins that lack variations unique to a given sample, precluding their detection. Fortunately, proteogenomics enables the detection of such proteomic variations and can be defined, broadly, as the use of nucleotide sequences to generate candidate protein sequences for mass spectrometry database searching. Proteogenomics is experiencing heightened significance due to two developments: (a) advances in DNA sequencing technologies that have made complete sequencing of human genomes and transcriptomes routine, and (b) the unveiling of the tremendous complexity of the human proteome as expressed at the levels of genes, cells, tissues, individuals, and populations. We review here the field of human proteogenomics, with an emphasis on its history, current implementations, the types of proteomic variations it reveals, and several important applications. PMID:27049631

ApiEST-DB: analyzing clustered EST data of the apicomplexan parasites.

PubMed

Li, Li; Crabtree, Jonathan; Fischer, Steve; Pinney, Deborah; Stoeckert, Christian J; Sibley, L David; Roos, David S

2004-01-01

ApiEST-DB (http://www.cbil.upenn.edu/paradbs-servlet/) provides integrated access to publicly available EST data from protozoan parasites in the phylum Apicomplexa. The database currently incorporates a total of nearly 100,000 ESTs from several parasite species of clinical and/or veterinary interest, including Eimeria tenella, Neospora caninum, Plasmodium falciparum, Sarcocystis neurona and Toxoplasma gondii. To facilitate analysis of these data, EST sequences were clustered and assembled to form consensus sequences for each organism, and these assemblies were then subjected to automated annotation via similarity searches against protein and domain databases. The underlying relational database infrastructure, Genomics Unified Schema (GUS), enables complex biologically based queries, facilitating validation of gene models, identification of alternative splicing, detection of single nucleotide polymorphisms, identification of stage-specific genes and recognition of phylogenetically conserved and phylogenetically restricted sequences.

SALAD database: a motif-based database of protein annotations for plant comparative genomics

PubMed Central

Mihara, Motohiro; Itoh, Takeshi; Izawa, Takeshi

2010-01-01

Proteins often have several motifs with distinct evolutionary histories. Proteins with similar motifs have similar biochemical properties and thus related biological functions. We constructed a unique comparative genomics database termed the SALAD database (http://salad.dna.affrc.go.jp/salad/) from plant-genome-based proteome data sets. We extracted evolutionarily conserved motifs by MEME software from 209 529 protein-sequence annotation groups selected by BLASTP from the proteome data sets of 10 species: rice, sorghum, Arabidopsis thaliana, grape, a lycophyte, a moss, 3 algae, and yeast. Similarity clustering of each protein group was performed by pairwise scoring of the motif patterns of the sequences. The SALAD database provides a user-friendly graphical viewer that displays a motif pattern diagram linked to the resulting bootstrapped dendrogram for each protein group. Amino-acid-sequence-based and nucleotide-sequence-based phylogenetic trees for motif combination alignment, a logo comparison diagram for each clade in the tree, and a Pfam-domain pattern diagram are also available. We also developed a viewer named ‘SALAD on ARRAYs’ to view arbitrary microarray data sets of paralogous genes linked to the same dendrogram in a window. The SALAD database is a powerful tool for comparing protein sequences and can provide valuable hints for biological analysis. PMID:19854933

Assembly: a resource for assembled genomes at NCBI

PubMed Central

Kitts, Paul A.; Church, Deanna M.; Thibaud-Nissen, Françoise; Choi, Jinna; Hem, Vichet; Sapojnikov, Victor; Smith, Robert G.; Tatusova, Tatiana; Xiang, Charlie; Zherikov, Andrey; DiCuccio, Michael; Murphy, Terence D.; Pruitt, Kim D.; Kimchi, Avi

2016-01-01

The NCBI Assembly database (www.ncbi.nlm.nih.gov/assembly/) provides stable accessioning and data tracking for genome assembly data. The model underlying the database can accommodate a range of assembly structures, including sets of unordered contig or scaffold sequences, bacterial genomes consisting of a single complete chromosome, or complex structures such as a human genome with modeled allelic variation. The database provides an assembly accession and version to unambiguously identify the set of sequences that make up a particular version of an assembly, and tracks changes to updated genome assemblies. The Assembly database reports metadata such as assembly names, simple statistical reports of the assembly (number of contigs and scaffolds, contiguity metrics such as contig N50, total sequence length and total gap length) as well as the assembly update history. The Assembly database also tracks the relationship between an assembly submitted to the International Nucleotide Sequence Database Consortium (INSDC) and the assembly represented in the NCBI RefSeq project. Users can find assemblies of interest by querying the Assembly Resource directly or by browsing available assemblies for a particular organism. Links in the Assembly Resource allow users to easily download sequence and annotations for current versions of genome assemblies from the NCBI genomes FTP site. PMID:26578580

SALAD database: a motif-based database of protein annotations for plant comparative genomics.

PubMed

Mihara, Motohiro; Itoh, Takeshi; Izawa, Takeshi

2010-01-01

Proteins often have several motifs with distinct evolutionary histories. Proteins with similar motifs have similar biochemical properties and thus related biological functions. We constructed a unique comparative genomics database termed the SALAD database (http://salad.dna.affrc.go.jp/salad/) from plant-genome-based proteome data sets. We extracted evolutionarily conserved motifs by MEME software from 209,529 protein-sequence annotation groups selected by BLASTP from the proteome data sets of 10 species: rice, sorghum, Arabidopsis thaliana, grape, a lycophyte, a moss, 3 algae, and yeast. Similarity clustering of each protein group was performed by pairwise scoring of the motif patterns of the sequences. The SALAD database provides a user-friendly graphical viewer that displays a motif pattern diagram linked to the resulting bootstrapped dendrogram for each protein group. Amino-acid-sequence-based and nucleotide-sequence-based phylogenetic trees for motif combination alignment, a logo comparison diagram for each clade in the tree, and a Pfam-domain pattern diagram are also available. We also developed a viewer named 'SALAD on ARRAYs' to view arbitrary microarray data sets of paralogous genes linked to the same dendrogram in a window. The SALAD database is a powerful tool for comparing protein sequences and can provide valuable hints for biological analysis.

muBLASTP: database-indexed protein sequence search on multicore CPUs.

PubMed

Zhang, Jing; Misra, Sanchit; Wang, Hao; Feng, Wu-Chun

2016-11-04

The Basic Local Alignment Search Tool (BLAST) is a fundamental program in the life sciences that searches databases for sequences that are most similar to a query sequence. Currently, the BLAST algorithm utilizes a query-indexed approach. Although many approaches suggest that sequence search with a database index can achieve much higher throughput (e.g., BLAT, SSAHA, and CAFE), they cannot deliver the same level of sensitivity as the query-indexed BLAST, i.e., NCBI BLAST, or they can only support nucleotide sequence search, e.g., MegaBLAST. Due to different challenges and characteristics between query indexing and database indexing, the existing techniques for query-indexed search cannot be used into database indexed search. muBLASTP, a novel database-indexed BLAST for protein sequence search, delivers identical hits returned to NCBI BLAST. On Intel Haswell multicore CPUs, for a single query, the single-threaded muBLASTP achieves up to a 4.41-fold speedup for alignment stages, and up to a 1.75-fold end-to-end speedup over single-threaded NCBI BLAST. For a batch of queries, the multithreaded muBLASTP achieves up to a 5.7-fold speedups for alignment stages, and up to a 4.56-fold end-to-end speedup over multithreaded NCBI BLAST. With a newly designed index structure for protein database and associated optimizations in BLASTP algorithm, we re-factored BLASTP algorithm for modern multicore processors that achieves much higher throughput with acceptable memory footprint for the database index.

Identification of novel microRNAs in Hevea brasiliensis and computational prediction of their targets

PubMed Central

2012-01-01

Background Plants respond to external stimuli through fine regulation of gene expression partially ensured by small RNAs. Of these, microRNAs (miRNAs) play a crucial role. They negatively regulate gene expression by targeting the cleavage or translational inhibition of target messenger RNAs (mRNAs). In Hevea brasiliensis, environmental and harvesting stresses are known to affect natural rubber production. This study set out to identify abiotic stress-related miRNAs in Hevea using next-generation sequencing and bioinformatic analysis. Results Deep sequencing of small RNAs was carried out on plantlets subjected to severe abiotic stress using the Solexa technique. By combining the LeARN pipeline, data from the Plant microRNA database (PMRD) and Hevea EST sequences, we identified 48 conserved miRNA families already characterized in other plant species, and 10 putatively novel miRNA families. The results showed the most abundant size for miRNAs to be 24 nucleotides, except for seven families. Several MIR genes produced both 20-22 nucleotides and 23-27 nucleotides. The two miRNA class sizes were detected for both conserved and putative novel miRNA families, suggesting their functional duality. The EST databases were scanned with conserved and novel miRNA sequences. MiRNA targets were computationally predicted and analysed. The predicted targets involved in "responses to stimuli" and to "antioxidant" and "transcription activities" are presented. Conclusions Deep sequencing of small RNAs combined with transcriptomic data is a powerful tool for identifying conserved and novel miRNAs when the complete genome is not yet available. Our study provided additional information for evolutionary studies and revealed potentially specific regulation of the control of redox status in Hevea. PMID:22330773

Genetic discovery in Xylella fastidiosa through sequence analysis of selected randomly amplified polymorphic DNAs.

PubMed

Chen, Jianchi; Civerolo, Edwin L; Jarret, Robert L; Van Sluys, Marie-Anne; de Oliveira, Mariana C

2005-02-01

Xylella fastidiosa causes many important plant diseases including Pierce's disease (PD) in grape and almond leaf scorch disease (ALSD). DNA-based methodologies, such as randomly amplified polymorphic DNA (RAPD) analysis, have been playing key roles in genetic information collection of the bacterium. This study further analyzed the nucleotide sequences of selected RAPDs from X. fastidiosa strains in conjunction with the available genome sequence databases and unveiled several previously unknown novel genetic traits. These include a sequence highly similar to those in the phage family of Podoviridae. Genome comparisons among X. fastidiosa strains suggested that the "phage" is currently active. Two other RAPDs were also related to horizontal gene transfer: one was part of a broadly distributed cryptic plasmid and the other was associated with conjugal transfer. One RAPD inferred a genomic rearrangement event among X. fastidiosa PD strains and another identified a single nucleotide polymorphism of evolutionary value.

NABIC: A New Access Portal to Search, Visualize, and Share Agricultural Genomics Data

PubMed Central

Seol, Young-Joo; Lee, Tae-Ho; Park, Dong-Suk; Kim, Chang-Kug

2016-01-01

The National Agricultural Biotechnology Information Center developed an access portal to search, visualize, and share agricultural genomics data with a focus on South Korean information and resources. The portal features an agricultural biotechnology database containing a wide range of omics data from public and proprietary sources. We collected 28.4 TB of data from 162 agricultural organisms, with 10 types of omics data comprising next-generation sequencing sequence read archive, genome, gene, nucleotide, DNA chip, expressed sequence tag, interactome, protein structure, molecular marker, and single-nucleotide polymorphism datasets. Our genomic resources contain information on five animals, seven plants, and one fungus, which is accessed through a genome browser. We also developed a data submission and analysis system as a web service, with easy-to-use functions and cutting-edge algorithms, including those for handling next-generation sequencing data. PMID:26848255

Bifidobacterium aquikefiri sp. nov., isolated from water kefir.

PubMed

Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter

2016-03-01

A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T  = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.

Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

PubMed Central

D'Souza, T M; Boominathan, K; Reddy, C A

1996-01-01

Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

PubMed

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Whole-genome random sequencing and assembly of Haemophilus influenzae Rd

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fleischmann, R.D.; Adams, M.D.; White, O.

1995-07-28

An approach for genome analysis based on sequencing and assembly of unselected pieces of DNA from the whole chromosome has been applied to obtain the complete nucleotide sequence (1,830,137 base pairs) of the genome from the bacterium Haemophilus influenzae Rd. This approach eliminates the need for initial mapping efforts and is therefore applicable to the vast array of microbial species for which genome maps are unavailable. The H. influenzae Rd genome sequence (Genome Sequence DataBase accession number L42023) represents the only complete genome sequence from a free-living organism. 46 refs., 4 figs., 4 tabs.

Submission of nucleotide sequence eimeria acervulina profilin to genbank database

USDA-ARS?s Scientific Manuscript database

Poultry coccidiosis, caused by intestinal protozoa Eimeria, is a severe problem for the poultry industry, leading to a substantial economic burden of over three billion dollars worldwide. Conventional vaccines including live vaccines and attenuated vaccines could cause mild to severe reactions Numer...

MAGIC database and interfaces: an integrated package for gene discovery and expression.

PubMed

Cordonnier-Pratt, Marie-Michèle; Liang, Chun; Wang, Haiming; Kolychev, Dmitri S; Sun, Feng; Freeman, Robert; Sullivan, Robert; Pratt, Lee H

2004-01-01

The rapidly increasing rate at which biological data is being produced requires a corresponding growth in relational databases and associated tools that can help laboratories contend with that data. With this need in mind, we describe here a Modular Approach to a Genomic, Integrated and Comprehensive (MAGIC) Database. This Oracle 9i database derives from an initial focus in our laboratory on gene discovery via production and analysis of expressed sequence tags (ESTs), and subsequently on gene expression as assessed by both EST clustering and microarrays. The MAGIC Gene Discovery portion of the database focuses on information derived from DNA sequences and on its biological relevance. In addition to MAGIC SEQ-LIMS, which is designed to support activities in the laboratory, it contains several additional subschemas. The latter include MAGIC Admin for database administration, MAGIC Sequence for sequence processing as well as sequence and clone attributes, MAGIC Cluster for the results of EST clustering, MAGIC Polymorphism in support of microsatellite and single-nucleotide-polymorphism discovery, and MAGIC Annotation for electronic annotation by BLAST and BLAT. The MAGIC Microarray portion is a MIAME-compliant database with two components at present. These are MAGIC Array-LIMS, which makes possible remote entry of all information into the database, and MAGIC Array Analysis, which provides data mining and visualization. Because all aspects of interaction with the MAGIC Database are via a web browser, it is ideally suited not only for individual research laboratories but also for core facilities that serve clients at any distance.

TryTransDB: A web-based resource for transport proteins in Trypanosomatidae.

PubMed

Sonar, Krushna; Kabra, Ritika; Singh, Shailza

2018-03-12

TryTransDB is a web-based resource that stores transport protein data which can be retrieved using a standalone BLAST tool. We have attempted to create an integrated database that can be a one-stop shop for the researchers working with transport proteins of Trypanosomatidae family. TryTransDB (Trypanosomatidae Transport Protein Database) is a web based comprehensive resource that can fire a BLAST search against most of the transport protein sequences (protein and nucleotide) from Trypanosomatidae family organisms. This web resource further allows to compute a phylogenetic tree by performing multiple sequence alignment (MSA) using CLUSTALW suite embedded in it. Also, cross-linking to other databases helps in gathering more information for a certain transport protein in a single website.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Submission of nucleotide sequence clostridium perfringens NetB toxin to genbank database

USDA-ARS?s Scientific Manuscript database

Clostridium perfringens can cause gas gangrene and food poisoning in humans and causes several enterot-oxemic diseases in animals including avian necrotic enteritis. This disease affects all chicken producing countries worldwide and is a considerable burden on the commercial chicken production indus...

Submission of nucleotide sequence chicken IL-7 to genbank database

USDA-ARS?s Scientific Manuscript database

Mammalian interleukin-7 (IL-7) is able to stimulate lymphocyte proliferation and maturation, and reverse immuno-suppression. However, whether poultry IL-7 has similar functions remains unclear. Chicken IL-7 promoted mouse B cell proliferation in vitro, and significantly reduced virus titer in bursal...

VKCDB: voltage-gated K+ channel database updated and upgraded.

PubMed

Gallin, Warren J; Boutet, Patrick A

2011-01-01

The Voltage-gated K(+) Channel DataBase (VKCDB) (http://vkcdb.biology.ualberta.ca) makes a comprehensive set of sequence data readily available for phylogenetic and comparative analysis. The current update contains 2063 entries for full-length or nearly full-length unique channel sequences from Bacteria (477), Archaea (18) and Eukaryotes (1568), an increase from 346 solely eukaryotic entries in the original release. In addition to protein sequences for channels, corresponding nucleotide sequences of the open reading frames corresponding to the amino acid sequences are now available and can be extracted in parallel with sets of protein sequences. Channels are categorized into subfamilies by phylogenetic analysis and by using hidden Markov model analyses. Although the raw database contains a number of fragmentary, duplicated, obsolete and non-channel sequences that were collected in early steps of data collection, the web interface will only return entries that have been validated as likely K(+) channels. The retrieval function of the web interface allows retrieval of entries that contain a substantial fraction of the core structural elements of VKCs, fragmentary entries, or both. The full database can be downloaded as either a MySQL dump or as an XML dump from the web site. We have now implemented automated updates at quarterly intervals.

Molecular variation and distribution of Anopheles fluviatilis (Diptera: Culicidae) complex in Iran.

PubMed

Naddaf, Saied Reza; Razavi, Mohammad Reza; Bahramali, Golnaz

2010-09-01

Anopheles fluviatilis James (Diptera: Culicidae) is one of the known malaria vectors in south and southeastern Iran. Earlier ITS2 sequences analysis of specimens from Iran demonstrated only a single genotype that was identical to species Y in India, which is also the same as species T. We identified 2 haplotypes in the An. fluviatilis populations of Iran based on differences in nucleotide sequences of D3 domain of the 28S locus of ribosomal DNA (rDNA). Comparison of sequence data from 44 Iranian specimens with those publicly available in the Genbank database showed that all of the 28S-D3 sequences from Kazeroun and Khesht regions in Fars Province were identical to the database entry representing species U in India. In other regions, all the individuals showed heterozygosity at the single nucleotide position, which identifies species U and T. It is argued that the 2 species may co-occur in some regions and hybridize; however, the heterozygosity in the 28S-D3 locus was not reflected in ITS2 sequences and this locus for all individuals was identical to species T. This study shows that in a newly diverged species, like members of An. fluviatilis complex, a single molecular marker may not be sufficiently discriminatory to identify all the taxa over a vast geographical area. In addition, other molecular markers may provide more reliable information for species discrimination.

DNA barcoding of Clarias gariepinus, Coptodon zillii and Sarotherodon melanotheron from Southwestern Nigeria

PubMed Central

Falade, Mofolusho O.; Opene, Anthony J.; Benson, Otarigho

2016-01-01

DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S) and cytochrome oxidase subunit I (COI) for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI) gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ) and maximum likelihood (ML) methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average), which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria. PMID:27990256

TRedD—A database for tandem repeats over the edit distance

PubMed Central

Sokol, Dina; Atagun, Firat

2010-01-01

A ‘tandem repeat’ in DNA is a sequence of two or more contiguous, approximate copies of a pattern of nucleotides. Tandem repeats are common in the genomes of both eukaryotic and prokaryotic organisms. They are significant markers for human identity testing, disease diagnosis, sequence homology and population studies. In this article, we describe a new database, TRedD, which contains the tandem repeats found in the human genome. The database is publicly available online, and the software for locating the repeats is also freely available. The definition of tandem repeats used by TRedD is a new and innovative definition based upon the concept of ‘evolutive tandem repeats’. In addition, we have developed a tool, called TandemGraph, to graphically depict the repeats occurring in a sequence. This tool can be coupled with any repeat finding software, and it should greatly facilitate analysis of results. Database URL: http://tandem.sci.brooklyn.cuny.edu/ PMID:20624712

CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer.

PubMed

Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel

2011-08-01

Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python <3.0*, MySQL server >5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.

Rice Annotation Project Database (RAP-DB): an integrative and interactive database for rice genomics.

PubMed

Sakai, Hiroaki; Lee, Sung Shin; Tanaka, Tsuyoshi; Numa, Hisataka; Kim, Jungsok; Kawahara, Yoshihiro; Wakimoto, Hironobu; Yang, Ching-chia; Iwamoto, Masao; Abe, Takashi; Yamada, Yuko; Muto, Akira; Inokuchi, Hachiro; Ikemura, Toshimichi; Matsumoto, Takashi; Sasaki, Takuji; Itoh, Takeshi

2013-02-01

The Rice Annotation Project Database (RAP-DB, http://rapdb.dna.affrc.go.jp/) has been providing a comprehensive set of gene annotations for the genome sequence of rice, Oryza sativa (japonica group) cv. Nipponbare. Since the first release in 2005, RAP-DB has been updated several times along with the genome assembly updates. Here, we present our newest RAP-DB based on the latest genome assembly, Os-Nipponbare-Reference-IRGSP-1.0 (IRGSP-1.0), which was released in 2011. We detected 37,869 loci by mapping transcript and protein sequences of 150 monocot species. To provide plant researchers with highly reliable and up to date rice gene annotations, we have been incorporating literature-based manually curated data, and 1,626 loci currently incorporate literature-based annotation data, including commonly used gene names or gene symbols. Transcriptional activities are shown at the nucleotide level by mapping RNA-Seq reads derived from 27 samples. We also mapped the Illumina reads of a Japanese leading japonica cultivar, Koshihikari, and a Chinese indica cultivar, Guangluai-4, to the genome and show alignments together with the single nucleotide polymorphisms (SNPs) and gene functional annotations through a newly developed browser, Short-Read Assembly Browser (S-RAB). We have developed two satellite databases, Plant Gene Family Database (PGFD) and Integrative Database of Cereal Gene Phylogeny (IDCGP), which display gene family and homologous gene relationships among diverse plant species. RAP-DB and the satellite databases offer simple and user-friendly web interfaces, enabling plant and genome researchers to access the data easily and facilitating a broad range of plant research topics.

UCbase 2.0: ultraconserved sequences database (2014 update)

PubMed Central

Lomonaco, Vincenzo; Martoglia, Riccardo; Mandreoli, Federica; Anderlucci, Laura; Emmett, Warren; Bicciato, Silvio; Taccioli, Cristian

2014-01-01

UCbase 2.0 (http://ucbase.unimore.it) is an update, extension and evolution of UCbase, a Web tool dedicated to the analysis of ultraconserved sequences (UCRs). UCRs are 481 sequences >200 bases sharing 100% identity among human, mouse and rat genomes. They are frequently located in genomic regions known to be involved in cancer or differentially expressed in human leukemias and carcinomas. UCbase 2.0 is a platform-independent Web resource that includes the updated version of the human genome annotation (hg19), information linking disorders to chromosomal coordinates based on the Systematized Nomenclature of Medicine classification, a query tool to search for Single Nucleotide Polymorphisms (SNPs) and a new text box to directly interrogate the database using a MySQL interface. To facilitate the interactive visual interpretation of UCR chromosomal positioning, UCbase 2.0 now includes a graph visualization interface directly linked to UCSC genome browser. Database URL: http://ucbase.unimore.it PMID:24951797

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

PubMed

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

ESTree db: a Tool for Peach Functional Genomics

PubMed Central

Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo

2005-01-01

Background The ESTree db represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. Results The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. Conclusion The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig. PMID:16351742

ESTree db: a tool for peach functional genomics.

PubMed

Lazzari, Barbara; Caprera, Andrea; Vecchietti, Alberto; Stella, Alessandra; Milanesi, Luciano; Pozzi, Carlo

2005-12-01

The ESTree db http://www.itb.cnr.it/estree/ represents a collection of Prunus persica expressed sequenced tags (ESTs) and is intended as a resource for peach functional genomics. A total of 6,155 successful EST sequences were obtained from four in-house prepared cDNA libraries from Prunus persica mesocarps at different developmental stages. Another 12,475 peach EST sequences were downloaded from public databases and added to the ESTree db. An automated pipeline was prepared to process EST sequences using public software integrated by in-house developed Perl scripts and data were collected in a MySQL database. A php-based web interface was developed to query the database. The ESTree db version as of April 2005 encompasses 18,630 sequences representing eight libraries. Contig assembly was performed with CAP3. Putative single nucleotide polymorphism (SNP) detection was performed with the AutoSNP program and a search engine was implemented to retrieve results. All the sequences and all the contig consensus sequences were annotated both with blastx against the GenBank nr db and with GOblet against the viridiplantae section of the Gene Ontology db. Links to NiceZyme (Expasy) and to the KEGG metabolic pathways were provided. A local BLAST utility is available. A text search utility allows querying and browsing the database. Statistics were provided on Gene Ontology occurrences to assign sequences to Gene Ontology categories. The resulting database is a comprehensive resource of data and links related to peach EST sequences. The Sequence Report and Contig Report pages work as the web interface core structures, giving quick access to data related to each sequence/contig.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 – 30 November 2011

PubMed Central

ABREU, ALUANA G.; ALBAINA, A.; ALPERMANN, TILMAN J.; APKENAS, VANESSA E.; BANKHEAD-DRONNET, S.; BERGEK, SARA; BERUMEN, MICHAEL L.; CHO, CHANG-HUNG; CLOBERT, JEAN; COULON, AURÉLIE; DE FERAUDY, D.; ESTONBA, A.; HANKELN, THOMAS; HOCHKIRCH, AXEL; HSU, TSAI-WEN; HUANG, TSURNG-JUHN; IRIGOIEN, X.; IRIONDO, M.; KAY, KATHLEEN M.; KINITZ, TIM; KOTHERA, LINDA; LE HÉNANFF, MAXIME; LIEUTIER, F.; LOURDAIS, OLIVIER; MACRINI, CAMILA M. T.; MANZANO, C.; MARTIN, C.; MORRIS, VERONICA R. F.; NANNINGA, GERRIT; PARDO, M. A.; PLIESKE, JÖRG; POINTEAU, S.; PRESTEGAARD, TORE; QUACK, MARKUS; RICHARD, MURIELLE; SAVAGE, HARRY M.; SCHWARCZ, KAISER D.; SHADE, JESSICA; SIMMS, ELLEN L.; SOLFERINI, VERA N.; STEVENS, VIRGINIE M.; VEITH, MICHAEL; WEN, MEI-JUAN; WICKER, FLORIAN; YOST, JENNIFER M.; ZARRAONAINDIA, I.

2017-01-01

This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. PMID:22296658

Complete nucleotide sequence of the freshwater unicellular cyanobacterium Synechococcus elongatus PCC 6301 chromosome: gene content and organization.

PubMed

Sugita, Chieko; Ogata, Koretsugu; Shikata, Masamitsu; Jikuya, Hiroyuki; Takano, Jun; Furumichi, Miho; Kanehisa, Minoru; Omata, Tatsuo; Sugiura, Masahiro; Sugita, Mamoru

2007-01-01

The entire genome of the unicellular cyanobacterium Synechococcus elongatus PCC 6301 (formerly Anacystis nidulans Berkeley strain 6301) was sequenced. The genome consisted of a circular chromosome 2,696,255 bp long. A total of 2,525 potential protein-coding genes, two sets of rRNA genes, 45 tRNA genes representing 42 tRNA species, and several genes for small stable RNAs were assigned to the chromosome by similarity searches and computer predictions. The translated products of 56% of the potential protein-coding genes showed sequence similarities to experimentally identified and predicted proteins of known function, and the products of 35% of the genes showed sequence similarities to the translated products of hypothetical genes. The remaining 9% of genes lacked significant similarities to genes for predicted proteins in the public DNA databases. Some 139 genes coding for photosynthesis-related components were identified. Thirty-seven genes for two-component signal transduction systems were also identified. This is the smallest number of such genes identified in cyanobacteria, except for marine cyanobacteria, suggesting that only simple signal transduction systems are found in this strain. The gene arrangement and nucleotide sequence of Synechococcus elongatus PCC 6301 were nearly identical to those of a closely related strain Synechococcus elongatus PCC 7942, except for the presence of a 188.6 kb inversion. The sequences as well as the gene information shown in this paper are available in the Web database, CYORF (http://www.cyano.genome.jp/).

REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

PubMed Central

Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.

2009-01-01

The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722

Submission of nucleotide sequence eimeria tenella elongation factor 1-alpha to genBank database

USDA-ARS?s Scientific Manuscript database

Avian coccidiosis is caused by multiple species of the apicomplexan protozoan, Eimeria, and is one of the most economically devastating enteric diseases for the poultry industry worldwide. Host immunity to Eimeria infection, however, is relatively species-specific. The ability to immunize chickens a...

Submission of nucleotide sequence clostridium perfringens alpha-toxin to genbank database

USDA-ARS?s Scientific Manuscript database

Clostridium perfringens (CP) is ubiquitous in the nature, and a normal inhabitant in the intestinal tracts of animals and humans. However, pathogenic CP is also a causative agent of poultry disease necrotic enteritis (NE). Clostridium perfringens alpha toxin is a toxin produced by the bacterium Clo...

Submission of nucleotide sequence clostridium perfringens pyruvate-flavodoxin oxi-reductase to genbank database

USDA-ARS?s Scientific Manuscript database

Clostridium perfringens (CP) is ubiquitous in the nature, and a normal inhabitant in the intestinal tracts of animals and humans. However, pathogenic CP is also a causative agent of poultry disease necrotic enteritis (NE). Clostridium-related poultry diseases such as necrotic enteritis (NE) and gang...

Submission of nucleotide sequence clostridium perfringens elongation factor-tu to genbank database

USDA-ARS?s Scientific Manuscript database

Clostridium perfringens (CP) is ubiquitous in the nature, and a normal inhabitant in the intestinal tracts of animals and humans. However, pathogenic CP is also a causative agent of poultry disease necrotic enteritis (NE). Clostridium-related poultry diseases such as necrotic enteritis (NE) and gang...

Bioinformatics: A History of Evolution "In Silico"

ERIC Educational Resources Information Center

Ondrej, Vladan; Dvorak, Petr

2012-01-01

Bioinformatics, biological databases, and the worldwide use of computers have accelerated biological research in many fields, such as evolutionary biology. Here, we describe a primer of nucleotide sequence management and the construction of a phylogenetic tree with two examples; the two selected are from completely different groups of organisms:…

The Yak genome database: an integrative database for studying yak biology and high-altitude adaption

PubMed Central

2012-01-01

Background The yak (Bos grunniens) is a long-haired bovine that lives at high altitudes and is an important source of milk, meat, fiber and fuel. The recent sequencing, assembly and annotation of its genome are expected to further our understanding of the means by which it has adapted to life at high altitudes and its ecologically important traits. Description The Yak Genome Database (YGD) is an internet-based resource that provides access to genomic sequence data and predicted functional information concerning the genes and proteins of Bos grunniens. The curated data stored in the YGD includes genome sequences, predicted genes and associated annotations, non-coding RNA sequences, transposable elements, single nucleotide variants, and three-way whole-genome alignments between human, cattle and yak. YGD offers useful searching and data mining tools, including the ability to search for genes by name or using function keywords as well as GBrowse genome browsers and/or BLAST servers, which can be used to visualize genome regions and identify similar sequences. Sequence data from the YGD can also be downloaded to perform local searches. Conclusions A new yak genome database (YGD) has been developed to facilitate studies on high-altitude adaption and bovine genomics. The database will be continuously updated to incorporate new information such as transcriptome data and population resequencing data. The YGD can be accessed at http://me.lzu.edu.cn/yak. PMID:23134687

Database resources of the National Center for Biotechnology Information: 2002 update

PubMed Central

Wheeler, David L.; Church, Deanna M.; Lash, Alex E.; Leipe, Detlef D.; Madden, Thomas L.; Pontius, Joan U.; Schuler, Gregory D.; Schriml, Lynn M.; Tatusova, Tatiana A.; Wagner, Lukas; Rapp, Barbara A.

2002-01-01

In addition to maintaining the GenBank nucleic acid sequence database, the National Center for Biotechnology Information (NCBI) provides data analysis and retrieval resources that operate on the data in GenBank and a variety of other biological data made available through NCBI’s web site. NCBI data retrieval resources include Entrez, PubMed, LocusLink and the Taxonomy Browser. Data analysis resources include BLAST, Electronic PCR, OrfFinder, RefSeq, UniGene, HomoloGene, Database of Single Nucleotide Polymorphisms (dbSNP), Human Genome Sequencing, Human MapViewer, Human¡VMouse Homology Map, Cancer Chromosome Aberration Project (CCAP), Entrez Genomes, Clusters of Orthologous Groups (COGs) database, Retroviral Genotyping Tools, SAGEmap, Gene Expression Omnibus (GEO), Online Mendelian Inheritance in Man (OMIM), the Molecular Modeling Database (MMDB) and the Conserved Domain Database (CDD). Augmenting many of the web applications are custom implementations of the BLAST program optimized to search specialized data sets. All of the resources can be accessed through the NCBI home page at http://www.ncbi.nlm.nih.gov. PMID:11752242

A new version of the RDP (Ribosomal Database Project)

NASA Technical Reports Server (NTRS)

Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.;

HIV Sequence Compendium 2015

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foley, Brian Thomas; Leitner, Thomas Kenneth; Apetrei, Cristian

This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database ismore » still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.« less

Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

PubMed

Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

2018-01-01

We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

DNA barcode and identification of the varieties and provenances of Taiwan's domestic and imported made teas using ribosomal internal transcribed spacer 2 sequences.

PubMed

Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh

2017-04-01

The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.

Plant Genome Resources at the National Center for Biotechnology Information

PubMed Central

Wheeler, David L.; Smith-White, Brian; Chetvernin, Vyacheslav; Resenchuk, Sergei; Dombrowski, Susan M.; Pechous, Steven W.; Tatusova, Tatiana; Ostell, James

2005-01-01

The National Center for Biotechnology Information (NCBI) integrates data from more than 20 biological databases through a flexible search and retrieval system called Entrez. A core Entrez database, Entrez Nucleotide, includes GenBank and is tightly linked to the NCBI Taxonomy database, the Entrez Protein database, and the scientific literature in PubMed. A suite of more specialized databases for genomes, genes, gene families, gene expression, gene variation, and protein domains dovetails with the core databases to make Entrez a powerful system for genomic research. Linked to the full range of Entrez databases is the NCBI Map Viewer, which displays aligned genetic, physical, and sequence maps for eukaryotic genomes including those of many plants. A specialized plant query page allow maps from all plant genomes covered by the Map Viewer to be searched in tandem to produce a display of aligned maps from several species. PlantBLAST searches against the sequences shown in the Map Viewer allow BLAST alignments to be viewed within a genomic context. In addition, precomputed sequence similarities, such as those for proteins offered by BLAST Link, enable fluid navigation from unannotated to annotated sequences, quickening the pace of discovery. NCBI Web pages for plants, such as Plant Genome Central, complete the system by providing centralized access to NCBI's genomic resources as well as links to organism-specific Web pages beyond NCBI. PMID:16010002

Gene discovery in Boophilus microplus, the cattle tick: the transcriptomes of ovaries, salivary glands, and hemocytes.

PubMed

Santos, Isabel K F de Miranda; Valenzuela, Jesus G; Ribeiro, José Marcos C; de Castro, Marilia; Costa, Juliana Nardelli; Costa, Ana Maria; da Silva, Edson Ramiro; Neto, Olavo Bilac Rego; Rocha, Clarisse; Daffre, Sirlei; Ferreira, Beatriz R; da Silva, João Santana; Szabó, Matias Pablo; Bechara, Gervasio Henrique

2004-10-01

The quest for new control strategies for ticks can profit from high throughput genomics. In order to identify genes that are involved in oogenesis and development, in defense, and in hematophagy, the transcriptomes of ovaries, hemocytes, and salivary glands from rapidly ingurgitating females, and of salivary glands from males of Boophilus microplus were PCR amplified, and the expressed sequence tags (EST) of random clones were mass sequenced. So far, more than 1,344 EST have been generated for these tissues, with approximately 30% novelty, depending on the the tissue studied. To date approximately 760 nucleotide sequences from B. microplus are deposited in the NCBI database. Mass sequencing of partial cDNAs of parasite genes can build up this scant database and rapidly generate a large quantity of useful information about potential targets for immunobiological or chemical control.

JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms

PubMed Central

Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

2015-01-01

The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/ PMID:26424080

JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

PubMed

Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

2015-01-01

The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. © The Author(s) 2015. Published by Oxford University Press.

IMGT, the International ImMunoGeneTics database.

PubMed Central

Lefranc, M P; Giudicelli, V; Busin, C; Bodmer, J; Müller, W; Bontrop, R; Lemaitre, M; Malik, A; Chaume, D

1998-01-01

IMGT, the international ImMunoGeneTics database, is an integrated database specialising in Immunoglobulins (Ig), T cell Receptors (TcR) and Major Histocompatibility Complex (MHC) of all vertebrate species, created by Marie-Paule Lefranc, CNRS, Montpellier II University, Montpellier, France (lefranc@ligm.crbm.cnrs-mop.fr). IMGT includes three databases: LIGM-DB (for Ig and TcR), MHC/HLA-DB and PRIMER-DB (the last two in development). IMGT comprises expertly annotated sequences and alignment tables. LIGM-DB contains more than 23 000 Immunoglobulin and T cell Receptor sequences from 78 species. MHC/HLA-DB contains Class I and Class II Human Leucocyte Antigen alignment tables. An IMGT tool, DNAPLOT, developed for Ig, TcR and MHC sequence alignments, is also available. IMGT works in close collaboration with the EMBL database. IMGT goals are to establish a common data access to all immunogenetics data, including nucleotide and protein sequences, oligonucleotide primers, gene maps and other genetic data of Ig, TcR and MHC molecules, and to provide a graphical user friendly data access. IMGT has important implications in medical research (repertoire in autoimmune diseases, AIDS, leukemias, lymphomas), therapeutical approaches (antibody engineering), genome diversity and genome evolution studies. IMGT is freely available at http://imgt.cnusc.fr:8104 PMID:9399859

Viral genome analysis and knowledge management.

PubMed

Kuiken, Carla; Yoon, Hyejin; Abfalterer, Werner; Gaschen, Brian; Lo, Chienchi; Korber, Bette

2013-01-01

One of the challenges of genetic data analysis is to combine information from sources that are distributed around the world and accessible through a wide array of different methods and interfaces. The HIV database and its footsteps, the hepatitis C virus (HCV) and hemorrhagic fever virus (HFV) databases, have made it their mission to make different data types easily available to their users. This involves a large amount of behind-the-scenes processing, including quality control and analysis of the sequences and their annotation. Gene and protein sequences are distilled from the sequences that are stored in GenBank; to this end, both submitter annotation and script-generated sequences are used. Alignments of both nucleotide and amino acid sequences are generated, manually curated, distilled into an alignment model, and regenerated in an iterative cycle that results in ever better new alignments. Annotation of epidemiological and clinical information is parsed, checked, and added to the database. User interfaces are updated, and new interfaces are added based upon user requests. Vital for its success, the database staff are heavy users of the system, which enables them to fix bugs and find opportunities for improvement. In this chapter we describe some of the infrastructure that keeps these heavily used analysis platforms alive and vital after nearly 25 years of use. The database/analysis platforms described in this chapter can be accessed at http://hiv.lanl.gov http://hcv.lanl.gov http://hfv.lanl.gov.

CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

PubMed Central

Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

2003-01-01

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

BIOSPIDA: A Relational Database Translator for NCBI.

PubMed

Hagen, Matthew S; Lee, Eva K

2010-11-13

As the volume and availability of biological databases continue widespread growth, it has become increasingly difficult for research scientists to identify all relevant information for biological entities of interest. Details of nucleotide sequences, gene expression, molecular interactions, and three-dimensional structures are maintained across many different databases. To retrieve all necessary information requires an integrated system that can query multiple databases with minimized overhead. This paper introduces a universal parser and relational schema translator that can be utilized for all NCBI databases in Abstract Syntax Notation (ASN.1). The data models for OMIM, Entrez-Gene, Pubmed, MMDB and GenBank have been successfully converted into relational databases and all are easily linkable helping to answer complex biological questions. These tools facilitate research scientists to locally integrate databases from NCBI without significant workload or development time.

UCbase 2.0: ultraconserved sequences database (2014 update).

PubMed

Lomonaco, Vincenzo; Martoglia, Riccardo; Mandreoli, Federica; Anderlucci, Laura; Emmett, Warren; Bicciato, Silvio; Taccioli, Cristian

2014-01-01

UCbase 2.0 (http://ucbase.unimore.it) is an update, extension and evolution of UCbase, a Web tool dedicated to the analysis of ultraconserved sequences (UCRs). UCRs are 481 sequences >200 bases sharing 100% identity among human, mouse and rat genomes. They are frequently located in genomic regions known to be involved in cancer or differentially expressed in human leukemias and carcinomas. UCbase 2.0 is a platform-independent Web resource that includes the updated version of the human genome annotation (hg19), information linking disorders to chromosomal coordinates based on the Systematized Nomenclature of Medicine classification, a query tool to search for Single Nucleotide Polymorphisms (SNPs) and a new text box to directly interrogate the database using a MySQL interface. To facilitate the interactive visual interpretation of UCR chromosomal positioning, UCbase 2.0 now includes a graph visualization interface directly linked to UCSC genome browser. Database URL: http://ucbase.unimore.it. © The Author(s) 2014. Published by Oxford University Press.

CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer

PubMed Central

Carter, Hannah; Diekhans, Mark; Ryan, Michael C.; Karchin, Rachel

2011-01-01

Summary: Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. Availability and Implementation: MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python <3.0*, MySQL server >5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM. Contact: karchin@jhu.edu Supplementary Information: Supplementary data are available at Bioinformatics online. PMID:21685053

Filovirus RefSeq Entries: Evaluation and Selection of Filovirus Type Variants, Type Sequences, and Names

PubMed Central

Kuhn, Jens H.; Andersen, Kristian G.; Bào, Yīmíng; Bavari, Sina; Becker, Stephan; Bennett, Richard S.; Bergman, Nicholas H.; Blinkova, Olga; Bradfute, Steven; Brister, J. Rodney; Bukreyev, Alexander; Chandran, Kartik; Chepurnov, Alexander A.; Davey, Robert A.; Dietzgen, Ralf G.; Doggett, Norman A.; Dolnik, Olga; Dye, John M.; Enterlein, Sven; Fenimore, Paul W.; Formenty, Pierre; Freiberg, Alexander N.; Garry, Robert F.; Garza, Nicole L.; Gire, Stephen K.; Gonzalez, Jean-Paul; Griffiths, Anthony; Happi, Christian T.; Hensley, Lisa E.; Herbert, Andrew S.; Hevey, Michael C.; Hoenen, Thomas; Honko, Anna N.; Ignatyev, Georgy M.; Jahrling, Peter B.; Johnson, Joshua C.; Johnson, Karl M.; Kindrachuk, Jason; Klenk, Hans-Dieter; Kobinger, Gary; Kochel, Tadeusz J.; Lackemeyer, Matthew G.; Lackner, Daniel F.; Leroy, Eric M.; Lever, Mark S.; Mühlberger, Elke; Netesov, Sergey V.; Olinger, Gene G.; Omilabu, Sunday A.; Palacios, Gustavo; Panchal, Rekha G.; Park, Daniel J.; Patterson, Jean L.; Paweska, Janusz T.; Peters, Clarence J.; Pettitt, James; Pitt, Louise; Radoshitzky, Sheli R.; Ryabchikova, Elena I.; Saphire, Erica Ollmann; Sabeti, Pardis C.; Sealfon, Rachel; Shestopalov, Aleksandr M.; Smither, Sophie J.; Sullivan, Nancy J.; Swanepoel, Robert; Takada, Ayato; Towner, Jonathan S.; van der Groen, Guido; Volchkov, Viktor E.; Volchkova, Valentina A.; Wahl-Jensen, Victoria; Warren, Travis K.; Warfield, Kelly L.; Weidmann, Manfred; Nichol, Stuart T.

2014-01-01

Sequence determination of complete or coding-complete genomes of viruses is becoming common practice for supporting the work of epidemiologists, ecologists, virologists, and taxonomists. Sequencing duration and costs are rapidly decreasing, sequencing hardware is under modification for use by non-experts, and software is constantly being improved to simplify sequence data management and analysis. Thus, analysis of virus disease outbreaks on the molecular level is now feasible, including characterization of the evolution of individual virus populations in single patients over time. The increasing accumulation of sequencing data creates a management problem for the curators of commonly used sequence databases and an entry retrieval problem for end users. Therefore, utilizing the data to their fullest potential will require setting nomenclature and annotation standards for virus isolates and associated genomic sequences. The National Center for Biotechnology Information’s (NCBI’s) RefSeq is a non-redundant, curated database for reference (or type) nucleotide sequence records that supplies source data to numerous other databases. Building on recently proposed templates for filovirus variant naming [ ()////-], we report consensus decisions from a majority of past and currently active filovirus experts on the eight filovirus type variants and isolates to be represented in RefSeq, their final designations, and their associated sequences. PMID:25256396

Graphical classification of DNA sequences of HLA alleles by deep learning.

PubMed

Miyake, Jun; Kaneshita, Yuhei; Asatani, Satoshi; Tagawa, Seiichi; Niioka, Hirohiko; Hirano, Takashi

2018-04-01

Alleles of human leukocyte antigen (HLA)-A DNAs are classified and expressed graphically by using artificial intelligence "Deep Learning (Stacked autoencoder)". Nucleotide sequence data corresponding to the length of 822 bp, collected from the Immuno Polymorphism Database, were compressed to 2-dimensional representation and were plotted. Profiles of the two-dimensional plots indicate that the alleles can be classified as clusters are formed. The two-dimensional plot of HLA-A DNAs gives a clear outlook for characterizing the various alleles.

Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.

PubMed

Robinson, N J; Robinson, P J; Gupta, A; Bleasby, A J; Whitton, B A; Morby, A P

1995-03-11

An octameric palindrome (5'-GCGATCGC-3') is abundant in cyanobacterial sequences within databases (GenBank/EMBL) and was designated HIP1 (highly iterated palindrome). The frequency of occurrence of all 256 octameric palindromes has now been determined in sub-databases revealing large and unique over-representation of HIP1 in cyanobacterial entries. DNA sequences from other bacteria were searched for any over-represented octameric palindromes analogous to HIP1. Only two sequences were identified, in the genomes of a thermophile and halophilic archaebacteria, although these were less abundant than HIP1 in cyanobacteria and relate to codon usage. To test the proposed widespread distribution of HIP1 in DNA from the cyanobacterium Synechococcus PCC 6301, randomly selected genomic clones were partly sequenced. HIP1 constituted 2.5% of the novel sequences, equivalent to a site on average once every 320 nucleotides. An oligonucleotide including HIP1 was also tested in PCR. Multiple products were obtained using template DNA from cyanobacterial strains in which HIP1 is abundant in known sequences, and some strains generated characteristic HIP-PCR banding patterns. However, analysis of DNA from one strain (not previously represented in databases) by random sequencing, HIP-PCR and Pvul digestion, confirms that not all cyanobacterial genomes are rich in HIP1.

A Bioinformatics Workflow for Variant Peptide Detection in Shotgun Proteomics*

PubMed Central

Li, Jing; Su, Zengliu; Ma, Ze-Qiang; Slebos, Robbert J. C.; Halvey, Patrick; Tabb, David L.; Liebler, Daniel C.; Pao, William; Zhang, Bing

2011-01-01

Shotgun proteomics data analysis usually relies on database search. However, commonly used protein sequence databases do not contain information on protein variants and thus prevent variant peptides and proteins from been identified. Including known coding variations into protein sequence databases could help alleviate this problem. Based on our recently published human Cancer Proteome Variation Database, we have created a protein sequence database that comprehensively annotates thousands of cancer-related coding variants collected in the Cancer Proteome Variation Database as well as noncancer-specific ones from the Single Nucleotide Polymorphism Database (dbSNP). Using this database, we then developed a data analysis workflow for variant peptide identification in shotgun proteomics. The high risk of false positive variant identifications was addressed by a modified false discovery rate estimation method. Analysis of colorectal cancer cell lines SW480, RKO, and HCT-116 revealed a total of 81 peptides that contain either noncancer-specific or cancer-related variations. Twenty-three out of 26 variants randomly selected from the 81 were confirmed by genomic sequencing. We further applied the workflow on data sets from three individual colorectal tumor specimens. A total of 204 distinct variant peptides were detected, and five carried known cancer-related mutations. Each individual showed a specific pattern of cancer-related mutations, suggesting potential use of this type of information for personalized medicine. Compatibility of the workflow has been tested with four popular database search engines including Sequest, Mascot, X!Tandem, and MyriMatch. In summary, we have developed a workflow that effectively uses existing genomic data to enable variant peptide detection in proteomics. PMID:21389108

Absence of ancient DNA in sub-fossil insect inclusions preserved in 'Anthropocene' Colombian copal.

PubMed

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L; Preziosi, Richard F; Brown, Terence A

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in 'Anthropocene' Colombian copal, dated to 'post-Bomb' and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal.

Absence of Ancient DNA in Sub-Fossil Insect Inclusions Preserved in ‘Anthropocene’ Colombian Copal

PubMed Central

Penney, David; Wadsworth, Caroline; Fox, Graeme; Kennedy, Sandra L.; Preziosi, Richard F.; Brown, Terence A.

2013-01-01

Insects preserved in copal, the sub-fossilized resin precursor of amber, have potential value in molecular ecological studies of recently-extinct species and of extant species that have never been collected as living specimens. The objective of the work reported in this paper was therefore to determine if ancient DNA is present in insects preserved in copal. We prepared DNA libraries from two stingless bees (Apidae: Meliponini: Trigonisca ameliae) preserved in ‘Anthropocene’ Colombian copal, dated to ‘post-Bomb’ and 10,612±62 cal yr BP, respectively, and obtained sequence reads using the GS Junior 454 System. Read numbers were low, but were significantly higher for DNA extracts prepared from crushed insects compared with extracts obtained by a non-destructive method. The younger specimen yielded sequence reads up to 535 nucleotides in length, but searches of these sequences against the nucleotide database revealed very few significant matches. None of these hits was to stingless bees though one read of 97 nucleotides aligned with two non-contiguous segments of the mitochondrial cytochrome oxidase subunit I gene of the East Asia bumblebee Bombus hypocrita. The most significant hit was for 452 nucleotides of a 470-nucleotide read that aligned with part of the genome of the root-nodulating bacterium Bradyrhizobium japonicum. The other significant hits were to proteobacteria and an actinomycete. Searches directed specifically at Apidae nucleotide sequences only gave short and insignificant alignments. All of the reads from the older specimen appeared to be artefacts. We were therefore unable to obtain any convincing evidence for the preservation of ancient DNA in either of the two copal inclusions that we studied, and conclude that DNA is not preserved in this type of material. Our results raise further doubts about claims of DNA extraction from fossil insects in amber, many millions of years older than copal. PMID:24039876

Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

PubMed

Xu, Weijia; Ozer, Stuart; Gutell, Robin R

2009-01-01

With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA

PubMed Central

Xu, Weijia; Ozer, Stuart; Gutell, Robin R.

2010-01-01

With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure. PMID:20502534

Molecular Tracing of Hepatitis C Virus Genotype 1 Isolates in Iran: A NS5B Phylogenetic Analysis with Systematic Review.

PubMed

Hesamizadeh, Khashayar; Alavian, Seyed Moayed; Najafi Tireh Shabankareh, Azar; Sharafi, Heidar

2016-12-01

Hepatitis C virus (HCV) is characterized by a high degree of genetic heterogeneity and classified into 7 genotypes and different subtypes. It heterogeneously distributed through various risk groups and geographical regions. A well-established phylogenetic relationship can simplify the tracing of HCV hierarchical strata into geographical regions. The current study aimed to find genetic phylogeny of subtypes 1a and 1b of HCV isolates based on NS5B nucleotide sequences in Iran and other members of Eastern Mediterranean regional office of world health organization, as well as other Middle Eastern countries, with a systematic review of available published and unpublished studies. The phylogenetic analyses were performed based on the nucleotide sequences of NS5B gene of HCV genotype 1 (HCV-1), which were registered in the GenBank database. The literature review was performed in two steps: 1) searching studies evaluating the NS5B sequences of HCV-1, on PubMed, Scopus, and Web of Science, and 2) Searching sequences of unpublished studies registered in the GenBank database. In this study, 442 sequences from HCV-1a and 232 from HCV-1b underwent phylogenetic analysis. Phylogenetic analysis of all sequences revealed different clusters in the phylogenetic trees. The results showed that the proportion of HCV-1a and -1b isolates from Iranian patients probably originated from domestic sources. Moreover, the HCV-1b isolates from Iranian patients may have similarities with the European ones. In this study, phylogenetic reconstruction of HCV-1 sequences clearly indicated for molecular tracing and ancestral relationships of the HCV genotypes in Iran, and showed the likelihood of domestic origin for HCV-1a and various origin for HCV-1b.

Ricebase: a breeding and genetics platform for rice, integrating individual molecular markers, pedigrees, and whole-genome-based data

USDA-ARS?s Scientific Manuscript database

Ricebase (http://ricebase.org) is an integrative genomic database for rice (Oryza sativa) with an emphasis on combining data sets in a way that maintains the key links between past and current genetic studies. Ricebase includes DNA sequence data, gene annotations, nucleotide variation data, and mol...

Database resources of the National Center for Biotechnology Information

PubMed Central

Wheeler, David L.; Church, Deanna M.; Lash, Alex E.; Leipe, Detlef D.; Madden, Thomas L.; Pontius, Joan U.; Schuler, Gregory D.; Schriml, Lynn M.; Tatusova, Tatiana A.; Wagner, Lukas; Rapp, Barbara A.

2001-01-01

In addition to maintaining the GenBank® nucleic acid sequence database, the National Center for Biotechnology Information (NCBI) provides data analysis and retrieval resources that operate on the data in GenBank and a variety of other biological data made available through NCBI’s Web site. NCBI data retrieval resources include Entrez, PubMed, LocusLink and the Taxonomy Browser. Data analysis resources include BLAST, Electronic PCR, OrfFinder, RefSeq, UniGene, HomoloGene, Database of Single Nucleotide Polymorphisms (dbSNP), Human Genome Sequencing, Human MapViewer, GeneMap’99, Human–Mouse Homology Map, Cancer Chromosome Aberration Project (CCAP), Entrez Genomes, Clusters of Orthologous Groups (COGs) database, Retroviral Genotyping Tools, Cancer Genome Anatomy Project (CGAP), SAGEmap, Gene Expression Omnibus (GEO), Online Mendelian Inheri­tance in Man (OMIM), the Molecular Modeling Database (MMDB) and the Conserved Domain Database (CDD). Augmenting many of the Web applications are custom implementations of the BLAST program optimized to search specialized data sets. All of the resources can be accessed through the NCBI home page at: http://www.ncbi.nlm.nih.gov. PMID:11125038

Database resources of the National Center for Biotechnology

PubMed Central

Wheeler, David L.; Church, Deanna M.; Federhen, Scott; Lash, Alex E.; Madden, Thomas L.; Pontius, Joan U.; Schuler, Gregory D.; Schriml, Lynn M.; Sequeira, Edwin; Tatusova, Tatiana A.; Wagner, Lukas

2003-01-01

In addition to maintaining the GenBank(R) nucleic acid sequence database, the National Center for Biotechnology Information (NCBI) provides data analysis and retrieval resources for the data in GenBank and other biological data made available through NCBI's Web site. NCBI resources include Entrez, PubMed, PubMed Central (PMC), LocusLink, the NCBITaxonomy Browser, BLAST, BLAST Link (BLink), Electronic PCR (e-PCR), Open Reading Frame (ORF) Finder, References Sequence (RefSeq), UniGene, HomoloGene, ProtEST, Database of Single Nucleotide Polymorphisms (dbSNP), Human/Mouse Homology Map, Cancer Chromosome Aberration Project (CCAP), Entrez Genomes and related tools, the Map Viewer, Model Maker (MM), Evidence Viewer (EV), Clusters of Orthologous Groups (COGs) database, Retroviral Genotyping Tools, SAGEmap, Gene Expression Omnibus (GEO), Online Mendelian Inheritance in Man (OMIM), the Molecular Modeling Database (MMDB), the Conserved Domain Database (CDD), and the Conserved Domain Architecture Retrieval Tool (CDART). Augmenting many of the Web applications are custom implementations of the BLAST program optimized to search specialized data sets. All of the resources can be accessed through the NCBI home page at: http://www.ncbi.nlm.nih.gov. PMID:12519941

Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

PubMed

Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

2011-08-01

In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam

2014-08-05

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Combined hairpin-antisense compositions and methods for modulating expression

DOEpatents

Shanklin, John; Nguyen, Tam Huu

2015-11-24

A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

Database resources of the National Center for Biotechnology Information

PubMed Central

2015-01-01

The National Center for Biotechnology Information (NCBI) provides a large suite of online resources for biological information and data, including the GenBank® nucleic acid sequence database and the PubMed database of citations and abstracts for published life science journals. Additional NCBI resources focus on literature (Bookshelf, PubMed Central (PMC) and PubReader); medical genetics (ClinVar, dbMHC, the Genetic Testing Registry, HIV-1/Human Protein Interaction Database and MedGen); genes and genomics (BioProject, BioSample, dbSNP, dbVar, Epigenomics, Gene, Gene Expression Omnibus (GEO), Genome, HomoloGene, the Map Viewer, Nucleotide, PopSet, Probe, RefSeq, Sequence Read Archive, the Taxonomy Browser, Trace Archive and UniGene); and proteins and chemicals (Biosystems, COBALT, the Conserved Domain Database (CDD), the Conserved Domain Architecture Retrieval Tool (CDART), the Molecular Modeling Database (MMDB), Protein Clusters, Protein and the PubChem suite of small molecule databases). The Entrez system provides search and retrieval operations for many of these databases. Augmenting many of the Web applications are custom implementations of the BLAST program optimized to search specialized data sets. All of these resources can be accessed through the NCBI home page at http://www.ncbi.nlm.nih.gov. PMID:25398906

Database resources of the National Center for Biotechnology Information

PubMed Central

2016-01-01

The National Center for Biotechnology Information (NCBI) provides a large suite of online resources for biological information and data, including the GenBank® nucleic acid sequence database and the PubMed database of citations and abstracts for published life science journals. Additional NCBI resources focus on literature (PubMed Central (PMC), Bookshelf and PubReader), health (ClinVar, dbGaP, dbMHC, the Genetic Testing Registry, HIV-1/Human Protein Interaction Database and MedGen), genomes (BioProject, Assembly, Genome, BioSample, dbSNP, dbVar, Epigenomics, the Map Viewer, Nucleotide, Probe, RefSeq, Sequence Read Archive, the Taxonomy Browser and the Trace Archive), genes (Gene, Gene Expression Omnibus (GEO), HomoloGene, PopSet and UniGene), proteins (Protein, the Conserved Domain Database (CDD), COBALT, Conserved Domain Architecture Retrieval Tool (CDART), the Molecular Modeling Database (MMDB) and Protein Clusters) and chemicals (Biosystems and the PubChem suite of small molecule databases). The Entrez system provides search and retrieval operations for most of these databases. Augmenting many of the web applications are custom implementations of the BLAST program optimized to search specialized datasets. All of these resources can be accessed through the NCBI home page at www.ncbi.nlm.nih.gov. PMID:26615191

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.

HeLa Nucleic Acid Contamination in The Cancer Genome Atlas Leads to the Misidentification of Human Papillomavirus 18

PubMed Central

Cantalupo, Paul G.; Katz, Joshua P.

2015-01-01

ABSTRACT We searched The Cancer Genome Atlas (TCGA) database for viruses by comparing non-human reads present in transcriptome sequencing (RNA-Seq) and whole-exome sequencing (WXS) data to viral sequence databases. Human papillomavirus 18 (HPV18) is an etiologic agent of cervical cancer, and as expected, we found robust expression of HPV18 genes in cervical cancer samples. In agreement with previous studies, we also found HPV18 transcripts in non-cervical cancer samples, including those from the colon, rectum, and normal kidney. However, in each of these cases, HPV18 gene expression was low, and single-nucleotide variants and positions of genomic alignments matched the integrated portion of HPV18 present in HeLa cells. Chimeric reads that match a known virus-cell junction of HPV18 integrated in HeLa cells were also present in some samples. We hypothesize that HPV18 sequences in these non-cervical samples are due to nucleic acid contamination from HeLa cells. This finding highlights the problems that contamination presents in computational virus detection pipelines. IMPORTANCE Viruses associated with cancer can be detected by searching tumor sequence databases. Several studies involving searches of the TCGA database have reported the presence of HPV18, a known cause of cervical cancer, in a small number of additional cancers, including those of the rectum, kidney, and colon. We have determined that the sequences related to HPV18 in non-cervical samples are due to nucleic acid contamination from HeLa cells. To our knowledge, this is the first report of the misidentification of viruses in next-generation sequencing data of tumors due to contamination with a cancer cell line. These results raise awareness of the difficulty of accurately identifying viruses in human sequence databases. PMID:25631090

Mitochondrial genome of the bullet tuna Auxis rochei from Indo-West Pacific collection provides novel genetic information about two subspecies.

PubMed

Li, Mingming; Guo, Liang; Zhang, Heng; Yang, Sen; Chen, Xinghan; Lin, Haoran; Meng, Zining

2016-09-01

Previously morphological studies supported the division of the bullet tuna into the two subspecies, Auxis rochei rochei and A. rochei eudorax. As a cosmopolitan species, A. rochei rochei ranges in the Indo-West Pacific and Atlantic oceans, while A. rochei eudorax inhabits in eastern Pacific region. Here, we used the HiSeq next-generation sequencing technique to determine the mitochondrial genome (mitogenome) of A. rochei from Indo-West Pacific collection, and then compared our data with mitogenomic sequences of the Atlantic and eastern Pacific retrieved from NCBI database. Results showed the mitogenome of A. rochei from three geographic collections shared the same genes and gene order, similar to typical teleosts. Also, we examined a low level of nucleotide diversity among these mitogenomic sequences. Interestingly, nucleotide diversity of intra-subspecies (Atlantic versus Indo-West) was higher than that of inter-subspecies (Atlantic versus eastern Pacific, Indo-West versus eastern Pacific).

BIOSPIDA: A Relational Database Translator for NCBI

PubMed Central

Hagen, Matthew S.; Lee, Eva K.

2010-01-01

As the volume and availability of biological databases continue widespread growth, it has become increasingly difficult for research scientists to identify all relevant information for biological entities of interest. Details of nucleotide sequences, gene expression, molecular interactions, and three-dimensional structures are maintained across many different databases. To retrieve all necessary information requires an integrated system that can query multiple databases with minimized overhead. This paper introduces a universal parser and relational schema translator that can be utilized for all NCBI databases in Abstract Syntax Notation (ASN.1). The data models for OMIM, Entrez-Gene, Pubmed, MMDB and GenBank have been successfully converted into relational databases and all are easily linkable helping to answer complex biological questions. These tools facilitate research scientists to locally integrate databases from NCBI without significant workload or development time. PMID:21347013

Actinobase: Database on molecular diversity, phylogeny and biocatalytic potential of salt tolerant alkaliphilic actinomycetes.

PubMed

Sharma, Amit K; Gohel, Sangeeta; Singh, Satya P

2012-01-01

Actinobase is a relational database of molecular diversity, phylogeny and biocatalytic potential of haloalkaliphilic actinomycetes. The main objective of this data base is to provide easy access to range of information, data storage, comparison and analysis apart from reduced data redundancy, data entry, storage, retrieval costs and improve data security. Information related to habitat, cell morphology, Gram reaction, biochemical characterization and molecular features would allow researchers in understanding identification and stress adaptation of the existing and new candidates belonging to salt tolerant alkaliphilic actinomycetes. The PHP front end helps to add nucleotides and protein sequence of reported entries which directly help researchers to obtain the required details. Analysis of the genus wise status of the salt tolerant alkaliphilic actinomycetes indicated 6 different genera among the 40 classified entries of the salt tolerant alkaliphilic actinomycetes. The results represented wide spread occurrence of salt tolerant alkaliphilic actinomycetes belonging to diverse taxonomic positions. Entries and information related to actinomycetes in the database are publicly accessible at http://www.actinobase.in. On clustalW/X multiple sequence alignment of the alkaline protease gene sequences, different clusters emerged among the groups. The narrow search and limit options of the constructed database provided comparable information. The user friendly access to PHP front end facilitates would facilitate addition of sequences of reported entries. The database is available for free at http://www.actinobase.in.

PseudoBase: a database with RNA pseudoknots.

PubMed

van Batenburg, F H; Gultyaev, A P; Pleij, C W; Ng, J; Oliehoek, J

2000-01-01

PseudoBase is a database containing structural, functional and sequence data related to RNA pseudo-knots. It can be reached at http://wwwbio. Leiden Univ.nl/ approximately Batenburg/PKB.html. This page will direct the user to a retrieval page from where a particular pseudoknot can be chosen, or to a submission page which enables the user to add pseudoknot information to the database or to an informative page that elaborates on the various aspects of the database. For each pseudoknot, 12 items are stored, e.g. the nucleotides of the region that contains the pseudoknot, the stem positions of the pseudoknot, the EMBL accession number of the sequence that contains this pseudoknot and the support that can be given regarding the reliability of the pseudoknot. Access is via a small number of steps, using 16 different categories. The development process was done by applying the evolutionary methodology for software development rather than by applying the methodology of the classical waterfall model or the more modern spiral model.

A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

PubMed

Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

2017-05-10

Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .

Private and Efficient Query Processing on Outsourced Genomic Databases.

PubMed

Ghasemi, Reza; Al Aziz, Md Momin; Mohammed, Noman; Dehkordi, Massoud Hadian; Jiang, Xiaoqian

2017-09-01

Applications of genomic studies are spreading rapidly in many domains of science and technology such as healthcare, biomedical research, direct-to-consumer services, and legal and forensic. However, there are a number of obstacles that make it hard to access and process a big genomic database for these applications. First, sequencing genomic sequence is a time consuming and expensive process. Second, it requires large-scale computation and storage systems to process genomic sequences. Third, genomic databases are often owned by different organizations, and thus, not available for public usage. Cloud computing paradigm can be leveraged to facilitate the creation and sharing of big genomic databases for these applications. Genomic data owners can outsource their databases in a centralized cloud server to ease the access of their databases. However, data owners are reluctant to adopt this model, as it requires outsourcing the data to an untrusted cloud service provider that may cause data breaches. In this paper, we propose a privacy-preserving model for outsourcing genomic data to a cloud. The proposed model enables query processing while providing privacy protection of genomic databases. Privacy of the individuals is guaranteed by permuting and adding fake genomic records in the database. These techniques allow cloud to evaluate count and top-k queries securely and efficiently. Experimental results demonstrate that a count and a top-k query over 40 Single Nucleotide Polymorphisms (SNPs) in a database of 20 000 records takes around 100 and 150 s, respectively.

A perchlorate sensitive iodide transporter in frogs

PubMed Central

Carr, Deborah L.; Carr, James A.; Willis, Ray E.; Pressley, Thomas A.

2008-01-01

Nucleotide sequence comparisons have identified a gene product in the genome database of African clawed frogs (Xenopus laevis) as a probable member of the solute carrier family of membrane transporters. To confirm its identity as a putative iodide transporter, we examined the function of this sequence after heterologous expression in mammalian cells. A green monkey kidney cell line transfected with the Xenopus nucleotide sequence had significantly greater 125I uptake than sham-transfected control cells. The uptake in carrier-transfected cells was significantly inhibited in the presence of perchlorate, a competitive inhibitor of mammalian Na+/iodide symporter. Tissue distributions of the sequence were also consistent with a role in iodide uptake. The mRNA encoding the carrier was found to be expressed in the thyroid gland, stomach, and kidney of tadpoles from X. laevis, as well as the bullfrog Rana catesbeiana. The ovaries of adult X. laevis also were found to express the carrier. Phylogenetic analysis suggested that the putative X. laevis iodide transporter is orthologous to vertebrate Na+-dependent iodide symporters. We conclude that the amphibian sequence encodes a protein that is indeed a functional Na+/iodide symporter in Xenopus laevis, as well as Rana catesbeiana. PMID:18275962

Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation.

PubMed

O'Leary, Nuala A; Wright, Mathew W; Brister, J Rodney; Ciufo, Stacy; Haddad, Diana; McVeigh, Rich; Rajput, Bhanu; Robbertse, Barbara; Smith-White, Brian; Ako-Adjei, Danso; Astashyn, Alexander; Badretdin, Azat; Bao, Yiming; Blinkova, Olga; Brover, Vyacheslav; Chetvernin, Vyacheslav; Choi, Jinna; Cox, Eric; Ermolaeva, Olga; Farrell, Catherine M; Goldfarb, Tamara; Gupta, Tripti; Haft, Daniel; Hatcher, Eneida; Hlavina, Wratko; Joardar, Vinita S; Kodali, Vamsi K; Li, Wenjun; Maglott, Donna; Masterson, Patrick; McGarvey, Kelly M; Murphy, Michael R; O'Neill, Kathleen; Pujar, Shashikant; Rangwala, Sanjida H; Rausch, Daniel; Riddick, Lillian D; Schoch, Conrad; Shkeda, Andrei; Storz, Susan S; Sun, Hanzhen; Thibaud-Nissen, Francoise; Tolstoy, Igor; Tully, Raymond E; Vatsan, Anjana R; Wallin, Craig; Webb, David; Wu, Wendy; Landrum, Melissa J; Kimchi, Avi; Tatusova, Tatiana; DiCuccio, Michael; Kitts, Paul; Murphy, Terence D; Pruitt, Kim D

2016-01-04

The RefSeq project at the National Center for Biotechnology Information (NCBI) maintains and curates a publicly available database of annotated genomic, transcript, and protein sequence records (http://www.ncbi.nlm.nih.gov/refseq/). The RefSeq project leverages the data submitted to the International Nucleotide Sequence Database Collaboration (INSDC) against a combination of computation, manual curation, and collaboration to produce a standard set of stable, non-redundant reference sequences. The RefSeq project augments these reference sequences with current knowledge including publications, functional features and informative nomenclature. The database currently represents sequences from more than 55,000 organisms (>4800 viruses, >40,000 prokaryotes and >10,000 eukaryotes; RefSeq release 71), ranging from a single record to complete genomes. This paper summarizes the current status of the viral, prokaryotic, and eukaryotic branches of the RefSeq project, reports on improvements to data access and details efforts to further expand the taxonomic representation of the collection. We also highlight diverse functional curation initiatives that support multiple uses of RefSeq data including taxonomic validation, genome annotation, comparative genomics, and clinical testing. We summarize our approach to utilizing available RNA-Seq and other data types in our manual curation process for vertebrate, plant, and other species, and describe a new direction for prokaryotic genomes and protein name management. Published by Oxford University Press on behalf of Nucleic Acids Research 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Transcriptome Analysis and Comparison of Marmota monax and Marmota himalayana.

PubMed

Liu, Yanan; Wang, Baoju; Wang, Lu; Vikash, Vikash; Wang, Qin; Roggendorf, Michael; Lu, Mengji; Yang, Dongliang; Liu, Jia

2016-01-01

The Eastern woodchuck (Marmota monax) is a classical animal model for studying hepatitis B virus (HBV) infection and hepatocellular carcinoma (HCC) in humans. Recently, we found that Marmota himalayana, an Asian animal species closely related to Marmota monax, is susceptible to woodchuck hepatitis virus (WHV) infection and can be used as a new mammalian model for HBV infection. However, the lack of genomic sequence information of both Marmota models strongly limited their application breadth and depth. To address this major obstacle of the Marmota models, we utilized Illumina RNA-Seq technology to sequence the cDNA libraries of liver and spleen samples of two Marmota monax and four Marmota himalayana. In total, over 13 billion nucleotide bases were sequenced and approximately 1.5 billion clean reads were obtained. Following assembly, 106,496 consensus sequences of Marmota monax and 78,483 consensus sequences of Marmota himalayana were detected. For functional annotation, in total 73,603 Unigenes of Marmota monax and 78,483 Unigenes of Marmota himalayana were identified using different databases (NR, NT, Swiss-Prot, KEGG, COG, GO). The Unigenes were aligned by blastx to protein databases to decide the coding DNA sequences (CDS) and in total 41,247 CDS of Marmota monax and 34,033 CDS of Marmota himalayana were predicted. The single nucleotide polymorphisms (SNPs) and the simple sequence repeats (SSRs) were also analyzed for all Unigenes obtained. Moreover, a large-scale transcriptome comparison was performed and revealed a high similarity in transcriptome sequences between the two marmota species. Our study provides an extensive amount of novel sequence information for Marmota monax and Marmota himalayana. This information may serve as a valuable genomics resource for further molecular, developmental and comparative evolutionary studies, as well as for the identification and characterization of functional genes that are involved in WHV infection and HCC development in the woodchuck model.

Transcriptome Analysis and Comparison of Marmota monax and Marmota himalayana

PubMed Central

Wang, Lu; Vikash, Vikash; Wang, Qin; Roggendorf, Michael; Lu, Mengji; Yang, Dongliang; Liu, Jia

2016-01-01

The Eastern woodchuck (Marmota monax) is a classical animal model for studying hepatitis B virus (HBV) infection and hepatocellular carcinoma (HCC) in humans. Recently, we found that Marmota himalayana, an Asian animal species closely related to Marmota monax, is susceptible to woodchuck hepatitis virus (WHV) infection and can be used as a new mammalian model for HBV infection. However, the lack of genomic sequence information of both Marmota models strongly limited their application breadth and depth. To address this major obstacle of the Marmota models, we utilized Illumina RNA-Seq technology to sequence the cDNA libraries of liver and spleen samples of two Marmota monax and four Marmota himalayana. In total, over 13 billion nucleotide bases were sequenced and approximately 1.5 billion clean reads were obtained. Following assembly, 106,496 consensus sequences of Marmota monax and 78,483 consensus sequences of Marmota himalayana were detected. For functional annotation, in total 73,603 Unigenes of Marmota monax and 78,483 Unigenes of Marmota himalayana were identified using different databases (NR, NT, Swiss-Prot, KEGG, COG, GO). The Unigenes were aligned by blastx to protein databases to decide the coding DNA sequences (CDS) and in total 41,247 CDS of Marmota monax and 34,033 CDS of Marmota himalayana were predicted. The single nucleotide polymorphisms (SNPs) and the simple sequence repeats (SSRs) were also analyzed for all Unigenes obtained. Moreover, a large-scale transcriptome comparison was performed and revealed a high similarity in transcriptome sequences between the two marmota species. Our study provides an extensive amount of novel sequence information for Marmota monax and Marmota himalayana. This information may serve as a valuable genomics resource for further molecular, developmental and comparative evolutionary studies, as well as for the identification and characterization of functional genes that are involved in WHV infection and HCC development in the woodchuck model. PMID:27806133

Image Encryption Algorithm Based on Hyperchaotic Maps and Nucleotide Sequences Database

PubMed Central

2017-01-01

Image encryption technology is one of the main means to ensure the safety of image information. Using the characteristics of chaos, such as randomness, regularity, ergodicity, and initial value sensitiveness, combined with the unique space conformation of DNA molecules and their unique information storage and processing ability, an efficient method for image encryption based on the chaos theory and a DNA sequence database is proposed. In this paper, digital image encryption employs a process of transforming the image pixel gray value by using chaotic sequence scrambling image pixel location and establishing superchaotic mapping, which maps quaternary sequences and DNA sequences, and by combining with the logic of the transformation between DNA sequences. The bases are replaced under the displaced rules by using DNA coding in a certain number of iterations that are based on the enhanced quaternary hyperchaotic sequence; the sequence is generated by Chen chaos. The cipher feedback mode and chaos iteration are employed in the encryption process to enhance the confusion and diffusion properties of the algorithm. Theoretical analysis and experimental results show that the proposed scheme not only demonstrates excellent encryption but also effectively resists chosen-plaintext attack, statistical attack, and differential attack. PMID:28392799

DNA barcoding commercially important aquatic invertebrates of Turkey.

PubMed

Keskin, Emre; Atar, Hasan Hüseyin

2013-08-01

DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.

CRITICA: coding region identification tool invoking comparative analysis

NASA Technical Reports Server (NTRS)

Badger, J. H.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

1999-01-01

Gene recognition is essential to understanding existing and future DNA sequence data. CRITICA (Coding Region Identification Tool Invoking Comparative Analysis) is a suite of programs for identifying likely protein-coding sequences in DNA by combining comparative analysis of DNA sequences with more common noncomparative methods. In the comparative component of the analysis, regions of DNA are aligned with related sequences from the DNA databases; if the translation of the aligned sequences has greater amino acid identity than expected for the observed percentage nucleotide identity, this is interpreted as evidence for coding. CRITICA also incorporates noncomparative information derived from the relative frequencies of hexanucleotides in coding frames versus other contexts (i.e., dicodon bias). The dicodon usage information is derived by iterative analysis of the data, such that CRITICA is not dependent on the existence or accuracy of coding sequence annotations in the databases. This independence makes the method particularly well suited for the analysis of novel genomes. CRITICA was tested by analyzing the available Salmonella typhimurium DNA sequences. Its predictions were compared with the DNA sequence annotations and with the predictions of GenMark. CRITICA proved to be more accurate than GenMark, and moreover, many of its predictions that would seem to be errors instead reflect problems in the sequence databases. The source code of CRITICA is freely available by anonymous FTP (rdp.life.uiuc.edu in/pub/critica) and on the World Wide Web (http:/(/)rdpwww.life.uiuc.edu).

Mi-DISCOVERER: A bioinformatics tool for the detection of mi-RNA in human genome.

PubMed

Arshad, Saadia; Mumtaz, Asia; Ahmad, Freed; Liaquat, Sadia; Nadeem, Shahid; Mehboob, Shahid; Afzal, Muhammad

2010-11-27

MicroRNAs (miRNAs) are 22 nucleotides non-coding RNAs that play pivotal regulatory roles in diverse organisms including the humans and are difficult to be identified due to lack of either sequence features or robust algorithms to efficiently identify. Therefore, we made a tool that is Mi-Discoverer for the detection of miRNAs in human genome. The tools used for the development of software are Microsoft Office Access 2003, the JDK version 1.6.0, BioJava version 1.0, and the NetBeans IDE version 6.0. All already made miRNAs softwares were web based; so the advantage of our project was to make a desktop facility to the user for sequence alignment search with already identified miRNAs of human genome present in the database. The user can also insert and update the newly discovered human miRNA in the database. Mi-Discoverer, a bioinformatics tool successfully identifies human miRNAs based on multiple sequence alignment searches. It's a non redundant database containing a large collection of publicly available human miRNAs.

Mi-DISCOVERER: A bioinformatics tool for the detection of mi-RNA in human genome

PubMed Central

Arshad, Saadia; Mumtaz, Asia; Ahmad, Freed; Liaquat, Sadia; Nadeem, Shahid; Mehboob, Shahid; Afzal, Muhammad

2010-01-01

MicroRNAs (miRNAs) are 22 nucleotides non-coding RNAs that play pivotal regulatory roles in diverse organisms including the humans and are difficult to be identified due to lack of either sequence features or robust algorithms to efficiently identify. Therefore, we made a tool that is Mi-Discoverer for the detection of miRNAs in human genome. The tools used for the development of software are Microsoft Office Access 2003, the JDK version 1.6.0, BioJava version 1.0, and the NetBeans IDE version 6.0. All already made miRNAs softwares were web based; so the advantage of our project was to make a desktop facility to the user for sequence alignment search with already identified miRNAs of human genome present in the database. The user can also insert and update the newly discovered human miRNA in the database. Mi-Discoverer, a bioinformatics tool successfully identifies human miRNAs based on multiple sequence alignment searches. It's a non redundant database containing a large collection of publicly available human miRNAs. PMID:21364831

SGP-1: Prediction and Validation of Homologous Genes Based on Sequence Alignments

PubMed Central

Wiehe, Thomas; Gebauer-Jung, Steffi; Mitchell-Olds, Thomas; Guigó, Roderic

2001-01-01

Conventional methods of gene prediction rely on the recognition of DNA-sequence signals, the coding potential or the comparison of a genomic sequence with a cDNA, EST, or protein database. Reasons for limited accuracy in many circumstances are species-specific training and the incompleteness of reference databases. Lately, comparative genome analysis has attracted increasing attention. Several analysis tools that are based on human/mouse comparisons are already available. Here, we present a program for the prediction of protein-coding genes, termed SGP-1 (Syntenic Gene Prediction), which is based on the similarity of homologous genomic sequences. In contrast to most existing tools, the accuracy of SGP-1 depends little on species-specific properties such as codon usage or the nucleotide distribution. SGP-1 may therefore be applied to nonstandard model organisms in vertebrates as well as in plants, without the need for extensive parameter training. In addition to predicting genes in large-scale genomic sequences, the program may be useful to validate gene structure annotations from databases. To this end, SGP-1 output also contains comparisons between predicted and annotated gene structures in HTML format. The program can be accessed via a Web server at http://soft.ice.mpg.de/sgp-1. The source code, written in ANSI C, is available on request from the authors. PMID:11544202

Pivotal role of computers and software in mass spectrometry - SEQUEST and 20 years of tandem MS database searching.

PubMed

Yates, John R

2015-11-01

Advances in computer technology and software have driven developments in mass spectrometry over the last 50 years. Computers and software have been impactful in three areas: the automation of difficult calculations to aid interpretation, the collection of data and control of instruments, and data interpretation. As the power of computers has grown, so too has the utility and impact on mass spectrometers and their capabilities. This has been particularly evident in the use of tandem mass spectrometry data to search protein and nucleotide sequence databases to identify peptide and protein sequences. This capability has driven the development of many new approaches to study biological systems, including the use of "bottom-up shotgun proteomics" to directly analyze protein mixtures. Graphical Abstract ᅟ.

HepSEQ: International Public Health Repository for Hepatitis B

PubMed Central

Gnaneshan, Saravanamuttu; Ijaz, Samreen; Moran, Joanne; Ramsay, Mary; Green, Jonathan

2007-01-01

HepSEQ is a repository for an extensive library of public health and molecular data relating to hepatitis B virus (HBV) infection collected from international sources. It is hosted by the Centre for Infections, Health Protection Agency (HPA), England, United Kingdom. This repository has been developed as a web-enabled, quality-controlled database to act as a tool for surveillance, HBV case management and for research. The web front-end for the database system can be accessed from . The format of the database system allows for comprehensive molecular, clinical and epidemiological data to be deposited into a functional database, to search and manipulate the stored data and to extract and visualize the information on epidemiological, virological, clinical, nucleotide sequence and mutational aspects of HBV infection through web front-end. Specific tools, built into the database, can be utilized to analyse deposited data and provide information on HBV genotype, identify mutations with known clinical significance (e.g. vaccine escape, precore and antiviral-resistant mutations) and carry out sequence homology searches against other deposited strains. Further mechanisms are also in place to allow specific tailored searches of the database to be undertaken. PMID:17130143

Molecular characterization of nucleopolyhedrovirus of three lepidopteran pests using late expression factor-8 gene.

PubMed

Jose, Jency; Jalali, S K; Shivalingaswamy, T M; Kumar, N K Krishna; Bhatnagar, R; Bandyopadhyay, A

2013-06-01

A PCR based method for detection of viral DNA in nucleopolyhedrovirus of three lepidopterans, Spodoptera litura, Amsacta albistriga and Helicoverpa armigera, was developed by employing the late expression factor-8 (lef-8) gene of three NPV using specific primers. The amplicons of 689, 699 and 665 bp were amplified, respectively, and the nucleotide sequences were submitted to GenBank and the accession numbers were obtained. The sequences of lef-8 gene of S. litura NPV and H. armigera NPV matched with those of their respective references in the GenBank database, thereby confirming their identity, however, the sequence of A. albistriga NPV was the first sequence submitted to the GenBank database. The sequence similarity analysis between the three lef-8 gene of NPV sequenced in the present study revealed that there was no significant similarity between them, however A. albistriga NPV and S. litura NPV were found to be closely related. CLUSTAL alignment of the sequences generated revealed general relatedness among NPVs lef-8 gene. The study confirmed that lef-8 gene can be used for quick and correct discriminatory identification of insect viruses.

MethSMRT: an integrative database for DNA N6-methyladenine and N4-methylcytosine generated by single-molecular real-time sequencing.

PubMed

Ye, Pohao; Luan, Yizhao; Chen, Kaining; Liu, Yizhi; Xiao, Chuanle; Xie, Zhi

2017-01-04

DNA methylation is an important type of epigenetic modifications, where 5- methylcytosine (5mC), 6-methyadenine (6mA) and 4-methylcytosine (4mC) are the most common types. Previous efforts have been largely focused on 5mC, providing invaluable insights into epigenetic regulation through DNA methylation. Recently developed single-molecule real-time (SMRT) sequencing technology provides a unique opportunity to detect the less studied DNA 6mA and 4mC modifications at single-nucleotide resolution. With a rapidly increased amount of SMRT sequencing data generated, there is an emerging demand to systematically explore DNA 6mA and 4mC modifications from these data sets. MethSMRT is the first resource hosting DNA 6mA and 4mC methylomes. All the data sets were processed using the same analysis pipeline with the same quality control. The current version of the database provides a platform to store, browse, search and download epigenome-wide methylation profiles of 156 species, including seven eukaryotes such as Arabidopsis, C. elegans, Drosophila, mouse and yeast, as well as 149 prokaryotes. It also offers a genome browser to visualize the methylation sites and related information such as single nucleotide polymorphisms (SNP) and genomic annotation. Furthermore, the database provides a quick summary of statistics of methylome of 6mA and 4mC and predicted methylation motifs for each species. MethSMRT is publicly available at http://sysbio.sysu.edu.cn/methsmrt/ without use restriction. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DSAP: deep-sequencing small RNA analysis pipeline.

PubMed

Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

2010-07-01

DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

Influenza Virus Database (IVDB): an integrated information resource and analysis platform for influenza virus research.

PubMed

Chang, Suhua; Zhang, Jiajie; Liao, Xiaoyun; Zhu, Xinxing; Wang, Dahai; Zhu, Jiang; Feng, Tao; Zhu, Baoli; Gao, George F; Wang, Jian; Yang, Huanming; Yu, Jun; Wang, Jing

2007-01-01

Frequent outbreaks of highly pathogenic avian influenza and the increasing data available for comparative analysis require a central database specialized in influenza viruses (IVs). We have established the Influenza Virus Database (IVDB) to integrate information and create an analysis platform for genetic, genomic, and phylogenetic studies of the virus. IVDB hosts complete genome sequences of influenza A virus generated by Beijing Institute of Genomics (BIG) and curates all other published IV sequences after expert annotation. Our Q-Filter system classifies and ranks all nucleotide sequences into seven categories according to sequence content and integrity. IVDB provides a series of tools and viewers for comparative analysis of the viral genomes, genes, genetic polymorphisms and phylogenetic relationships. A search system has been developed for users to retrieve a combination of different data types by setting search options. To facilitate analysis of global viral transmission and evolution, the IV Sequence Distribution Tool (IVDT) has been developed to display the worldwide geographic distribution of chosen viral genotypes and to couple genomic data with epidemiological data. The BLAST, multiple sequence alignment and phylogenetic analysis tools were integrated for online data analysis. Furthermore, IVDB offers instant access to pre-computed alignments and polymorphisms of IV genes and proteins, and presents the results as SNP distribution plots and minor allele distributions. IVDB is publicly available at http://influenza.genomics.org.cn.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Correcting Inconsistencies and Errors in Bacterial Genome Metadata Using an Automated Curation Tool in Excel (AutoCurE).

PubMed

Schmedes, Sarah E; King, Jonathan L; Budowle, Bruce

2015-01-01

Whole-genome data are invaluable for large-scale comparative genomic studies. Current sequencing technologies have made it feasible to sequence entire bacterial genomes with relative ease and time with a substantially reduced cost per nucleotide, hence cost per genome. More than 3,000 bacterial genomes have been sequenced and are available at the finished status. Publically available genomes can be readily downloaded; however, there are challenges to verify the specific supporting data contained within the download and to identify errors and inconsistencies that may be present within the organizational data content and metadata. AutoCurE, an automated tool for bacterial genome database curation in Excel, was developed to facilitate local database curation of supporting data that accompany downloaded genomes from the National Center for Biotechnology Information. AutoCurE provides an automated approach to curate local genomic databases by flagging inconsistencies or errors by comparing the downloaded supporting data to the genome reports to verify genome name, RefSeq accession numbers, the presence of archaea, BioProject/UIDs, and sequence file descriptions. Flags are generated for nine metadata fields if there are inconsistencies between the downloaded genomes and genomes reports and if erroneous or missing data are evident. AutoCurE is an easy-to-use tool for local database curation for large-scale genome data prior to downstream analyses.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

USGS Publications Warehouse

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

Assessment of genetic diversity among four orchids based on ddRAD sequencing data for conservation purposes.

PubMed

Roy, Subhas Chandra; Moitra, Kaushik; De Sarker, Dilip

2017-01-01

Genetic diversity was assessed in the four orchid species using NGS based ddRAD sequencing data. The assembled nucleotide sequences (fastq) were deposited in the SRA archive of NCBI Database with accession number (SRP063543 for Dendrobium , SRP065790 for Geodorum, SRP072201 for Cymbidium and SRP072378 for Rhynchostylis ). Total base pair read was 1.1 Mbp in case of Dendrobium sp., 553.3 Kbp for Geodorum sp., 1.6 Gbp for Cymbidium , and 1.4 Gbp for Rhynchostylis . Average GC% was 43.9 in Geodorum , 43.7% in Dendrobium , 41.2% in Cymbidium and 42.3% in Rhynchostylis . Four partial gene sequences were used in DnaSP5 program for nucleotide diversity and phylogenetic relationship determination ( Ycf2 gene of Dendrobium, matK gene of Geodorum , psbD gene of Cymbidium and Ycf2 gene of Ryhnchostylis ). Nucleotide diversity (per site) Pi (π) was 0.10560 in Dendrobium, 0.03586 in Geodorum, 0.01364 in Cymbidium and 0.011344 in Rhynchostylis . Neutrality test statistics showed the negative value in all the four orchid species (Tajima's D value -2.17959 in Dendrobium , -2.01655 in Geodorum, -2.12362 in Rhynchostylis and -1.54222 in Cymbidium ) indicating the purifying selection. Result for these gene sequences ( mat K and Ycf 2 and psb D) indicate that they were not evolved neutrally, but signifying that selection might have played a role in evolution of these genes in these four groups of orchids. Phylogenetic relationship was analyzed by reconstructing dendrogram based on the matK, psbD and Ycf2 gene sequences using maximum likelihood method in MEGA6 program.

Numerical classification of coding sequences

NASA Technical Reports Server (NTRS)

Collins, D. W.; Liu, C. C.; Jukes, T. H.

1992-01-01

DNA sequences coding for protein may be represented by counts of nucleotides or codons. A complete reading frame may be abbreviated by its base count, e.g. A76C158G121T74, or with the corresponding codon table, e.g. (AAA)0(AAC)1(AAG)9 ... (TTT)0. We propose that these numerical designations be used to augment current methods of sequence annotation. Because base counts and codon tables do not require revision as knowledge of function evolves, they are well-suited to act as cross-references, for example to identify redundant GenBank entries. These descriptors may be compared, in place of DNA sequences, to extract homologous genes from large databases. This approach permits rapid searching with good selectivity.

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

Functional analysis of regulatory single-nucleotide polymorphisms.

PubMed

Pampín, Sandra; Rodríguez-Rey, José C

2007-04-01

The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Novel Detection of Insecticide Resistance Related P450 Genes and Transcriptome Analysis of the Hemimetabolous Pest Erthesina fullo (Thunberg) (Hemiptera: Heteroptera).

PubMed

Liu, Yang; Wu, Haoyang; Xie, Qiang; Bu, Wenjun

2015-01-01

Erthesina fullo (Thunberg, 1783) is an economically important heteropteran species in China. Since only three nucleotide sequences of this species (COI, 16S rRNA, and 18S rRNA) appear in the GenBank database so far, no analysis of the molecular mechanisms underlying E. fullo's resistance to insecticide and environmental stress has been accomplished. We reported a de novo assembled and annotated transcriptome for adult E. fullo using the Illumina sequence system. A total of 53,359,458 clean reads of 4.8 billion nucleotides (nt) were assembled into 27,488 unigenes with an average length of 750 bp, of which 17,743 (64.55%) were annotated. In the present study, we identified 88 putative cytochrome P450 sequences and analyzed the evolution of cytochrome P450 superfamilies, genes of the CYP3 clan related to metabolizing xenobiotics and plant natural compounds, in E. fullo, increasing the candidate genes for the molecular mechanisms of insecticide resistance in P450. The sequenced transcriptome greatly expands the available genomic information and could allow a better understanding of the mechanisms of insecticide resistance at the systems biology level.

Identification of novel alleles of the rice blast resistance gene Pi54

NASA Astrophysics Data System (ADS)

Vasudevan, Kumar; Gruissem, Wilhelm; Bhullar, Navreet K.

2015-10-01

Rice blast is one of the most devastating rice diseases and continuous resistance breeding is required to control the disease. The rice blast resistance gene Pi54 initially identified in an Indian cultivar confers broad-spectrum resistance in India. We explored the allelic diversity of the Pi54 gene among 885 Indian rice genotypes that were found resistant in our screening against field mixture of naturally existing M. oryzae strains as well as against five unique strains. These genotypes are also annotated as rice blast resistant in the International Rice Genebank database. Sequence-based allele mining was used to amplify and clone the Pi54 allelic variants. Nine new alleles of Pi54 were identified based on the nucleotide sequence comparison to the Pi54 reference sequence as well as to already known Pi54 alleles. DNA sequence analysis of the newly identified Pi54 alleles revealed several single polymorphic sites, three double deletions and an eight base pair deletion. A SNP-rich region was found between a tyrosine kinase phosphorylation site and the nucleotide binding site (NBS) domain. Together, the newly identified Pi54 alleles expand the allelic series and are candidates for rice blast resistance breeding programs.

Application of viromics: a new approach to the understanding of viral infections in humans.

PubMed

Ramamurthy, Mageshbabu; Sankar, Sathish; Kannangai, Rajesh; Nandagopal, Balaji; Sridharan, Gopalan

2017-12-01

This review is focused at exploring the strengths of modern technology driven data compiled in the areas of virus gene sequencing, virus protein structures and their implication to viral diagnosis and therapy. The information for virome analysis (viromics) is generated by the study of viral genomes (entire nucleotide sequence) and viral genes (coding for protein). Presently, the study of viral infectious diseases in terms of etiopathogenesis and development of newer therapeutics is undergoing rapid changes. Currently, viromics relies on deep sequencing, next generation sequencing (NGS) data and public domain databases like GenBank and unique virus specific databases. Two commonly used NGS platforms: Illumina and Ion Torrent, recommend maximum fragment lengths of about 300 and 400 nucleotides for analysis respectively. Direct detection of viruses in clinical samples is now evolving using these methods. Presently, there are a considerable number of good treatment options for HBV/HIV/HCV. These viruses however show development of drug resistance. The drug susceptibility regions of the genomes are sequenced and the prediction of drug resistance is now possible from 3 public domains available on the web. This has been made possible through advances in the technology with the advent of high throughput sequencing and meta-analysis through sophisticated and easy to use software and the use of high speed computers for bioinformatics. More recently NGS technology has been improved with single-molecule real-time sequencing. Here complete long reads can be obtained with less error overcoming a limitation of the NGS which is inherently prone to software anomalies that arise in the hands of personnel without adequate training. The development in understanding the viruses in terms of their genome, pathobiology, transcriptomics and molecular epidemiology constitutes viromics. It could be stated that these developments will bring about radical changes and advancement especially in the field of antiviral therapy and diagnostic virology.

Sequencing, Analysis, and Annotation of Expressed Sequence Tags for Camelus dromedarius

PubMed Central

Al-Swailem, Abdulaziz M.; Shehata, Maher M.; Abu-Duhier, Faisel M.; Al-Yamani, Essam J.; Al-Busadah, Khalid A.; Al-Arawi, Mohammed S.; Al-Khider, Ali Y.; Al-Muhaimeed, Abdullah N.; Al-Qahtani, Fahad H.; Manee, Manee M.; Al-Shomrani, Badr M.; Al-Qhtani, Saad M.; Al-Harthi, Amer S.; Akdemir, Kadir C.; Otu, Hasan H.

2010-01-01

Despite its economical, cultural, and biological importance, there has not been a large scale sequencing project to date for Camelus dromedarius. With the goal of sequencing complete DNA of the organism, we first established and sequenced camel EST libraries, generating 70,272 reads. Following trimming, chimera check, repeat masking, cluster and assembly, we obtained 23,602 putative gene sequences, out of which over 4,500 potentially novel or fast evolving gene sequences do not carry any homology to other available genomes. Functional annotation of sequences with similarities in nucleotide and protein databases has been obtained using Gene Ontology classification. Comparison to available full length cDNA sequences and Open Reading Frame (ORF) analysis of camel sequences that exhibit homology to known genes show more than 80% of the contigs with an ORF>300 bp and ∼40% hits extending to the start codons of full length cDNAs suggesting successful characterization of camel genes. Similarity analyses are done separately for different organisms including human, mouse, bovine, and rat. Accompanying web portal, CAGBASE (http://camel.kacst.edu.sa/), hosts a relational database containing annotated EST sequences and analysis tools with possibility to add sequences from public domain. We anticipate our results to provide a home base for genomic studies of camel and other comparative studies enabling a starting point for whole genome sequencing of the organism. PMID:20502665

RICD: a rice indica cDNA database resource for rice functional genomics.

PubMed

Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

2008-11-26

The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

Comparison of the genomic sequence of the microminipig, a novel breed of swine, with the genomic database for conventional pig.

PubMed

Miura, Naoki; Kucho, Ken-Ichi; Noguchi, Michiko; Miyoshi, Noriaki; Uchiumi, Toshiki; Kawaguchi, Hiroaki; Tanimoto, Akihide

2014-01-01

The microminipig, which weighs less than 10 kg at an early stage of maturity, has been reported as a potential experimental model animal. Its extremely small size and other distinct characteristics suggest the possibility of a number of differences between the genome of the microminipig and that of conventional pigs. In this study, we analyzed the genomes of two healthy microminipigs using a next-generation sequencer SOLiD™ system. We then compared the obtained genomic sequences with a genomic database for the domestic pig (Sus scrofa). The mapping coverage of sequenced tag from the microminipig to conventional pig genomic sequences was greater than 96% and we detected no clear, substantial genomic variance from these data. The results may indicate that the distinct characteristics of the microminipig derive from small-scale alterations in the genome, such as Single Nucleotide Polymorphisms or translational modifications, rather than large-scale deletion or insertion polymorphisms. Further investigation of the entire genomic sequence of the microminipig with methods enabling deeper coverage is required to elucidate the genetic basis of its distinct phenotypic traits. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Structural Analysis of Biodiversity

PubMed Central

Sirovich, Lawrence; Stoeckle, Mark Y.; Zhang, Yu

2010-01-01

Large, recently-available genomic databases cover a wide range of life forms, suggesting opportunity for insights into genetic structure of biodiversity. In this study we refine our recently-described technique using indicator vectors to analyze and visualize nucleotide sequences. The indicator vector approach generates correlation matrices, dubbed Klee diagrams, which represent a novel way of assembling and viewing large genomic datasets. To explore its potential utility, here we apply the improved algorithm to a collection of almost 17000 DNA barcode sequences covering 12 widely-separated animal taxa, demonstrating that indicator vectors for classification gave correct assignment in all 11000 test cases. Indicator vector analysis revealed discontinuities corresponding to species- and higher-level taxonomic divisions, suggesting an efficient approach to classification of organisms from poorly-studied groups. As compared to standard distance metrics, indicator vectors preserve diagnostic character probabilities, enable automated classification of test sequences, and generate high-information density single-page displays. These results support application of indicator vectors for comparative analysis of large nucleotide data sets and raise prospect of gaining insight into broad-scale patterns in the genetic structure of biodiversity. PMID:20195371

[Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

PubMed

Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

2009-08-01

Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers rabies viruses were likely to be street virus that already circulating in wildlife.

High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

PubMed

Tong, Steven Y C; Xie, Shirley; Richardson, Leisha J; Ballard, Susan A; Dakh, Farshid; Grabsch, Elizabeth A; Grayson, M Lindsay; Howden, Benjamin P; Johnson, Paul D R; Giffard, Philip M

2011-01-01

We have developed a single nucleotide polymorphism (SNP) nucleated high-resolution melting (HRM) technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST) database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE) and an allele specific real-time PCR (AS kinetic PCR) SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs) in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs) and provides a Simpson's Index of Diversity (D) of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

PubMed

Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

2013-10-01

Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

PubMed

Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

2014-08-28

The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

Challenges in the association of human single nucleotide polymorphism mentions with unique database identifiers

PubMed Central

2011-01-01

Background Most information on genomic variations and their associations with phenotypes are covered exclusively in scientific publications rather than in structured databases. These texts commonly describe variations using natural language; database identifiers are seldom mentioned. This complicates the retrieval of variations, associated articles, as well as information extraction, e. g. the search for biological implications. To overcome these challenges, procedures to map textual mentions of variations to database identifiers need to be developed. Results This article describes a workflow for normalization of variation mentions, i.e. the association of them to unique database identifiers. Common pitfalls in the interpretation of single nucleotide polymorphism (SNP) mentions are highlighted and discussed. The developed normalization procedure achieves a precision of 98.1 % and a recall of 67.5% for unambiguous association of variation mentions with dbSNP identifiers on a text corpus based on 296 MEDLINE abstracts containing 527 mentions of SNPs. The annotated corpus is freely available at http://www.scai.fraunhofer.de/snp-normalization-corpus.html. Conclusions Comparable approaches usually focus on variations mentioned on the protein sequence and neglect problems for other SNP mentions. The results presented here indicate that normalizing SNPs described on DNA level is more difficult than the normalization of SNPs described on protein level. The challenges associated with normalization are exemplified with ambiguities and errors, which occur in this corpus. PMID:21992066

Comparing the normalization methods for the differential analysis of Illumina high-throughput RNA-Seq data.

PubMed

Li, Peipei; Piao, Yongjun; Shon, Ho Sun; Ryu, Keun Ho

2015-10-28

Recently, rapid improvements in technology and decrease in sequencing costs have made RNA-Seq a widely used technique to quantify gene expression levels. Various normalization approaches have been proposed, owing to the importance of normalization in the analysis of RNA-Seq data. A comparison of recently proposed normalization methods is required to generate suitable guidelines for the selection of the most appropriate approach for future experiments. In this paper, we compared eight non-abundance (RC, UQ, Med, TMM, DESeq, Q, RPKM, and ERPKM) and two abundance estimation normalization methods (RSEM and Sailfish). The experiments were based on real Illumina high-throughput RNA-Seq of 35- and 76-nucleotide sequences produced in the MAQC project and simulation reads. Reads were mapped with human genome obtained from UCSC Genome Browser Database. For precise evaluation, we investigated Spearman correlation between the normalization results from RNA-Seq and MAQC qRT-PCR values for 996 genes. Based on this work, we showed that out of the eight non-abundance estimation normalization methods, RC, UQ, Med, TMM, DESeq, and Q gave similar normalization results for all data sets. For RNA-Seq of a 35-nucleotide sequence, RPKM showed the highest correlation results, but for RNA-Seq of a 76-nucleotide sequence, least correlation was observed than the other methods. ERPKM did not improve results than RPKM. Between two abundance estimation normalization methods, for RNA-Seq of a 35-nucleotide sequence, higher correlation was obtained with Sailfish than that with RSEM, which was better than without using abundance estimation methods. However, for RNA-Seq of a 76-nucleotide sequence, the results achieved by RSEM were similar to without applying abundance estimation methods, and were much better than with Sailfish. Furthermore, we found that adding a poly-A tail increased alignment numbers, but did not improve normalization results. Spearman correlation analysis revealed that RC, UQ, Med, TMM, DESeq, and Q did not noticeably improve gene expression normalization, regardless of read length. Other normalization methods were more efficient when alignment accuracy was low; Sailfish with RPKM gave the best normalization results. When alignment accuracy was high, RC was sufficient for gene expression calculation. And we suggest ignoring poly-A tail during differential gene expression analysis.

Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

PubMed Central

Hunt, C; Morimoto, R I

1985-01-01

We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

Enriching Genomic Resources and Marker Development from Transcript Sequences of Jatropha curcas for Microgravity Studies

PubMed Central

Tian, Wenlan; Paudel, Dev

2017-01-01

Jatropha (Jatropha curcas L.) is an economically important species with a great potential for biodiesel production. To enrich the jatropha genomic databases and resources for microgravity studies, we sequenced and annotated the transcriptome of jatropha and developed SSR and SNP markers from the transcriptome sequences. In total 1,714,433 raw reads with an average length of 441.2 nucleotides were generated. De novo assembling and clustering resulted in 115,611 uniquely assembled sequences (UASs) including 21,418 full-length cDNAs and 23,264 new jatropha transcript sequences. The whole set of UASs were fully annotated, out of which 59,903 (51.81%) were assigned with gene ontology (GO) term, 12,584 (10.88%) had orthologs in Eukaryotic Orthologous Groups (KOG), and 8,822 (7.63%) were mapped to 317 pathways in six different categories in Kyoto Encyclopedia of Genes and Genome (KEGG) database, and it contained 3,588 putative transcription factors. From the UASs, 9,798 SSRs were discovered with AG/CT as the most frequent (45.8%) SSR motif type. Further 38,693 SNPs were detected and 7,584 remained after filtering. This UAS set has enriched the current jatropha genomic databases and provided a large number of genetic markers, which can facilitate jatropha genetic improvement and many other genetic and biological studies. PMID:28154822

VitisExpDB: a database resource for grape functional genomics.

PubMed

Doddapaneni, Harshavardhan; Lin, Hong; Walker, M Andrew; Yao, Jiqiang; Civerolo, Edwin L

2008-02-28

The family Vitaceae consists of many different grape species that grow in a range of climatic conditions. In the past few years, several studies have generated functional genomic information on different Vitis species and cultivars, including the European grape vine, Vitis vinifera. Our goal is to develop a comprehensive web data source for Vitaceae. VitisExpDB is an online MySQL-PHP driven relational database that houses annotated EST and gene expression data for V. vinifera and non-vinifera grape species and varieties. Currently, the database stores approximately 320,000 EST sequences derived from 8 species/hybrids, their annotation (BLAST top match) details and Gene Ontology based structured vocabulary. Putative homologs for each EST in other species and varieties along with information on their percent nucleotide identities, phylogenetic relationship and common primers can be retrieved. The database also includes information on probe sequence and annotation features of the high density 60-mer gene expression chip consisting of approximately 20,000 non-redundant set of ESTs. Finally, the database includes 14 processed global microarray expression profile sets. Data from 12 of these expression profile sets have been mapped onto metabolic pathways. A user-friendly web interface with multiple search indices and extensively hyperlinked result features that permit efficient data retrieval has been developed. Several online bioinformatics tools that interact with the database along with other sequence analysis tools have been added. In addition, users can submit their ESTs to the database. The developed database provides genomic resource to grape community for functional analysis of genes in the collection and for the grape genome annotation and gene function identification. The VitisExpDB database is available through our website http://cropdisease.ars.usda.gov/vitis_at/main-page.htm.

VitisExpDB: A database resource for grape functional genomics

PubMed Central

Doddapaneni, Harshavardhan; Lin, Hong; Walker, M Andrew; Yao, Jiqiang; Civerolo, Edwin L

2008-01-01

Background The family Vitaceae consists of many different grape species that grow in a range of climatic conditions. In the past few years, several studies have generated functional genomic information on different Vitis species and cultivars, including the European grape vine, Vitis vinifera. Our goal is to develop a comprehensive web data source for Vitaceae. Description VitisExpDB is an online MySQL-PHP driven relational database that houses annotated EST and gene expression data for V. vinifera and non-vinifera grape species and varieties. Currently, the database stores ~320,000 EST sequences derived from 8 species/hybrids, their annotation (BLAST top match) details and Gene Ontology based structured vocabulary. Putative homologs for each EST in other species and varieties along with information on their percent nucleotide identities, phylogenetic relationship and common primers can be retrieved. The database also includes information on probe sequence and annotation features of the high density 60-mer gene expression chip consisting of ~20,000 non-redundant set of ESTs. Finally, the database includes 14 processed global microarray expression profile sets. Data from 12 of these expression profile sets have been mapped onto metabolic pathways. A user-friendly web interface with multiple search indices and extensively hyperlinked result features that permit efficient data retrieval has been developed. Several online bioinformatics tools that interact with the database along with other sequence analysis tools have been added. In addition, users can submit their ESTs to the database. Conclusion The developed database provides genomic resource to grape community for functional analysis of genes in the collection and for the grape genome annotation and gene function identification. The VitisExpDB database is available through our website . PMID:18307813

Database resources of the National Center for Biotechnology Information.

PubMed

2016-01-04

The National Center for Biotechnology Information (NCBI) provides a large suite of online resources for biological information and data, including the GenBank(®) nucleic acid sequence database and the PubMed database of citations and abstracts for published life science journals. Additional NCBI resources focus on literature (PubMed Central (PMC), Bookshelf and PubReader), health (ClinVar, dbGaP, dbMHC, the Genetic Testing Registry, HIV-1/Human Protein Interaction Database and MedGen), genomes (BioProject, Assembly, Genome, BioSample, dbSNP, dbVar, Epigenomics, the Map Viewer, Nucleotide, Probe, RefSeq, Sequence Read Archive, the Taxonomy Browser and the Trace Archive), genes (Gene, Gene Expression Omnibus (GEO), HomoloGene, PopSet and UniGene), proteins (Protein, the Conserved Domain Database (CDD), COBALT, Conserved Domain Architecture Retrieval Tool (CDART), the Molecular Modeling Database (MMDB) and Protein Clusters) and chemicals (Biosystems and the PubChem suite of small molecule databases). The Entrez system provides search and retrieval operations for most of these databases. Augmenting many of the web applications are custom implementations of the BLAST program optimized to search specialized datasets. All of these resources can be accessed through the NCBI home page at www.ncbi.nlm.nih.gov. Published by Oxford University Press on behalf of Nucleic Acids Research 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Database resources of the National Center for Biotechnology Information.

PubMed

2015-01-01

The National Center for Biotechnology Information (NCBI) provides a large suite of online resources for biological information and data, including the GenBank(®) nucleic acid sequence database and the PubMed database of citations and abstracts for published life science journals. Additional NCBI resources focus on literature (Bookshelf, PubMed Central (PMC) and PubReader); medical genetics (ClinVar, dbMHC, the Genetic Testing Registry, HIV-1/Human Protein Interaction Database and MedGen); genes and genomics (BioProject, BioSample, dbSNP, dbVar, Epigenomics, Gene, Gene Expression Omnibus (GEO), Genome, HomoloGene, the Map Viewer, Nucleotide, PopSet, Probe, RefSeq, Sequence Read Archive, the Taxonomy Browser, Trace Archive and UniGene); and proteins and chemicals (Biosystems, COBALT, the Conserved Domain Database (CDD), the Conserved Domain Architecture Retrieval Tool (CDART), the Molecular Modeling Database (MMDB), Protein Clusters, Protein and the PubChem suite of small molecule databases). The Entrez system provides search and retrieval operations for many of these databases. Augmenting many of the Web applications are custom implementations of the BLAST program optimized to search specialized data sets. All of these resources can be accessed through the NCBI home page at http://www.ncbi.nlm.nih.gov. Published by Oxford University Press on behalf of Nucleic Acids Research 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

A novel tandem repeat sequence located on human chromosome 4p: isolation and characterization.

PubMed

Kogi, M; Fukushige, S; Lefevre, C; Hadano, S; Ikeda, J E

1997-06-01

In an effort to analyze the genomic region of the distal half of human chromosome 4p, to where Huntington disease and other diseases have been mapped, we have isolated the cosmid clone (CRS447) that was likely to contain a region with specific repeat sequences. Clone CRS447 was subjected to detailed analysis, including chromosome mapping, restriction mapping, and DNA sequencing. Chromosome mapping by both a human-CHO hybrid cell panel and FISH revealed that CRS447 was predominantly located in the 4p15.1-15.3 region. CRS447 was shown to consist of tandem repeats of 4.7-kb units present on chromosome 4p. A single EcoRI unit was subcloned (pRS447), and the complete sequence was determined as 4752 nucleotides. When pRS447 was used as a probe, the number of copies of this repeat per haploid genome was estimated to be 50-70. Sequence analysis revealed that it contained two internal CA repeats and one putative ORF. Database search established that this sequence was unreported. However, two homologous STS markers were found in the database. We concluded that CRS447/pRS447 is a novel tandem repeat sequence that is mainly specific to human chromosome 4p.

GeneBuilder: interactive in silico prediction of gene structure.

PubMed

Milanesi, L; D'Angelo, D; Rogozin, I B

1999-01-01

Prediction of gene structure in newly sequenced DNA becomes very important in large genome sequencing projects. This problem is complicated due to the exon-intron structure of eukaryotic genes and because gene expression is regulated by many different short nucleotide domains. In order to be able to analyse the full gene structure in different organisms, it is necessary to combine information about potential functional signals (promoter region, splice sites, start and stop codons, 3' untranslated region) together with the statistical properties of coding sequences (coding potential), information about homologous proteins, ESTs and repeated elements. We have developed the GeneBuilder system which is based on prediction of functional signals and coding regions by different approaches in combination with similarity searches in proteins and EST databases. The potential gene structure models are obtained by using a dynamic programming method. The program permits the use of several parameters for gene structure prediction and refinement. During gene model construction, selecting different exon homology levels with a protein sequence selected from a list of homologous proteins can improve the accuracy of the gene structure prediction. In the case of low homology, GeneBuilder is still able to predict the gene structure. The GeneBuilder system has been tested by using the standard set (Burset and Guigo, Genomics, 34, 353-367, 1996) and the performances are: 0.89 sensitivity and 0.91 specificity at the nucleotide level. The total correlation coefficient is 0.88. The GeneBuilder system is implemented as a part of the WebGene a the URL: http://www.itba.mi. cnr.it/webgene and TRADAT (TRAncription Database and Analysis Tools) launcher URL: http://www.itba.mi.cnr.it/tradat.

VecScreen_plus_taxonomy: imposing a tax(onomy) increase on vector contamination screening.

PubMed

Schäffer, Alejandro A; Nawrocki, Eric P; Choi, Yoon; Kitts, Paul A; Karsch-Mizrachi, Ilene; McVeigh, Richard

2018-03-01

Nucleic acid sequences in public databases should not contain vector contamination, but many sequences in GenBank do (or did) contain vectors. The National Center for Biotechnology Information uses the program VecScreen to screen submitted sequences for contamination. Additional tools are needed to distinguish true-positive (contamination) from false-positive (not contamination) VecScreen matches. A principal reason for false-positive VecScreen matches is that the sequence and the matching vector subsequence originate from closely related or identical organisms (for example, both originate in Escherichia coli). We collected information on the taxonomy of sources of vector segments in the UniVec database used by VecScreen. We used that information in two overlapping software pipelines for retrospective analysis of contamination in GenBank and for prospective analysis of contamination in new sequence submissions. Using the retrospective pipeline, we identified and corrected over 8000 contaminated sequences in the nonredundant nucleotide database. The prospective analysis pipeline has been in production use since April 2017 to evaluate some new GenBank submissions. Data on the sources of UniVec entries were included in release 10.0 (ftp://ftp.ncbi.nih.gov/pub/UniVec/). The main software is freely available at https://github.com/aaschaffer/vecscreen_plus_taxonomy. aschaffe@helix.nih.gov. Supplementary data are available at Bioinformatics online. Published by Oxford University Press 2017. This work is written by US Government employees and are in the public domain in the US.

Identification of Novel Sequence Types among Staphylococcus haemolyticus Isolated from Variety of Infections in India.

PubMed

Panda, Sasmita; Jena, Smrutiti; Sharma, Savitri; Dhawan, Benu; Nath, Gopal; Singh, Durg Vijai

2016-01-01

The aim of this study was to determine sequence types of 34 S. haemolyticus strains isolated from a variety of infections between 2013 and 2016 in India by MLST. The MEGA5.2 software was used to align and compare the nucleotide sequences. The advanced cluster analysis was performed to define the clonal complexes. MLST analysis showed 24 new sequence types (ST) among S. haemolyticus isolates, irrespective of sources and place of isolation. The finding of this study allowed to set up an MLST database on the PubMLST.org website using BIGSdb software and made available at http://pubmlst.org/shaemolyticus/. The data of this study thus suggest that MLST can be used to study population structure and diversity among S. haemolyticus isolates.

Identification of Novel Sequence Types among Staphylococcus haemolyticus Isolated from Variety of Infections in India

PubMed Central

Panda, Sasmita; Jena, Smrutiti; Sharma, Savitri; Dhawan, Benu; Nath, Gopal

2016-01-01

The aim of this study was to determine sequence types of 34 S. haemolyticus strains isolated from a variety of infections between 2013 and 2016 in India by MLST. The MEGA5.2 software was used to align and compare the nucleotide sequences. The advanced cluster analysis was performed to define the clonal complexes. MLST analysis showed 24 new sequence types (ST) among S. haemolyticus isolates, irrespective of sources and place of isolation. The finding of this study allowed to set up an MLST database on the PubMLST.org website using BIGSdb software and made available at http://pubmlst.org/shaemolyticus/. The data of this study thus suggest that MLST can be used to study population structure and diversity among S. haemolyticus isolates. PMID:27824930

AutoFACT: An Automatic Functional Annotation and Classification Tool

PubMed Central

Koski, Liisa B; Gray, Michael W; Lang, B Franz; Burger, Gertraud

2005-01-01

Background Assignment of function to new molecular sequence data is an essential step in genomics projects. The usual process involves similarity searches of a given sequence against one or more databases, an arduous process for large datasets. Results We present AutoFACT, a fully automated and customizable annotation tool that assigns biologically informative functions to a sequence. Key features of this tool are that it (1) analyzes nucleotide and protein sequence data; (2) determines the most informative functional description by combining multiple BLAST reports from several user-selected databases; (3) assigns putative metabolic pathways, functional classes, enzyme classes, GeneOntology terms and locus names; and (4) generates output in HTML, text and GFF formats for the user's convenience. We have compared AutoFACT to four well-established annotation pipelines. The error rate of functional annotation is estimated to be only between 1–2%. Comparison of AutoFACT to the traditional top-BLAST-hit annotation method shows that our procedure increases the number of functionally informative annotations by approximately 50%. Conclusion AutoFACT will serve as a useful annotation tool for smaller sequencing groups lacking dedicated bioinformatics staff. It is implemented in PERL and runs on LINUX/UNIX platforms. AutoFACT is available at . PMID:15960857

Generation and analysis of expressed sequence tags from the bone marrow of Chinese Sika deer.

PubMed

Yao, Baojin; Zhao, Yu; Zhang, Mei; Li, Juan

2012-03-01

Sika deer is one of the best-known and highly valued animals of China. Despite its economic, cultural, and biological importance, there has not been a large-scale sequencing project for Sika deer to date. With the ultimate goal of sequencing the complete genome of this organism, we first established a bone marrow cDNA library for Sika deer and generated a total of 2,025 reads. After processing the sequences, 2,017 high-quality expressed sequence tags (ESTs) were obtained. These ESTs were assembled into 1,157 unigenes, including 238 contigs and 919 singletons. Comparative analyses indicated that 888 (76.75%) of the unigenes had significant matches to sequences in the non-redundant protein database, In addition to highly expressed genes, such as stearoyl-CoA desaturase, cytochrome c oxidase, adipocyte-type fatty acid-binding protein, adiponectin and thymosin beta-4, we also obtained vascular endothelial growth factor-A and heparin-binding growth-associated molecule, both of which are of great importance for angiogenesis research. There were 244 (21.09%) unigenes with no significant match to any sequence in current protein or nucleotide databases, and these sequences may represent genes with unknown function in Sika deer. Open reading frame analysis of the sequences was performed using the getorf program. In addition, the sequences were functionally classified using the gene ontology hierarchy, clusters of orthologous groups of proteins and Kyoto encyclopedia of genes and genomes databases. Analysis of ESTs described in this paper provides an important resource for the transcriptome exploration of Sika deer, and will also facilitate further studies on functional genomics, gene discovery and genome annotation of Sika deer.

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

In silico identification of conserved microRNAs in large number of diverse plant species

PubMed Central

Sunkar, Ramanjulu; Jagadeeswaran, Guru

2008-01-01

Background MicroRNAs (miRNAs) are recently discovered small non-coding RNAs that play pivotal roles in gene expression, specifically at the post-transcriptional level in plants and animals. Identification of miRNAs in large number of diverse plant species is important to understand the evolution of miRNAs and miRNA-targeted gene regulations. Now-a-days, publicly available databases play a central role in the in-silico biology. Because, at least ~21 miRNA families are conserved in higher plants, a homology based search using these databases can help identify orthologs or paralogs in plants. Results We searched all publicly available nucleotide databases of genome survey sequences (GSS), high-throughput genomics sequences (HTGS), expressed sequenced tags (ESTs) and nonredundant (NR) nucleotides and identified 682 miRNAs in 155 diverse plant species. We found more than 15 conserved miRNA families in 11 plant species, 10 to14 families in 10 plant species and 5 to 9 families in 29 plant species. Nineteen conserved miRNA families were identified in important model legumes such as Medicago, Lotus and soybean. Five miRNA families – miR319, miR156/157, miR169, miR165/166 and miR394 – were found in 51, 45, 41, 40 and 40 diverse plant species, respectively. miR403 homologs were found in 16 dicots, whereas miR437 and miR444 homologs, as well as the miR396d/e variant of the miR396 family, were found only in monocots, thus providing large-scale authenticity for the dicot- and monocot-specific miRNAs. Furthermore, we provide computational and/or experimental evidence for the conservation of 6 newly found Arabidopsis miRNA homologs (miR158, miR391, miR824, miR825, miR827 and miR840) and 2 small RNAs (small-85 and small-87) in Brassica spp. Conclusion Using all publicly available nucleotide databases, 682 miRNAs were identified in 155 diverse plant species. By combining the expression analysis with the computational approach, we found that 6 miRNAs and 2 small RNAs that have been identified only in Arabidopsis thus far, are also conserved in Brassica spp. These findings will be useful for tracing the evolution of small RNAs by examining their expression in common ancestors of the Arabidopsis-Brassica lineage. PMID:18416839

A high-throughput approach to profile RNA structure.

PubMed

Delli Ponti, Riccardo; Marti, Stefanie; Armaos, Alexandros; Tartaglia, Gian Gaetano

2017-03-17

Here we introduce the Computational Recognition of Secondary Structure (CROSS) method to calculate the structural profile of an RNA sequence (single- or double-stranded state) at single-nucleotide resolution and without sequence length restrictions. We trained CROSS using data from high-throughput experiments such as Selective 2΄-Hydroxyl Acylation analyzed by Primer Extension (SHAPE; Mouse and HIV transcriptomes) and Parallel Analysis of RNA Structure (PARS; Human and Yeast transcriptomes) as well as high-quality NMR/X-ray structures (PDB database). The algorithm uses primary structure information alone to predict experimental structural profiles with >80% accuracy, showing high performances on large RNAs such as Xist (17 900 nucleotides; Area Under the ROC Curve AUC of 0.75 on dimethyl sulfate (DMS) experiments). We integrated CROSS in thermodynamics-based methods to predict secondary structure and observed an increase in their predictive power by up to 30%. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

PubMed Central

Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

2015-01-01

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

Towards computational improvement of DNA database indexing and short DNA query searching.

PubMed

Stojanov, Done; Koceski, Sašo; Mileva, Aleksandra; Koceska, Nataša; Bande, Cveta Martinovska

2014-09-03

In order to facilitate and speed up the search of massive DNA databases, the database is indexed at the beginning, employing a mapping function. By searching through the indexed data structure, exact query hits can be identified. If the database is searched against an annotated DNA query, such as a known promoter consensus sequence, then the starting locations and the number of potential genes can be determined. This is particularly relevant if unannotated DNA sequences have to be functionally annotated. However, indexing a massive DNA database and searching an indexed data structure with millions of entries is a time-demanding process. In this paper, we propose a fast DNA database indexing and searching approach, identifying all query hits in the database, without having to examine all entries in the indexed data structure, limiting the maximum length of a query that can be searched against the database. By applying the proposed indexing equation, the whole human genome could be indexed in 10 hours on a personal computer, under the assumption that there is enough RAM to store the indexed data structure. Analysing the methodology proposed by Reneker, we observed that hits at starting positions [Formula: see text] are not reported, if the database is searched against a query shorter than [Formula: see text] nucleotides, such that [Formula: see text] is the length of the DNA database words being mapped and [Formula: see text] is the length of the query. A solution of this drawback is also presented.

Herpesvirus systematics☆

PubMed Central

Davison, Andrew J.

2010-01-01

This paper is about the taxonomy and genomics of herpesviruses. Each theme is presented as a digest of current information flanked by commentaries on past activities and future directions. The International Committee on Taxonomy of Viruses recently instituted a major update of herpesvirus classification. The former family Herpesviridae was elevated to a new order, the Herpesvirales, which now accommodates 3 families, 3 subfamilies, 17 genera and 90 species. Future developments will include revisiting the herpesvirus species definition and the criteria used for taxonomic assignment, particularly in regard to the possibilities of classifying the large number of herpesviruses detected only as DNA sequences by polymerase chain reaction. Nucleotide sequence accessions in primary databases, such as GenBank, consist of the sequences plus annotations of the genetic features. The quality of these accessions is important because they provide a knowledge base that is used widely by the research community. However, updating the accessions to take account of improved knowledge is essentially reserved to the original depositors, and this activity is rarely undertaken. Thus, the primary databases are likely to become antiquated. In contrast, secondary databases are open to curation by experts other than the original depositors, thus increasing the likelihood that they will remain up to date. One of the most promising secondary databases is RefSeq, which aims to furnish the best available annotations for complete genome sequences. Progress in regard to improving the RefSeq herpesvirus accessions is discussed, and insights into particular aspects of herpesvirus genomics arising from this work are reported. PMID:20346601

The salinity tolerant poplar database (STPD): a comprehensive database for studying tree salt-tolerant adaption and poplar genomics.

PubMed

Ma, Yazhen; Xu, Ting; Wan, Dongshi; Ma, Tao; Shi, Sheng; Liu, Jianquan; Hu, Quanjun

2015-03-17

Soil salinity is a significant factor that impairs plant growth and agricultural productivity, and numerous efforts are underway to enhance salt tolerance of economically important plants. Populus species are widely cultivated for diverse uses. Especially, they grow in different habitats, from salty soil to mesophytic environment, and are therefore used as a model genus for elucidating physiological and molecular mechanisms of stress tolerance in woody plants. The Salinity Tolerant Poplar Database (STPD) is an integrative database for salt-tolerant poplar genome biology. Currently the STPD contains Populus euphratica genome and its related genetic resources. P. euphratica, with a preference of the salty habitats, has become a valuable genetic resource for the exploitation of tolerance characteristics in trees. This database contains curated data including genomic sequence, genes and gene functional information, non-coding RNA sequences, transposable elements, simple sequence repeats and single nucleotide polymorphisms information of P. euphratica, gene expression data between P. euphratica and Populus tomentosa, and whole-genome alignments between Populus trichocarpa, P. euphratica and Salix suchowensis. The STPD provides useful searching and data mining tools, including GBrowse genome browser, BLAST servers and genome alignments viewer, which can be used to browse genome regions, identify similar sequences and visualize genome alignments. Datasets within the STPD can also be downloaded to perform local searches. A new Salinity Tolerant Poplar Database has been developed to assist studies of salt tolerance in trees and poplar genomics. The database will be continuously updated to incorporate new genome-wide data of related poplar species. This database will serve as an infrastructure for researches on the molecular function of genes, comparative genomics, and evolution in closely related species as well as promote advances in molecular breeding within Populus. The STPD can be accessed at http://me.lzu.edu.cn/stpd/ .

The diploid genome sequence of an Asian individual

PubMed Central

Wang, Jun; Wang, Wei; Li, Ruiqiang; Li, Yingrui; Tian, Geng; Goodman, Laurie; Fan, Wei; Zhang, Junqing; Li, Jun; Zhang, Juanbin; Guo, Yiran; Feng, Binxiao; Li, Heng; Lu, Yao; Fang, Xiaodong; Liang, Huiqing; Du, Zhenglin; Li, Dong; Zhao, Yiqing; Hu, Yujie; Yang, Zhenzhen; Zheng, Hancheng; Hellmann, Ines; Inouye, Michael; Pool, John; Yi, Xin; Zhao, Jing; Duan, Jinjie; Zhou, Yan; Qin, Junjie; Ma, Lijia; Li, Guoqing; Yang, Zhentao; Zhang, Guojie; Yang, Bin; Yu, Chang; Liang, Fang; Li, Wenjie; Li, Shaochuan; Li, Dawei; Ni, Peixiang; Ruan, Jue; Li, Qibin; Zhu, Hongmei; Liu, Dongyuan; Lu, Zhike; Li, Ning; Guo, Guangwu; Zhang, Jianguo; Ye, Jia; Fang, Lin; Hao, Qin; Chen, Quan; Liang, Yu; Su, Yeyang; san, A.; Ping, Cuo; Yang, Shuang; Chen, Fang; Li, Li; Zhou, Ke; Zheng, Hongkun; Ren, Yuanyuan; Yang, Ling; Gao, Yang; Yang, Guohua; Li, Zhuo; Feng, Xiaoli; Kristiansen, Karsten; Wong, Gane Ka-Shu; Nielsen, Rasmus; Durbin, Richard; Bolund, Lars; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian

2009-01-01

Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J. D. Watson and J. C. Venter), and structural variation identification. These variations were considered for their potential biological impact. Our sequence data and analyses demonstrate the potential usefulness of next-generation sequencing technologies for personal genomics. PMID:18987735

HIV Sequence Compendium 2010

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuiken, Carla; Foley, Brian; Leitner, Thomas

This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is stillmore » increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.« less

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation

PubMed Central

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F.; Sampson, Juliana K.; Khalid, Haniya; Sheth, Nihar U.; Batalo, Michael; Serrano, Myrna G.; Roberts, Catherine H.; Hess, Michael L.; Buck, Gregory A.; Neale, Michael C.; Manjili, Masoud H.; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor–recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential. PMID:25414699

In silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem-Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation.

PubMed

Jameson-Lee, Max; Koparde, Vishal; Griffith, Phil; Scalora, Allison F; Sampson, Juliana K; Khalid, Haniya; Sheth, Nihar U; Batalo, Michael; Serrano, Myrna G; Roberts, Catherine H; Hess, Michael L; Buck, Gregory A; Neale, Michael C; Manjili, Masoud H; Toor, Amir Ahmed

2014-01-01

Donor T-cell mediated graft versus host (GVH) effects may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA) presented by the human leukocyte antigen (HLA) molecules in each donor-recipient pair undergoing stem-cell transplantation (SCT). Whole exome sequencing has previously demonstrated a large number of non-synonymous single nucleotide polymorphisms (SNP) present in HLA-matched recipients of SCT donors (GVH direction). The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric peptides incorporating the variant amino acid resulting from these SNPs were interrogated in silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM) and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data were interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting a HLA-specific alloreactivity potential.

A combined strategy involving Sanger and 454 pyrosequencing increases genomic resources to aid in the management of reproduction, disease control and genetic selection in the turbot (Scophthalmus maximus).

PubMed

Ribas, Laia; Pardo, Belén G; Fernández, Carlos; Alvarez-Diós, José Antonio; Gómez-Tato, Antonio; Quiroga, María Isabel; Planas, Josep V; Sitjà-Bobadilla, Ariadna; Martínez, Paulino; Piferrer, Francesc

2013-03-15

Genomic resources for plant and animal species that are under exploitation primarily for human consumption are increasingly important, among other things, for understanding physiological processes and for establishing adequate genetic selection programs. Current available techniques for high-throughput sequencing have been implemented in a number of species, including fish, to obtain a proper description of the transcriptome. The objective of this study was to generate a comprehensive transcriptomic database in turbot, a highly priced farmed fish species in Europe, with potential expansion to other areas of the world, for which there are unsolved production bottlenecks, to understand better reproductive- and immune-related functions. This information is essential to implement marker assisted selection programs useful for the turbot industry. Expressed sequence tags were generated by Sanger sequencing of cDNA libraries from different immune-related tissues after several parasitic challenges. The resulting database ("Turbot 2 database") was enlarged with sequences generated from a 454 sequencing run of brain-hypophysis-gonadal axis-derived RNA obtained from turbot at different development stages. The assembly of Sanger and 454 sequences generated 52,427 consensus sequences ("Turbot 3 database"), of which 23,661 were successfully annotated. A total of 1,410 sequences were confirmed to be related to reproduction and key genes involved in sex differentiation and maturation were identified for the first time in turbot (AR, AMH, SRY-related genes, CYP19A, ZPGs, STAR FSHR, etc.). Similarly, 2,241 sequences were related to the immune system and several novel key immune genes were identified (BCL, TRAF, NCK, CD28 and TOLLIP, among others). The number of genes of many relevant reproduction- and immune-related pathways present in the database was 50-90% of the total gene count of each pathway. In addition, 1,237 microsatellites and 7,362 single nucleotide polymorphisms (SNPs) were also compiled. Further, 2,976 putative natural antisense transcripts (NATs) including microRNAs were also identified. The combined sequencing strategies employed here significantly increased the turbot genomic resources available, including 34,400 novel sequences. The generated database contains a larger number of genes relevant for reproduction- and immune-associated studies, with an excellent coverage of most genes present in many relevant physiological pathways. This database also allowed the identification of many microsatellites and SNP markers that will be very useful for population and genome screening and a valuable aid in marker assisted selection programs.

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

PubMed

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

De Novo Transcriptome Sequencing Analysis of cDNA Library and Large-Scale Unigene Assembly in Japanese Red Pine (Pinus densiflora)

PubMed Central

Liu, Le; Zhang, Shijie; Lian, Chunlan

2015-01-01

Japanese red pine (Pinus densiflora) is extensively cultivated in Japan, Korea, China, and Russia and is harvested for timber, pulpwood, garden, and paper markets. However, genetic information and molecular markers were very scarce for this species. In this study, over 51 million sequencing clean reads from P. densiflora mRNA were produced using Illumina paired-end sequencing technology. It yielded 83,913 unigenes with a mean length of 751 bp, of which 54,530 (64.98%) unigenes showed similarity to sequences in the NCBI database. Among which the best matches in the NCBI Nr database were Picea sitchensis (41.60%), Amborella trichopoda (9.83%), and Pinus taeda (4.15%). A total of 1953 putative microsatellites were identified in 1784 unigenes using MISA (MicroSAtellite) software, of which the tri-nucleotide repeats were most abundant (50.18%) and 629 EST-SSR (expressed sequence tag- simple sequence repeats) primer pairs were successfully designed. Among 20 EST-SSR primer pairs randomly chosen, 17 markers yielded amplification products of the expected size in P. densiflora. Our results will provide a valuable resource for gene-function analysis, germplasm identification, molecular marker-assisted breeding and resistance-related gene(s) mapping for pine for P. densiflora. PMID:26690126

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Systematic asymmetric nucleotide exchanges produce human mitochondrial RNAs cryptically encoding for overlapping protein coding genes.

PubMed

Seligmann, Hervé

2013-05-07

GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Genomics dataset on unclassified published organism (patent US 7547531).

PubMed

Khan Shawan, Mohammad Mahfuz Ali; Hasan, Md Ashraful; Hossain, Md Mozammel; Hasan, Md Mahmudul; Parvin, Afroza; Akter, Salina; Uddin, Kazi Rasel; Banik, Subrata; Morshed, Mahbubul; Rahman, Md Nazibur; Rahman, S M Badier

2016-12-01

Nucleotide (DNA) sequence analysis provides important clues regarding the characteristics and taxonomic position of an organism. With the intention that, DNA sequence analysis is very crucial to learn about hierarchical classification of that particular organism. This dataset (patent US 7547531) is chosen to simplify all the complex raw data buried in undisclosed DNA sequences which help to open doors for new collaborations. In this data, a total of 48 unidentified DNA sequences from patent US 7547531 were selected and their complete sequences were retrieved from NCBI BioSample database. Quick response (QR) code of those DNA sequences was constructed by DNA BarID tool. QR code is useful for the identification and comparison of isolates with other organisms. AT/GC content of the DNA sequences was determined using ENDMEMO GC Content Calculator, which indicates their stability at different temperature. The highest GC content was observed in GP445188 (62.5%) which was followed by GP445198 (61.8%) and GP445189 (59.44%), while lowest was in GP445178 (24.39%). In addition, New England BioLabs (NEB) database was used to identify cleavage code indicating the 5, 3 and blunt end and enzyme code indicating the methylation site of the DNA sequences was also shown. These data will be helpful for the construction of the organisms' hierarchical classification, determination of their phylogenetic and taxonomic position and revelation of their molecular characteristics.

Molecular analysis of the human faecal archaea in a southern Indian population.

PubMed

Rani, Sandya B; Balamurugan, Ramadass; Ramakrishna, Balakrishnan S

2017-03-01

Archaea are an important constituent of the human gut microbiota, but there is no information on human gut archaea in an Indian population. In this study, faecal samples were obtained from different age groups (neonatal babies, preschool children, school-going children, adolescents, adults and elderly) of a southern Indian population, and from a tribal population also resident in southern India). 16S rRNA gene sequences specific to Archaea were amplified from pooled faecal DNA in each group, sequenced, and aligned against the NCBI database. Of the 806 adequate sequences in the study, most aligned with 22 known sequences. There were 9 novel sequences in the present study. All sequences were deposited in the GenBank nucleotide sequence database with the following accession numbers: KF607113 - KF607918. Methanobrevibacter was the most prevalent genus among all the age groups accounting for 98% in neonates, 96% in post-weaning, and 100% each in preschool, school and adult population. In the elderly, Methanobrevibacter accounted for 96% and in tribal adults, 99% of the clones belonged to Methanobrevibacter genus. Other genera detected included Caldisphaera, Halobaculum, Methanosphaeraand Thermogymnomonas. Methanobrevibacter smithii predominated in all age groups, accounting for 749 (92.9%) of the 806 sequences. Archaea can be found in the faeces of southern Indian residents immediately after birth. Methanobrevibacter smithii was the dominant faecal archeon in all age groups, with other genera being found at the extremes of age.

Isolation of Chandipura virus (Vesiculovirus: Rhabdoviridae) from Sergentomyia species of sandflies from Nagpur, Maharashtra, India.

PubMed

Sudeep, A B; Bondre, V P; Gurav, Y K; Gokhale, M D; Sapkal, G N; Mavale, M S; George, R P; Mishra, A C

2014-05-01

An outbreak of acute encephalitis syndrome was reported from Vidarbha region of Maharashtra s0 tate, India, during July 2012. Anti-IgM antibodies against Chandipura virus (CHPV) were detected in clinical samples. Sandfly collections were done to determine their role in CHPV transmission. Twenty nine pools of Sergentomyia spp. comprising 625 specimens were processed for virus isolation in Vero E6 cell line. Diagnostic RT-PCR targeting N-gene was carried out with the sample that showed cytopathic effects (CPE). The PCR product was sequenced, analysed and the sequences were deposited in Genbank database. CPE in Vero E6 cell line infected with three pools was detected at 48 h post infection. However, virus could be isolated only from one pool. RT-PCR studies demonstrated 527 nucleotide product that confirmed the agent as CHPV. Sequence analysis of the new isolate showed difference in 10-12 nucleotides in comparison to earlier isolates. This is perhaps the first isolation of CHPV from Sergentomyia spp. in India and virus isolation during transmission season suggests their probable role in CHPV transmission. Further studies need to be done to confirm the precise role of Sargentomyia spp. in CHPV transmission.

The small RNA profile in latex from Hevea brasiliensis trees is affected by tapping panel dryness.

PubMed

Gébelin, Virginie; Leclercq, Julie; Kuswanhadi; Argout, Xavier; Chaidamsari, Tetty; Hu, Songnian; Tang, Chaorong; Sarah, Gautier; Yang, Meng; Montoro, Pascal

2013-10-01

Natural rubber is harvested by tapping Hevea brasiliensis (Willd. ex A. Juss.) Müll. Arg. Harvesting stress can lead to tapping panel dryness (TPD). MicroRNAs (miRNAs) are induced by abiotic stress and regulate gene expression by targeting the cleavage or translational inhibition of target messenger RNAs. This study set out to sequence miRNAs expressed in latex cells and to identify TPD-related putative targets. Deep sequencing of small RNAs was carried out on latex from trees affected by TPD using Solexa technology. The most abundant small RNA class size was 21 nucleotides for TPD trees compared with 24 nucleotides in healthy trees. By combining the LeARN pipeline, data from the Plant MicroRNA database and Hevea EST sequences, we identified 19 additional conserved and four putative species-specific miRNA families not found in previous studies on rubber. The relative transcript abundance of the Hbpre-MIR159b gene increased with TPD. This study revealed a small RNA-specific signature of TPD-affected trees. Both RNA degradation and a shift in miRNA biogenesis are suggested to explain the general decline in small RNAs and, particularly, in miRNAs.

Vascular endothelial cells express isoforms of protein kinase A inhibitor.

PubMed

Lum, Hazel; Hao, Zengping; Gayle, Dave; Kumar, Priyadarsini; Patterson, Carolyn E; Uhler, Michael D

2002-01-01

The expression and function of the endogenous inhibitor of cAMP-dependent protein kinase (PKI) in endothelial cells are unknown. In this study, overexpression of rabbit muscle PKI gene into endothelial cells inhibited the cAMP-mediated increase and exacerbated thrombin-induced decrease in endothelial barrier function. We investigated PKI expression in human pulmonary artery (HPAECs), foreskin microvessel (HMECs), and brain microvessel endothelial cells (HBMECs). RT-PCR using specific primers for human PKI alpha, human PKI gamma, and mouse PKI beta sequences detected PKI alpha and PKI gamma mRNA in all three cell types. Sequencing and BLAST analysis indicated that forward and reverse DNA strands for PKI alpha and PKI gamma were of >96% identity with database sequences. RNase protection assays showed protection of the 542 nucleotides in HBMEC and HPAEC PKI alpha mRNA and 240 nucleotides in HBMEC, HPAEC, and HMEC PKI gamma mRNA. Western blot analysis indicated that PKI gamma protein was detected in all three cell types, whereas PKI alpha was found in HBMECs. In summary, endothelial cells from three different vascular beds express PKI alpha and PKI gamma, which may be physiologically important in endothelial barrier function.

High-Throughput Sequence Analysis of Turbot (Scophthalmus maximus) Transcriptome Using 454-Pyrosequencing for the Discovery of Antiviral Immune Genes

PubMed Central

Pereiro, Patricia; Balseiro, Pablo; Romero, Alejandro; Dios, Sonia; Forn-Cuni, Gabriel; Fuste, Berta; Planas, Josep V.; Beltran, Sergi; Novoa, Beatriz; Figueras, Antonio

2012-01-01

Background Turbot (Scophthalmus maximus L.) is an important aquacultural resource both in Europe and Asia. However, there is little information on gene sequences available in public databases. Currently, one of the main problems affecting the culture of this flatfish is mortality due to several pathogens, especially viral diseases which are not treatable. In order to identify new genes involved in immune defense, we conducted 454-pyrosequencing of the turbot transcriptome after different immune stimulations. Methodology/Principal Findings Turbot were injected with viral stimuli to increase the expression level of immune-related genes. High-throughput deep sequencing using 454-pyrosequencing technology yielded 915,256 high-quality reads. These sequences were assembled into 55,404 contigs that were subjected to annotation steps. Intriguingly, 55.16% of the deduced protein was not significantly similar to any sequences in the databases used for the annotation and only 0.85% of the BLASTx top-hits matched S. maximus protein sequences. This relatively low level of annotation is possibly due to the limited information for this specie and other flatfish in the database. These results suggest the identification of a large number of new genes in turbot and in fish in general. A more detailed analysis showed the presence of putative members of several innate and specific immune pathways. Conclusions/Significance To our knowledge, this study is the first transcriptome analysis using 454-pyrosequencing for turbot. Previously, there were only 12,471 EST and less of 1,500 nucleotide sequences for S. maximus in NCBI database. Our results provide a rich source of data (55,404 contigs and 181,845 singletons) for discovering and identifying new genes, which will serve as a basis for microarray construction, gene expression characterization and for identification of genetic markers to be used in several applications. Immune stimulation in turbot was very effective, obtaining an enormous variety of sequences belonging to genes involved in the defense mechanisms. PMID:22629298

MOSAIC: an online database dedicated to the comparative genomics of bacterial strains at the intra-species level.

PubMed

Chiapello, Hélène; Gendrault, Annie; Caron, Christophe; Blum, Jérome; Petit, Marie-Agnès; El Karoui, Meriem

2008-11-27

The recent availability of complete sequences for numerous closely related bacterial genomes opens up new challenges in comparative genomics. Several methods have been developed to align complete genomes at the nucleotide level but their use and the biological interpretation of results are not straightforward. It is therefore necessary to develop new resources to access, analyze, and visualize genome comparisons. Here we present recent developments on MOSAIC, a generalist comparative bacterial genome database. This database provides the bacteriologist community with easy access to comparisons of complete bacterial genomes at the intra-species level. The strategy we developed for comparison allows us to define two types of regions in bacterial genomes: backbone segments (i.e., regions conserved in all compared strains) and variable segments (i.e., regions that are either specific to or variable in one of the aligned genomes). Definition of these segments at the nucleotide level allows precise comparative and evolutionary analyses of both coding and non-coding regions of bacterial genomes. Such work is easily performed using the MOSAIC Web interface, which allows browsing and graphical visualization of genome comparisons. The MOSAIC database now includes 493 pairwise comparisons and 35 multiple maximal comparisons representing 78 bacterial species. Genome conserved regions (backbones) and variable segments are presented in various formats for further analysis. A graphical interface allows visualization of aligned genomes and functional annotations. The MOSAIC database is available online at http://genome.jouy.inra.fr/mosaic.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

VCGDB: a dynamic genome database of the Chinese population

PubMed Central

2014-01-01

Background The data released by the 1000 Genomes Project contain an increasing number of genome sequences from different nations and populations with a large number of genetic variations. As a result, the focus of human genome studies is changing from single and static to complex and dynamic. The currently available human reference genome (GRCh37) is based on sequencing data from 13 anonymous Caucasian volunteers, which might limit the scope of genomics, transcriptomics, epigenetics, and genome wide association studies. Description We used the massive amount of sequencing data published by the 1000 Genomes Project Consortium to construct the Virtual Chinese Genome Database (VCGDB), a dynamic genome database of the Chinese population based on the whole genome sequencing data of 194 individuals. VCGDB provides dynamic genomic information, which contains 35 million single nucleotide variations (SNVs), 0.5 million insertions/deletions (indels), and 29 million rare variations, together with genomic annotation information. VCGDB also provides a highly interactive user-friendly virtual Chinese genome browser (VCGBrowser) with functions like seamless zooming and real-time searching. In addition, we have established three population-specific consensus Chinese reference genomes that are compatible with mainstream alignment software. Conclusions VCGDB offers a feasible strategy for processing big data to keep pace with the biological data explosion by providing a robust resource for genomics studies; in particular, studies aimed at finding regions of the genome associated with diseases. PMID:24708222

TypeLoader: A fast and efficient automated workflow for the annotation and submission of novel full-length HLA alleles.

PubMed

Surendranath, V; Albrecht, V; Hayhurst, J D; Schöne, B; Robinson, J; Marsh, S G E; Schmidt, A H; Lange, V

2017-07-01

Recent years have seen a rapid increase in the discovery of novel allelic variants of the human leukocyte antigen (HLA) genes. Commonly, only the exons encoding the peptide binding domains of novel HLA alleles are submitted. As a result, the IPD-IMGT/HLA Database lacks sequence information outside those regions for the majority of known alleles. This has implications for the application of the new sequencing technologies, which deliver sequence data often covering the complete gene. As these technologies simplify the characterization of the complete gene regions, it is desirable for novel alleles to be submitted as full-length sequences to the database. However, the manual annotation of full-length alleles and the generation of specific formats required by the sequence repositories is prone to error and time consuming. We have developed TypeLoader to address both these facets. With only the full-length sequence as a starting point, Typeloader performs automatic sequence annotation and subsequently handles all steps involved in preparing the specific formats for submission with very little manual intervention. TypeLoader is routinely used at the DKMS Life Science Lab and has aided in the successful submission of more than 900 novel HLA alleles as full-length sequences to the European Nucleotide Archive repository and the IPD-IMGT/HLA Database with a 95% reduction in the time spent on annotation and submission when compared with handling these processes manually. TypeLoader is implemented as a web application and can be easily installed and used on a standalone Linux desktop system or within a Linux client/server architecture. TypeLoader is downloadable from http://www.github.com/DKMS-LSL/typeloader. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

In silico analysis of subtilisin from Glaciozyma antarctica PI12

NASA Astrophysics Data System (ADS)

Mustafha, Siti Mardhiah; Murad, Abdul Munir Abdul; Mahadi, Nor Muhammad; Kamaruddin, Shazilah; Bakar, Farah Diba Abu

2015-09-01

Subtilisin constitute as a major player in industrial enzymes that has a wide range of application especially in the detergent industry. In this study, a cDNA encoding for subtilisin (GaSUBT) was extracted from the psychrophilic yeast, Glaciozyma antarctica PI12, PCR amplified and sequenced. Various bioinformatics tools were used to characterize the GaSUBT. GaSUBT contains 1587 bp nucleotides encoding for 529 amino acids. The predicted molecular weight of the deduced protein is 55.34 kDa with an isoelectric point of 6.25. GaSUBT was predicted to possess a signal peptide and pro-peptide consisting of a peptidase inhibitor I9 sequence. From the sequence alignment analysis of deduced amino acids with other subtilisins in the NCBI database showed that the sequences surrounding the catalytic triad that forms the catalytic domain are well conserved.

De Novo Assembly and Characterization of Fruit Transcriptome in Black Pepper (Piper nigrum)

PubMed Central

Hu, Lisong; Hao, Chaoyun; Fan, Rui; Wu, Baoduo; Tan, Lehe; Wu, Huasong

2015-01-01

Black pepper is one of the most popular and oldest spices in the world and valued for its pungent constituent alkaloids. Pinerine is the main bioactive compound in pepper alkaloids, which perform unique physiological functions. However, the mechanisms of piperine synthesis are poorly understood. This study is the first to describe the fruit transcriptome of black pepper by sequencing on Illumina HiSeq 2000 platform. A total of 56,281,710 raw reads were obtained and assembled. From these raw reads, 44,061 unigenes with an average length of 1,345 nt were generated. During functional annotation, 40,537 unigenes were annotated in Gene Ontology categories, Kyoto Encyclopedia of Genes and Genomes pathways, Swiss-Prot database, and Nucleotide Collection (NR/NT) database. In addition, 8,196 simple sequence repeats (SSRs) were detected. In a detailed analysis of the transcriptome, housekeeping genes for quantitative polymerase chain reaction internal control, polymorphic SSRs, and lysine/ornithine metabolism-related genes were identified. These results validated the availability of our database. Our study could provide useful data for further research on piperine synthesis in black pepper. PMID:26121657

De Novo Assembly and Characterization of Fruit Transcriptome in Black Pepper (Piper nigrum).

PubMed

Hu, Lisong; Hao, Chaoyun; Fan, Rui; Wu, Baoduo; Tan, Lehe; Wu, Huasong

2015-01-01

Black pepper is one of the most popular and oldest spices in the world and valued for its pungent constituent alkaloids. Pinerine is the main bioactive compound in pepper alkaloids, which perform unique physiological functions. However, the mechanisms of piperine synthesis are poorly understood. This study is the first to describe the fruit transcriptome of black pepper by sequencing on Illumina HiSeq 2000 platform. A total of 56,281,710 raw reads were obtained and assembled. From these raw reads, 44,061 unigenes with an average length of 1,345 nt were generated. During functional annotation, 40,537 unigenes were annotated in Gene Ontology categories, Kyoto Encyclopedia of Genes and Genomes pathways, Swiss-Prot database, and Nucleotide Collection (NR/NT) database. In addition, 8,196 simple sequence repeats (SSRs) were detected. In a detailed analysis of the transcriptome, housekeeping genes for quantitative polymerase chain reaction internal control, polymorphic SSRs, and lysine/ornithine metabolism-related genes were identified. These results validated the availability of our database. Our study could provide useful data for further research on piperine synthesis in black pepper.

Automated detection of records in biological sequence databases that are inconsistent with the literature.

PubMed

Bouadjenek, Mohamed Reda; Verspoor, Karin; Zobel, Justin

2017-07-01

We investigate and analyse the data quality of nucleotide sequence databases with the objective of automatic detection of data anomalies and suspicious records. Specifically, we demonstrate that the published literature associated with each data record can be used to automatically evaluate its quality, by cross-checking the consistency of the key content of the database record with the referenced publications. Focusing on GenBank, we describe a set of quality indicators based on the relevance paradigm of information retrieval (IR). Then, we use these quality indicators to train an anomaly detection algorithm to classify records as "confident" or "suspicious". Our experiments on the PubMed Central collection show assessing the coherence between the literature and database records, through our algorithms, is an effective mechanism for assisting curators to perform data cleansing. Although fewer than 0.25% of the records in our data set are known to be faulty, we would expect that there are many more in GenBank that have not yet been identified. By automated comparison with literature they can be identified with a precision of up to 10% and a recall of up to 30%, while strongly outperforming several baselines. While these results leave substantial room for improvement, they reflect both the very imbalanced nature of the data, and the limited explicitly labelled data that is available. Overall, the obtained results show promise for the development of a new kind of approach to detecting low-quality and suspicious sequence records based on literature analysis and consistency. From a practical point of view, this will greatly help curators in identifying inconsistent records in large-scale sequence databases by highlighting records that are likely to be inconsistent with the literature. Copyright © 2017 Elsevier Inc. All rights reserved.

MetaBar - a tool for consistent contextual data acquisition and standards compliant submission.

PubMed

Hankeln, Wolfgang; Buttigieg, Pier Luigi; Fink, Dennis; Kottmann, Renzo; Yilmaz, Pelin; Glöckner, Frank Oliver

2010-06-30

Environmental sequence datasets are increasing at an exponential rate; however, the vast majority of them lack appropriate descriptors like sampling location, time and depth/altitude: generally referred to as metadata or contextual data. The consistent capture and structured submission of these data is crucial for integrated data analysis and ecosystems modeling. The application MetaBar has been developed, to support consistent contextual data acquisition. MetaBar is a spreadsheet and web-based software tool designed to assist users in the consistent acquisition, electronic storage, and submission of contextual data associated to their samples. A preconfigured Microsoft Excel spreadsheet is used to initiate structured contextual data storage in the field or laboratory. Each sample is given a unique identifier and at any stage the sheets can be uploaded to the MetaBar database server. To label samples, identifiers can be printed as barcodes. An intuitive web interface provides quick access to the contextual data in the MetaBar database as well as user and project management capabilities. Export functions facilitate contextual and sequence data submission to the International Nucleotide Sequence Database Collaboration (INSDC), comprising of the DNA DataBase of Japan (DDBJ), the European Molecular Biology Laboratory database (EMBL) and GenBank. MetaBar requests and stores contextual data in compliance to the Genomic Standards Consortium specifications. The MetaBar open source code base for local installation is available under the GNU General Public License version 3 (GNU GPL3). The MetaBar software supports the typical workflow from data acquisition and field-sampling to contextual data enriched sequence submission to an INSDC database. The integration with the megx.net marine Ecological Genomics database and portal facilitates georeferenced data integration and metadata-based comparisons of sampling sites as well as interactive data visualization. The ample export functionalities and the INSDC submission support enable exchange of data across disciplines and safeguarding contextual data.

MetaBar - a tool for consistent contextual data acquisition and standards compliant submission

PubMed Central

2010-01-01

Background Environmental sequence datasets are increasing at an exponential rate; however, the vast majority of them lack appropriate descriptors like sampling location, time and depth/altitude: generally referred to as metadata or contextual data. The consistent capture and structured submission of these data is crucial for integrated data analysis and ecosystems modeling. The application MetaBar has been developed, to support consistent contextual data acquisition. Results MetaBar is a spreadsheet and web-based software tool designed to assist users in the consistent acquisition, electronic storage, and submission of contextual data associated to their samples. A preconfigured Microsoft® Excel® spreadsheet is used to initiate structured contextual data storage in the field or laboratory. Each sample is given a unique identifier and at any stage the sheets can be uploaded to the MetaBar database server. To label samples, identifiers can be printed as barcodes. An intuitive web interface provides quick access to the contextual data in the MetaBar database as well as user and project management capabilities. Export functions facilitate contextual and sequence data submission to the International Nucleotide Sequence Database Collaboration (INSDC), comprising of the DNA DataBase of Japan (DDBJ), the European Molecular Biology Laboratory database (EMBL) and GenBank. MetaBar requests and stores contextual data in compliance to the Genomic Standards Consortium specifications. The MetaBar open source code base for local installation is available under the GNU General Public License version 3 (GNU GPL3). Conclusion The MetaBar software supports the typical workflow from data acquisition and field-sampling to contextual data enriched sequence submission to an INSDC database. The integration with the megx.net marine Ecological Genomics database and portal facilitates georeferenced data integration and metadata-based comparisons of sampling sites as well as interactive data visualization. The ample export functionalities and the INSDC submission support enable exchange of data across disciplines and safeguarding contextual data. PMID:20591175

Leukotriene signaling in the extinct human subspecies Homo denisovan and Homo neanderthalensis. Structural and functional comparison with Homo sapiens.

PubMed

Adel, Susan; Kakularam, Kumar Reddy; Horn, Thomas; Reddanna, Pallu; Kuhn, Hartmut; Heydeck, Dagmar

2015-01-01

Mammalian lipoxygenases (LOXs) have been implicated in cell differentiation and in the biosynthesis of pro- and anti-inflammatory lipid mediators. The initial draft sequence of the Homo neanderthalensis genome (coverage of 1.3-fold) suggested defective leukotriene signaling in this archaic human subspecies since expression of essential proteins appeared to be corrupted. Meanwhile high quality genomic sequence data became available for two extinct human subspecies (H. neanderthalensis, Homo denisovan) and completion of the human 1000 genome project provided a comprehensive database characterizing the genetic variability of the human genome. For this study we extracted the nucleotide sequences of selected eicosanoid relevant genes (ALOX5, ALOX15, ALOX12, ALOX15B, ALOX12B, ALOXE3, COX1, COX2, LTA4H, LTC4S, ALOX5AP, CYSLTR1, CYSLTR2, BLTR1, BLTR2) from the corresponding databases. Comparison of the deduced amino acid sequences in connection with site-directed mutagenesis studies and structural modeling suggested that the major enzymes and receptors of leukotriene signaling as well as the two cyclooxygenase isoforms were fully functional in these two extinct human subspecies. Copyright © 2014 Elsevier Inc. All rights reserved.

Diagnosis of local hepatic tuberculosis through next-generation sequencing: Smarter, faster and better.

PubMed

Ai, Jing-Wen; Li, Yang; Cheng, Qi; Cui, Peng; Wu, Hong-Long; Xu, Bin; Zhang, Wen-Hong

2018-06-01

A 45-year-old man who complained of continuous fever and multiple hepatic masses was admitted to our hospital. Repeated MRI manifestations were similar while each radiological report suggested contradictory diagnosis pointing to infections or malignances respectively. Pathologic examination of the liver tissue showed no direct evidence of either infections or tumor. We performed next-generation sequencing on the liver tissue and peripheral blood to further investigate the possible etiology. High throughput sequencing was performed on the liver lesion tissues using BGISEQ-100 platform, and data was mapped to the Microbial Genome Databases after filtering low quality data and human reads. We identified a total of 299 sequencing reads of Mycobacterium tuberculosis (M. tuberculosis) complex sequences from the liver tissue, including 8, 229 of 4,424,435 of the M. tuberculosis nucleotide sequences, and Mycobacterium africanum, Mycobacterium bovis, and Mycobacterium canettii were also detected due to the 99.9% identical rate among these strains. No specific Mycobacterial tuberculosis nucleotide sequence was detected in the sample of peripheral blood. Patient's symptom quickly recovered after anti-tuberculosis treatment and repeated Ziehl-Neelsen staining of the liver tissue finally identified small numbers of positive bacillus. The diagnosis of this patient was difficult to establish before the next-generation sequencing because of contradictive radiological results and negative pathological findings. More sensitive diagnostic methods are urgently needed. This is the first case reporting hepatic tuberculosis confirmed by the next-generation sequencing, and marks the promising potential of the application of the next-generation sequencing in the diagnosis of hepatic lesions with unknown etiology. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

African-American mitochondrial DNAs often match mtDNAs found in multiple African ethnic groups

PubMed Central

Ely, Bert; Wilson, Jamie Lee; Jackson, Fatimah; Jackson, Bruce A

2006-01-01

Background Mitochondrial DNA (mtDNA) haplotypes have become popular tools for tracing maternal ancestry, and several companies offer this service to the general public. Numerous studies have demonstrated that human mtDNA haplotypes can be used with confidence to identify the continent where the haplotype originated. Ideally, mtDNA haplotypes could also be used to identify a particular country or ethnic group from which the maternal ancestor emanated. However, the geographic distribution of mtDNA haplotypes is greatly influenced by the movement of both individuals and population groups. Consequently, common mtDNA haplotypes are shared among multiple ethnic groups. We have studied the distribution of mtDNA haplotypes among West African ethnic groups to determine how often mtDNA haplotypes can be used to reconnect Americans of African descent to a country or ethnic group of a maternal African ancestor. The nucleotide sequence of the mtDNA hypervariable segment I (HVS-I) usually provides sufficient information to assign a particular mtDNA to the proper haplogroup, and it contains most of the variation that is available to distinguish a particular mtDNA haplotype from closely related haplotypes. In this study, samples of general African-American and specific Gullah/Geechee HVS-I haplotypes were compared with two databases of HVS-I haplotypes from sub-Saharan Africa, and the incidence of perfect matches recorded for each sample. Results When two independent African-American samples were analyzed, more than half of the sampled HVS-I mtDNA haplotypes exactly matched common haplotypes that were shared among multiple African ethnic groups. Another 40% did not match any sequence in the database, and fewer than 10% were an exact match to a sequence from a single African ethnic group. Differences in the regional distribution of haplotypes were observed in the African database, and the African-American haplotypes were more likely to match haplotypes found in ethnic groups from West or West Central Africa than those found in eastern or southern Africa. Fewer than 14% of the African-American mtDNA sequences matched sequences from only West Africa or only West Central Africa. Conclusion Our database of sub-Saharan mtDNA sequences includes the most common haplotypes that are shared among ethnic groups from multiple regions of Africa. These common haplotypes have been found in half of all sub-Saharan Africans. More than 60% of the remaining haplotypes differ from the common haplotypes at a single nucleotide position in the HVS-I region, and they are likely to occur at varying frequencies within sub-Saharan Africa. However, the finding that 40% of the African-American mtDNAs analyzed had no match in the database indicates that only a small fraction of the total number of African haplotypes has been identified. In addition, the finding that fewer than 10% of African-American mtDNAs matched mtDNA sequences from a single African region suggests that few African Americans might be able to trace their mtDNA lineages to a particular region of Africa, and even fewer will be able to trace their mtDNA to a single ethnic group. However, no firm conclusions should be made until a much larger database is available. It is clear, however, that when identical mtDNA haplotypes are shared among many ethnic groups from different parts of Africa, it is impossible to determine which single ethnic group was the source of a particular maternal ancestor based on the mtDNA sequence. PMID:17038170

TRANSFAC: an integrated system for gene expression regulation.

PubMed

Wingender, E; Chen, X; Hehl, R; Karas, H; Liebich, I; Matys, V; Meinhardt, T; Prüss, M; Reuter, I; Schacherer, F

2000-01-01

TRANSFAC is a database on transcription factors, their genomic binding sites and DNA-binding profiles (http://transfac.gbf.de/TRANSFAC/). Its content has been enhanced, in particular by information about training sequences used for the construction of nucleotide matrices as well as by data on plant sites and factors. Moreover, TRANSFAC has been extended by two new modules: PathoDB provides data on pathologically relevant mutations in regulatory regions and transcription factor genes, whereas S/MARt DB compiles features of scaffold/matrix attached regions (S/MARs) and the proteins binding to them. Additionally, the databases TRANSPATH, about signal transduction, and CYTOMER, about organs and cell types, have been extended and are increasingly integrated with the TRANSFAC data sources.

Aminoacyl-tRNA synthetases database Y2K

PubMed Central

Szymanski, Maciej; Barciszewski, Jan

2000-01-01

The aminoacyl-tRNA synthetases (AARS) are a diverse group of enzymes that ensure the fidelity of transfer of genetic information from DNA into protein. They catalyse the attachment of amino acids to transfer RNAs and thereby establish the rules of the genetic code by virtue of matching the nucleotide triplet of the anticodon with its cognate amino acid. Currently, 818 AARS primary structures have been reported from archaebacteria, eubacteria, mitochondria, chloroplasts and eukaryotic cells. The database is a compilation of the amino acid sequences of all AARSs, known to date, which are available as separate entries or alignments of related proteins via the WWW at http://rose.man.poznan.pl/aars/index.html PMID:10592262

Aminoacyl-tRNA synthetases database Y2K.

PubMed

Szymanski, M; Barciszewski, J

2000-01-01

The aminoacyl-tRNA synthetases (AARS) are a diverse group of enzymes that ensure the fidelity of transfer of genetic information from DNA into protein. They catalyse the attachment of amino acids to transfer RNAs and thereby establish the rules of the genetic code by virtue of matching the nucleotide triplet of the anticodon with its cognate amino acid. Currently, 818 AARS primary structures have been reported from archaebacteria, eubacteria, mitochondria, chloro-plasts and eukaryotic cells. The database is a compilation of the amino acid sequences of all AARSs, known to date, which are available as separate entries or alignments of related proteins via the WWW at http://rose.man.poznan.pl/aars/index.html

BEND3 is involved in the human-specific repression of calreticulin: Implication for the evolution of higher brain functions in human.

PubMed

Aghajanirefah, A; Nguyen, L N; Ohadi, M

2016-01-15

Recent emerging evidence indicates that changes in gene expression levels are linked to human evolution. We have previously reported a human-specific nucleotide in the promoter sequence of the calreticulin (CALR) gene at position -220C, which is the site of action of valproic acid. Reversion of this nucleotide to the ancestral A-allele has been detected in patients with degrees of deficit in higher brain cognitive functions. This mutation has since been reported in the 1000 genomes database at an approximate frequency of <0.0004 in humans (rs138452745). In the study reported here, we present update on the status of rs138452745 across evolution, based on the Ensembl and NCBI databases. The DNA pulldown assay was also used to identify the proteins binding to the C- and A-alleles, using two cell lines, SK-N-BE and HeLa. Consistent with our previous findings, the C-allele is human-specific, and the A-allele is the rule across all other species (N=38). This nucleotide resides in a block of 12-nucleotides that is strictly conserved across evolution. The DNA pulldown experiments revealed that in both SK-N-BE and HeLa cells, the transcription repressor BEN domain containing 3 (BEND3) binds to the human-specific C-allele, whereas the nuclear factor I (NFI) family members, NF1A, B, C, and X, specifically bind to the ancestral A-allele. This binding pattern is consistent with a previously reported decreased promoter activity of the C-allele vs. the A-allele. We propose that there is a link between binding of BEND3 to the CALR rs138452745 C-allele and removal of NFI binding site from this nucleotide, and the evolution of human-specific higher brain functions. To our knowledge, CALR rs138452745 is the first instance of enormous nucleotide conservation across evolution, except in the human species. Copyright © 2015 Elsevier B.V. All rights reserved.

The PARIGA server for real time filtering and analysis of reciprocal BLAST results.

PubMed

Orsini, Massimiliano; Carcangiu, Simone; Cuccuru, Gianmauro; Uva, Paolo; Tramontano, Anna

2013-01-01

BLAST-based similarity searches are commonly used in several applications involving both nucleotide and protein sequences. These applications span from simple tasks such as mapping sequences over a database to more complex procedures as clustering or annotation processes. When the amount of analysed data increases, manual inspection of BLAST results become a tedious procedure. Tools for parsing or filtering BLAST results for different purposes are then required. We describe here PARIGA (http://resources.bioinformatica.crs4.it/pariga/), a server that enables users to perform all-against-all BLAST searches on two sets of sequences selected by the user. Moreover, since it stores the two BLAST output in a python-serialized-objects database, results can be filtered according to several parameters in real-time fashion, without re-running the process and avoiding additional programming efforts. Results can be interrogated by the user using logical operations, for example to retrieve cases where two queries match same targets, or when sequences from the two datasets are reciprocal best hits, or when a query matches a target in multiple regions. The Pariga web server is designed to be a helpful tool for managing the results of sequence similarity searches. The design and implementation of the server renders all operations very fast and easy to use.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

The standard operating procedure of the DOE-JGI Metagenome Annotation Pipeline (MAP v.4)

DOE PAGES

Huntemann, Marcel; Ivanova, Natalia N.; Mavromatis, Konstantinos; ...

2016-02-24

The DOE-JGI Metagenome Annotation Pipeline (MAP v.4) performs structural and functional annotation for metagenomic sequences that are submitted to the Integrated Microbial Genomes with Microbiomes (IMG/M) system for comparative analysis. The pipeline runs on nucleotide sequences provide d via the IMG submission site. Users must first define their analysis projects in GOLD and then submit the associated sequence datasets consisting of scaffolds/contigs with optional coverage information and/or unassembled reads in fasta and fastq file formats. The MAP processing consists of feature prediction including identification of protein-coding genes, non-coding RNAs and regulatory RNAs, as well as CRISPR elements. Structural annotation ismore » followed by functional annotation including assignment of protein product names and connection to various protein family databases.« less

The standard operating procedure of the DOE-JGI Metagenome Annotation Pipeline (MAP v.4)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huntemann, Marcel; Ivanova, Natalia N.; Mavromatis, Konstantinos

The DOE-JGI Metagenome Annotation Pipeline (MAP v.4) performs structural and functional annotation for metagenomic sequences that are submitted to the Integrated Microbial Genomes with Microbiomes (IMG/M) system for comparative analysis. The pipeline runs on nucleotide sequences provide d via the IMG submission site. Users must first define their analysis projects in GOLD and then submit the associated sequence datasets consisting of scaffolds/contigs with optional coverage information and/or unassembled reads in fasta and fastq file formats. The MAP processing consists of feature prediction including identification of protein-coding genes, non-coding RNAs and regulatory RNAs, as well as CRISPR elements. Structural annotation ismore » followed by functional annotation including assignment of protein product names and connection to various protein family databases.« less

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

StatsDB: platform-agnostic storage and understanding of next generation sequencing run metrics

PubMed Central

Ramirez-Gonzalez, Ricardo H.; Leggett, Richard M.; Waite, Darren; Thanki, Anil; Drou, Nizar; Caccamo, Mario; Davey, Robert

2014-01-01

Modern sequencing platforms generate enormous quantities of data in ever-decreasing amounts of time. Additionally, techniques such as multiplex sequencing allow one run to contain hundreds of different samples. With such data comes a significant challenge to understand its quality and to understand how the quality and yield are changing across instruments and over time. As well as the desire to understand historical data, sequencing centres often have a duty to provide clear summaries of individual run performance to collaborators or customers. We present StatsDB, an open-source software package for storage and analysis of next generation sequencing run metrics. The system has been designed for incorporation into a primary analysis pipeline, either at the programmatic level or via integration into existing user interfaces. Statistics are stored in an SQL database and APIs provide the ability to store and access the data while abstracting the underlying database design. This abstraction allows simpler, wider querying across multiple fields than is possible by the manual steps and calculation required to dissect individual reports, e.g. ”provide metrics about nucleotide bias in libraries using adaptor barcode X, across all runs on sequencer A, within the last month”. The software is supplied with modules for storage of statistics from FastQC, a commonly used tool for analysis of sequence reads, but the open nature of the database schema means it can be easily adapted to other tools. Currently at The Genome Analysis Centre (TGAC), reports are accessed through our LIMS system or through a standalone GUI tool, but the API and supplied examples make it easy to develop custom reports and to interface with other packages. PMID:24627795

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

PubMed

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Deep insight into the Ganoderma lucidum by comprehensive analysis of its transcriptome.

PubMed

Yu, Guo-Jun; Wang, Man; Huang, Jie; Yin, Ya-Lin; Chen, Yi-Jie; Jiang, Shuai; Jin, Yan-Xia; Lan, Xian-Qing; Wong, Barry Hon Cheung; Liang, Yi; Sun, Hui

2012-01-01

Ganoderma lucidum is a basidiomycete white rot fungus and is of medicinal importance in China, Japan and other countries in the Asiatic region. To date, much research has been performed in identifying the medicinal ingredients in Ganoderma lucidum. Despite its important therapeutic effects in disease, little is known about Ganoderma lucidum at the genomic level. In order to gain a molecular understanding of this fungus, we utilized Illumina high-throughput technology to sequence and analyze the transcriptome of Ganoderma lucidum. We obtained 6,439,690 and 6,416,670 high-quality reads from the mycelium and fruiting body of Ganoderma lucidum, and these were assembled to form 18,892 and 27,408 unigenes, respectively. A similarity search was performed against the NCBI non-redundant nucleotide database and a customized database composed of five fungal genomes. 11,098 and 8, 775 unigenes were matched to the NCBI non-redundant nucleotide database and our customized database, respectively. All unigenes were subjected to annotation by Gene Ontology, Eukaryotic Orthologous Group terms and Kyoto Encyclopedia of Genes and Genomes. Differentially expressed genes from the Ganoderma lucidum mycelium and fruiting body stage were analyzed, resulting in the identification of 13 unigenes which are involved in the terpenoid backbone biosynthesis pathway. Quantitative real-time PCR was used to confirm the expression levels of these unigenes. Ganoderma lucidum was also studied for wood degrading activity and a total of 22 putative FOLymes (fungal oxidative lignin enzymes) and 120 CAZymes (carbohydrate-active enzymes) were predicted from our Ganoderma lucidum transcriptome. Our study provides comprehensive gene expression information on Ganoderma lucidum at the transcriptional level, which will form the foundation for functional genomics studies in this fungus. The use of Illumina sequencing technology has made de novo transcriptome assembly and gene expression analysis possible in species that lack full genome information.

Deep Insight into the Ganoderma lucidum by Comprehensive Analysis of Its Transcriptome

PubMed Central

Yu, Guo-Jun; Wang, Man; Huang, Jie; Yin, Ya-Lin; Chen, Yi-Jie; Jiang, Shuai; Jin, Yan-Xia; Lan, Xian-Qing; Wong, Barry Hon Cheung; Liang, Yi; Sun, Hui

2012-01-01

Background Ganoderma lucidum is a basidiomycete white rot fungus and is of medicinal importance in China, Japan and other countries in the Asiatic region. To date, much research has been performed in identifying the medicinal ingredients in Ganoderma lucidum. Despite its important therapeutic effects in disease, little is known about Ganoderma lucidum at the genomic level. In order to gain a molecular understanding of this fungus, we utilized Illumina high-throughput technology to sequence and analyze the transcriptome of Ganoderma lucidum. Methodology/Principal Findings We obtained 6,439,690 and 6,416,670 high-quality reads from the mycelium and fruiting body of Ganoderma lucidum, and these were assembled to form 18,892 and 27,408 unigenes, respectively. A similarity search was performed against the NCBI non-redundant nucleotide database and a customized database composed of five fungal genomes. 11,098 and 8, 775 unigenes were matched to the NCBI non-redundant nucleotide database and our customized database, respectively. All unigenes were subjected to annotation by Gene Ontology, Eukaryotic Orthologous Group terms and Kyoto Encyclopedia of Genes and Genomes. Differentially expressed genes from the Ganoderma lucidum mycelium and fruiting body stage were analyzed, resulting in the identification of 13 unigenes which are involved in the terpenoid backbone biosynthesis pathway. Quantitative real-time PCR was used to confirm the expression levels of these unigenes. Ganoderma lucidum was also studied for wood degrading activity and a total of 22 putative FOLymes (fungal oxidative lignin enzymes) and 120 CAZymes (carbohydrate-active enzymes) were predicted from our Ganoderma lucidum transcriptome. Conclusions Our study provides comprehensive gene expression information on Ganoderma lucidum at the transcriptional level, which will form the foundation for functional genomics studies in this fungus. The use of Illumina sequencing technology has made de novo transcriptome assembly and gene expression analysis possible in species that lack full genome information. PMID:22952861

Molecular characterization of faba bean necrotic yellows viruses in Tunisia.

PubMed

Kraberger, Simona; Kumari, Safaa G; Najar, Asma; Stainton, Daisy; Martin, Darren P; Varsani, Arvind

2018-03-01

Faba bean necrotic yellows virus (FBNYV) (genus Nanovirus; family Nanoviridae) has a genome comprising eight individually encapsidated circular single-stranded DNA components. It has frequently been found infecting faba bean (Vicia faba L.) and chickpea (Cicer arietinum L.) in association with satellite molecules (alphasatellites). Genome sequences of FBNYV from Azerbaijan, Egypt, Iran, Morocco, Spain and Syria have been determined previously and we now report the first five genome sequences of FBNYV and associated alphasatellites from faba bean sampled in Tunisia. In addition, we have determined the genome sequences of two additional FBNYV isolates from chickpea plants sampled in Syria and Iran. All individual FBNYV genome component sequences that were determined here share > 84% nucleotide sequence identity with FBNYV sequences available in public databases, with the DNA-M component displaying the highest degree of diversity. As with other studied nanoviruses, recombination and genome component reassortment occurs frequently both between FBNYV genomes and between genomes of nanoviruses belonging to other species.

Identification of common, unique and polymorphic microsatellites among 73 cyanobacterial genomes.

PubMed

Kabra, Ritika; Kapil, Aditi; Attarwala, Kherunnisa; Rai, Piyush Kant; Shanker, Asheesh

2016-04-01

Microsatellites also known as Simple Sequence Repeats are short tandem repeats of 1-6 nucleotides. These repeats are found in coding as well as non-coding regions of both prokaryotic and eukaryotic genomes and play a significant role in the study of gene regulation, genetic mapping, DNA fingerprinting and evolutionary studies. The availability of 73 complete genome sequences of cyanobacteria enabled us to mine and statistically analyze microsatellites in these genomes. The cyanobacterial microsatellites identified through bioinformatics analysis were stored in a user-friendly database named CyanoSat, which is an efficient data representation and query system designed using ASP.net. The information in CyanoSat comprises of perfect, imperfect and compound microsatellites found in coding, non-coding and coding-non-coding regions. Moreover, it contains PCR primers with 200 nucleotides long flanking region. The mined cyanobacterial microsatellites can be freely accessed at www.compubio.in/CyanoSat/home.aspx. In addition to this 82 polymorphic, 13,866 unique and 2390 common microsatellites were also detected. These microsatellites will be useful in strain identification and genetic diversity studies of cyanobacteria.

MAX mutations status in Swedish patients with pheochromocytoma and paraganglioma tumours.

PubMed

Crona, Joakim; Maharjan, Rajani; Delgado Verdugo, Alberto; Stålberg, Peter; Granberg, Dan; Hellman, Per; Björklund, Peyman

2014-03-01

Pheochromocytoma (PCC) and Paraganglioma are rare tumours originating from neuroendocrine cells. Up to 60% of cases have either germline or somatic mutation in one of eleven described susceptibility loci, SDHA, SDHB, SDHC, SDHD, SDHAF2, VHL, EPAS1, RET, NF1, TMEM127 and MYC associated factor-X (MAX). Recently, germline mutations in MAX were found to confer susceptibility to PCC and paraganglioma (PGL). A subsequent multicentre study found about 1% of PCCs and PGLs to have germline or somatic mutations in MAX. However, there has been no study investigating the frequency of MAX mutations in a Scandinavian cohort. We analysed tumour specimens from 63 patients with PCC and PGL treated at Uppsala University hospital, Sweden, for re-sequencing of MAX using automated Sanger sequencing. Our results show that 0% (0/63) of tumours had mutations in MAX. Allele frequencies of known single nucleotide polymorphisms rs4902359, rs45440292, rs1957948 and rs1957949 corresponded to those available in the Single Nucleotide Polymorphism Database. We conclude that MAX mutations remain unusual events and targeted genetic screening should be considered after more common genetic events have been excluded.

Assessment of snake DNA barcodes based on mitochondrial COI and Cytb genes revealed multiple putative cryptic species in Thailand.

PubMed

Laopichienpong, Nararat; Muangmai, Narongrit; Supikamolseni, Arrjaree; Twilprawat, Panupon; Chanhome, Lawan; Suntrarachun, Sunutcha; Peyachoknagul, Surin; Srikulnath, Kornsorn

2016-12-15

DNA barcodes of mitochondrial cytochrome c oxidase I (COI), cytochrome b (Cytb) genes, and their combined data sets were constructed from 35 snake species in Thailand. No barcoding gap was detected in either of the two genes from the observed intra- and interspecific sequence divergences. Intra- and interspecific sequence divergences of the COI gene differed 14 times, with barcode cut-off scores ranging over 2%-4% for threshold values differentiated among most of the different species; the Cytb gene differed 6 times with cut-off scores ranging over 2%-6%. Thirty-five specific nucleotide mutations were also found at interspecific level in the COI gene, identifying 18 snake species, but no specific nucleotide mutation was observed for Cytb in any single species. This suggests that COI barcoding was a better marker than Cytb. Phylogenetic clustering analysis indicated that most species were represented by monophyletic clusters, suggesting that these snake species could be clearly differentiated using COI barcodes. However, the two-marker combination of both COI and Cytb was more effective, differentiating snake species by over 2%-4%, and reducing species numbers in the overlap value between intra- and interspecific divergences. Three species delimitation algorithms (general mixed Yule-coalescent, automatic barcoding gap detection, and statistical parsimony network analysis) were extensively applied to a wide range of snakes based on both barcodes. This revealed cryptic diversity for eleven snake species in Thailand. In addition, eleven accessions from the database previously grouped under the same species were represented at different species level, suggesting either high genetic diversity, or the misidentification of these sequences in the database as a consequence of cryptic species. Copyright © 2016 Elsevier B.V. All rights reserved.

Centrifuge: rapid and sensitive classification of metagenomic sequences

PubMed Central

Song, Li; Breitwieser, Florian P.

2016-01-01

Centrifuge is a novel microbial classification engine that enables rapid, accurate, and sensitive labeling of reads and quantification of species on desktop computers. The system uses an indexing scheme based on the Burrows-Wheeler transform (BWT) and the Ferragina-Manzini (FM) index, optimized specifically for the metagenomic classification problem. Centrifuge requires a relatively small index (4.2 GB for 4078 bacterial and 200 archaeal genomes) and classifies sequences at very high speed, allowing it to process the millions of reads from a typical high-throughput DNA sequencing run within a few minutes. Together, these advances enable timely and accurate analysis of large metagenomics data sets on conventional desktop computers. Because of its space-optimized indexing schemes, Centrifuge also makes it possible to index the entire NCBI nonredundant nucleotide sequence database (a total of 109 billion bases) with an index size of 69 GB, in contrast to k-mer-based indexing schemes, which require far more extensive space. PMID:27852649

mtDNAmanager: a Web-based tool for the management and quality analysis of mitochondrial DNA control-region sequences

PubMed Central

Lee, Hwan Young; Song, Injee; Ha, Eunho; Cho, Sung-Bae; Yang, Woo Ick; Shin, Kyoung-Jin

2008-01-01

Background For the past few years, scientific controversy has surrounded the large number of errors in forensic and literature mitochondrial DNA (mtDNA) data. However, recent research has shown that using mtDNA phylogeny and referring to known mtDNA haplotypes can be useful for checking the quality of sequence data. Results We developed a Web-based bioinformatics resource "mtDNAmanager" that offers a convenient interface supporting the management and quality analysis of mtDNA sequence data. The mtDNAmanager performs computations on mtDNA control-region sequences to estimate the most-probable mtDNA haplogroups and retrieves similar sequences from a selected database. By the phased designation of the most-probable haplogroups (both expected and estimated haplogroups), mtDNAmanager enables users to systematically detect errors whilst allowing for confirmation of the presence of clear key diagnostic mutations and accompanying mutations. The query tools of mtDNAmanager also facilitate database screening with two options of "match" and "include the queried nucleotide polymorphism". In addition, mtDNAmanager provides Web interfaces for users to manage and analyse their own data in batch mode. Conclusion The mtDNAmanager will provide systematic routines for mtDNA sequence data management and analysis via easily accessible Web interfaces, and thus should be very useful for population, medical and forensic studies that employ mtDNA analysis. mtDNAmanager can be accessed at . PMID:19014619

Genetic diversity and host specificity varies across three genera of blood parasites in ducks of the Pacific Americas Flyway

USGS Publications Warehouse

Reeves, Andrew B.; Smith, Matthew M.; Meixell, Brandt W.; Fleskes, Joseph P.; Ramey, Andrew M.

2015-01-01

Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus andLeucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodiumparasites infecting North American waterfowl as compared to those of the generaHaemoproteus and Leucocytozoon.

Genetic Diversity and Host Specificity Varies across Three Genera of Blood Parasites in Ducks of the Pacific Americas Flyway

PubMed Central

Reeves, Andrew B.; Smith, Mathew M.; Meixell, Brandt W.; Fleskes, Joseph P; Ramey, Andrew M.

2015-01-01

Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus and Leucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodium parasites infecting North American waterfowl as compared to those of the genera Haemoproteus and Leucocytozoon. PMID:25710468

AthMethPre: a web server for the prediction and query of mRNA m6A sites in Arabidopsis thaliana.

PubMed

Xiang, Shunian; Yan, Zhangming; Liu, Ke; Zhang, Yaou; Sun, Zhirong

2016-10-18

N 6 -Methyladenosine (m 6 A) is the most prevalent and abundant modification in mRNA that has been linked to many key biological processes. High-throughput experiments have generated m 6 A-peaks across the transcriptome of A. thaliana, but the specific methylated sites were not assigned, which impedes the understanding of m 6 A functions in plants. Therefore, computational prediction of mRNA m 6 A sites becomes emergently important. Here, we present a method to predict the m 6 A sites for A. thaliana mRNA sequence(s). To predict the m 6 A sites of an mRNA sequence, we employed the support vector machine to build a classifier using the features of the positional flanking nucleotide sequence and position-independent k-mer nucleotide spectrum. Our method achieved good performance and was applied to a web server to provide service for the prediction of A. thaliana m 6 A sites. The server also provides a comprehensive database of predicted transcriptome-wide m 6 A sites and curated m 6 A-seq peaks from the literature for query and visualization. The AthMethPre web server is the first web server that provides a user-friendly tool for the prediction and query of A. thaliana mRNA m 6 A sites, which is freely accessible for public use at .

De novo transcriptome analysis of an imminent biofuel crop, Camelina sativa L. using Illumina GAIIX sequencing platform and identification of SSR markers.

PubMed

Mudalkar, Shalini; Golla, Ramesh; Ghatty, Sreenivas; Reddy, Attipalli Ramachandra

2014-01-01

Camelina sativa L. is an emerging biofuel crop with potential applications in industry, medicine, cosmetics and human nutrition. The crop is unexploited owing to very limited availability of transcriptome and genomic data. In order to analyse the various metabolic pathways, we performed de novo assembly of the transcriptome on Illumina GAIIX platform with paired end sequencing for obtaining short reads. The sequencing output generated a FastQ file size of 2.97 GB with 10.83 million reads having a maximum read length of 101 nucleotides. The number of contigs generated was 53,854 with maximum and minimum lengths of 10,086 and 200 nucleotides respectively. These trancripts were annotated using BLAST search against the Aracyc, Swiss-Prot, TrEMBL, gene ontology and clusters of orthologous groups (KOG) databases. The genes involved in lipid metabolism were studied and the transcription factors were identified. Sequence similarity studies of Camelina with the other related organisms indicated the close relatedness of Camelina with Arabidopsis. In addition, bioinformatics analysis revealed the presence of a total of 19,379 simple sequence repeats. This is the first report on Camelina sativa L., where the transcriptome of the entire plant, including seedlings, seed, root, leaves and stem was done. Our data established an excellent resource for gene discovery and provide useful information for functional and comparative genomic studies in this promising biofuel crop.

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

RNA-Seq analysis and transcriptome assembly for blackberry (Rubus sp. Var. Lochness) fruit.

PubMed

Garcia-Seco, Daniel; Zhang, Yang; Gutierrez-Mañero, Francisco J; Martin, Cathie; Ramos-Solano, Beatriz

2015-01-22

There is an increasing interest in berries, especially blackberries in the diet, because of recent reports of their health benefits due to their high content of flavonoids. A broad range of genomic tools are available for other Rosaceae species but these tools are still lacking in the Rubus genus, thus limiting gene discovery and the breeding of improved varieties. De novo RNA-seq of ripe blackberries grown under field conditions was performed using Illumina Hiseq 2000. Almost 9 billion nucleotide bases were sequenced in total. Following assembly, 42,062 consensus sequences were detected. For functional annotation, 33,040 (NR), 32,762 (NT), 21,932 (Swiss-Prot), 20,134 (KEGG), 13,676 (COG), 24,168 (GO) consensus sequences were annotated using different databases; in total 34,552 annotated sequences were identified. For protein prediction analysis, the number of coding DNA sequences (CDS) that mapped to the protein database was 32,540. Non redundant (NR), annotation showed that 25,418 genes (73.5%) has the highest similarity with Fragaria vesca subspecies vesca. Reanalysis was undertaken by aligning the reads with this reference genome for a deeper analysis of the transcriptome. We demonstrated that de novo assembly, using Trinity and later annotation with Blast using different databases, were complementary to alignment to the reference sequence using SOAPaligner/SOAP2. The Fragaria reference genome belongs to a species in the same family as blackberry (Rosaceae) but to a different genus. Since blackberries are tetraploids, the possibility of artefactual gene chimeras resulting from mis-assembly was tested with one of the genes sequenced by RNAseq, Chalcone Synthase (CHS). cDNAs encoding this protein were cloned and sequenced. Primers designed to the assembled sequences accurately distinguished different contigs, at least for chalcone synthase genes. We prepared and analysed transcriptome data from ripe blackberries, for which prior genomic information was limited. This new sequence information will improve the knowledge of this important and healthy fruit, providing an invaluable new tool for biological research.

DECIPHER, a Search-Based Approach to Chimera Identification for 16S rRNA Sequences

PubMed Central

Wright, Erik S.; Yilmaz, L. Safak

2012-01-01

DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu). PMID:22101057

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

High-quality mtDNA control region sequences from 680 individuals sampled across the Netherlands to establish a national forensic mtDNA reference database.

PubMed

Chaitanya, Lakshmi; van Oven, Mannis; Brauer, Silke; Zimmermann, Bettina; Huber, Gabriela; Xavier, Catarina; Parson, Walther; de Knijff, Peter; Kayser, Manfred

2016-03-01

The use of mitochondrial DNA (mtDNA) for maternal lineage identification often marks the last resort when investigating forensic and missing-person cases involving highly degraded biological materials. As with all comparative DNA testing, a match between evidence and reference sample requires a statistical interpretation, for which high-quality mtDNA population frequency data are crucial. Here, we determined, under high quality standards, the complete mtDNA control-region sequences of 680 individuals from across the Netherlands sampled at 54 sites, covering the entire country with 10 geographic sub-regions. The complete mtDNA control region (nucleotide positions 16,024-16,569 and 1-576) was amplified with two PCR primers and sequenced with ten different sequencing primers using the EMPOP protocol. Haplotype diversity of the entire sample set was very high at 99.63% and, accordingly, the random-match probability was 0.37%. No population substructure within the Netherlands was detected with our dataset. Phylogenetic analyses were performed to determine mtDNA haplogroups. Inclusion of these high-quality data in the EMPOP database (accession number: EMP00666) will improve its overall data content and geographic coverage in the interest of all EMPOP users worldwide. Moreover, this dataset will serve as (the start of) a national reference database for mtDNA applications in forensic and missing person casework in the Netherlands. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

PubMed Central

Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

2016-01-01

Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

The barley EST DNA Replication and Repair Database (bEST-DRRD) as a tool for the identification of the genes involved in DNA replication and repair.

PubMed

Gruszka, Damian; Marzec, Marek; Szarejko, Iwona

2012-06-14

The high level of conservation of genes that regulate DNA replication and repair indicates that they may serve as a source of information on the origin and evolution of the species and makes them a reliable system for the identification of cross-species homologs. Studies that had been conducted to date shed light on the processes of DNA replication and repair in bacteria, yeast and mammals. However, there is still much to be learned about the process of DNA damage repair in plants. These studies, which were conducted mainly using bioinformatics tools, enabled the list of genes that participate in various pathways of DNA repair in Arabidopsis thaliana (L.) Heynh to be outlined; however, information regarding these mechanisms in crop plants is still very limited. A similar, functional approach is particularly difficult for a species whose complete genomic sequences are still unavailable. One of the solutions is to apply ESTs (Expressed Sequence Tags) as the basis for gene identification. For the construction of the barley EST DNA Replication and Repair Database (bEST-DRRD), presented here, the Arabidopsis nucleotide and protein sequences involved in DNA replication and repair were used to browse for and retrieve the deposited sequences, derived from four barley (Hordeum vulgare L.) sequence databases, including the "Barley Genome version 0.05" database (encompassing ca. 90% of barley coding sequences) and from two databases covering the complete genomes of two monocot models: Oryza sativa L. and Brachypodium distachyon L. in order to identify homologous genes. Sequences of the categorised Arabidopsis queries are used for browsing the repositories, which are located on the ViroBLAST platform. The bEST-DRRD is currently used in our project during the identification and validation of the barley genes involved in DNA repair. The presented database provides information about the Arabidopsis genes involved in DNA replication and repair, their expression patterns and models of protein interactions. It was designed and established to provide an open-access tool for the identification of monocot homologs of known Arabidopsis genes that are responsible for DNA-related processes. The barley genes identified in the project are currently being analysed to validate their function.

Genovar: a detection and visualization tool for genomic variants.

PubMed

Jung, Kwang Su; Moon, Sanghoon; Kim, Young Jin; Kim, Bong-Jo; Park, Kiejung

2012-05-08

Along with single nucleotide polymorphisms (SNPs), copy number variation (CNV) is considered an important source of genetic variation associated with disease susceptibility. Despite the importance of CNV, the tools currently available for its analysis often produce false positive results due to limitations such as low resolution of array platforms, platform specificity, and the type of CNV. To resolve this problem, spurious signals must be separated from true signals by visual inspection. None of the previously reported CNV analysis tools support this function and the simultaneous visualization of comparative genomic hybridization arrays (aCGH) and sequence alignment. The purpose of the present study was to develop a useful program for the efficient detection and visualization of CNV regions that enables the manual exclusion of erroneous signals. A JAVA-based stand-alone program called Genovar was developed. To ascertain whether a detected CNV region is a novel variant, Genovar compares the detected CNV regions with previously reported CNV regions using the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation) and the Single Nucleotide Polymorphism Database (dbSNP). The current version of Genovar is capable of visualizing genomic data from sources such as the aCGH data file and sequence alignment format files. Genovar is freely accessible and provides a user-friendly graphic user interface (GUI) to facilitate the detection of CNV regions. The program also provides comprehensive information to help in the elimination of spurious signals by visual inspection, making Genovar a valuable tool for reducing false positive CNV results. http://genovar.sourceforge.net/.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2009-30 November 2009.

PubMed

An, Junghwa; Bechet, Arnaud; Berggren, Asa; Brown, Sarah K; Bruford, Michael W; Cai, Qingui; Cassel-Lundhagen, Anna; Cezilly, Frank; Chen, Song-Lin; Cheng, Wei; Choi, Sung-Kyoung; Ding, X Y; Fan, Yong; Feldheim, Kevin A; Feng, Z Y; Friesen, Vicki L; Gaillard, Maria; Galaraza, Juan A; Gallo, Leonardo; Ganeshaiah, K N; Geraci, Julia; Gibbons, John G; Grant, William S; Grauvogel, Zac; Gustafsson, S; Guyon, Jeffrey R; Han, L; Heath, Daniel D; Hemmilä, S; Hogan, J Derek; Hou, B W; Jakse, Jernej; Javornik, Branka; Kaňuch, Peter; Kim, Kyung-Kil; Kim, Kyung-Seok; Kim, Sang-Gyu; Kim, Sang-In; Kim, Woo-Jin; Kim, Yi-Kyung; Klich, Maren A; Kreiser, Brian R; Kwan, Ye-Seul; Lam, Athena W; Lasater, Kelly; Lascoux, M; Lee, Hang; Lee, Yun-Sun; Li, D L; Li, Shao-Jing; Li, W Y; Liao, Xiaolin; Liber, Zlatko; Lin, Lin; Liu, Shaoying; Luo, Xin-Hui; Ma, Y H; Ma, Yajun; Marchelli, Paula; Min, Mi-Sook; Moccia, Maria Domenica; Mohana, Kumara P; Moore, Marcelle; Morris-Pocock, James A; Park, Han-Chan; Pfunder, Monika; Ivan, Radosavljević; Ravikanth, G; Roderick, George K; Rokas, Antonis; Sacks, Benjamin N; Saski, Christopher A; Satovic, Zlatko; Schoville, Sean D; Sebastiani, Federico; Sha, Zhen-Xia; Shin, Eun-Ha; Soliani, Carolina; Sreejayan, N; Sun, Zhengxin; Tao, Yong; Taylor, Scott A; Templin, William D; Shaanker, R Uma; Vasudeva, R; Vendramin, Giovanni G; Walter, Ryan P; Wang, Gui-Zhong; Wang, Ke-Jian; Wang, Y Q; Wattier, Rémi A; Wei, Fuwen; Widmer, Alex; Woltmann, Stefan; Won, Yong-Jin; Wu, Jing; Xie, M L; Xu, Genbo; Xu, Xiao-Jun; Ye, Hai-Hui; Zhan, Xiangjiang; Zhang, F; Zhong, J

2010-03-01

This article documents the addition of 411 microsatellite marker loci and 15 pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Acanthopagrus schlegeli, Anopheles lesteri, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus oryzae, Aspergillus terreus, Branchiostoma japonicum, Branchiostoma belcheri, Colias behrii, Coryphopterus personatus, Cynogolssus semilaevis, Cynoglossus semilaevis, Dendrobium officinale, Dendrobium officinale, Dysoxylum malabaricum, Metrioptera roeselii, Myrmeciza exsul, Ochotona thibetana, Neosartorya fischeri, Nothofagus pumilio, Onychodactylus fischeri, Phoenicopterus roseus, Salvia officinalis L., Scylla paramamosain, Silene latifo, Sula sula, and Vulpes vulpes. These loci were cross-tested on the following species: Aspergillus giganteus, Colias pelidne, Colias interior, Colias meadii, Colias eurytheme, Coryphopterus lipernes, Coryphopterus glaucofrenum, Coryphopterus eidolon, Gnatholepis thompsoni, Elacatinus evelynae, Dendrobium loddigesii Dendrobium devonianum, Dysoxylum binectariferum, Nothofagus antarctica, Nothofagus dombeyii, Nothofagus nervosa, Nothofagus obliqua, Sula nebouxii, and Sula variegata. This article also documents the addition of 39 sequencing primer pairs and 15 allele specific primers or probes for Paralithodes camtschaticus. © 2010 Blackwell Publishing Ltd.

AquaPathogen X--A template database for tracking field isolates of aquatic pathogens

USGS Publications Warehouse

Emmenegger, Evi; Kurath, Gael

2012-01-01

AquaPathogen X is a template database for recording information on individual isolates of aquatic pathogens and is available for download from the U.S. Geological Survey (USGS) Western Fisheries Research Center (WFRC) website (http://wfrc.usgs.gov). This template database can accommodate the nucleotide sequence data generated in molecular epidemiological studies along with the myriad of abiotic and biotic traits associated with isolates of various pathogens (for example, viruses, parasites, or bacteria) from multiple aquatic animal host species (for example, fish, shellfish, or shrimp). The simultaneous cataloging of isolates from different aquatic pathogens is a unique feature to the AquaPathogen X database, which can be used in surveillance of emerging aquatic animal diseases and clarification of main risk factors associated with pathogen incursions into new water systems. As a template database, the data fields are empty upon download and can be modified to user specifications. For example, an application of the template database that stores the epidemiological profiles of fish virus isolates, called Fish ViroTrak (fig. 1), was also developed (Emmenegger and others, 2011).

Comprehensive red blood cell and platelet antigen prediction from whole genome sequencing: proof of principle

PubMed Central

Westhoff, Connie M.; Uy, Jon Michael; Aguad, Maria; Smeland‐Wagman, Robin; Kaufman, Richard M.; Rehm, Heidi L.; Green, Robert C.; Silberstein, Leslie E.

2015-01-01

BACKGROUND There are 346 serologically defined red blood cell (RBC) antigens and 33 serologically defined platelet (PLT) antigens, most of which have known genetic changes in 45 RBC or six PLT genes that correlate with antigen expression. Polymorphic sites associated with antigen expression in the primary literature and reference databases are annotated according to nucleotide positions in cDNA. This makes antigen prediction from next‐generation sequencing data challenging, since it uses genomic coordinates. STUDY DESIGN AND METHODS The conventional cDNA reference sequences for all known RBC and PLT genes that correlate with antigen expression were aligned to the human reference genome. The alignments allowed conversion of conventional cDNA nucleotide positions to the corresponding genomic coordinates. RBC and PLT antigen prediction was then performed using the human reference genome and whole genome sequencing (WGS) data with serologic confirmation. RESULTS Some major differences and alignment issues were found when attempting to convert the conventional cDNA to human reference genome sequences for the following genes: ABO, A4GALT, RHD, RHCE, FUT3, ACKR1 (previously DARC), ACHE, FUT2, CR1, GCNT2, and RHAG. However, it was possible to create usable alignments, which facilitated the prediction of all RBC and PLT antigens with a known molecular basis from WGS data. Traditional serologic typing for 18 RBC antigens were in agreement with the WGS‐based antigen predictions, providing proof of principle for this approach. CONCLUSION Detailed mapping of conventional cDNA annotated RBC and PLT alleles can enable accurate prediction of RBC and PLT antigens from whole genomic sequencing data. PMID:26634332

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.

PubMed

Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L

2017-10-06

Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016.

PubMed

Sadeuh-Mba, Serge Alain; Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard

2017-10-01

Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5-100% nucleotide (nt) and 98.3-100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4-99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic cycle of domestic rabies in Cameroon.

Molecular characterization and phylogenetic relatedness of dog-derived Rabies Viruses circulating in Cameroon between 2010 and 2016

PubMed Central

Momo, Jean Blaise; Besong, Laura; Loul, Sévérin; Njouom, Richard

2017-01-01

Rabies is enzootic among dog populations in some parts of Cameroon and the risk of human rabies is thought to be steadily high in these regions. However, the molecular epidemiology of circulating Rabies Virus (RABV) has been hardly considered in Cameroon as well as in most neighboring central African countries. To address this fundamental gap, 76 nucleoprotein (N) gene sequences of dog-derived RABV were obtained from 100 brain specimens sampled in Cameroon from 2010 to 2016. Studied sequences were subjected to molecular and phylogenetic analyses with reference strains retrieved from databases. The 71 studied Africa-1 isolates displayed 93.5–100% nucleotide (nt) and 98.3–100% amino-acid (aa) identities to each other while, the 5 studied Africa-2 isolates shared 99.4–99.7% sequence similarities at nt and aa levels. Maximum Likelihood based phylogenies inferred from nucleotide sequences confirmed all studied RABV isolates as members of the dog-related species 1 of the Lyssavirus genus. Individual isolates could be unambiguously assigned as either the Africa-1 subclade of the Cosmopolitan clade or the Africa 2 clade. The Africa-1 subclade appeared to be more prevalent and diversified. Indeed, 70 studied isolates segregated into 3 distinct circulating variants within Africa-1a lineage while a unique isolate was strikingly related to the Africa-1b lineage known to be prevalent in the neighboring Central African Republic and eastern Africa. Interestingly, all five Africa-2 isolates fell into the group-E lineage even though they appeared to be loosely related to databases available reference RABV; including those previously documented in Cameroon. This study uncovered the co-circulation of several Africa-1 and Africa-2 lineages in the southern regions of Cameroon. Striking phylogenetic outcasts to the geographic differentiation of RABV variants indicated that importation from close regions or neighboring countries apparently contributes to the sustainment of the enzootic cycle of domestic rabies in Cameroon. PMID:29084223

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

De novo Assembly of the Indo-Pacific Humpback Dolphin Leucocyte Transcriptome to Identify Putative Genes Involved in the Aquatic Adaptation and Immune Response

PubMed Central

Xia, Jia; Yang, Lili; Chen, Jialin; Wu, Yuping; Yi, Meisheng

2013-01-01

Background The Indo-Pacific humpback dolphin (Sousa chinensis), a marine mammal species inhabited in the waters of Southeast Asia, South Africa and Australia, has attracted much attention because of the dramatic decline in population size in the past decades, which raises the concern of extinction. So far, this species is poorly characterized at molecular level due to little sequence information available in public databases. Recent advances in large-scale RNA sequencing provide an efficient approach to generate abundant sequences for functional genomic analyses in the species with un-sequenced genomes. Principal Findings We performed a de novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome by Illumina sequencing. 108,751 high quality sequences from 47,840,388 paired-end reads were generated, and 48,868 and 46,587 unigenes were functionally annotated by BLAST search against the NCBI non-redundant and Swiss-Prot protein databases (E-value<10−5), respectively. In total, 16,467 unigenes were clustered into 25 functional categories by searching against the COG database, and BLAST2GO search assigned 37,976 unigenes to 61 GO terms. In addition, 36,345 unigenes were grouped into 258 KEGG pathways. We also identified 9,906 simple sequence repeats and 3,681 putative single nucleotide polymorphisms as potential molecular markers in our assembled sequences. A large number of unigenes were predicted to be involved in immune response, and many genes were predicted to be relevant to adaptive evolution and cetacean-specific traits. Conclusion This study represented the first transcriptome analysis of the Indo-Pacific humpback dolphin, an endangered species. The de novo transcriptome analysis of the unique transcripts will provide valuable sequence information for discovery of new genes, characterization of gene expression, investigation of various pathways and adaptive evolution, as well as identification of genetic markers. PMID:24015242

De novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome to identify putative genes involved in the aquatic adaptation and immune response.

PubMed

Gui, Duan; Jia, Kuntong; Xia, Jia; Yang, Lili; Chen, Jialin; Wu, Yuping; Yi, Meisheng

2013-01-01

The Indo-Pacific humpback dolphin (Sousa chinensis), a marine mammal species inhabited in the waters of Southeast Asia, South Africa and Australia, has attracted much attention because of the dramatic decline in population size in the past decades, which raises the concern of extinction. So far, this species is poorly characterized at molecular level due to little sequence information available in public databases. Recent advances in large-scale RNA sequencing provide an efficient approach to generate abundant sequences for functional genomic analyses in the species with un-sequenced genomes. We performed a de novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome by Illumina sequencing. 108,751 high quality sequences from 47,840,388 paired-end reads were generated, and 48,868 and 46,587 unigenes were functionally annotated by BLAST search against the NCBI non-redundant and Swiss-Prot protein databases (E-value<10(-5)), respectively. In total, 16,467 unigenes were clustered into 25 functional categories by searching against the COG database, and BLAST2GO search assigned 37,976 unigenes to 61 GO terms. In addition, 36,345 unigenes were grouped into 258 KEGG pathways. We also identified 9,906 simple sequence repeats and 3,681 putative single nucleotide polymorphisms as potential molecular markers in our assembled sequences. A large number of unigenes were predicted to be involved in immune response, and many genes were predicted to be relevant to adaptive evolution and cetacean-specific traits. This study represented the first transcriptome analysis of the Indo-Pacific humpback dolphin, an endangered species. The de novo transcriptome analysis of the unique transcripts will provide valuable sequence information for discovery of new genes, characterization of gene expression, investigation of various pathways and adaptive evolution, as well as identification of genetic markers.

Analysis of expressed sequence tags (ESTs) from cocoa (Theobroma cacao L) upon infection with Phytophthora megakarya.

PubMed

Naganeeswaran, Sudalaimuthu Asari; Subbian, Elain Apshara; Ramaswamy, Manimekalai

2012-01-01

Phytophthora megakarya, the causative agent of cacao black pod disease in West African countries causes an extensive loss of yield. In this study we have analyzed 4 libraries of ESTs derived from Phytophthora megakarya infected cocoa leaf and pod tissues. Totally 6379 redundant sequences were retrieved from ESTtik database and EST processing was performed using seqclean tool. Clustering and assembling using CAP3 generated 3333 non-redundant (907 contigs and 2426 singletons) sequences. The primary sequence analysis of 3333 non-redundant sequences showed that the GC percentage was 42.7 and the sequence length ranged from 101 - 2576 nucleotides. Further, functional analysis (Blast, Interproscan, Gene ontology and KEGG search) were executed and 1230 orthologous genes were annotated. Totally 272 enzymes corresponding to 114 metabolic pathways were identified. Functional annotation revealed that most of the sequences are related to molecular function, stress response and biological processes. The annotated enzymes are aldehyde dehydrogenase (E.C: 1.2.1.3), catalase (E.C: 1.11.1.6), acetyl-CoA C-acetyltransferase (E.C: 2.3.1.9), threonine ammonia-lyase (E.C: 4.3.1.19), acetolactate synthase (E.C: 2.2.1.6), O-methyltransferase (E.C: 2.1.1.68) which play an important role in amino acid biosynthesis and phenyl propanoid biosynthesis. All this information was stored in MySQL database management system to be used in future for reconstruction of biotic stress response pathway in cocoa.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

PubMed Central

Ryynänen, Heikki J; Primmer, Craig R

2006-01-01

Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

A framework for organizing cancer-related variations from existing databases, publications and NGS data using a High-performance Integrated Virtual Environment (HIVE).

PubMed

Wu, Tsung-Jung; Shamsaddini, Amirhossein; Pan, Yang; Smith, Krista; Crichton, Daniel J; Simonyan, Vahan; Mazumder, Raja

2014-01-01

Years of sequence feature curation by UniProtKB/Swiss-Prot, PIR-PSD, NCBI-CDD, RefSeq and other database biocurators has led to a rich repository of information on functional sites of genes and proteins. This information along with variation-related annotation can be used to scan human short sequence reads from next-generation sequencing (NGS) pipelines for presence of non-synonymous single-nucleotide variations (nsSNVs) that affect functional sites. This and similar workflows are becoming more important because thousands of NGS data sets are being made available through projects such as The Cancer Genome Atlas (TCGA), and researchers want to evaluate their biomarkers in genomic data. BioMuta, an integrated sequence feature database, provides a framework for automated and manual curation and integration of cancer-related sequence features so that they can be used in NGS analysis pipelines. Sequence feature information in BioMuta is collected from the Catalogue of Somatic Mutations in Cancer (COSMIC), ClinVar, UniProtKB and through biocuration of information available from publications. Additionally, nsSNVs identified through automated analysis of NGS data from TCGA are also included in the database. Because of the petabytes of data and information present in NGS primary repositories, a platform HIVE (High-performance Integrated Virtual Environment) for storing, analyzing, computing and curating NGS data and associated metadata has been developed. Using HIVE, 31 979 nsSNVs were identified in TCGA-derived NGS data from breast cancer patients. All variations identified through this process are stored in a Curated Short Read archive, and the nsSNVs from the tumor samples are included in BioMuta. Currently, BioMuta has 26 cancer types with 13 896 small-scale and 308 986 large-scale study-derived variations. Integration of variation data allows identifications of novel or common nsSNVs that can be prioritized in validation studies. Database URL: BioMuta: http://hive.biochemistry.gwu.edu/tools/biomuta/index.php; CSR: http://hive.biochemistry.gwu.edu/dna.cgi?cmd=csr; HIVE: http://hive.biochemistry.gwu.edu.

MitoSatPlant: mitochondrial microsatellites database of viridiplantae.

PubMed

Kumar, Manjeet; Kapil, Aditi; Shanker, Asheesh

2014-11-01

Microsatellites also known as simple sequence repeats (SSRs) consist of 1-6 nucleotide long repeating units. The importance of mitochondrial SSRs (mtSSRs) in fields like population genetics, plant phylogenetics and genome mapping motivated us to develop MitoSatPlant, a repository of plant mtSSRs. It contains information for perfect, imperfect and compound SSRs mined from 92 mitochondrial genomes of green plants, available at NCBI (as of 1 Feb 2014). A total of 72,798 SSRs were found, of which PCR primers were designed for 72,495 SSRs. Among all sequences, tetranucleotide repeats (26,802) were found to be most abundant whereas hexanucleotide repeats (2751) were detected with least frequency. MitoSatPlant was developed using SQL server 2008 and can be accessed through a front end designed in ASP.Net. It is an easy to use, user-friendly database and will prove to be a useful resource for plant scientists. To the best of our knowledge MitoSatPlant is the only database available for plant mtSSRs and can be freely accessed at http://compubio.in/mitosatplant/. Copyright © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

Finding Protein and Nucleotide Similarities with FASTA

PubMed Central

Pearson, William R.

2016-01-01

The FASTA programs provide a comprehensive set of rapid similarity searching tools ( fasta36, fastx36, tfastx36, fasty36, tfasty36), similar to those provided by the BLAST package, as well as programs for slower, optimal, local and global similarity searches ( ssearch36, ggsearch36) and for searching with short peptides and oligonucleotides ( fasts36, fastm36). The FASTA programs use an empirical strategy for estimating statistical significance that accommodates a range of similarity scoring matrices and gap penalties, improving alignment boundary accuracy and search sensitivity (Unit 3.5). The FASTA programs can produce “BLAST-like” alignment and tabular output, for ease of integration into existing analysis pipelines, and can search small, representative databases, and then report results for a larger set of sequences, using links from the smaller dataset. The FASTA programs work with a wide variety of database formats, including mySQL and postgreSQL databases (Unit 9.4). The programs also provide a strategy for integrating domain and active site annotations into alignments and highlighting the mutational state of functionally critical residues. These protocols describe how to use the FASTA programs to characterize protein and DNA sequences, using protein:protein, protein:DNA, and DNA:DNA comparisons. PMID:27010337

RNA Bricks—a database of RNA 3D motifs and their interactions

PubMed Central

Chojnowski, Grzegorz; Waleń, Tomasz; Bujnicki, Janusz M.

2014-01-01

The RNA Bricks database (http://iimcb.genesilico.pl/rnabricks), stores information about recurrent RNA 3D motifs and their interactions, found in experimentally determined RNA structures and in RNA–protein complexes. In contrast to other similar tools (RNA 3D Motif Atlas, RNA Frabase, Rloom) RNA motifs, i.e. ‘RNA bricks’ are presented in the molecular environment, in which they were determined, including RNA, protein, metal ions, water molecules and ligands. All nucleotide residues in RNA bricks are annotated with structural quality scores that describe real-space correlation coefficients with the electron density data (if available), backbone geometry and possible steric conflicts, which can be used to identify poorly modeled residues. The database is also equipped with an algorithm for 3D motif search and comparison. The algorithm compares spatial positions of backbone atoms of the user-provided query structure and of stored RNA motifs, without relying on sequence or secondary structure information. This enables the identification of local structural similarities among evolutionarily related and unrelated RNA molecules. Besides, the search utility enables searching ‘RNA bricks’ according to sequence similarity, and makes it possible to identify motifs with modified ribonucleotide residues at specific positions. PMID:24220091

Finding Protein and Nucleotide Similarities with FASTA.

PubMed

Pearson, William R

2016-03-24

The FASTA programs provide a comprehensive set of rapid similarity searching tools (fasta36, fastx36, tfastx36, fasty36, tfasty36), similar to those provided by the BLAST package, as well as programs for slower, optimal, local, and global similarity searches (ssearch36, ggsearch36), and for searching with short peptides and oligonucleotides (fasts36, fastm36). The FASTA programs use an empirical strategy for estimating statistical significance that accommodates a range of similarity scoring matrices and gap penalties, improving alignment boundary accuracy and search sensitivity. The FASTA programs can produce "BLAST-like" alignment and tabular output, for ease of integration into existing analysis pipelines, and can search small, representative databases, and then report results for a larger set of sequences, using links from the smaller dataset. The FASTA programs work with a wide variety of database formats, including mySQL and postgreSQL databases. The programs also provide a strategy for integrating domain and active site annotations into alignments and highlighting the mutational state of functionally critical residues. These protocols describe how to use the FASTA programs to characterize protein and DNA sequences, using protein:protein, protein:DNA, and DNA:DNA comparisons. Copyright © 2016 John Wiley & Sons, Inc.

Finding similar nucleotide sequences using network BLAST searches.

PubMed

Ladunga, Istvan

2009-06-01

The Basic Local Alignment Search Tool (BLAST) is a keystone of bioinformatics due to its performance and user-friendliness. Beginner and intermediate users will learn how to design and submit blastn and Megablast searches on the Web pages at the National Center for Biotechnology Information. We map nucleic acid sequences to genomes, find identical or similar mRNA, expressed sequence tag, and noncoding RNA sequences, and run Megablast searches, which are much faster than blastn. Understanding results is assisted by taxonomy reports, genomic views, and multiple alignments. We interpret expected frequency thresholds, biological significance, and statistical significance. Weak hits provide no evidence, but hints for further analyses. We find genes that may code for homologous proteins by translated BLAST. We reduce false positives by filtering out low-complexity regions. Parsed BLAST results can be integrated into analysis pipelines. Links in the output connect to Entrez, PUBMED, structural, sequence, interaction, and expression databases. This facilitates integration with a wide spectrum of biological knowledge.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

Characterization of mango (Mangifera indica L.) transcriptome and chloroplast genome.

PubMed

Azim, M Kamran; Khan, Ishtaiq A; Zhang, Yong

2014-05-01

We characterized mango leaf transcriptome and chloroplast genome using next generation DNA sequencing. The RNA-seq output of mango transcriptome generated >12 million reads (total nucleotides sequenced >1 Gb). De novo transcriptome assembly generated 30,509 unigenes with lengths in the range of 300 to ≥3,000 nt and 67× depth of coverage. Blast searching against nonredundant nucleotide databases and several Viridiplantae genomic datasets annotated 24,593 mango unigenes (80% of total) and identified Citrus sinensis as closest neighbor of mango with 9,141 (37%) matched sequences. The annotation with gene ontology and Clusters of Orthologous Group terms categorized unigene sequences into 57 and 25 classes, respectively. More than 13,500 unigenes were assigned to 293 KEGG pathways. Besides major plant biology related pathways, KEGG based gene annotation pointed out active presence of an array of biochemical pathways involved in (a) biosynthesis of bioactive flavonoids, flavones and flavonols, (b) biosynthesis of terpenoids and lignins and (c) plant hormone signal transduction. The mango transcriptome sequences revealed 235 proteases belonging to five catalytic classes of proteolytic enzymes. The draft genome of mango chloroplast (cp) was obtained by a combination of Sanger and next generation sequencing. The draft mango cp genome size is 151,173 bp with a pair of inverted repeats of 27,093 bp separated by small and large single copy regions, respectively. Out of 139 genes in mango cp genome, 91 found to be protein coding. Sequence analysis revealed cp genome of C. sinensis as closest neighbor of mango. We found 51 short repeats in mango cp genome supposed to be associated with extensive rearrangements. This is the first report of transcriptome and chloroplast genome analysis of any Anacardiaceae family member.

Deep Whole-Genome Sequencing to Detect Mixed Infection of Mycobacterium tuberculosis

PubMed Central

Gan, Mingyu; Liu, Qingyun; Yang, Chongguang; Gao, Qian; Luo, Tao

2016-01-01

Mixed infection by multiple Mycobacterium tuberculosis (MTB) strains is associated with poor treatment outcome of tuberculosis (TB). Traditional genotyping methods have been used to detect mixed infections of MTB, however, their sensitivity and resolution are limited. Deep whole-genome sequencing (WGS) has been proved highly sensitive and discriminative for studying population heterogeneity of MTB. Here, we developed a phylogenetic-based method to detect MTB mixed infections using WGS data. We collected published WGS data of 782 global MTB strains from public database. We called homogeneous and heterogeneous single nucleotide variations (SNVs) of individual strains by mapping short reads to the ancestral MTB reference genome. We constructed a phylogenomic database based on 68,639 homogeneous SNVs of 652 MTB strains. Mixed infections were determined if multiple evolutionary paths were identified by mapping the SNVs of individual samples to the phylogenomic database. By simulation, our method could specifically detect mixed infections when the sequencing depth of minor strains was as low as 1× coverage, and when the genomic distance of two mixed strains was as small as 16 SNVs. By applying our methods to all 782 samples, we detected 47 mixed infections and 45 of them were caused by locally endemic strains. The results indicate that our method is highly sensitive and discriminative for identifying mixed infections from deep WGS data of MTB isolates. PMID:27391214

De novo RNA-seq and functional annotation of Ornithonyssus bacoti.

PubMed

Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li

2018-06-01

Ornithonyssus bacoti (Hirst) (Acari: Macronyssidae) is a vector and reservoir of pathogens causing serious infectious diseases, such as epidemic hemorrhagic fever, endemic typhus, tularemia, and leptospirosis. Its genome and transcriptome data are lacking in public databases. In this study, total RNA was extracted from live O. bacoti to conduct RNA-seq, functional annotation, coding domain sequence (CDS) prediction and simple sequence repeats (SSRs) detection. The results showed that 65.8 million clean reads were generated and assembled into 72,185 unigenes, of which 49.4% were annotated by seven functional databases. 23,121 unigenes were annotated and assigned to 457 species by non-redundant protein sequence database. The BLAST top-two hit species were Metaseiulus occidentalis and Ixodes scapularis. The procedure detected 12,426 SSRs, of which tri- and di-nucleotides were the most abundant types and the representative motifs were AAT/ATT and AC/GT. 26,936 CDS were predicted with a mean length of 711 bp. 87 unigenes of 30 functional genes, which are usually involved in stress responses, drug resistance, movement, metabolism and allergy, were further identified by bioinformatics methods. The unigenes putatively encoding cytochrome P450 proteins were further analyzed phylogenetically. In conclusion, this study completed the RNA-seq and functional annotation of O. bacoti successfully, which provides reliable molecular data for its future studies of gene function and molecular markers.

GenomeHubs: simple containerized setup of a custom Ensembl database and web server for any species

PubMed Central

Kumar, Sujai; Stevens, Lewis; Blaxter, Mark

2017-01-01

Abstract As the generation and use of genomic datasets is becoming increasingly common in all areas of biology, the need for resources to collate, analyse and present data from one or more genome projects is becoming more pressing. The Ensembl platform is a powerful tool to make genome data and cross-species analyses easily accessible through a web interface and a comprehensive application programming interface. Here we introduce GenomeHubs, which provide a containerized environment to facilitate the setup and hosting of custom Ensembl genome browsers. This simplifies mirroring of existing content and import of new genomic data into the Ensembl database schema. GenomeHubs also provide a set of analysis containers to decorate imported genomes with results of standard analyses and functional annotations and support export to flat files, including EMBL format for submission of assemblies and annotations to International Nucleotide Sequence Database Collaboration. Database URL: http://GenomeHubs.org PMID:28605774

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

A combined strategy involving Sanger and 454 pyrosequencing increases genomic resources to aid in the management of reproduction, disease control and genetic selection in the turbot (Scophthalmus maximus)

PubMed Central

2013-01-01

Background Genomic resources for plant and animal species that are under exploitation primarily for human consumption are increasingly important, among other things, for understanding physiological processes and for establishing adequate genetic selection programs. Current available techniques for high-throughput sequencing have been implemented in a number of species, including fish, to obtain a proper description of the transcriptome. The objective of this study was to generate a comprehensive transcriptomic database in turbot, a highly priced farmed fish species in Europe, with potential expansion to other areas of the world, for which there are unsolved production bottlenecks, to understand better reproductive- and immune-related functions. This information is essential to implement marker assisted selection programs useful for the turbot industry. Results Expressed sequence tags were generated by Sanger sequencing of cDNA libraries from different immune-related tissues after several parasitic challenges. The resulting database (“Turbot 2 database”) was enlarged with sequences generated from a 454 sequencing run of brain-hypophysis-gonadal axis-derived RNA obtained from turbot at different development stages. The assembly of Sanger and 454 sequences generated 52,427 consensus sequences (“Turbot 3 database”), of which 23,661 were successfully annotated. A total of 1,410 sequences were confirmed to be related to reproduction and key genes involved in sex differentiation and maturation were identified for the first time in turbot (AR, AMH, SRY-related genes, CYP19A, ZPGs, STAR FSHR, etc.). Similarly, 2,241 sequences were related to the immune system and several novel key immune genes were identified (BCL, TRAF, NCK, CD28 and TOLLIP, among others). The number of genes of many relevant reproduction- and immune-related pathways present in the database was 50–90% of the total gene count of each pathway. In addition, 1,237 microsatellites and 7,362 single nucleotide polymorphisms (SNPs) were also compiled. Further, 2,976 putative natural antisense transcripts (NATs) including microRNAs were also identified. Conclusions The combined sequencing strategies employed here significantly increased the turbot genomic resources available, including 34,400 novel sequences. The generated database contains a larger number of genes relevant for reproduction- and immune-associated studies, with an excellent coverage of most genes present in many relevant physiological pathways. This database also allowed the identification of many microsatellites and SNP markers that will be very useful for population and genome screening and a valuable aid in marker assisted selection programs. PMID:23497389

Enriching public descriptions of marine phages using the Genomic Standards Consortium MIGS standard

PubMed Central

Duhaime, Melissa Beth; Kottmann, Renzo; Field, Dawn; Glöckner, Frank Oliver

2011-01-01

In any sequencing project, the possible depth of comparative analysis is determined largely by the amount and quality of the accompanying contextual data. The structure, content, and storage of this contextual data should be standardized to ensure consistent coverage of all sequenced entities and facilitate comparisons. The Genomic Standards Consortium (GSC) has developed the “Minimum Information about Genome/Metagenome Sequences (MIGS/MIMS)” checklist for the description of genomes and here we annotate all 30 publicly available marine bacteriophage sequences to the MIGS standard. These annotations build on existing International Nucleotide Sequence Database Collaboration (INSDC) records, and confirm, as expected that current submissions lack most MIGS fields. MIGS fields were manually curated from the literature and placed in XML format as specified by the Genomic Contextual Data Markup Language (GCDML). These “machine-readable” reports were then analyzed to highlight patterns describing this collection of genomes. Completed reports are provided in GCDML. This work represents one step towards the annotation of our complete collection of genome sequences and shows the utility of capturing richer metadata along with raw sequences. PMID:21677864

Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

PubMed Central

Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

1998-01-01

We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

GarlicESTdb: an online database and mining tool for garlic EST sequences.

PubMed

Kim, Dae-Won; Jung, Tae-Sung; Nam, Seong-Hyeuk; Kwon, Hyuk-Ryul; Kim, Aeri; Chae, Sung-Hwa; Choi, Sang-Haeng; Kim, Dong-Wook; Kim, Ryong Nam; Park, Hong-Seog

2009-05-18

Allium sativum., commonly known as garlic, is a species in the onion genus (Allium), which is a large and diverse one containing over 1,250 species. Its close relatives include chives, onion, leek and shallot. Garlic has been used throughout recorded history for culinary, medicinal use and health benefits. Currently, the interest in garlic is highly increasing due to nutritional and pharmaceutical value including high blood pressure and cholesterol, atherosclerosis and cancer. For all that, there are no comprehensive databases available for Expressed Sequence Tags(EST) of garlic for gene discovery and future efforts of genome annotation. That is why we developed a new garlic database and applications to enable comprehensive analysis of garlic gene expression. GarlicESTdb is an integrated database and mining tool for large-scale garlic (Allium sativum) EST sequencing. A total of 21,595 ESTs collected from an in-house cDNA library were used to construct the database. The analysis pipeline is an automated system written in JAVA and consists of the following components: automatic preprocessing of EST reads, assembly of raw sequences, annotation of the assembled sequences, storage of the analyzed information into MySQL databases, and graphic display of all processed data. A web application was implemented with the latest J2EE (Java 2 Platform Enterprise Edition) software technology (JSP/EJB/JavaServlet) for browsing and querying the database, for creation of dynamic web pages on the client side, and for mapping annotated enzymes to KEGG pathways, the AJAX framework was also used partially. The online resources, such as putative annotation, single nucleotide polymorphisms (SNP) and tandem repeat data sets, can be searched by text, explored on the website, searched using BLAST, and downloaded. To archive more significant BLAST results, a curation system was introduced with which biologists can easily edit best-hit annotation information for others to view. The GarlicESTdb web application is freely available at http://garlicdb.kribb.re.kr. GarlicESTdb is the first incorporated online information database of EST sequences isolated from garlic that can be freely accessed and downloaded. It has many useful features for interactive mining of EST contigs and datasets from each library, including curation of annotated information, expression profiling, information retrieval, and summary of statistics of functional annotation. Consequently, the development of GarlicESTdb will provide a crucial contribution to biologists for data-mining and more efficient experimental studies.

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

De novo assembly of maritime pine transcriptome: implications for forest breeding and biotechnology.

PubMed

Canales, Javier; Bautista, Rocio; Label, Philippe; Gómez-Maldonado, Josefa; Lesur, Isabelle; Fernández-Pozo, Noe; Rueda-López, Marina; Guerrero-Fernández, Dario; Castro-Rodríguez, Vanessa; Benzekri, Hicham; Cañas, Rafael A; Guevara, María-Angeles; Rodrigues, Andreia; Seoane, Pedro; Teyssier, Caroline; Morel, Alexandre; Ehrenmann, François; Le Provost, Grégoire; Lalanne, Céline; Noirot, Céline; Klopp, Christophe; Reymond, Isabelle; García-Gutiérrez, Angel; Trontin, Jean-François; Lelu-Walter, Marie-Anne; Miguel, Celia; Cervera, María Teresa; Cantón, Francisco R; Plomion, Christophe; Harvengt, Luc; Avila, Concepción; Gonzalo Claros, M; Cánovas, Francisco M

2014-04-01

Maritime pine (Pinus pinasterAit.) is a widely distributed conifer species in Southwestern Europe and one of the most advanced models for conifer research. In the current work, comprehensive characterization of the maritime pine transcriptome was performed using a combination of two different next-generation sequencing platforms, 454 and Illumina. De novo assembly of the transcriptome provided a catalogue of 26 020 unique transcripts in maritime pine trees and a collection of 9641 full-length cDNAs. Quality of the transcriptome assembly was validated by RT-PCR amplification of selected transcripts for structural and regulatory genes. Transcription factors and enzyme-encoding transcripts were annotated. Furthermore, the available sequencing data permitted the identification of polymorphisms and the establishment of robust single nucleotide polymorphism (SNP) and simple-sequence repeat (SSR) databases for genotyping applications and integration of translational genomics in maritime pine breeding programmes. All our data are freely available at SustainpineDB, the P. pinaster expressional database. Results reported here on the maritime pine transcriptome represent a valuable resource for future basic and applied studies on this ecological and economically important pine species. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Where the bugs are: analyzing distributions of bacterial phyla by descriptor keyword search in the nucleotide database.

PubMed

Squartini, Andrea

2011-07-26

The associations between bacteria and environment underlie their preferential interactions with given physical or chemical conditions. Microbial ecology aims at extracting conserved patterns of occurrence of bacterial taxa in relation to defined habitats and contexts. In the present report the NCBI nucleotide sequence database is used as dataset to extract information relative to the distribution of each of the 24 phyla of the bacteria superkingdom and of the Archaea. Over two and a half million records are filtered in their cross-association with each of 48 sets of keywords, defined to cover natural or artificial habitats, interactions with plant, animal or human hosts, and physical-chemical conditions. The results are processed showing: (a) how the different descriptors enrich or deplete the proportions at which the phyla occur in the total database; (b) in which order of abundance do the different keywords score for each phylum (preferred habitats or conditions), and to which extent are phyla clustered to few descriptors (specific) or spread across many (cosmopolitan); (c) which keywords individuate the communities ranking highest for diversity and evenness. A number of cues emerge from the results, contributing to sharpen the picture on the functional systematic diversity of prokaryotes. Suggestions are given for a future automated service dedicated to refining and updating such kind of analyses via public bioinformatic engines.

Mutation screening in the Greek population and evaluation of NLGN3 and NLGN4X genes causal factors for autism.

PubMed

Volaki, Konstantina; Pampanos, Andreas; Kitsiou-Tzeli, Sophia; Vrettou, Christina; Oikonomakis, Vasilis; Sofocleous, Christalena; Kanavakis, Emmanuel

2013-10-01

Molecular and neurobiological evidence for the involvement of neuroligins (particularly NLGN3 and NLGN4X genes) in autistic disorder is accumulating. However, previous mutation screening studies on these two genes have yielded controversial results. The present study explores, for the first time, the contribution of NLGN3 and NLGN4X genetic variants in Greek patients with autistic disorder. We analyzed the full exonic sequence of NLGN3 and NLGN4X genes in 40 patients strictly fulfilling the Diagnostic and Statistical Manual of Mental Disorders, 4th ed. criteria for autistic disorder. We identified nine nucleotide changes in NLGN4X--one probable causative mutation (p.K378R) previously reported by our research group, one novel variant (c.-206G>C), one nonvalidated single nucleotide polymorphism (SNP, rs111953947), and six known human SNPs reported in the SNP database--and one known human SNP in NLGN3 also reported in the SNP database. The variants identified are expected to be benign. However, they should be investigated in the context of variants in interacting cellular pathways to assess their contribution to the etiology of autism.

Genome-Wide SNP Genotyping to Infer the Effects on Gene Functions in Tomato

PubMed Central

Hirakawa, Hideki; Shirasawa, Kenta; Ohyama, Akio; Fukuoka, Hiroyuki; Aoki, Koh; Rothan, Christophe; Sato, Shusei; Isobe, Sachiko; Tabata, Satoshi

2013-01-01

The genotype data of 7054 single nucleotide polymorphism (SNP) loci in 40 tomato lines, including inbred lines, F1 hybrids, and wild relatives, were collected using Illumina's Infinium and GoldenGate assay platforms, the latter of which was utilized in our previous study. The dendrogram based on the genotype data corresponded well to the breeding types of tomato and wild relatives. The SNPs were classified into six categories according to their positions in the genes predicted on the tomato genome sequence. The genes with SNPs were annotated by homology searches against the nucleotide and protein databases, as well as by domain searches, and they were classified into the functional categories defined by the NCBI's eukaryotic orthologous groups (KOG). To infer the SNPs' effects on the gene functions, the three-dimensional structures of the 843 proteins that were encoded by the genes with SNPs causing missense mutations were constructed by homology modelling, and 200 of these proteins were considered to carry non-synonymous amino acid substitutions in the predicted functional sites. The SNP information obtained in this study is available at the Kazusa Tomato Genomics Database (http://plant1.kazusa.or.jp/tomato/). PMID:23482505

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Microbe-ID: an open source toolbox for microbial genotyping and species identification.

PubMed

Tabima, Javier F; Everhart, Sydney E; Larsen, Meredith M; Weisberg, Alexandra J; Kamvar, Zhian N; Tancos, Matthew A; Smart, Christine D; Chang, Jeff H; Grünwald, Niklaus J

2016-01-01

Development of tools to identify species, genotypes, or novel strains of invasive organisms is critical for monitoring emergence and implementing rapid response measures. Molecular markers, although critical to identifying species or genotypes, require bioinformatic tools for analysis. However, user-friendly analytical tools for fast identification are not readily available. To address this need, we created a web-based set of applications called Microbe-ID that allow for customizing a toolbox for rapid species identification and strain genotyping using any genetic markers of choice. Two components of Microbe-ID, named Sequence-ID and Genotype-ID, implement species and genotype identification, respectively. Sequence-ID allows identification of species by using BLAST to query sequences for any locus of interest against a custom reference sequence database. Genotype-ID allows placement of an unknown multilocus marker in either a minimum spanning network or dendrogram with bootstrap support from a user-created reference database. Microbe-ID can be used for identification of any organism based on nucleotide sequences or any molecular marker type and several examples are provided. We created a public website for demonstration purposes called Microbe-ID (microbe-id.org) and provided a working implementation for the genus Phytophthora (phytophthora-id.org). In Phytophthora-ID, the Sequence-ID application allows identification based on ITS or cox spacer sequences. Genotype-ID groups individuals into clonal lineages based on simple sequence repeat (SSR) markers for the two invasive plant pathogen species P. infestans and P. ramorum. All code is open source and available on github and CRAN. Instructions for installation and use are provided at https://github.com/grunwaldlab/Microbe-ID.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

DRDB: An Online Date Palm Genomic Resource Database.

PubMed

He, Zilong; Zhang, Chengwei; Liu, Wanfei; Lin, Qiang; Wei, Ting; Aljohi, Hasan A; Chen, Wei-Hua; Hu, Songnian

2017-01-01

Background: Date palm ( Phoenix dactylifera L.) is a cultivated woody plant with agricultural and economic importance in many countries around the world. With the advantages of next generation sequencing technologies, genome sequences for many date palm cultivars have been released recently. Short sequence repeat (SSR) and single nucleotide polymorphism (SNP) can be identified from these genomic data, and have been proven to be very useful biomarkers in plant genome analysis and breeding. Results: Here, we first improved the date palm genome assembly using 130X of HiSeq data generated in our lab. Then 246,445 SSRs (214,901 SSRs and 31,544 compound SSRs) were annotated in this genome assembly; among the SSRs, mononucleotide SSRs (58.92%) were the most abundant, followed by di- (29.92%), tri- (8.14%), tetra- (2.47%), penta- (0.36%), and hexa-nucleotide SSRs (0.19%). The high-quality PCR primer pairs were designed for most (174,497; 70.81% out of total) SSRs. We also annotated 6,375,806 SNPs with raw read depth≥3 in 90% cultivars. To further reduce false positive SNPs, we only kept 5,572,650 (87.40% out of total) SNPs with at least 20% cultivars support for downstream analyses. The high-quality PCR primer pairs were also obtained for 4,177,778 (65.53%) SNPs. We reconstructed the phylogenetic relationships among the 62 cultivars using these variants and found that they can be divided into three clusters, namely North Africa, Egypt - Sudan, and Middle East - South Asian, with Egypt - Sudan being the admixture of North Africa and Middle East - South Asian cultivars; we further confirmed these clusters using principal component analysis. Moreover, 34,346 SSRs and 4,177,778 SNPs with PCR primers were assigned to shared cultivars for cultivar classification and diversity analysis. All these SSRs, SNPs and their classification are available in our database, and can be used for cultivar identification, comparison, and molecular breeding. Conclusion: DRDB is a comprehensive genomic resource database of date palm. It can serve as a bioinformatics platform for date palm genomics, genetics, and molecular breeding. DRDB is freely available at http://drdb.big.ac.cn/home.

DRDB: An Online Date Palm Genomic Resource Database

PubMed Central

He, Zilong; Zhang, Chengwei; Liu, Wanfei; Lin, Qiang; Wei, Ting; Aljohi, Hasan A.; Chen, Wei-Hua; Hu, Songnian

2017-01-01

Background: Date palm (Phoenix dactylifera L.) is a cultivated woody plant with agricultural and economic importance in many countries around the world. With the advantages of next generation sequencing technologies, genome sequences for many date palm cultivars have been released recently. Short sequence repeat (SSR) and single nucleotide polymorphism (SNP) can be identified from these genomic data, and have been proven to be very useful biomarkers in plant genome analysis and breeding. Results: Here, we first improved the date palm genome assembly using 130X of HiSeq data generated in our lab. Then 246,445 SSRs (214,901 SSRs and 31,544 compound SSRs) were annotated in this genome assembly; among the SSRs, mononucleotide SSRs (58.92%) were the most abundant, followed by di- (29.92%), tri- (8.14%), tetra- (2.47%), penta- (0.36%), and hexa-nucleotide SSRs (0.19%). The high-quality PCR primer pairs were designed for most (174,497; 70.81% out of total) SSRs. We also annotated 6,375,806 SNPs with raw read depth≥3 in 90% cultivars. To further reduce false positive SNPs, we only kept 5,572,650 (87.40% out of total) SNPs with at least 20% cultivars support for downstream analyses. The high-quality PCR primer pairs were also obtained for 4,177,778 (65.53%) SNPs. We reconstructed the phylogenetic relationships among the 62 cultivars using these variants and found that they can be divided into three clusters, namely North Africa, Egypt – Sudan, and Middle East – South Asian, with Egypt – Sudan being the admixture of North Africa and Middle East – South Asian cultivars; we further confirmed these clusters using principal component analysis. Moreover, 34,346 SSRs and 4,177,778 SNPs with PCR primers were assigned to shared cultivars for cultivar classification and diversity analysis. All these SSRs, SNPs and their classification are available in our database, and can be used for cultivar identification, comparison, and molecular breeding. Conclusion: DRDB is a comprehensive genomic resource database of date palm. It can serve as a bioinformatics platform for date palm genomics, genetics, and molecular breeding. DRDB is freely available at http://drdb.big.ac.cn/home. PMID:29209336

SNPdbe: constructing an nsSNP functional impacts database.

PubMed

Schaefer, Christian; Meier, Alice; Rost, Burkhard; Bromberg, Yana

2012-02-15

Many existing databases annotate experimentally characterized single nucleotide polymorphisms (SNPs). Each non-synonymous SNP (nsSNP) changes one amino acid in the gene product (single amino acid substitution;SAAS). This change can either affect protein function or be neutral in that respect. Most polymorphisms lack experimental annotation of their functional impact. Here, we introduce SNPdbe-SNP database of effects, with predictions of computationally annotated functional impacts of SNPs. Database entries represent nsSNPs in dbSNP and 1000 Genomes collection, as well as variants from UniProt and PMD. SAASs come from >2600 organisms; 'human' being the most prevalent. The impact of each SAAS on protein function is predicted using the SNAP and SIFT algorithms and augmented with experimentally derived function/structure information and disease associations from PMD, OMIM and UniProt. SNPdbe is consistently updated and easily augmented with new sources of information. The database is available as an MySQL dump and via a web front end that allows searches with any combination of organism names, sequences and mutation IDs. http://www.rostlab.org/services/snpdbe.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Analysis of the full genome of human group C rotaviruses reveals lineage diversification and reassortment.

PubMed

Medici, Maria Cristina; Tummolo, Fabio; Martella, Vito; Arcangeletti, Maria Cristina; De Conto, Flora; Chezzi, Carlo; Fehér, Enikő; Marton, Szilvia; Calderaro, Adriana; Bányai, Krisztián

2016-08-01

Group C rotaviruses (RVC) are enteric pathogens of humans and animals. Whole-genome sequences are available only for few RVCs, leaving gaps in our knowledge about their genetic diversity. We determined the full-length genome sequence of two human RVCs (PR2593/2004 and PR713/2012), detected in Italy from hospital-based surveillance for rotavirus infection in 2004 and 2012. In the 11 RNA genomic segments, the two Italian RVCs segregated within separate intra-genotypic lineages showed variation ranging from 1.9 % (VP6) to 15.9 % (VP3) at the nucleotide level. Comprehensive analysis of human RVC sequences available in the databases allowed us to reveal the existence of at least two major genome configurations, defined as type I and type II. Human RVCs of type I were all associated with the M3 VP3 genotype, including the Italian strain PR2593/2004. Conversely, human RVCs of type II were all associated with the M2 VP3 genotype, including the Italian strain PR713/2012. Reassortant RVC strains between these major genome configurations were identified. Although only a few full-genome sequences of human RVCs, mostly of Asian origin, are available, the analysis of human RVC sequences retrieved from the databases indicates that at least two intra-genotypic RVC lineages circulate in European countries. Gathering more sequence data is necessary to develop a standardized genotype and intra-genotypic lineage classification system useful for epidemiological investigations and avoiding confusion in the literature.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Identification of a novel miRNA from the ovine ovary by a combinatorial approach of bioinformatics and experiments

PubMed Central

CHANG, Weihua; WANG, Juanhong; TAO, Dayong; ZHANG, Yong; HE, Jianzhong; SHI, Changqing

2015-01-01

MicroRNAs (miRNAs) are a class of short endogenous, single-stranded, non-coding small RNA molecules, about 19–25 nucleotides in length that regulate gene expression at the translation level and influence many physiological process, such apoptosis, metabolism, signal transduction, and occurrence and development of diseases. In this study, we constructed a library from the ovine luteal phase ovary by using next-generation sequencing technology (Solexa high-throughput sequencing technique) and identified 267 novel miRNAs by bioinformatics. One of the novel miRNAs (ovis_aries_ovary-m0033_3p), which expressed in the sheep ovary and testis, was confirmed by real time PCR and northern blot. Ovis_aries_ovary-m0033_3p was 21 nucleotides in length and located on chromosome 12, and it had 100% similarity to hsa-miR-214-3p, mmu-miR-214-3p, dre-miR-214and ssc-miR-214. Meanwhile, the pre-miRNA was 82 nucleotides in length and had a standard hairpin stem-loop structure. From the consistency of the sequence and structure, we speculated that ovis_aries_ovary-m0033_3p had a function similar to hsa-miR-214-3p, which is involved in the fine regulation of cell survival, embryonic development, breeding activities and resistance to ovarian cancer, so we defined it as oar-miR-214-3p. These experimental results will enrich the miRNA database for ovis aries and provide the basis for researching the regulation mechanism of miRNA in relation to breeding activities of seasonal breeding animals. PMID:26268666

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

Genomic paradigms for food-borne enteric pathogen analysis at the USFDA: case studies highlighting method utility, integration and resolution.

PubMed

Elkins, C A; Kotewicz, M L; Jackson, S A; Lacher, D W; Abu-Ali, G S; Patel, I R

2013-01-01

Modern risk control and food safety practices involving food-borne bacterial pathogens are benefiting from new genomic technologies for rapid, yet highly specific, strain characterisations. Within the United States Food and Drug Administration (USFDA) Center for Food Safety and Applied Nutrition (CFSAN), optical genome mapping and DNA microarray genotyping have been used for several years to quickly assess genomic architecture and gene content, respectively, for outbreak strain subtyping and to enhance retrospective trace-back analyses. The application and relative utility of each method varies with outbreak scenario and the suspect pathogen, with comparative analytical power enhanced by database scale and depth. Integration of these two technologies allows high-resolution scrutiny of the genomic landscapes of enteric food-borne pathogens with notable examples including Shiga toxin-producing Escherichia coli (STEC) and Salmonella enterica serovars from a variety of food commodities. Moreover, the recent application of whole genome sequencing technologies to food-borne pathogen outbreaks and surveillance has enhanced resolution to the single nucleotide scale. This new wealth of sequence data will support more refined next-generation custom microarray designs, targeted re-sequencing and "genomic signature recognition" approaches involving a combination of genes and single nucleotide polymorphism detection to distil strain-specific fingerprinting to a minimised scale. This paper examines the utility of microarrays and optical mapping in analysing outbreaks, reviews best practices and the limits of these technologies for pathogen differentiation, and it considers future integration with whole genome sequencing efforts.

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

PubMed

Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

2018-04-11

Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions. It also allows the definition of sequence length and sequence variability of the target region as well as the less variable flanking regions for tailoring to MPS platforms. As shown in this study, TIA can be used to discover identity-linked SNP islands within the human genome, useful for differentiating individuals by targeted resequencing on MPS technologies.

Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

PubMed

Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

2008-01-01

Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

TIR-NBS-LRR genes are rare in monocots: evidence from diverse monocot orders

PubMed Central

Tarr, D Ellen K; Alexander, Helen M

2009-01-01

Background Plant resistance (R) gene products recognize pathogen effector molecules. Many R genes code for proteins containing nucleotide binding site (NBS) and C-terminal leucine-rich repeat (LRR) domains. NBS-LRR proteins can be divided into two groups, TIR-NBS-LRR and non-TIR-NBS-LRR, based on the structure of the N-terminal domain. Although both classes are clearly present in gymnosperms and eudicots, only non-TIR sequences have been found consistently in monocots. Since most studies in monocots have been limited to agriculturally important grasses, it is difficult to draw conclusions. The purpose of our study was to look for evidence of these sequences in additional monocot orders. Findings Using degenerate PCR, we amplified NBS sequences from four monocot species (C. blanda, D. marginata, S. trifasciata, and Spathiphyllum sp.), a gymnosperm (C. revoluta) and a eudicot (C. canephora). We successfully amplified TIR-NBS-LRR sequences from dicot and gymnosperm DNA, but not from monocot DNA. Using databases, we obtained NBS sequences from additional monocots, magnoliids and basal angiosperms. TIR-type sequences were not present in monocot or magnoliid sequences, but were present in the basal angiosperms. Phylogenetic analysis supported a single TIR clade and multiple non-TIR clades. Conclusion We were unable to find monocot TIR-NBS-LRR sequences by PCR amplification or database searches. In contrast to previous studies, our results represent five monocot orders (Poales, Zingiberales, Arecales, Asparagales, and Alismatales). Our results establish the presence of TIR-NBS-LRR sequences in basal angiosperms and suggest that although these sequences were present in early land plants, they have been reduced significantly in monocots and magnoliids. PMID:19785756

The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.

PubMed Central

Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A

1987-01-01

The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

[Cloning of new acylamidase gene from Rhodococcus erythropolis and its expression in Escherichia coli].

PubMed

Lavrov, K V; Ianenko, A S

2013-10-01

The gene for new Rhodococcus erythropolis TA37 acylamidase, which possesses unique substrate specificity, has been cloned and expressed in E. coli. Substrates for this enzyme are not only simple amides, such as acetamide and propionamide, but also N-substituted amides, such as 4'-nitroacetanilide. The 1431-bp gene was expressed in E. coli BL21 (DE3) cells on pET16b plasmid under the control of a promoter of the φ 10 gene from the T7 phage. The molecular mass of recombinant acylamidase in E. coli was 55 kDa, which corresponded to that of native acylamidase from Rhodococcus erythropolis TA37. Recombinant acylamidase was able to hydrolize N-substituted amides. A search of a nucleotide database and multiple alignment revealed that acylamidase belonged to the Amidase protein family PF01425, but its nucleotide and amino acid sequences differed significantly from those of the described amidases.

TargetCompare: A web interface to compare simultaneous miRNAs targets

PubMed Central

Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-dos-Santos, André M; dos Santos, Ândrea Ribeiro

2014-01-01

MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. Availability http://lghm.ufpa.br/targetcompare PMID:25352731

TargetCompare: A web interface to compare simultaneous miRNAs targets.

PubMed

Moreira, Fabiano Cordeiro; Dustan, Bruno; Hamoy, Igor G; Ribeiro-Dos-Santos, André M; Dos Santos, Andrea Ribeiro

2014-01-01

MicroRNAs (miRNAs) are small non-coding nucleotide sequences between 17 and 25 nucleotides in length that primarily function in the regulation of gene expression. A since miRNA has thousand of predict targets in a complex, regulatory cell signaling network. Therefore, it is of interest to study multiple target genes simultaneously. Hence, we describe a web tool (developed using Java programming language and MySQL database server) to analyse multiple targets of pre-selected miRNAs. We cross validated the tool in eight most highly expressed miRNAs in the antrum region of stomach. This helped to identify 43 potential genes that are target of at least six of the referred miRNAs. The developed tool aims to reduce the randomness and increase the chance of selecting strong candidate target genes and miRNAs responsible for playing important roles in the studied tissue. http://lghm.ufpa.br/targetcompare.

ChloroSSRdb: a repository of perfect and imperfect chloroplastic simple sequence repeats (cpSSRs) of green plants

PubMed Central

Kapil, Aditi; Rai, Piyush Kant; Shanker, Asheesh

2014-01-01

Simple sequence repeats (SSRs) are regions in DNA sequence that contain repeating motifs of length 1–6 nucleotides. These repeats are ubiquitously present and are found in both coding and non-coding regions of genome. A total of 534 complete chloroplast genome sequences (as on 18 September 2014) of Viridiplantae are available at NCBI organelle genome resource. It provides opportunity to mine these genomes for the detection of SSRs and store them in the form of a database. In an attempt to properly manage and retrieve chloroplastic SSRs, we designed ChloroSSRdb which is a relational database developed using SQL server 2008 and accessed through ASP.NET. It provides information of all the three types (perfect, imperfect and compound) of SSRs. At present, ChloroSSRdb contains 124 430 mined SSRs, with majority lying in non-coding region. Out of these, PCR primers were designed for 118 249 SSRs. Tetranucleotide repeats (47 079) were found to be the most frequent repeat type, whereas hexanucleotide repeats (6414) being the least abundant. Additionally, in each species statistical analyses were performed to calculate relative frequency, correlation coefficient and chi-square statistics of perfect and imperfect SSRs. In accordance with the growing interest in SSR studies, ChloroSSRdb will prove to be a useful resource in developing genetic markers, phylogenetic analysis, genetic mapping, etc. Moreover, it will serve as a ready reference for mined SSRs in available chloroplast genomes of green plants. Database URL: www.compubio.in/chlorossrdb/ PMID:25380781

ChloroSSRdb: a repository of perfect and imperfect chloroplastic simple sequence repeats (cpSSRs) of green plants.

PubMed

Kapil, Aditi; Rai, Piyush Kant; Shanker, Asheesh

2014-01-01

Simple sequence repeats (SSRs) are regions in DNA sequence that contain repeating motifs of length 1-6 nucleotides. These repeats are ubiquitously present and are found in both coding and non-coding regions of genome. A total of 534 complete chloroplast genome sequences (as on 18 September 2014) of Viridiplantae are available at NCBI organelle genome resource. It provides opportunity to mine these genomes for the detection of SSRs and store them in the form of a database. In an attempt to properly manage and retrieve chloroplastic SSRs, we designed ChloroSSRdb which is a relational database developed using SQL server 2008 and accessed through ASP.NET. It provides information of all the three types (perfect, imperfect and compound) of SSRs. At present, ChloroSSRdb contains 124 430 mined SSRs, with majority lying in non-coding region. Out of these, PCR primers were designed for 118 249 SSRs. Tetranucleotide repeats (47 079) were found to be the most frequent repeat type, whereas hexanucleotide repeats (6414) being the least abundant. Additionally, in each species statistical analyses were performed to calculate relative frequency, correlation coefficient and chi-square statistics of perfect and imperfect SSRs. In accordance with the growing interest in SSR studies, ChloroSSRdb will prove to be a useful resource in developing genetic markers, phylogenetic analysis, genetic mapping, etc. Moreover, it will serve as a ready reference for mined SSRs in available chloroplast genomes of green plants. Database URL: www.compubio.in/chlorossrdb/ © The Author(s) 2014. Published by Oxford University Press.

Statistical properties of DNA sequences

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

1995-01-01

We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

A comparative analysis of exome capture.

PubMed

Parla, Jennifer S; Iossifov, Ivan; Grabill, Ian; Spector, Mona S; Kramer, Melissa; McCombie, W Richard

2011-09-29

Human exome resequencing using commercial target capture kits has been and is being used for sequencing large numbers of individuals to search for variants associated with various human diseases. We rigorously evaluated the capabilities of two solution exome capture kits. These analyses help clarify the strengths and limitations of those data as well as systematically identify variables that should be considered in the use of those data. Each exome kit performed well at capturing the targets they were designed to capture, which mainly corresponds to the consensus coding sequences (CCDS) annotations of the human genome. In addition, based on their respective targets, each capture kit coupled with high coverage Illumina sequencing produced highly accurate nucleotide calls. However, other databases, such as the Reference Sequence collection (RefSeq), define the exome more broadly, and so not surprisingly, the exome kits did not capture these additional regions. Commercial exome capture kits provide a very efficient way to sequence select areas of the genome at very high accuracy. Here we provide the data to help guide critical analyses of sequencing data derived from these products.

Drosophila Nora virus capsid proteins differ from those of other picorna-like viruses.

PubMed

Ekström, Jens-Ola; Habayeb, Mazen S; Srivastava, Vaibhav; Kieselbach, Thomas; Wingsle, Gunnar; Hultmark, Dan

2011-09-01

The recently discovered Nora virus from Drosophila melanogaster is a single-stranded RNA virus. Its published genomic sequence encodes a typical picorna-like cassette of replicative enzymes, but no capsid proteins similar to those in other picorna-like viruses. We have now done additional sequencing at the termini of the viral genome, extending it by 455 nucleotides at the 5' end, but no more coding sequence was found. The completeness of the final 12,333-nucleotide sequence was verified by the production of infectious virus from the cloned genome. To identify the capsid proteins, we purified Nora virus particles and analyzed their proteins by mass spectrometry. Our results show that the capsid is built from three major proteins, VP4A, B and C, encoded in the fourth open reading frame of the viral genome. The viral particles also contain traces of a protein from the third open reading frame, VP3. VP4A and B are not closely related to other picorna-like virus capsid proteins in sequence, but may form similar jelly roll folds. VP4C differs from the others and is predicted to have an essentially α-helical conformation. In a related virus, identified from EST database sequences from Nasonia parasitoid wasps, VP4C is encoded in a separate open reading frame, separated from VP4A and B by a frame-shift. This opens a possibility that VP4C is produced in non-equimolar quantities. Altogether, our results suggest that the Nora virus capsid has a different protein organization compared to the order Picornavirales. Copyright © 2011 Elsevier B.V. All rights reserved.

Genomic Sequencing of Bordetella pertussis for Epidemiology and Global Surveillance of Whooping Cough.

PubMed

Bouchez, Valérie; Guglielmini, Julien; Dazas, Mélody; Landier, Annie; Toubiana, Julie; Guillot, Sophie; Criscuolo, Alexis; Brisse, Sylvain

2018-06-01

Bordetella pertussis causes whooping cough, a highly contagious respiratory disease that is reemerging in many world regions. The spread of antigen-deficient strains may threaten acellular vaccine efficacy. Dynamics of strain transmission are poorly defined because of shortcomings in current strain genotyping methods. Our objective was to develop a whole-genome genotyping strategy with sufficient resolution for local epidemiologic questions and sufficient reproducibility to enable international comparisons of clinical isolates. We defined a core genome multilocus sequence typing scheme comprising 2,038 loci and demonstrated its congruence with whole-genome single-nucleotide polymorphism variation. Most cases of intrafamilial groups of isolates or of multiple isolates recovered from the same patient were distinguished from temporally and geographically cocirculating isolates. However, epidemiologically unrelated isolates were sometimes nearly undistinguishable. We set up a publicly accessible core genome multilocus sequence typing database to enable global comparisons of B. pertussis isolates, opening the way for internationally coordinated surveillance.

EMPOP-quality mtDNA control region sequences from Kashmiri of Azad Jammu & Kashmir, Pakistan.

PubMed

Rakha, Allah; Peng, Min-Sheng; Bi, Rui; Song, Jiao-Jiao; Salahudin, Zeenat; Adan, Atif; Israr, Muhammad; Yao, Yong-Gang

2016-11-01

The mitochondrial DNA (mtDNA) control region (nucleotide position 16024-576) sequences were generated through Sanger sequencing method for 317 self-identified Kashmiris from all districts of Azad Jammu & Kashmir Pakistan. The population sample set showed a total of 251 haplotypes, with a relatively high haplotype diversity (0.9977) and a low random match probability (0.54%). The containing matrilineal lineages belonging to three different phylogeographic origins of Western Eurasian (48.9%), South Asian (47.0%) and East Asian (4.1%). The present study was compared to previous data from Pakistan and other worldwide populations (Central Asia, Western Asia, and East & Southeast Asia). The dataset is made available through EMPOP under accession number EMP00679 and will serve as an mtDNA reference database in forensic casework in Pakistan. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

GBshape: a genome browser database for DNA shape annotations

PubMed Central

Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo

2015-01-01

Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329

Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.

PubMed

Mitra, Sanga; Das, Pijush; Samadder, Arpa; Das, Smarajit; Betai, Rupal; Chakrabarti, Jayprokas

2015-01-01

During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

PubMed

Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

2008-08-19

Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

PubMed Central

Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

2008-01-01

Background Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required. PMID:18710585

ActiveDriverDB: human disease mutations and genome variation in post-translational modification sites of proteins

PubMed Central

Krassowski, Michal; Paczkowska, Marta; Cullion, Kim; Huang, Tina; Dzneladze, Irakli; Ouellette, B F Francis; Yamada, Joseph T; Fradet-Turcotte, Amelie

2018-01-01

Abstract Interpretation of genetic variation is needed for deciphering genotype-phenotype associations, mechanisms of inherited disease, and cancer driver mutations. Millions of single nucleotide variants (SNVs) in human genomes are known and thousands are associated with disease. An estimated 21% of disease-associated amino acid substitutions corresponding to missense SNVs are located in protein sites of post-translational modifications (PTMs), chemical modifications of amino acids that extend protein function. ActiveDriverDB is a comprehensive human proteo-genomics database that annotates disease mutations and population variants through the lens of PTMs. We integrated >385,000 published PTM sites with ∼3.6 million substitutions from The Cancer Genome Atlas (TCGA), the ClinVar database of disease genes, and human genome sequencing projects. The database includes site-specific interaction networks of proteins, upstream enzymes such as kinases, and drugs targeting these enzymes. We also predicted network-rewiring impact of mutations by analyzing gains and losses of kinase-bound sequence motifs. ActiveDriverDB provides detailed visualization, filtering, browsing and searching options for studying PTM-associated mutations. Users can upload mutation datasets interactively and use our application programming interface in pipelines. Integrative analysis of mutations and PTMs may help decipher molecular mechanisms of phenotypes and disease, as exemplified by case studies of TP53, BRCA2 and VHL. The open-source database is available at https://www.ActiveDriverDB.org. PMID:29126202

SpliceDisease database: linking RNA splicing and disease.

PubMed

Wang, Juan; Zhang, Jie; Li, Kaibo; Zhao, Wei; Cui, Qinghua

2012-01-01

RNA splicing is an important aspect of gene regulation in many organisms. Splicing of RNA is regulated by complicated mechanisms involving numerous RNA-binding proteins and the intricate network of interactions among them. Mutations in cis-acting splicing elements or its regulatory proteins have been shown to be involved in human diseases. Defects in pre-mRNA splicing process have emerged as a common disease-causing mechanism. Therefore, a database integrating RNA splicing and disease associations would be helpful for understanding not only the RNA splicing but also its contribution to disease. In SpliceDisease database, we manually curated 2337 splicing mutation disease entries involving 303 genes and 370 diseases, which have been supported experimentally in 898 publications. The SpliceDisease database provides information including the change of the nucleotide in the sequence, the location of the mutation on the gene, the reference Pubmed ID and detailed description for the relationship among gene mutations, splicing defects and diseases. We standardized the names of the diseases and genes and provided links for these genes to NCBI and UCSC genome browser for further annotation and genomic sequences. For the location of the mutation, we give direct links of the entry to the respective position/region in the genome browser. The users can freely browse, search and download the data in SpliceDisease at http://cmbi.bjmu.edu.cn/sdisease.

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

MELOGEN: an EST database for melon functional genomics

PubMed Central

Gonzalez-Ibeas, Daniel; Blanca, José; Roig, Cristina; González-To, Mireia; Picó, Belén; Truniger, Verónica; Gómez, Pedro; Deleu, Wim; Caño-Delgado, Ana; Arús, Pere; Nuez, Fernando; Garcia-Mas, Jordi; Puigdomènech, Pere; Aranda, Miguel A

2007-01-01

Background Melon (Cucumis melo L.) is one of the most important fleshy fruits for fresh consumption. Despite this, few genomic resources exist for this species. To facilitate the discovery of genes involved in essential traits, such as fruit development, fruit maturation and disease resistance, and to speed up the process of breeding new and better adapted melon varieties, we have produced a large collection of expressed sequence tags (ESTs) from eight normalized cDNA libraries from different tissues in different physiological conditions. Results We determined over 30,000 ESTs that were clustered into 16,637 non-redundant sequences or unigenes, comprising 6,023 tentative consensus sequences (contigs) and 10,614 unclustered sequences (singletons). Many potential molecular markers were identified in the melon dataset: 1,052 potential simple sequence repeats (SSRs) and 356 single nucleotide polymorphisms (SNPs) were found. Sixty-nine percent of the melon unigenes showed a significant similarity with proteins in databases. Functional classification of the unigenes was carried out following the Gene Ontology scheme. In total, 9,402 unigenes were mapped to one or more ontology. Remarkably, the distributions of melon and Arabidopsis unigenes followed similar tendencies, suggesting that the melon dataset is representative of the whole melon transcriptome. Bioinformatic analyses primarily focused on potential precursors of melon micro RNAs (miRNAs) in the melon dataset, but many other genes potentially controlling disease resistance and fruit quality traits were also identified. Patterns of transcript accumulation were characterised by Real-Time-qPCR for 20 of these genes. Conclusion The collection of ESTs characterised here represents a substantial increase on the genetic information available for melon. A database (MELOGEN) which contains all EST sequences, contig images and several tools for analysis and data mining has been created. This set of sequences constitutes also the basis for an oligo-based microarray for melon that is being used in experiments to further analyse the melon transcriptome. PMID:17767721

Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

PubMed

Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

1997-03-01

cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

Database of amino acid-nucleotide contacts in contacts in DNA-homeodomain protein

NASA Astrophysics Data System (ADS)

Grokhlina, T. I.; Zrelov, P. V.; Ivanov, V. V.; Polozov, R. V.; Chirgadze, Yu. N.; Sivozhelezov, V. S.

2013-09-01

The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires an analysis of the physicochemical characteristics of these contacts and the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used to compare and classify the interfaces of the protein-DNA complexes.

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Handermann, M; Szépe, O; Darai, G

1991-06-01

The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.

Centrifuge: rapid and sensitive classification of metagenomic sequences.

PubMed

Kim, Daehwan; Song, Li; Breitwieser, Florian P; Salzberg, Steven L

2016-12-01

Centrifuge is a novel microbial classification engine that enables rapid, accurate, and sensitive labeling of reads and quantification of species on desktop computers. The system uses an indexing scheme based on the Burrows-Wheeler transform (BWT) and the Ferragina-Manzini (FM) index, optimized specifically for the metagenomic classification problem. Centrifuge requires a relatively small index (4.2 GB for 4078 bacterial and 200 archaeal genomes) and classifies sequences at very high speed, allowing it to process the millions of reads from a typical high-throughput DNA sequencing run within a few minutes. Together, these advances enable timely and accurate analysis of large metagenomics data sets on conventional desktop computers. Because of its space-optimized indexing schemes, Centrifuge also makes it possible to index the entire NCBI nonredundant nucleotide sequence database (a total of 109 billion bases) with an index size of 69 GB, in contrast to k-mer-based indexing schemes, which require far more extensive space. © 2016 Kim et al.; Published by Cold Spring Harbor Laboratory Press.

Nucleotide and amino acid variations of tannase gene from different Aspergillus strains.

PubMed

Borrego-Terrazas, J A; Lara-Victoriano, F; Flores-Gallegos, A C; Veana, F; Aguilar, C N; Rodríguez-Herrera, R

2014-08-01

Tannase is an enzyme that catalyses the hydrolysis of ester bonds present in tannins. Most of the scientific reports about this biocatalysis focus on aspects related to tannase production and its recovery; on the other hand, reports assessing the molecular aspects of the tannase gene or protein are scarce. In the present study, a tannase gene fragment from several Aspergillus strains isolated from the Mexican semidesert was sequenced and compared with tannase amino acid sequences reported in NCBI database using bioinformatics tools. The genetic relationship among the different tannase sequences was also determined. A conserved region of 7 amino acids was found with the conserved motif GXSXG common to esterases, in which the active-site serine residue is located. In addition, in Aspergillus niger strains GH1 and PSH, we found an extra codon in the tannase sequences encoding glycine. The tannase gene belonging to semidesert fungal strains followed a neutral evolution path with the formation of 10 haplotypes, of which A. niger GH1 and PSH haplotypes are the oldest.

An Efficient Strategy of Screening for Pathogens in Wild-Caught Ticks and Mosquitoes by Reusing Small RNA Deep Sequencing Data

PubMed Central

An, Xiaoping; Fan, Hang; Ma, Maijuan; Anderson, Benjamin D.; Jiang, Jiafu; Liu, Wei; Cao, Wuchun; Tong, Yigang

2014-01-01

This paper explored our hypothesis that sRNA (18∼30 bp) deep sequencing technique can be used as an efficient strategy to identify microorganisms other than viruses, such as prokaryotic and eukaryotic pathogens. In the study, the clean reads derived from the sRNA deep sequencing data of wild-caught ticks and mosquitoes were compared against the NCBI nucleotide collection (non-redundant nt database) using Blastn. The blast results were then analyzed with in-house Python scripts. An empirical formula was proposed to identify the putative pathogens. Results showed that not only viruses but also prokaryotic and eukaryotic species of interest can be screened out and were subsequently confirmed with experiments. Specially, a novel Rickettsia spp. was indicated to exist in Haemaphysalis longicornis ticks collected in Beijing. Our study demonstrated the reuse of sRNA deep sequencing data would have the potential to trace the origin of pathogens or discover novel agents of emerging/re-emerging infectious diseases. PMID:24618575

rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria

PubMed Central

Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel

2003-01-01

Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

De Novo Transcriptome Sequencing Reveals Important Molecular Networks and Metabolic Pathways of the Plant, Chlorophytum borivilianum

PubMed Central

Kalra, Shikha; Puniya, Bhanwar Lal; Kulshreshtha, Deepika; Kumar, Sunil; Kaur, Jagdeep; Ramachandran, Srinivasan; Singh, Kashmir

2013-01-01

Chlorophytum borivilianum, an endangered medicinal plant species is highly recognized for its aphrodisiac properties provided by saponins present in the plant. The transcriptome information of this species is limited and only few hundred expressed sequence tags (ESTs) are available in the public databases. To gain molecular insight of this plant, high throughput transcriptome sequencing of leaf RNA was carried out using Illumina's HiSeq 2000 sequencing platform. A total of 22,161,444 single end reads were retrieved after quality filtering. Available (e.g., De-Bruijn/Eulerian graph) and in-house developed bioinformatics tools were used for assembly and annotation of transcriptome. A total of 101,141 assembled transcripts were obtained, with coverage size of 22.42 Mb and average length of 221 bp. Guanine-cytosine (GC) content was found to be 44%. Bioinformatics analysis, using non-redundant proteins, gene ontology (GO), enzyme commission (EC) and kyoto encyclopedia of genes and genomes (KEGG) databases, extracted all the known enzymes involved in saponin and flavonoid biosynthesis. Few genes of the alkaloid biosynthesis, along with anticancer and plant defense genes, were also discovered. Additionally, several cytochrome P450 (CYP450) and glycosyltransferase unique sequences were also found. We identified simple sequence repeat motifs in transcripts with an abundance of di-nucleotide simple sequence repeat (SSR; 43.1%) markers. Large scale expression profiling through Reads per Kilobase per Million mapped reads (RPKM) showed major genes involved in different metabolic pathways of the plant. Genes, expressed sequence tags (ESTs) and unique sequences from this study provide an important resource for the scientific community, interested in the molecular genetics and functional genomics of C. borivilianum. PMID:24376689

De Novo transcriptome sequencing reveals important molecular networks and metabolic pathways of the plant, Chlorophytum borivilianum.

PubMed

Kalra, Shikha; Puniya, Bhanwar Lal; Kulshreshtha, Deepika; Kumar, Sunil; Kaur, Jagdeep; Ramachandran, Srinivasan; Singh, Kashmir

2013-01-01

Chlorophytum borivilianum, an endangered medicinal plant species is highly recognized for its aphrodisiac properties provided by saponins present in the plant. The transcriptome information of this species is limited and only few hundred expressed sequence tags (ESTs) are available in the public databases. To gain molecular insight of this plant, high throughput transcriptome sequencing of leaf RNA was carried out using Illumina's HiSeq 2000 sequencing platform. A total of 22,161,444 single end reads were retrieved after quality filtering. Available (e.g., De-Bruijn/Eulerian graph) and in-house developed bioinformatics tools were used for assembly and annotation of transcriptome. A total of 101,141 assembled transcripts were obtained, with coverage size of 22.42 Mb and average length of 221 bp. Guanine-cytosine (GC) content was found to be 44%. Bioinformatics analysis, using non-redundant proteins, gene ontology (GO), enzyme commission (EC) and kyoto encyclopedia of genes and genomes (KEGG) databases, extracted all the known enzymes involved in saponin and flavonoid biosynthesis. Few genes of the alkaloid biosynthesis, along with anticancer and plant defense genes, were also discovered. Additionally, several cytochrome P450 (CYP450) and glycosyltransferase unique sequences were also found. We identified simple sequence repeat motifs in transcripts with an abundance of di-nucleotide simple sequence repeat (SSR; 43.1%) markers. Large scale expression profiling through Reads per Kilobase per Million mapped reads (RPKM) showed major genes involved in different metabolic pathways of the plant. Genes, expressed sequence tags (ESTs) and unique sequences from this study provide an important resource for the scientific community, interested in the molecular genetics and functional genomics of C. borivilianum.

Diversity and three-dimensional structures of the alpha Mcr of the methanogenic Archaea from the anoxic region of Tucuruí Lake, in Eastern Brazilian Amazonia

PubMed Central

Santana, Priscila Bessa; Junior, Rubens Ghilardi; Alves, Claudio Nahum; Silva, Jeronimo Lameira; McCulloch, John Anthony; Schneider, Maria Paula Cruz; da Costa da Silva, Artur

2012-01-01

Methanogenic archaeans are organisms of considerable ecological and biotechnological interest that produce methane through a restricted metabolic pathway, which culminates in the reaction catalyzed by the Methyl-coenzyme M reductase (Mcr) enzyme, and results in the release of methane. Using a metagenomic approach, the gene of the α subunit of mcr (mcrα) was isolated from sediment sample from an anoxic zone, rich in decomposing organic material, obtained from the Tucuruí hydroelectric dam reservoir in eastern Brazilian Amazonia. The partial nucleotide sequences obtained were 83 to 95% similar to those available in databases, indicating a low diversity of archaeans in the reservoir. Two orders were identified - the Methanomicrobiales, and a unique Operational Taxonomic Unit (OTU) forming a clade with the Methanosarcinales according to low bootstrap values. Homology modeling was used to determine the three-dimensional (3D) structures, for this the partial nucleotide sequence of the mcrα were isolated and translated on their partial amino acid sequences. The 3D structures of the archaean Mcrα observed in the present study varied little, and presented approximately 70% identity in comparison with the Mcrα of Methanopyrus klanderi. The results demonstrated that the community of methanogenic archaeans of the anoxic C1 region of the Tucurui reservoir is relatively homogeneous. PMID:22481885

Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.

PubMed

Taylor, Louis J; Strebel, Klaus

2017-01-07

Gene knockouts are a common tool used to study gene function in various organisms. However, designing gene knockouts is complicated in viruses, which frequently contain sequences that code for multiple overlapping genes. Designing mutants that can be traced by the creation of new or elimination of existing restriction sites further compounds the difficulty in experimental design of knockouts of overlapping genes. While software is available to rapidly identify restriction sites in a given nucleotide sequence, no existing software addresses experimental design of mutations involving multiple overlapping amino acid sequences in generating gene knockouts. Pyviko performed well on a test set of over 240,000 gene pairs collected from viral genomes deposited in the National Center for Biotechnology Information Nucleotide database, identifying a point mutation which added a premature stop codon within the first 20 codons of the target gene in 93.2% of all tested gene-overprinted gene pairs. This shows that Pyviko can be used successfully in a wide variety of contexts to facilitate the molecular cloning and study of viral overprinted genes. Pyviko is an extensible and intuitive Python tool for designing knockouts of overlapping genes. Freely available as both a Python package and a web-based interface ( http://louiejtaylor.github.io/pyViKO/ ), Pyviko simplifies the experimental design of gene knockouts in complex viruses with overlapping genes.

Biosynthesis and hyper production of pullulan by a newly isolated strain of Aspergillus japonicus-VIT-SB1.

PubMed

Mishra, Bishwambhar; Suneetha, V

2014-07-01

The main focus of this study was to screen and characterize novel microbial strains isolated from culinary leaf samples, capable of producing high concentrations of pullulan. Hundred isolates were screened from the phylloplane of different plants. The results revealed that eight strains had the capability to produce exopolysaccharide (EPS) and only one potential strain (designated as VIT-SB1) could produce the significant amount of EPS (3.9 ± 0.02%) on the 6th day of the fermentation without optimisation. The EPS synthesized by VIT-SB1 strain was confirmed to be pullulan on the basis of the results of FT-IR, HPLC and the enzymatic (Pullulanase) analysis. More than 91% hydrolysis of pullulan by pullulanase enzyme also indicated the presence of α (1 → 6) glycosidic linkages of α (1 → 4) linked maltotriose units. This VIT-SB1 strain was identified as Aspergillus japonicus based on the nucleotide sequence of the D1/D2 domain of Large-Subunit rRNA gene. The sequence was submitted to the GenBank Nucleotide sequence database with Accession No: KC128815. This study has confirmed that pullulan production capacity of this novel strain and Aureobasidium pullulans are comparable. Hence Aspergillus japonicus-VIT-SB1 strain can be commercially exploited as a potential pullulan producing strain.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Comparative high-throughput transcriptome sequencing and development of SiESTa, the Silene EST annotation database

PubMed Central

2011-01-01

Background The genus Silene is widely used as a model system for addressing ecological and evolutionary questions in plants, but advances in using the genus as a model system are impeded by the lack of available resources for studying its genome. Massively parallel sequencing cDNA has recently developed into an efficient method for characterizing the transcriptomes of non-model organisms, generating massive amounts of data that enable the study of multiple species in a comparative framework. The sequences generated provide an excellent resource for identifying expressed genes, characterizing functional variation and developing molecular markers, thereby laying the foundations for future studies on gene sequence and gene expression divergence. Here, we report the results of a comparative transcriptome sequencing study of eight individuals representing four Silene and one Dianthus species as outgroup. All sequences and annotations have been deposited in a newly developed and publicly available database called SiESTa, the Silene EST annotation database. Results A total of 1,041,122 EST reads were generated in two runs on a Roche GS-FLX 454 pyrosequencing platform. EST reads were analyzed separately for all eight individuals sequenced and were assembled into contigs using TGICL. These were annotated with results from BLASTX searches and Gene Ontology (GO) terms, and thousands of single-nucleotide polymorphisms (SNPs) were characterized. Unassembled reads were kept as singletons and together with the contigs contributed to the unigenes characterized in each individual. The high quality of unigenes is evidenced by the proportion (49%) that have significant hits in similarity searches with the A. thaliana proteome. The SiESTa database is accessible at http://www.siesta.ethz.ch. Conclusion The sequence collections established in the present study provide an important genomic resource for four Silene and one Dianthus species and will help to further develop Silene as a plant model system. The genes characterized will be useful for future research not only in the species included in the present study, but also in related species for which no genomic resources are yet available. Our results demonstrate the efficiency of massively parallel transcriptome sequencing in a comparative framework as an approach for developing genomic resources in diverse groups of non-model organisms. PMID:21791039

Microsatellite analysis in the genome of Acanthaceae: An in silico approach.

PubMed

Kaliswamy, Priyadharsini; Vellingiri, Srividhya; Nathan, Bharathi; Selvaraj, Saravanakumar

2015-01-01

Acanthaceae is one of the advanced and specialized families with conventionally used medicinal plants. Simple sequence repeats (SSRs) play a major role as molecular markers for genome analysis and plant breeding. The microsatellites existing in the complete genome sequences would help to attain a direct role in the genome organization, recombination, gene regulation, quantitative genetic variation, and evolution of genes. The current study reports the frequency of microsatellites and appropriate markers for the Acanthaceae family genome sequences. The whole nucleotide sequences of Acanthaceae species were obtained from National Center for Biotechnology Information database and screened for the presence of SSRs. SSR Locator tool was used to predict the microsatellites and inbuilt Primer3 module was used for primer designing. Totally 110 repeats from 108 sequences of Acanthaceae family plant genomes were identified, and the occurrence of dinucleotide repeats was found to be abundant in the genome sequences. The essential amino acid isoleucine was found rich in all the sequences. We also designed the SSR-based primers/markers for 59 sequences of this family that contains microsatellite repeats in their genome. The identified microsatellites and primers might be useful for breeding and genetic studies of plants that belong to Acanthaceae family in the future.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Development of an aquatic pathogen database (AquaPathogen X) and its utilization in tracking emerging fish virus pathogens in North America

USGS Publications Warehouse

Emmenegger, E.J.; Kentop, E.; Thompson, T.M.; Pittam, S.; Ryan, A.; Keon, D.; Carlino, J.A.; Ranson, J.; Life, R.B.; Troyer, R.M.; Garver, K.A.; Kurath, G.

2011-01-01

The AquaPathogen X database is a template for recording information on individual isolates of aquatic pathogens and is freely available for download (http://wfrc.usgs.gov). This database can accommodate the nucleotide sequence data generated in molecular epidemiological studies along with the myriad of abiotic and biotic traits associated with isolates of various pathogens (e.g. viruses, parasites and bacteria) from multiple aquatic animal host species (e.g. fish, shellfish and shrimp). The cataloguing of isolates from different aquatic pathogens simultaneously is a unique feature to the AquaPathogen X database, which can be used in surveillance of emerging aquatic animal diseases and elucidation of key risk factors associated with pathogen incursions into new water systems. An application of the template database that stores the epidemiological profiles of fish virus isolates, called Fish ViroTrak, was also developed. Exported records for two aquatic rhabdovirus species emerging in North America were used in the implementation of two separate web-accessible databases: the Molecular Epidemiology of Aquatic Pathogens infectious haematopoietic necrosis virus (MEAP-IHNV) database (http://gis.nacse.org/ihnv/) released in 2006 and the MEAP- viral haemorrhagic septicaemia virus (http://gis.nacse.org/vhsv/) database released in 2010.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

PubMed

Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

2018-01-01

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity within each population. We also provide functional annotation based on the genome position of each SNP and evaluate the use of clonal lines for filtering of PSVs and MSVs. These SNPs form a new database, which provides an important resource for a new high density SNP array design and for other SNP genotyping platforms used for genetic and genomics studies of this iconic salmonid fish species.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

sapFinder: an R/Bioconductor package for detection of variant peptides in shotgun proteomics experiments.

PubMed

Wen, Bo; Xu, Shaohang; Sheynkman, Gloria M; Feng, Qiang; Lin, Liang; Wang, Quanhui; Xu, Xun; Wang, Jun; Liu, Siqi

2014-11-01

Single nucleotide variations (SNVs) located within a reading frame can result in single amino acid polymorphisms (SAPs), leading to alteration of the corresponding amino acid sequence as well as function of a protein. Accurate detection of SAPs is an important issue in proteomic analysis at the experimental and bioinformatic level. Herein, we present sapFinder, an R software package, for detection of the variant peptides based on tandem mass spectrometry (MS/MS)-based proteomics data. This package automates the construction of variation-associated databases from public SNV repositories or sample-specific next-generation sequencing (NGS) data and the identification of SAPs through database searching, post-processing and generation of HTML-based report with visualized interface. sapFinder is implemented as a Bioconductor package in R. The package and the vignette can be downloaded at http://bioconductor.org/packages/devel/bioc/html/sapFinder.html and are provided under a GPL-2 license. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

Gene Expression Profiling Reveals Functional Specialization along the Intestinal Tract of a Carnivorous Teleostean Fish (Dicentrarchus labrax)

PubMed Central

Calduch-Giner, Josep A.; Sitjà-Bobadilla, Ariadna; Pérez-Sánchez, Jaume

2016-01-01

High-quality sequencing reads from the intestine of European sea bass were assembled, annotated by similarity against protein reference databases and combined with nucleotide sequences from public and private databases. After redundancy filtering, 24,906 non-redundant annotated sequences encoding 15,367 different gene descriptions were obtained. These annotated sequences were used to design a custom, high-density oligo-microarray (8 × 15 K) for the transcriptomic profiling of anterior (AI), middle (MI), and posterior (PI) intestinal segments. Similar molecular signatures were found for AI and MI segments, which were combined in a single group (AI-MI) whereas the PI outstood separately, with more than 1900 differentially expressed genes with a fold-change cutoff of 2. Functional analysis revealed that molecular and cellular functions related to feed digestion and nutrient absorption and transport were over-represented in AI-MI segments. By contrast, the initiation and establishment of immune defense mechanisms became especially relevant in PI, although the microarray expression profiling validated by qPCR indicated that these functional changes are gradual from anterior to posterior intestinal segments. This functional divergence occurred in association with spatial transcriptional changes in nutrient transporters and the mucosal chemosensing system via G protein-coupled receptors. These findings contribute to identify key indicators of gut functions and to compare different fish feeding strategies and immune defense mechanisms acquired along the evolution of teleosts. PMID:27610085

Gene Expression Profiling Reveals Functional Specialization along the Intestinal Tract of a Carnivorous Teleostean Fish (Dicentrarchus labrax).

PubMed

Calduch-Giner, Josep A; Sitjà-Bobadilla, Ariadna; Pérez-Sánchez, Jaume

2016-01-01

High-quality sequencing reads from the intestine of European sea bass were assembled, annotated by similarity against protein reference databases and combined with nucleotide sequences from public and private databases. After redundancy filtering, 24,906 non-redundant annotated sequences encoding 15,367 different gene descriptions were obtained. These annotated sequences were used to design a custom, high-density oligo-microarray (8 × 15 K) for the transcriptomic profiling of anterior (AI), middle (MI), and posterior (PI) intestinal segments. Similar molecular signatures were found for AI and MI segments, which were combined in a single group (AI-MI) whereas the PI outstood separately, with more than 1900 differentially expressed genes with a fold-change cutoff of 2. Functional analysis revealed that molecular and cellular functions related to feed digestion and nutrient absorption and transport were over-represented in AI-MI segments. By contrast, the initiation and establishment of immune defense mechanisms became especially relevant in PI, although the microarray expression profiling validated by qPCR indicated that these functional changes are gradual from anterior to posterior intestinal segments. This functional divergence occurred in association with spatial transcriptional changes in nutrient transporters and the mucosal chemosensing system via G protein-coupled receptors. These findings contribute to identify key indicators of gut functions and to compare different fish feeding strategies and immune defense mechanisms acquired along the evolution of teleosts.

Sequence homology between HLA-bound cytomegalovirus and human peptides: A potential trigger for alloreactivity

PubMed Central

Koparde, Vishal N.; Jameson-Lee, Maximilian; Elnasseh, Abdelrhman G.; Scalora, Allison F.; Kobulnicky, David J.; Serrano, Myrna G.; Roberts, Catherine H.; Buck, Gregory A.; Neale, Michael C.; Nixon, Daniel E.; Toor, Amir A.

2017-01-01

Human cytomegalovirus (hCMV) reactivation may often coincide with the development of graft-versus-host-disease (GVHD) in stem cell transplantation (SCT). Seventy seven SCT donor-recipient pairs (DRP) (HLA matched unrelated donor (MUD), n = 50; matched related donor (MRD), n = 27) underwent whole exome sequencing to identify single nucleotide polymorphisms (SNPs) generating alloreactive peptide libraries for each DRP (9-mer peptide-HLA complexes); Human CMV CROSS (Cross-Reactive Open Source Sequence) database was compiled from NCBI; HLA class I binding affinity for each DRPs HLA was calculated by NetMHCpan 2.8 and hCMV- derived 9-mers algorithmically compared to the alloreactive peptide-HLA complex libraries. Short consecutive (≥6) amino acid (AA) sequence homology matching hCMV to recipient peptides was considered for HLA-bound-peptide (IC50<500nM) cross reactivity. Of the 70,686 hCMV 9-mers contained within the hCMV CROSS database, an average of 29,658 matched the MRD DRP alloreactive peptides and 52,910 matched MUD DRP peptides (p<0.001). In silico analysis revealed multiple high affinity, immunogenic CMV-Human peptide matches (IC50<500 nM) expressed in GVHD-affected tissue-specific manner. hCMV+GVHD was found in 18 patients, 13 developing hCMV viremia before GVHD onset. Analysis of patients with GVHD identified potential cross reactive peptide expression within affected organs. We propose that hCMV peptide sequence homology with human alloreactive peptides may contribute to the pathophysiology of GVHD. PMID:28800601

Sequence homology between HLA-bound cytomegalovirus and human peptides: A potential trigger for alloreactivity.

PubMed

Hall, Charles E; Koparde, Vishal N; Jameson-Lee, Maximilian; Elnasseh, Abdelrhman G; Scalora, Allison F; Kobulnicky, David J; Serrano, Myrna G; Roberts, Catherine H; Buck, Gregory A; Neale, Michael C; Nixon, Daniel E; Toor, Amir A

2017-01-01

Human cytomegalovirus (hCMV) reactivation may often coincide with the development of graft-versus-host-disease (GVHD) in stem cell transplantation (SCT). Seventy seven SCT donor-recipient pairs (DRP) (HLA matched unrelated donor (MUD), n = 50; matched related donor (MRD), n = 27) underwent whole exome sequencing to identify single nucleotide polymorphisms (SNPs) generating alloreactive peptide libraries for each DRP (9-mer peptide-HLA complexes); Human CMV CROSS (Cross-Reactive Open Source Sequence) database was compiled from NCBI; HLA class I binding affinity for each DRPs HLA was calculated by NetMHCpan 2.8 and hCMV- derived 9-mers algorithmically compared to the alloreactive peptide-HLA complex libraries. Short consecutive (≥6) amino acid (AA) sequence homology matching hCMV to recipient peptides was considered for HLA-bound-peptide (IC50<500nM) cross reactivity. Of the 70,686 hCMV 9-mers contained within the hCMV CROSS database, an average of 29,658 matched the MRD DRP alloreactive peptides and 52,910 matched MUD DRP peptides (p<0.001). In silico analysis revealed multiple high affinity, immunogenic CMV-Human peptide matches (IC50<500 nM) expressed in GVHD-affected tissue-specific manner. hCMV+GVHD was found in 18 patients, 13 developing hCMV viremia before GVHD onset. Analysis of patients with GVHD identified potential cross reactive peptide expression within affected organs. We propose that hCMV peptide sequence homology with human alloreactive peptides may contribute to the pathophysiology of GVHD.

Insilico profiling of microRNAs in Korean ginseng (Panax ginseng Meyer)

PubMed Central

Mathiyalagan, Ramya; Subramaniyam, Sathiyamoorthy; Natarajan, Sathishkumar; Kim, Yeon Ju; Sun, Myung Suk; Kim, Se Young; Kim, Yu-Jin; Yang, Deok Chun

2013-01-01

MicroRNAs (miRNAs) are a class of recently discovered non-coding small RNA molecules, on average approximately 21 nucleotides in length, which underlie numerous important biological roles in gene regulation in various organisms. The miRNA database (release 18) has 18,226 miRNAs, which have been deposited from different species. Although miRNAs have been identified and validated in many plant species, no studies have been reported on discovering miRNAs in Panax ginseng Meyer, which is a traditionally known medicinal plant in oriental medicine, also known as Korean ginseng. It has triterpene ginseng saponins called ginsenosides, which are responsible for its various pharmacological activities. Predicting conserved miRNAs by homology-based analysis with available expressed sequence tag (EST) sequences can be powerful, if the species lacks whole genome sequence information. In this study by using the EST based computational approach, 69 conserved miRNAs belonging to 44 miRNA families were identified in Korean ginseng. The digital gene expression patterns of predicted conserved miRNAs were analyzed by deep sequencing using small RNA sequences of flower buds, leaves, and lateral roots. We have found that many of the identified miRNAs showed tissue specific expressions. Using the insilico method, 346 potential targets were identified for the predicted 69 conserved miRNAs by searching the ginseng EST database, and the predicted targets were mainly involved in secondary metabolic processes, responses to biotic and abiotic stress, and transcription regulator activities, as well as a variety of other metabolic processes. PMID:23717176

Fungal genome resources at NCBI.

PubMed

Robbertse, B; Tatusova, T

2011-09-01

The National Center for Biotechnology Information (NCBI) is well known for the nucleotide sequence archive, GenBank and sequence analysis tool BLAST. However, NCBI integrates many types of biomolecular data from variety of sources and makes it available to the scientific community as interactive web resources as well as organized releases of bulk data. These tools are available to explore and compare fungal genomes. Searching all databases with Fungi [organism] at http://www.ncbi.nlm.nih.gov/ is the quickest way to find resources of interest with fungal entries. Some tools though are resources specific and can be indirectly accessed from a particular database in the Entrez system. These include graphical viewers and comparative analysis tools such as TaxPlot, TaxMap and UniGene DDD (found via UniGene Homepage). Gene and BioProject pages also serve as portals to external data such as community annotation websites, BioGrid and UniProt. There are many different ways of accessing genomic data at NCBI. Depending on the focus and goal of research projects or the level of interest, a user would select a particular route for accessing genomic databases and resources. This review article describes methods of accessing fungal genome data and provides examples that illustrate the use of analysis tools.

ExDom: an integrated database for comparative analysis of the exon–intron structures of protein domains in eukaryotes

PubMed Central

Bhasi, Ashwini; Philip, Philge; Manikandan, Vinu; Senapathy, Periannan

2009-01-01

We have developed ExDom, a unique database for the comparative analysis of the exon–intron structures of 96 680 protein domains from seven eukaryotic organisms (Homo sapiens, Mus musculus, Bos taurus, Rattus norvegicus, Danio rerio, Gallus gallus and Arabidopsis thaliana). ExDom provides integrated access to exon-domain data through a sophisticated web interface which has the following analytical capabilities: (i) intergenomic and intragenomic comparative analysis of exon–intron structure of domains; (ii) color-coded graphical display of the domain architecture of proteins correlated with their corresponding exon-intron structures; (iii) graphical analysis of multiple sequence alignments of amino acid and coding nucleotide sequences of homologous protein domains from seven organisms; (iv) comparative graphical display of exon distributions within the tertiary structures of protein domains; and (v) visualization of exon–intron structures of alternative transcripts of a gene correlated to variations in the domain architecture of corresponding protein isoforms. These novel analytical features are highly suited for detailed investigations on the exon–intron structure of domains and make ExDom a powerful tool for exploring several key questions concerning the function, origin and evolution of genes and proteins. ExDom database is freely accessible at: http://66.170.16.154/ExDom/. PMID:18984624

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling

PubMed Central

Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien

2012-01-01

The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

Molecular typing and characterization of a new serotype of human enterovirus (EV-B111) identified in China.

PubMed

Zhang, Yong; Hong, Mei; Sun, Qiang; Zhu, Shuangli; Tsewang; Li, Xiaolei; Yan, Dongmei; Wang, Dongyan; Xu, Wenbo

2014-04-01

Molecular methods, based on sequencing the region encoding the complete VP1 or P1 protein, have enabled the rapid identification of new enterovirus serotypes. In the present study, the complete genome of a newly discovered enterovirus serotype, strain Q0011/XZ/CHN/2000 (hereafter referred to as Q0011), was sequenced and analyzed. The virus, isolated from a stool sample from a patient with acute flaccid paralysis in the Tibet region of China in 2000, was characterized by amplicon sequencing and comparison to a GenBank database of enterovirus nucleotide sequences. The nucleotide sequence encoding the complete VP1 capsid protein is most closely related to the sequences of viruses within the species enterovirus B (EV-B), but is less than 72.1% identical to the homologous sequences of the recognized human enterovirus serotypes, with the greatest homology to EV-B101 and echovirus 32. Moreover, the deduced amino acid sequence of the complete VP1 region is less than 84.7% identical to those of the recognized serotypes, suggesting that the strain is a new serotype of enterovirus within EV-B. The virus was characterized as a new enterovirus type, named EV-B111, by the Picornaviridae Study Group of the International Committee on Taxonomy of Viruses. Low positive rate and titer of neutralizing antibody against EV-B111 were found in the Tibet region of China. Nearly 50% of children ≤5 years had no neutralizing antibody against EV-B111. So the extent of transmission and the exposure of the population to this new EV are very limited. This is the first identification of a new serotype of human enterovirus in China, and strain Q0011 was designated the prototype strain of EV-B111. Copyright © 2014 Elsevier B.V. All rights reserved.

Microbe-ID: an open source toolbox for microbial genotyping and species identification

PubMed Central

Tabima, Javier F.; Everhart, Sydney E.; Larsen, Meredith M.; Weisberg, Alexandra J.; Kamvar, Zhian N.; Tancos, Matthew A.; Smart, Christine D.; Chang, Jeff H.

2016-01-01

Development of tools to identify species, genotypes, or novel strains of invasive organisms is critical for monitoring emergence and implementing rapid response measures. Molecular markers, although critical to identifying species or genotypes, require bioinformatic tools for analysis. However, user-friendly analytical tools for fast identification are not readily available. To address this need, we created a web-based set of applications called Microbe-ID that allow for customizing a toolbox for rapid species identification and strain genotyping using any genetic markers of choice. Two components of Microbe-ID, named Sequence-ID and Genotype-ID, implement species and genotype identification, respectively. Sequence-ID allows identification of species by using BLAST to query sequences for any locus of interest against a custom reference sequence database. Genotype-ID allows placement of an unknown multilocus marker in either a minimum spanning network or dendrogram with bootstrap support from a user-created reference database. Microbe-ID can be used for identification of any organism based on nucleotide sequences or any molecular marker type and several examples are provided. We created a public website for demonstration purposes called Microbe-ID (microbe-id.org) and provided a working implementation for the genus Phytophthora (phytophthora-id.org). In Phytophthora-ID, the Sequence-ID application allows identification based on ITS or cox spacer sequences. Genotype-ID groups individuals into clonal lineages based on simple sequence repeat (SSR) markers for the two invasive plant pathogen species P. infestans and P. ramorum. All code is open source and available on github and CRAN. Instructions for installation and use are provided at https://github.com/grunwaldlab/Microbe-ID. PMID:27602267

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

India Allele Finder: a web-based annotation tool for identifying common alleles in next-generation sequencing data of Indian origin.

PubMed

Zhang, Jimmy F; James, Francis; Shukla, Anju; Girisha, Katta M; Paciorkowski, Alex R

2017-06-27

We built India Allele Finder, an online searchable database and command line tool, that gives researchers access to variant frequencies of Indian Telugu individuals, using publicly available fastq data from the 1000 Genomes Project. Access to appropriate population-based genomic variant annotation can accelerate the interpretation of genomic sequencing data. In particular, exome analysis of individuals of Indian descent will identify population variants not reflected in European exomes, complicating genomic analysis for such individuals. India Allele Finder offers improved ease-of-use to investigators seeking to identify and annotate sequencing data from Indian populations. We describe the use of India Allele Finder to identify common population variants in a disease quartet whole exome dataset, reducing the number of candidate single nucleotide variants from 84 to 7. India Allele Finder is freely available to investigators to annotate genomic sequencing data from Indian populations. Use of India Allele Finder allows efficient identification of population variants in genomic sequencing data, and is an example of a population-specific annotation tool that simplifies analysis and encourages international collaboration in genomics research.

Transcription Factor Map Alignment of Promoter Regions

PubMed Central

Blanco, Enrique; Messeguer, Xavier; Smith, Temple F; Guigó, Roderic

2006-01-01

We address the problem of comparing and characterizing the promoter regions of genes with similar expression patterns. This remains a challenging problem in sequence analysis, because often the promoter regions of co-expressed genes do not show discernible sequence conservation. In our approach, thus, we have not directly compared the nucleotide sequence of promoters. Instead, we have obtained predictions of transcription factor binding sites, annotated the predicted sites with the labels of the corresponding binding factors, and aligned the resulting sequences of labels—to which we refer here as transcription factor maps (TF-maps). To obtain the global pairwise alignment of two TF-maps, we have adapted an algorithm initially developed to align restriction enzyme maps. We have optimized the parameters of the algorithm in a small, but well-curated, collection of human–mouse orthologous gene pairs. Results in this dataset, as well as in an independent much larger dataset from the CISRED database, indicate that TF-map alignments are able to uncover conserved regulatory elements, which cannot be detected by the typical sequence alignments. PMID:16733547

Molecular identification of poisonous mushrooms using nuclear ITS region and peptide toxins: a retrospective study on fatal cases in Thailand.

PubMed

Parnmen, Sittiporn; Sikaphan, Sujitra; Leudang, Siriwan; Boonpratuang, Thitiya; Rangsiruji, Achariya; Naksuwankul, Khwanruan

2016-02-01

Cases of mushroom poisoning in Thailand have increased annually. During 2008 to 2014, the cases reported to the National Institute of Health included 57 deaths; at least 15 died after ingestion of amanitas, the most common lethal wild mushrooms inhabited. Hence, the aims of this study were to identify mushroom samples from nine clinically reported cases during the 7-year study period based on nuclear ITS sequence data and diagnose lethal peptide toxins using a reversed phase LC-MS method. Nucleotide similarity was identified using BLAST search of the NCBI database and the Barcode of Life Database (BOLD). Clade characterization was performed by maximum likelihood and Bayesian phylogenetic approaches. Based on BLAST and BOLD reference databases our results yielded high nucleotide similarities of poisonous mushroom samples to A. exitialis and A. fuliginea. Detailed phylogenetic analyses showed that all mushroom samples fall into their current classification. Detection of the peptide toxins revealed the presence of amatoxins and phallotoxins in A. exitialis and A. fuliginea. In addition, toxic α-amanitin was identified in a new provisional species, Amanita sp.1, with the highest toxin quantity. Molecular identification confirmed that the mushrooms ingested by the patients were members of the lethal amanitas in the sections Amanita and Phalloideae. In Thailand, the presence of A. exitialis was reported here for the first time and all three poisonous mushroom species provided new and informative data for clinical studies.

Evolution of Fseg/Cseg dimorphism in region III of the Plasmodium falciparum eba-175 gene.

PubMed

Yasukochi, Yoshiki; Naka, Izumi; Patarapotikul, Jintana; Hananantachai, Hathairad; Ohashi, Jun

2017-04-01

The 175-kDa erythrocyte binding antigen (EBA-175) of the malaria parasite Plasmodium falciparum is important for its invasion into human erythrocytes. The primary structure of eba-175 is divided into seven regions, namely I to VII. Region III contains highly divergent dimorphic segments, termed Fseg and Cseg. The allele frequencies of segmental dimorphism within a P. falciparum population have been extensively examined; however, the molecular evolution of segmental dimorphism is not well understood. A comprehensive comparison of nucleotide sequences among 32 P. falciparum eba-175 alleles identified in our previous study, two Plasmodium reichenowi, and one P. gaboni orthologous alleles obtained from the GenBank database was conducted to uncover the origin and evolutionary processes of segmental dimorphism in P. falciparum eba-175. In the eba-175 nucleotide sequence derived from a P. reichenowi CDC strain, both Fseg and Cseg were found in region III, which implies that the original eba-175 gene had both segments, and deletions of F- and C-segments generated Cseg and Fseg alleles, respectively. We also confirmed the presence of allele with Fseg and Cseg in another P. reichenowi strain (SY57), by re-mapping short reads obtained from the GenBank database. On the other hand, the segmental sequence of eba-175 ortholog in P. gaboni was quite diverged from those of the other species, suggesting that the original eba-175 dimorphism of P. falciparum can be traced back to the stem linage of P. falciparum and P. reichenowi. Our findings suggest that Fseg and Cseg alleles are derived from a single eba-175 allele containing both segments in the ancestral population of P. falciparum and P. reichenowi, and that the allelic dimorphism of eba-175 was shaped by the independent emergence of similar dimorphic lineage in different species that has never been observed in any evolutionary mode of allelic dimorphism at other loci in malaria genomes. Copyright © 2017 Elsevier B.V. All rights reserved.

HIV drug resistance testing among patients failing second line antiretroviral therapy. Comparison of in-house and commercial sequencing.

PubMed

Chimukangara, Benjamin; Varyani, Bhavini; Shamu, Tinei; Mutsvangwa, Junior; Manasa, Justen; White, Elizabeth; Chimbetete, Cleophas; Luethy, Ruedi; Katzenstein, David

2017-05-01

HIV genotyping is often unavailable in low and middle-income countries due to infrastructure requirements and cost. We compared genotype resistance testing in patients with virologic failure, by amplification of HIV pol gene, followed by "in-house" sequencing and commercial sequencing. Remnant plasma samples from adults and children failing second-line ART were amplified and sequenced using in-house and commercial di-deoxysequencing, and analyzed in Harare, Zimbabwe and at Stanford, U.S.A, respectively. HIV drug resistance mutations were determined using the Stanford HIV drug resistance database. Twenty-six of 28 samples were amplified and 25 were successfully genotyped. Comparison of average percent nucleotide and amino acid identities between 23 pairs sequenced in both laboratories were 99.51 (±0.56) and 99.11 (±0.95), respectively. All pairs clustered together in phylogenetic analysis. Sequencing analysis identified 6/23 pairs with mutation discordances resulting in differences in phenotype, but these did not impact future regimens. The results demonstrate our ability to produce good quality drug resistance data in-house. Despite discordant mutations in some sequence pairs, the phenotypic predictions were not clinically significant. Copyright © 2016 Elsevier B.V. All rights reserved.

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

Accessing and distributing EMBL data using CORBA (common object request broker architecture).

PubMed

Wang, L; Rodriguez-Tomé, P; Redaschi, N; McNeil, P; Robinson, A; Lijnzaad, P

2000-01-01

The EMBL Nucleotide Sequence Database is a comprehensive database of DNA and RNA sequences and related information traditionally made available in flat-file format. Queries through tools such as SRS (Sequence Retrieval System) also return data in flat-file format. Flat files have a number of shortcomings, however, and the resources therefore currently lack a flexible environment to meet individual researchers' needs. The Object Management Group's common object request broker architecture (CORBA) is an industry standard that provides platform-independent programming interfaces and models for portable distributed object-oriented computing applications. Its independence from programming languages, computing platforms and network protocols makes it attractive for developing new applications for querying and distributing biological data. A CORBA infrastructure developed by EMBL-EBI provides an efficient means of accessing and distributing EMBL data. The EMBL object model is defined such that it provides a basis for specifying interfaces in interface definition language (IDL) and thus for developing the CORBA servers. The mapping from the object model to the relational schema in the underlying Oracle database uses the facilities provided by PersistenceTM, an object/relational tool. The techniques of developing loaders and 'live object caching' with persistent objects achieve a smart live object cache where objects are created on demand. The objects are managed by an evictor pattern mechanism. The CORBA interfaces to the EMBL database address some of the problems of traditional flat-file formats and provide an efficient means for accessing and distributing EMBL data. CORBA also provides a flexible environment for users to develop their applications by building clients to our CORBA servers, which can be integrated into existing systems.

Accessing and distributing EMBL data using CORBA (common object request broker architecture)

PubMed Central

Wang, Lichun; Rodriguez-Tomé, Patricia; Redaschi, Nicole; McNeil, Phil; Robinson, Alan; Lijnzaad, Philip

2000-01-01

Background: The EMBL Nucleotide Sequence Database is a comprehensive database of DNA and RNA sequences and related information traditionally made available in flat-file format. Queries through tools such as SRS (Sequence Retrieval System) also return data in flat-file format. Flat files have a number of shortcomings, however, and the resources therefore currently lack a flexible environment to meet individual researchers' needs. The Object Management Group's common object request broker architecture (CORBA) is an industry standard that provides platform-independent programming interfaces and models for portable distributed object-oriented computing applications. Its independence from programming languages, computing platforms and network protocols makes it attractive for developing new applications for querying and distributing biological data. Results: A CORBA infrastructure developed by EMBL-EBI provides an efficient means of accessing and distributing EMBL data. The EMBL object model is defined such that it provides a basis for specifying interfaces in interface definition language (IDL) and thus for developing the CORBA servers. The mapping from the object model to the relational schema in the underlying Oracle database uses the facilities provided by PersistenceTM, an object/relational tool. The techniques of developing loaders and 'live object caching' with persistent objects achieve a smart live object cache where objects are created on demand. The objects are managed by an evictor pattern mechanism. Conclusions: The CORBA interfaces to the EMBL database address some of the problems of traditional flat-file formats and provide an efficient means for accessing and distributing EMBL data. CORBA also provides a flexible environment for users to develop their applications by building clients to our CORBA servers, which can be integrated into existing systems. PMID:11178259

G-Boxes, Bigfoot Genes, and Environmental Response: Characterization of Intragenomic Conserved Noncoding Sequences in Arabidopsis[W

PubMed Central

Freeling, Michael; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Thomas, Brian C.

2007-01-01

A tetraploidy left Arabidopsis thaliana with 6358 pairs of homoeologs that, when aligned, generated 14,944 intragenomic conserved noncoding sequences (CNSs). Our previous work assembled these phylogenetic footprints into a database. We show that known transcription factor (TF) binding motifs, including the G-box, are overrepresented in these CNSs. A total of 254 genes spanning long lengths of CNS-rich chromosomes (Bigfoot) dominate this database. Therefore, we made subdatabases: one containing Bigfoot genes and the other containing genes with three to five CNSs (Smallfoot). Bigfoot genes are generally TFs that respond to signals, with their modal CNS positioned 3.1 kb 5′ from the ATG. Smallfoot genes encode components of signal transduction machinery, the cytoskeleton, or involve transcription. We queried each subdatabase with each possible 7-nucleotide sequence. Among hundreds of hits, most were purified from CNSs, and almost all of those significantly enriched in CNSs had no experimental history. The 7-mers in CNSs are not 5′- to 3′-oriented in Bigfoot genes but are often oriented in Smallfoot genes. CNSs with one G-box tend to have two G-boxes. CNSs were shared with the homoeolog only and with no other gene, suggesting that binding site turnover impedes detection. Bigfoot genes may function in adaptation to environmental change. PMID:17496117

G-boxes, bigfoot genes, and environmental response: characterization of intragenomic conserved noncoding sequences in Arabidopsis.

PubMed

Freeling, Michael; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Thomas, Brian C

2007-05-01

A tetraploidy left Arabidopsis thaliana with 6358 pairs of homoeologs that, when aligned, generated 14,944 intragenomic conserved noncoding sequences (CNSs). Our previous work assembled these phylogenetic footprints into a database. We show that known transcription factor (TF) binding motifs, including the G-box, are overrepresented in these CNSs. A total of 254 genes spanning long lengths of CNS-rich chromosomes (Bigfoot) dominate this database. Therefore, we made subdatabases: one containing Bigfoot genes and the other containing genes with three to five CNSs (Smallfoot). Bigfoot genes are generally TFs that respond to signals, with their modal CNS positioned 3.1 kb 5' from the ATG. Smallfoot genes encode components of signal transduction machinery, the cytoskeleton, or involve transcription. We queried each subdatabase with each possible 7-nucleotide sequence. Among hundreds of hits, most were purified from CNSs, and almost all of those significantly enriched in CNSs had no experimental history. The 7-mers in CNSs are not 5'- to 3'-oriented in Bigfoot genes but are often oriented in Smallfoot genes. CNSs with one G-box tend to have two G-boxes. CNSs were shared with the homoeolog only and with no other gene, suggesting that binding site turnover impedes detection. Bigfoot genes may function in adaptation to environmental change.

Archaeon and archaeal virus diversity classification via sequence entropy and fractal dimension

NASA Astrophysics Data System (ADS)

Tremberger, George, Jr.; Gallardo, Victor; Espinoza, Carola; Holden, Todd; Gadura, N.; Cheung, E.; Schneider, P.; Lieberman, D.; Cheung, T.

2010-09-01

Archaea are important potential candidates in astrobiology as their metabolism includes solar, inorganic and organic energy sources. Archaeal viruses would also be expected to be present in a sustainable archaeal exobiological community. Genetic sequence Shannon entropy and fractal dimension can be used to establish a two-dimensional measure for classification and phylogenetic study of these organisms. A sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. Archaeal 16S and 23S ribosomal RNA sequences were studied. Outliers in the 16S rRNA fractal dimension and entropy plot were found to be halophilic archaea. Positive correlation (R-square ~ 0.75, N = 18) was observed between fractal dimension and entropy across the studied species. The 16S ribosomal RNA sequence entropy correlates with the 23S ribosomal RNA sequence entropy across species with R-square 0.93, N = 18. Entropy values correspond positively with branch lengths of a published phylogeny. The studied archaeal virus sequences have high fractal dimensions of 2.02 or more. A comparison of selected extremophile sequences with archaeal sequences from the Humboldt Marine Ecosystem database (Wood-Hull Oceanography Institute, MIT) suggests the presence of continuous sequence expression as inferred from distributions of entropy and fractal dimension, consistent with the diversity expected in an exobiological archaeal community.

SeqReporter: automating next-generation sequencing result interpretation and reporting workflow in a clinical laboratory.

PubMed

Roy, Somak; Durso, Mary Beth; Wald, Abigail; Nikiforov, Yuri E; Nikiforova, Marina N

2014-01-01

A wide repertoire of bioinformatics applications exist for next-generation sequencing data analysis; however, certain requirements of the clinical molecular laboratory limit their use: i) comprehensive report generation, ii) compatibility with existing laboratory information systems and computer operating system, iii) knowledgebase development, iv) quality management, and v) data security. SeqReporter is a web-based application developed using ASP.NET framework version 4.0. The client-side was designed using HTML5, CSS3, and Javascript. The server-side processing (VB.NET) relied on interaction with a customized SQL server 2008 R2 database. Overall, 104 cases (1062 variant calls) were analyzed by SeqReporter. Each variant call was classified into one of five report levels: i) known clinical significance, ii) uncertain clinical significance, iii) pending pathologists' review, iv) synonymous and deep intronic, and v) platform and panel-specific sequence errors. SeqReporter correctly annotated and classified 99.9% (859 of 860) of sequence variants, including 68.7% synonymous single-nucleotide variants, 28.3% nonsynonymous single-nucleotide variants, 1.7% insertions, and 1.3% deletions. One variant of potential clinical significance was re-classified after pathologist review. Laboratory information system-compatible clinical reports were generated automatically. SeqReporter also facilitated quality management activities. SeqReporter is an example of a customized and well-designed informatics solution to optimize and automate the downstream analysis of clinical next-generation sequencing data. We propose it as a model that may envisage the development of a comprehensive clinical informatics solution. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Mitochondrial DNA variant at HVI region as a candidate of genetic markers of type 2 diabetes

NASA Astrophysics Data System (ADS)

Gumilar, Gun Gun; Purnamasari, Yunita; Setiadi, Rahmat

2016-02-01

Mitochondrial DNA (mtDNA) is maternally inherited. mtDNA mutations which can contribute to the excess of maternal inheritance of type 2 diabetes. Due to the high mutation rate, one of the areas in the mtDNA that is often associated with the disease is the hypervariable region I (HVI). Therefore, this study was conducted to determine the genetic variants of human mtDNA HVI that related to the type 2 diabetes in four samples that were taken from four generations in one lineage. Steps being taken include the lyses of hair follicles, amplification of mtDNA HVI fragment using Polymerase Chain Reaction (PCR), detection of PCR products through agarose gel electrophoresis technique, the measurement of the concentration of mtDNA using UV-Vis spectrophotometer, determination of the nucleotide sequence via direct sequencing method and analysis of the sequencing results using SeqMan DNASTAR program. Based on the comparison between nucleotide sequence of samples and revised Cambridge Reference Sequence (rCRS) obtained six same mutations that these are C16147T, T16189C, C16193del, T16127C, A16235G, and A16293C. After comparing the data obtained to the secondary data from Mitomap and NCBI, it were found that two mutations, T16189C and T16217C, become candidates as genetic markers of type 2 diabetes even the mutations were found also in the generations of undiagnosed type 2 diabetes. The results of this study are expected to give contribution to the collection of human mtDNA database of genetic variants that associated to metabolic diseases, so that in the future it can be utilized in various fields, especially in medicine.

Exome capture sequencing identifies a novel mutation in BBS4

PubMed Central

Wang, Hui; Chen, Xianfeng; Dudinsky, Lynn; Patenia, Claire; Chen, Yiyun; Li, Yumei; Wei, Yue; Abboud, Emad B.; Al-Rajhi, Ali A.; Lewis, Richard Alan; Lupski, James R.; Mardon, Graeme; Gibbs, Richard A.; Perkins, Brian D.

2011-01-01

Purpose Leber congenital amaurosis (LCA) is one of the most severe eye dystrophies characterized by severe vision loss at an early stage and accounts for approximately 5% of all retinal dystrophies. The purpose of this study was to identify a novel LCA disease allele or gene and to develop an approach combining genetic mapping with whole exome sequencing. Methods Three patients from King Khaled Eye Specialist Hospital (KKESH205) underwent whole genome single nucleotide polymorphism genotyping, and a single candidate region was identified. Taking advantage of next-generation high-throughput DNA sequencing technologies, whole exome capture sequencing was performed on patient KKESH205#7. Sanger direct sequencing was used during the validation step. The zebrafish model was used to examine the function of the mutant allele. Results A novel missense mutation in Bardet-Biedl syndrome 4 protein (BBS4) was identified in a consanguineous family from Saudi Arabia. This missense mutation in the fifth exon (c.253G>C;p.E85Q) of BBS4 is likely a disease-causing mutation as it segregates with the disease. The mutation is not found in the single nucleotide polymorphism (SNP) database, the 1000 Genomes Project, or matching normal controls. Functional analysis of this mutation in zebrafish indicates that the G253C allele is pathogenic. Coinjection of the G253C allele cannot rescue the mislocalization of rhodopsin in the retina when BBS4 is knocked down by morpholino injection. Immunofluorescence analysis in cell culture shows that this missense mutation in BBS4 does not cause obvious defects in protein expression or pericentriolar localization. Conclusions This mutation likely mainly reduces or abolishes BBS4 function in the retina. Further studies of this allele will provide important insights concerning the pleiotropic nature of BBS4 function. PMID:22219648

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Transcriptome characterization and polymorphism detection between subspecies of big sagebrush (Artemisia tridentata)

PubMed Central

2011-01-01

Background Big sagebrush (Artemisia tridentata) is one of the most widely distributed and ecologically important shrub species in western North America. This species serves as a critical habitat and food resource for many animals and invertebrates. Habitat loss due to a combination of disturbances followed by establishment of invasive plant species is a serious threat to big sagebrush ecosystem sustainability. Lack of genomic data has limited our understanding of the evolutionary history and ecological adaptation in this species. Here, we report on the sequencing of expressed sequence tags (ESTs) and detection of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in subspecies of big sagebrush. Results cDNA of A. tridentata sspp. tridentata and vaseyana were normalized and sequenced using the 454 GS FLX Titanium pyrosequencing technology. Assembly of the reads resulted in 20,357 contig consensus sequences in ssp. tridentata and 20,250 contigs in ssp. vaseyana. A BLASTx search against the non-redundant (NR) protein database using 29,541 consensus sequences obtained from a combined assembly resulted in 21,436 sequences with significant blast alignments (≤ 1e-15). A total of 20,952 SNPs and 119 polymorphic SSRs were detected between the two subspecies. SNPs were validated through various methods including sequence capture. Validation of SNPs in different individuals uncovered a high level of nucleotide variation in EST sequences. EST sequences of a third, tetraploid subspecies (ssp. wyomingensis) obtained by Illumina sequencing were mapped to the consensus sequences of the combined 454 EST assembly. Approximately one-third of the SNPs between sspp. tridentata and vaseyana identified in the combined assembly were also polymorphic within the two geographically distant ssp. wyomingensis samples. Conclusion We have produced a large EST dataset for Artemisia tridentata, which contains a large sample of the big sagebrush leaf transcriptome. SNP mapping among the three subspecies suggest the origin of ssp. wyomingensis via mixed ancestry. A large number of SNP and SSR markers provide the foundation for future research to address questions in big sagebrush evolution, ecological genetics, and conservation using genomic approaches. PMID:21767398

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

Toward an integrated knowledge environment to support modern oncology.

PubMed

Blake, Patrick M; Decker, David A; Glennon, Timothy M; Liang, Yong Michael; Losko, Sascha; Navin, Nicholas; Suh, K Stephen

2011-01-01

Around the world, teams of researchers continue to develop a wide range of systems to capture, store, and analyze data including treatment, patient outcomes, tumor registries, next-generation sequencing, single-nucleotide polymorphism, copy number, gene expression, drug chemistry, drug safety, and toxicity. Scientists mine, curate, and manually annotate growing mountains of data to produce high-quality databases, while clinical information is aggregated in distant systems. Databases are currently scattered, and relationships between variables coded in disparate datasets are frequently invisible. The challenge is to evolve oncology informatics from a "systems" orientation of standalone platforms and silos into an "integrated knowledge environments" that will connect "knowable" research data with patient clinical information. The aim of this article is to review progress toward an integrated knowledge environment to support modern oncology with a focus on supporting scientific discovery and improving cancer care.

Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

PubMed

Stafuzza, Nedenia Bonvino; Zerlotini, Adhemar; Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

2017-01-01

Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds

PubMed Central

Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J.; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

2017-01-01

Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs. PMID:28323836

Molecular characterization of echovirus 30-associated outbreak of aseptic meningitis in Korea in 2008.

PubMed

Choi, Young Jin; Park, Kwi Sung; Baek, Kyoung Ah; Jung, Eun Hye; Nam, Hae Seon; Kim, Yong Bae; Park, Joon Soo

2010-03-01

Evaluation of the primary etiologic agents that cause aseptic meningitis outbreaks may provide valuable information regarding the prevention and management of aseptic meningitis. In Korea, an outbreak of aseptic meningitis caused by echovirus type 30 (E30) occurred from May to October in 2008. In order to determine the etiologic agent, CSF and/or stool specimens from 140 children hospitalized for aseptic meningitis at Soonchunhyang University Cheonan Hospital between June and October of 2008 were tested for virus isolation and identification. E30 accounted for 61.7% (37 cases) and echovirus 6 accounted for 21.7% (13 cases) of all the human enteroviruses (HEVs) isolates (60 cases in total). For the molecular characterization of the isolates, the VP1 gene sequence of 18 Korean E30 isolates was compared pairwise using the MegAlign with 34 reference strains from the GenBank database. The pairwise comparison of the nucleotide sequences of the VP1 genes demonstrated that the sequences of the Korean strains differed from those of lineage groups A, B, C, D, E, F and G. Reconstruction of the phylogenetic tree based on the complete VP1 nucleotide sequences resulted in a monophyletic tree, with eight clustered lineage groups. All Korean isolates were segregated from other lineage groups, thus suggesting that the Korean strains were a distinct lineage of E30, and a probable cause of this outbreak. This manuscript is the first report, to the best of our knowledge, of the molecular characteristics of E30 strains associated with an aseptic meningitis outbreak in Korea, and their respective phylogenetic relationships.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

Transcriptomics of the Bed Bug (Cimex lectularius)

PubMed Central

Rajarapu, Swapna P.; Jones, Susan C.; Mittapalli, Omprakash

2011-01-01

Background Bed bugs (Cimex lectularius) are blood-feeding insects poised to become one of the major pests in households throughout the United States. Resistance of C. lectularius to insecticides/pesticides is one factor thought to be involved in its sudden resurgence. Despite its high-impact status, scant knowledge exists at the genomic level for C. lectularius. Hence, we subjected the C. lectularius transcriptome to 454 pyrosequencing in order to identify potential genes involved in pesticide resistance. Methodology and Principal Findings Using 454 pyrosequencing, we obtained a total of 216,419 reads with 79,596,412 bp, which were assembled into 35,646 expressed sequence tags (3902 contigs and 31744 singletons). Nearly 85.9% of the C. lectularius sequences showed similarity to insect sequences, but 44.8% of the deduced proteins of C. lectularius did not show similarity with sequences in the GenBank non-redundant database. KEGG analysis revealed putative members of several detoxification pathways involved in pesticide resistance. Lamprin domains, Protein Kinase domains, Protein Tyrosine Kinase domains and cytochrome P450 domains were among the top Pfam domains predicted for the C. lectularius sequences. An initial assessment of putative defense genes, including a cytochrome P450 and a glutathione-S-transferase (GST), revealed high transcript levels for the cytochrome P450 (CYP9) in pesticide-exposed versus pesticide-susceptible C. lectularius populations. A significant number of single nucleotide polymorphisms (296) and microsatellite loci (370) were predicted in the C. lectularius sequences. Furthermore, 59 putative sequences of Wolbachia were retrieved from the database. Conclusions To our knowledge this is the first study to elucidate the genetic makeup of C. lectularius. This pyrosequencing effort provides clues to the identification of potential detoxification genes involved in pesticide resistance of C. lectularius and lays the foundation for future functional genomics studies. PMID:21283830

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Bijective transformation circular codes and nucleotide exchanging RNA transcription.

PubMed

Michel, Christian J; Seligmann, Hervé

2014-04-01

The C(3) self-complementary circular code X identified in genes of prokaryotes and eukaryotes is a set of 20 trinucleotides enabling reading frame retrieval and maintenance, i.e. a framing code (Arquès and Michel, 1996; Michel, 2012, 2013). Some mitochondrial RNAs correspond to DNA sequences when RNA transcription systematically exchanges between nucleotides (Seligmann, 2013a,b). We study here the 23 bijective transformation codes ΠX of X which may code nucleotide exchanging RNA transcription as suggested by this mitochondrial observation. The 23 bijective transformation codes ΠX are C(3) trinucleotide circular codes, seven of them are also self-complementary. Furthermore, several correlations are observed between the Reading Frame Retrieval (RFR) probability of bijective transformation codes ΠX and the different biological properties of ΠX related to their numbers of RNAs in GenBank's EST database, their polymerization rate, their number of amino acids and the chirality of amino acids they code. Results suggest that the circular code X with the functions of reading frame retrieval and maintenance in regular RNA transcription, may also have, through its bijective transformation codes ΠX, the same functions in nucleotide exchanging RNA transcription. Associations with properties such as amino acid chirality suggest that the RFR of X and its bijective transformations molded the origins of the genetic code's machinery. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Evolutionary conservation analysis increases the colocalization of predicted exonic splicing enhancers in the BRCA1 gene with missense sequence changes and in-frame deletions, but not polymorphisms

PubMed Central

Pettigrew, Christopher; Wayte, Nicola; Lovelock, Paul K; Tavtigian, Sean V; Chenevix-Trench, Georgia; Spurdle, Amanda B; Brown, Melissa A

2005-01-01

Introduction Aberrant pre-mRNA splicing can be more detrimental to the function of a gene than changes in the length or nature of the encoded amino acid sequence. Although predicting the effects of changes in consensus 5' and 3' splice sites near intron:exon boundaries is relatively straightforward, predicting the possible effects of changes in exonic splicing enhancers (ESEs) remains a challenge. Methods As an initial step toward determining which ESEs predicted by the web-based tool ESEfinder in the breast cancer susceptibility gene BRCA1 are likely to be functional, we have determined their evolutionary conservation and compared their location with known BRCA1 sequence variants. Results Using the default settings of ESEfinder, we initially detected 669 potential ESEs in the coding region of the BRCA1 gene. Increasing the threshold score reduced the total number to 464, while taking into consideration the proximity to splice donor and acceptor sites reduced the number to 211. Approximately 11% of these ESEs (23/211) either are identical at the nucleotide level in human, primates, mouse, cow, dog and opossum Brca1 (conserved) or are detectable by ESEfinder in the same position in the Brca1 sequence (shared). The frequency of conserved and shared predicted ESEs between human and mouse is higher in BRCA1 exons (2.8 per 100 nucleotides) than in introns (0.6 per 100 nucleotides). Of conserved or shared putative ESEs, 61% (14/23) were predicted to be affected by sequence variants reported in the Breast Cancer Information Core database. Applying the filters described above increased the colocalization of predicted ESEs with missense changes, in-frame deletions and unclassified variants predicted to be deleterious to protein function, whereas they decreased the colocalization with known polymorphisms or unclassified variants predicted to be neutral. Conclusion In this report we show that evolutionary conservation analysis may be used to improve the specificity of an ESE prediction tool. This is the first report on the prediction of the frequency and distribution of ESEs in the BRCA1 gene, and it is the first reported attempt to predict which ESEs are most likely to be functional and therefore which sequence variants in ESEs are most likely to be pathogenic. PMID:16280041

Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

PubMed

Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

2015-01-01

Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

GFinisher: a new strategy to refine and finish bacterial genome assemblies

NASA Astrophysics Data System (ADS)

Guizelini, Dieval; Raittz, Roberto T.; Cruz, Leonardo M.; Souza, Emanuel M.; Steffens, Maria B. R.; Pedrosa, Fabio O.

2016-10-01

Despite the development in DNA sequencing technology, improving the number and the length of reads, the process of reconstruction of complete genome sequences, the so called genome assembly, is still complex. Only 13% of the prokaryotic genome sequencing projects have been completed. Draft genome sequences deposited in public databases are fragmented in contigs and may lack the full gene complement. The aim of the present work is to identify assembly errors and improve the assembly process of bacterial genomes. The biological patterns observed in genomic sequences and the application of a priori information can allow the identification of misassembled regions, and the reorganization and improvement of the overall de novo genome assembly. GFinisher starts generating a Fuzzy GC skew graphs for each contig in an assembly and follows breaking down the contigs in critical points in order to reassemble and close them using jFGap. This has been successfully applied to dataset from 96 genome assemblies, decreasing the number of contigs by up to 86%. GFinisher can easily optimize assemblies of prokaryotic draft genomes and can be used to improve the assembly programs based on nucleotide sequence patterns in the genome. The software and source code are available at http://gfinisher.sourceforge.net/.

GFinisher: a new strategy to refine and finish bacterial genome assemblies.

PubMed

Guizelini, Dieval; Raittz, Roberto T; Cruz, Leonardo M; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O

2016-10-10

Despite the development in DNA sequencing technology, improving the number and the length of reads, the process of reconstruction of complete genome sequences, the so called genome assembly, is still complex. Only 13% of the prokaryotic genome sequencing projects have been completed. Draft genome sequences deposited in public databases are fragmented in contigs and may lack the full gene complement. The aim of the present work is to identify assembly errors and improve the assembly process of bacterial genomes. The biological patterns observed in genomic sequences and the application of a priori information can allow the identification of misassembled regions, and the reorganization and improvement of the overall de novo genome assembly. GFinisher starts generating a Fuzzy GC skew graphs for each contig in an assembly and follows breaking down the contigs in critical points in order to reassemble and close them using jFGap. This has been successfully applied to dataset from 96 genome assemblies, decreasing the number of contigs by up to 86%. GFinisher can easily optimize assemblies of prokaryotic draft genomes and can be used to improve the assembly programs based on nucleotide sequence patterns in the genome. The software and source code are available at http://gfinisher.sourceforge.net/.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

PubMed Central

Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

2016-01-01

Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

PubMed

Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

2017-09-01

Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

Information Entropy of Influenza A Segment 7

NASA Astrophysics Data System (ADS)

Thompson, William A.; Fan, Shaohua; Weltman, Joel K.

2008-12-01

Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.

DRUMS: Disk Repository with Update Management and Select option for high throughput sequencing data.

PubMed

Nettling, Martin; Thieme, Nils; Both, Andreas; Grosse, Ivo

2014-02-04

New technologies for analyzing biological samples, like next generation sequencing, are producing a growing amount of data together with quality scores. Moreover, software tools (e.g., for mapping sequence reads), calculating transcription factor binding probabilities, estimating epigenetic modification enriched regions or determining single nucleotide polymorphism increase this amount of position-specific DNA-related data even further. Hence, requesting data becomes challenging and expensive and is often implemented using specialised hardware. In addition, picking specific data as fast as possible becomes increasingly important in many fields of science. The general problem of handling big data sets was addressed by developing specialized databases like HBase, HyperTable or Cassandra. However, these database solutions require also specialized or distributed hardware leading to expensive investments. To the best of our knowledge, there is no database capable of (i) storing billions of position-specific DNA-related records, (ii) performing fast and resource saving requests, and (iii) running on a single standard computer hardware. Here, we present DRUMS (Disk Repository with Update Management and Select option), satisfying demands (i)-(iii). It tackles the weaknesses of traditional databases while handling position-specific DNA-related data in an efficient manner. DRUMS is capable of storing up to billions of records. Moreover, it focuses on optimizing relating single lookups as range request, which are needed permanently for computations in bioinformatics. To validate the power of DRUMS, we compare it to the widely used MySQL database. The test setting considers two biological data sets. We use standard desktop hardware as test environment. DRUMS outperforms MySQL in writing and reading records by a factor of two up to a factor of 10000. Furthermore, it can work with significantly larger data sets. Our work focuses on mid-sized data sets up to several billion records without requiring cluster technology. Storing position-specific data is a general problem and the concept we present here is a generalized approach. Hence, it can be easily applied to other fields of bioinformatics.

In silico prediction of splice-altering single nucleotide variants in the human genome.

PubMed

Jian, Xueqiu; Boerwinkle, Eric; Liu, Xiaoming

2014-12-16

In silico tools have been developed to predict variants that may have an impact on pre-mRNA splicing. The major limitation of the application of these tools to basic research and clinical practice is the difficulty in interpreting the output. Most tools only predict potential splice sites given a DNA sequence without measuring splicing signal changes caused by a variant. Another limitation is the lack of large-scale evaluation studies of these tools. We compared eight in silico tools on 2959 single nucleotide variants within splicing consensus regions (scSNVs) using receiver operating characteristic analysis. The Position Weight Matrix model and MaxEntScan outperformed other methods. Two ensemble learning methods, adaptive boosting and random forests, were used to construct models that take advantage of individual methods. Both models further improved prediction, with outputs of directly interpretable prediction scores. We applied our ensemble scores to scSNVs from the Catalogue of Somatic Mutations in Cancer database. Analysis showed that predicted splice-altering scSNVs are enriched in recurrent scSNVs and known cancer genes. We pre-computed our ensemble scores for all potential scSNVs across the human genome, providing a whole genome level resource for identifying splice-altering scSNVs discovered from large-scale sequencing studies.

The Apis mellifera Filamentous Virus Genome

PubMed Central

Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D.; de Miranda, Joachim R.; Neumann, Peter

2015-01-01

A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family. PMID:26184284

The Apis mellifera Filamentous Virus Genome.

PubMed

Gauthier, Laurent; Cornman, Scott; Hartmann, Ulrike; Cousserans, François; Evans, Jay D; de Miranda, Joachim R; Neumann, Peter

2015-07-09

A complete reference genome of the Apis mellifera Filamentous virus (AmFV) was determined using Illumina Hiseq sequencing. The AmFV genome is a double stranded DNA molecule of approximately 498,500 nucleotides with a GC content of 50.8%. It encompasses 247 non-overlapping open reading frames (ORFs), equally distributed on both strands, which cover 65% of the genome. While most of the ORFs lacked threshold sequence alignments to reference protein databases, twenty-eight were found to display significant homologies with proteins present in other large double stranded DNA viruses. Remarkably, 13 ORFs had strong similarity with typical baculovirus domains such as PIFs (per os infectivity factor genes: pif-1, pif-2, pif-3 and p74) and BRO (Baculovirus Repeated Open Reading Frame). The putative AmFV DNA polymerase is of type B, but is only distantly related to those of the baculoviruses. The ORFs encoding proteins involved in nucleotide metabolism had the highest percent identity to viral proteins in GenBank. Other notable features include the presence of several collagen-like, chitin-binding, kinesin and pacifastin domains. Due to the large size of the AmFV genome and the inconsistent affiliation with other large double stranded DNA virus families infecting invertebrates, AmFV may belong to a new virus family.

GBshape: a genome browser database for DNA shape annotations.

PubMed

Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J; Parker, Stephen C J; Nuzhdin, Sergey V; Tullius, Thomas D; Rohs, Remo

2015-01-01

Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.